1
1
Attenuation of Ca2+ homeostasis, oxidative stress, and mitochondrial dysfunctions in diabetic rat heart: insulin therapy or aerobic 2
exercise? 3
4
Márcia F. da Silvaa, Antônio J. Natalib*; Edson da Silvaac, Gilton J. Gomesb, Bruno G. Teodorod, Daise N.Q. Cunhab, Lucas R. Drummondb, 5
Filipe R. Drummondb, Anselmo G. Mourab, Felipe G. Belfortb, Alessandro de Oliveirab, Izabel R. S. C. Maldonadoa*, Luciane C. Albericid*# 6
7
*The authors share senior authorship. 8 9 aDepartamento de Biologia Geral, Universidade Federal de Viçosa, Viçosa, MG, Brasil. 10 bDepartamento de Educação Física, Universidade Federal de Viçosa, Viçosa, MG, Brasil. 11 cDepartamento de Ciências Básicas, Universidade Federal do Vale do Jequitinhonha e Mucuri, Diamantina, MG, Brasil. 12 dDepartamento de Física e Química, Universidade de São Paulo, Ribeirão Preto, SP, Brasil. 13 14 #Corresponding author: Luciane Carla Alberici 15
Address: Universidade de São Paulo, Faculdade de Ciências Farmacêuticas de Ribeirão Preto 16
Av. Do Café s/n, Ribeirão Preto, São Paulo, Brazil. 17
Post code: 14040-903 18
Phone: +55 (16) 36024435 Fax: +55 (16) 36024880 19
e-mail: [email protected] 20
21
Articles in
PresS
. J Ap
pl P
hysio
l (May 21, 2015). d
oi:10.1152/jap
plp
hysio
l.00915.2014
C
op
yrigh
t © 2015 b
y the A
merican
Ph
ysiolo
gical S
ociety.
2
Abbreviations: 22
ATP - Adenosine triphosphate 23
BG - Blood glucose 24
Ca2+ - Calcium 25
CaMKII - Ca2+/calmodulin-dependent protein kinase 26
CE - Control exercised 27
CS - Control sedentary 28
DE - Diabetic exercised 29
DEI - Diabetic trained treated plus insulin 30
DS - Diabetic sedentary 31
DSI - Diabetic sedentary 32
EF - Ejection fraction 33
EGTA - Ethylene glycol tetra-acetate 34
FS - Fractional shortening 35
GSH - Reduced glutathione 36
GSSH - Oxidized glutathione 37
IRS - insulin receptor substrate 38
LV- Left ventricle 39
LVM- Left ventricular myocytes 40
MPTP - Mitochondrial permeability transition pore 41
NADPH - Nicotinamide adenine dinucleotide phosphate 42
NCX - Sodium-calcium exchanger 43
NHE - Sodium-hydrogen exchanger 44
3
Nox-4 - NADPH oxidase 4 45
RaM - Rapid uptake mode 46
RHR - Resting heart rate 47
ROS - Reactive oxygen species 48
RyR - Ryanodine receptor 49
SERCA - Sarcoplasmc reticulum calcium ATPase 50
SOD - Superoxide dismutase 51
STZ - Streptozootocin 52
UCP - Uncoupling protein 53
54
4
Abstract 55
We tested the effects of swimming training and insulin therapy, either alone or in combination, on the intracellular calcium ([Ca2+]i) homeostasis, 56
oxidative stress and mitochondrial functions in diabetic rat hearts. Male Wistar rats were separated into control, diabetic or diabetic plus insulin 57
groups. Type 1 diabetes mellitus was induced by streptozotocin (STZ). Insulin treated groups received 1 to 4 UI of insulin daily for eight weeks. 58
Each group was divided into sedentary or exercised rats. Trained groups were submitted to a swimming (90 min/day, 5 days/week, 8 weeks). 59
[Ca2+]i transient in left ventricular myocytes (LVM), oxidative stress in left ventricular (LV) tissue and mitochondrial functions in the heart were 60
assessed. Diabetes reduced the amplitude and prolonged the times to peak and to half decay of the [Ca2+]i transient in LVM, increased NADPH 61
oxidase-4 (Nox-4) expression, decreased superoxide dismutase (SOD) and increased carbonyl protein contents in LV tissue. In isolated 62
mitochondria, diabetes increased Ca2+ uptake, susceptibility to permeability transition pore (MPTP) opening, UCP-2 expression and oxygen 63
consumption, but reduced H2O2 release. Swimming training corrected the time course of the [Ca2+]i transient, UCP-2 expression and 64
mitochondrial Ca2+ uptake. Insulin replacement further normalized [Ca2+]i transient amplitude, Nox-4 expression and carbonyl content. 65
Alongside these benefits, the combination of both therapies restored the LV tissue SOD and mitochondrial O2 consumption, H2O2 release and 66
MPTP opening. In conclusion, the combination of swimming training with insulin replacement was more effective in attenuating intracellular 67
Ca2+ disruptions, oxidative stress and mitochondrial dysfunctions in STZ-induced diabetic rat hearts. 68
69
Keywords: Physical activity; Diabetes mellitus; Mitochondria; Nox-4 70
71
72
73
74
5
1. Introduction 75
Diabetic cardiomyopathy leads initially to diastolic dysfunction which frequently progress to heart failure and sudden death (12). Cardiac 76
systolic and diastolic dysfunctions are associated with impaired intracellular calcium (Ca2+) homeostasis (16, 23, 43, 48) due to decreased 77
expression and/or activity of Ca2+ regulatory proteins (48, 23, 43, 16, 10, 47). 78
Heart failure induced by diabetes is also associated with increased reactive oxygen species (ROS) (19) as well as with nicotinamide 79
adenine dinucleotide phosphate (NADPH) oxidase activation by glycated proteins, and mitochondrial dysfunction (47). Mitochondrial 80
dysfunctions in diabetic hearts are related with increased expression of mitochondrial uncoupling protein-3 (UCP-3) (8, 19, 44) impaired 81
respiratory capacity, altered expression of respiratory chain complexes (8) and Ca2+ uptake, higher susceptibility to mitochondrial permeability 82
transition pore (MPTP) opening and elevated apoptotic signaling molecules (8, 26). Recently, it has been demonstrated that in diabetic hearts the 83
expression of phosphorylated Ca2+/calmodulin-dependent protein kinase II (CaMKII) and NADPH oxidase were augmented and its activation by 84
impaired Ca2+ metabolism would increase ROS production (32). 85
Aerobic exercise and insulin replacement are strategies to management of diabetes (41, 46). Endurance exercise training was shown to 86
improve cardiomyocyte Ca2+ cycling and restore its intracellular calcium ([Ca2+]i) transient and hence contractile function in diabetic rats (41). 87
Endurance exercise is also known to protect the rat myocardium against oxidative stress (22). The stimulation of Ca2+ uptake by insulin 88
replacement is involved in the regulation of heart metabolism and transporter activities (34). However, the effects of combined endurance 89
exercise training and insulin treatment on cardiac oxidative stress and heart mitochondrial function of diabetic rats are poorly understood. Then, 90
this study sought to examine the effects of swimming training combined with insulin treatment on cardiac oxidative stress and mitochondrial 91
dysfunctions in streptozotocin (STZ)-induced diabetic rats. 92
93
6
2. Materials and methods 94
95
2.1. Experimental animals 96
Male Wistar rats (30 days; 80.2 ± 1.8g) had free access to chow and water and were housed at 22 ± 2 °C on a 12h light-dark cycle, and 97
were separated in control sedentary (CS), control exercised (CE), diabetic sedentary (DS), diabetic exercised (DE), diabetic sedentary insulin 98
(DSI) and diabetic exercised insulin (DEI). Experiments were approved by the Ethics Committee of the Federal University of Viçosa (Protocol 99
number 51/2011). 100
101
2.2. Induction of diabetes and insulin treatment 102
Diabetic groups received an intraperitoneal injection [60 mg/kg of body weight (BW)] of STZ (Sigma, St. Louis, USA) diluted in sodium 103
citrate buffer (0.1 M, pH 4.5), and control groups received the buffer. Seven days after, animals with fasting blood glucose (BG) above 300 104
mg/dL were considered diabetic. Animals from DEI and DSI received a daily dose of human insulin (1-4 U/day). 105
106
2.3. Exercise training protocol 107
Animals from CE, DE and DEI groups were subjected to a swimming training program (five days/week/eight weeks) (Adapted from 108
[13]). On the first week the animals exercised with no load for 10-50 min/day and exercise duration was increased by 10 min/day. In the second 109
week, the animals exercised with a load corresponding to 1% of BW and the exercise duration was increased by 10 min/day up to a total of 90 110
min of continuous swimming in one session. From the third week on, the load was increased weekly (1% of BW/wk) up to a load of 5% of BW 111
on the eighth week. 112
113
2.4. Resting heart rate assessment 114
7
Resting heart rate (RHR) was obtained from electrocardiogram. Animals were placed inside a chamber for anesthesia (isoflurane 2% and 115
oxygen 100%) at a constant flow of 1L/minute. The electrocardiogram (DII) was acquired using the data acquisition system PowerLab ® (AD 116
Instr., SP, Brazil) and data analyzed using the program Lab Chart Pro ® (AD Instr. Lab Chart 7, SP, Brazil). Heart rate was obtained by average 117
of five consecutive cardiac cycles. 118
119
2.4. Echocardiographic examinations 120
Animals were anesthetized with isoflurane via mask (isoflurane 3% and oxygen 100% constant flow (1 L/min). Cardiac contraction and 121
relaxation were assessed noninvasively by transthoracic echocardiography using parasternal long- and short-axis images. Two-dimensional, M-122
mode echocardiographic images and color-guided pulsed-wave Doppler images were obtained by standard echocardiographic techniques (11) 123
(MyLabTM30, Esaote, Genova, Itália). The systolic function was assessed using the ejection fraction (EF) and fractional shortening (FS) while the 124
diastolic function was assessed using the mitral flow data [i.e. early filling wave (peak E); late filling wave (peak A) and E/A ratio)]. 125
126
2.5. Isolation of cardiomyocytes and mitochondria from left ventricle (LV) 127
Two days after the last exercise training session the rats were euthanized by cervical dislocation and their hearts were removed. LV 128
myocytes were enzymatically isolated [Adapted from (9)], using 1 mg/mL of collagenase type II (Worthington, USA) and 0.1 mg/mL of protease 129
(Sigma). LV mitochondria were isolated by standard differential centrifugation (40). 130
131
132
2.6. Intracellular Ca2+ measurements 133
Intracellular calcium ([Ca2+] i) transients in cardiomyocytes were evaluated as described (35) using 5 μM fluo-4 AM (Molecular Probes, 134
Eugene, OR, USA). A Meta LSM 510 scanning system (Carl Zeiss GmbH, Germany) with an x63 oil immersion objective was used for confocal 135
8
fluorescence imaging (488/510 nm ex/em). Digital image processing was performed using routines custom-written in the Matlab® platform. The 136
amplitude of the [Ca2+]i transient, measured as fluorescence ratio (F/F0), with fluorescence intensity (F) normalized to the minimal intensity 137
measured between 1-Hz contractions at diastolic phase (F0), the time to peak and the time from the peak to half resting level of the [Ca2+]i 138
transient were determined. 139
140
2.7. Heart Redox State 141
Reduced (GSH) and oxidized (GSSG) glutathione and protein carbonyl levels were assessed in LV tissue (50 mg/mL in cold 0.1 M Tris-142
HCl buffer, pH 7.4) by the fluorimetric ortho-phthalaldehyde method (20). Protein carbonyl were detected spectrophotometrically by 143
derivatisation of the carbonyl group with 2,4-dinitrophenylhydrazine (39, 40). Superoxide dismutase (SOD) content in LV tissue was determined 144
spectrophotometrically by the tetrazolium salt formation using a Superoxide Dismutase Assay Kit (Cayman®). 145
146
2.8. Mitochondrial standard incubation procedure and assays 147
Mitochondria were energized with 5 mM glutamate and malate in an incubation medium containing of 125 mM sucrose, 65 mM KCl, 2 148
mM K2HPO4, 10 mM HEPES-KOH pH 7.4, at 30 °C. Mitochondrial respiration was monitored using a temperature-controlled computer-149
interfaced Clark-type oxygen electrode (Oxytherm, Hansatech Inst, UK). Hydrogen peroxide production was monitored spectrofluorimetrically 150
using 1 µM Amplex red (Molecular Probes, OR, USA) and 1 UI/mL horseradish peroxidase (49); these assays were performed in the presence of 151
0.1 mM ethylene glycol tetra-acetate (EGTA). Ca2+ influx and efflux were monitored spectrofluorimetrically using 150 nM Calcium Green 5N 152
(Molecular Probes, OR, USA) (36). Ca2+ flux and H2O2 production were monitored in a Model F-4500 Hitachi fluorescence spectrophotometer 153
at the 506/531 and 563/587 (ex/em) wavelength pair, respectively. 154
155
2.9. Analysis of mRNA expression 156
9
RNA was isolated using the TRIzol reagent (Invitrogen®). For real-time PCR analysis, RNA was reverse transcribed using the Reverse 157
Transcriptase IMPROM II (PROMEGA®) and used in quantitative PCR reactions containing EVA-green fluorescent dye (BioRad®). Relative 158
expression of mRNAs was determined after normalization by β-actin using the ΔΔCt method (4). Quantitative PCR was performed using 159
Eppendorf Realplex4 Mastercycler Instrument (Eppendorf®). Primers for NOX4, β-actin and uncoupling protein-2 (UCP-2) were designed as 160
described in Table 1. 161
162
2.10. Statistical analysis 163
Normal distribution of the data was determined by the Shapiro–Wilk test. Non-normally distributed variables were log-transformed 164
before statistical analyses. Comparisons between groups were performed by using the factorial analysis 2 (sedentary x exercised) by 3 (control x 165
diabetes x insulin), followed by the Tukey post hoc test (Statistical Analysis System software - SAS version 9.3). Statistical significance was 166
defined at P ≤ 0.05. Results are presented as means ± SEM. 167
168
3. Results 169
170
3.1. General characteristics of rats 171
The initial BG levels were no different among the groups (Table 2). Streptozotocin augmented the final BG levels to approximately 500 172
mg/dL during the experimental period (factor effect: p<0.05). Insulin treatment reduced the final PG (factor effect: p<0.05) in diabetic rats by 173
approximately 35% (control: 88.70 ± 24.35; diabetes: 510.70 ± 24.3; insulin: 327.51± 24.34 – in mg/dL). However, neither exercise training 174
effect nor interaction between factors were observed (p>0.05). 175
The initial BW was not different among groups, however STZ-injected animals gained less BW (factor effect: p<0.05) than controls until 176
the end of the experimental period (control: 318.90 ± 12.39 g; diabetes: 194.80 ± 12.38; insulin: 216.71± 12.37 – in grams). Neither insulin 177
10
treatment nor exercise training alone altered significantly the BW gain in diabetic rats (factor effect: p<0.05). Interaction between factors was 178
observed (factor effect: p<0.05). For example, animals from DEI group exhibited higher BW as compared to those of both DS and DE groups. 179
Diabetes reduced the heart weight (HW) (factor effect: p<0.05), while insulin treatment attenuated such reduction (factor effect: p<0.05) 180
in diabetic rats (control: 1.92 ± 0.08; diabetes: 1.01 ± 0.08; insulin: 1.53 ± 0.08 – in grams). However, neither exercise training effect nor 181
interaction between factors were observed (p>0.05). The HW/BW was reduced in diabetic rats (factor effect: p<0.05) when compared to insulin-182
treated animals (control: 6.26 ± 0.48; diabetes: 5.28 ± 0.48; insulin: 7.25 ± 0.48 – in mg/g). Nevertheless, neither exercise training effect nor 183
interaction between factors were observed (p>0.05). 184
Resting heart rate was reduced by diabetes (factor effect: p<0.05), whereas insulin treatment corrected such effect (control: 341.60 ± 8.99; 185
diabetes: 272.10 ± 8.99; insulin: 346.70 ± 9.52 – in bpm). However, neither exercise training effect nor interaction between factors were 186
observed (p>0.05). 187
Diabetic animals exhibited reduced ejection fraction (control: 81.00 ± 1.16%; diabetes: 62.25 ± 3.21%; insulin: 67.46 ± 1.84%) and 188
fractional shortening (control: 45.57 ± 1.53%; diabetes: 30.05 ± 1.39%; insulin: 33.04 ± 1.32%) by the end of the experiment (factor effect: 189
p<0.05) which indicates systolic dysfunction (Table 3). Ejection fraction was not affected by either exercise training or insulin treatment (factor 190
effect: p>0.05), although interaction between factors was found (p<0.05). Animals from DE group showed higher EF than those from DS and 191
DEI groups, and animals from DEI group higher than those from DE and DSI groups. Exercise training increased the FS (sedentary: 34.18 ± 192
1.78%; exercised: 39.20 ± 2.12%), whereas no effect of insulin treatment was observed. However, interaction between factors was observed 193
(p<0.05). Rats from DEI group exhibited higher FS as compared to those from DSI and DE groups. Diabetic rats also showed higher E/A ratio 194
(factor effect: p<0.05) than controls (control: 1.72 ± 0.07; diabetes: 2.81 ± 0.21; insulin: 2.99 ± 0.11) which characterizes diastolic dysfunction. 195
Nevertheless, exercise training and insulin treatment, either isolated or in combination, did not reverse the diastolic dysfunction induced by 196
diabetes. 197
198
11
3.2. Intracellular global calcium transients 199
STZ-induced diabetes reduced (factor effect: p<0.05) the amplitude of the [Ca2+]i transient, whereas insulin treatment restored it to the 200
levels of controls (control: 2.27 ± 0.02 F/F0; diabetes: 2.12 ± 0.02 F/F0; insulin: 2.25 ± 0.02 - in F/F0). However, no effect of exercise was 201
observed (factor effect: p>0.05). There was interaction (p<0.05) between factors. Figure 1A shows that the [Ca2+]i transient amplitude in diabetic 202
myocytes (DS and DE) was significantly lower than that in controls (CS). In contrast, DSI group showed higher amplitude as compared to that 203
of DE group. The combination of exercise training with insulin treatment significantly increased the [Ca2+]i transient amplitude in DEI group as 204
compared to those of DS and DE groups. 205
The time to peak of the [Ca2+] i transient (Fig. 1B) was not affected by either diabetes or insulin treatment (factor effect: p>0.05). 206
Nevertheless, exercise training reduced (factor effect: p<0.05) the time to peak of the [Ca2+]i transient (sedentary: 77.00 ± 1.00; exercised: 71.00 207
± 1.00 – in ms). Such exercise effect was observed in CE, DE and DEI groups. No interaction between factors was found (p>0.05). 208
Diabetes prolonged the time to half decay of the [Ca2+] i transient (factor effect: p<0.05), while insulin treatment shortened it towards the 209
control levels (control: 221.00 ± 2.00; diabetes: 251.00 ± 2.00; insulin: 233.00 ± 2.00 in ms). In addition, exercise training reduced (factor effect: 210
p<0.05) the time to half decay of the [Ca2+] i transient (sedentary: 238.00 ± 2.00; exercised: 233.00 ± 2.00 in ms). Interaction (p<0.05) between 211
factors was observed. Figure 1C shows that the time to half decay of the [Ca2+] i transient in diabetic myocytes was longer than that of controls. 212
In contrast, insulin treatment itself (DSI group) as well as exercise training (DE group) and its combination (DEI group) shortened the time to 213
half decay of the [Ca2+] i transient in diabetic animals, as compared to DS group. 214
215
3.3. Heart Redox State 216
217
We observed that hearts of diabetic sedentary rats exhibited an increased expression of NADPH oxidase-4 (Nox-4) (factor effect: p<0.05), 218
as compared to control rats, which was reduced by insulin treatment (control: 0.86 ± 0.09; diabetes: 1.56 ± 0.19; insulin: 0.74 ± 0.12 – in RNA 219
12
relative expression). Exercise training had no isolated effect, however interaction between factors was observed (p<0.05). Control levels of Nox-220
4 expression in hearts of diabetic rats were reached when exercise training and insulin treatment were combined (Fig. 2A). 221
In normal conditions, the excess of O2•- is inactivated and converted to H2O2 by superoxide dismutase (SOD). However, along with the 222
increased Nox-4 expression hearts of our diabetic rats displayed a diminished SOD content (Fig. 2B; factor effect: p<0.05), which was not 223
reversed by insulin treatment (control: 43.82 ± 3.86; diabetes: 28.86 ± 1.43; insulin: 32.83 ± 2.43 – in U.mg-1). Exercise training showed no 224
independent effect (factor effect: p>0.05), however interaction between factors was found (p<0.05). Hearts from DEI group showed increased 225
SOD content as compared to those from DS, DSI and DE. 226
An additional indicative of low SOD content in hearts of our diabetic sedentary rats was verified by the reduced/oxidized glutathione 227
(GSH/GSSG), since GSH is consumed by glutathione peroxidase to degrade H2O2 generating GSSG and H2O. We found a slight increase (factor 228
effect: p<0.05; control: 1.77 ± 0.07; diabetes: 2.30 ± 0.11; insulin: 1.89 ± 0.16) in GSH/GSSG in diabetic hearts (Fig. 2C), indicating low 229
productions of H2O2, despite the apparent increase of O2•- production by elevated Nox-4 expression. Neither exercise training nor insulin 230
treatment had independent effect on GSH/GSSG (factor effect: p>0.05), nevertheless there was interaction between factors (p<0.05). Hearts from 231
DEI group showed lower GSH/GSSG than those from DE and DS groups. 232
The oxidative damage, as a consequence of an unbalanced production/inactivation of O2•-, was verified by the content of carbonyl 233
proteins (Fig. 2D). Proteins of diabetic rat hearts were more oxidized, an effect that was reversed by insulin treatment (factor effect: p<0.05; 234
control: 0.40 ± 0.07; diabetes: 0.84 ± 0.10; insulin: 0.37 ± 0.07 – in nmol.mg-1). Exercise training had no independent effect (factor effect: 235
p>0.05), however interaction between factors was observed (p<0.05). Hearts from DEI group showed lower carbonyl content than those from DS 236
and DE groups. Furthermore, the modulation of carbonyl contents promoted by diabetes and treatments (insulin or exercise) follow the profile 237
found for Nox-4 expression, suggesting linked effects. 238
239
3.4. Mitochondrial function 240
13
241
Diabetes did not affect (factor effect: p>0.05) the respiration rates (Table 4) in the phosphorylating state (State III) but increased the rates 242
in the resting state (State IV). Diabetes decreased (factor effect: p<0.05) the respiratory control ratios (RCR; control: 10.05 ± 0.58; diabetes: 7.39 243
± 0.60; insulin: 7.94 ± 0.36), indicating a weakness of the coupling between respiration and phosphorylation. Neither swimming training nor 244
insulin treatment of diabetic rats restored these respiratory parameters (factor effect: p>0.05) and no interaction between factors was observed for 245
such parameters (p>0.05). However, mitocondria from DEI group exhibited lower O2 consumption in State IV than those from DS, DSI and DE 246
groups. 247
In addition, LV of diabetic rats also presented an augment (factor effect: p<0.05) in the expression of UCP-2 (control: 0.77 ± 0.09; 248
diabetes: 1.83 ± 0.22; insulin: 1.13 ± 0.19 - in UCP/β-actin) (Fig. 3). These proteins located at the inner membrane that can dissipate the proton 249
gradient built by respiratory chain, promoting a mild uncoupling of the oxidative phosphorylation. UCP-2 mRNA was partially restored by 250
insulin treatment as an independent factor. Likewise, exercise training reduced (factor effect: p<0.05) the expression of UCP-2 (sedentary: 1.60 ± 251
0.21; exercised: 0.94 ± 0.11 - in UCP/β-actin), as an independent factor, as well as in diabetic rats when combined with insulin treatment 252
(interaction: p<0.05). For example, LV from DEI group exhibited lower UCP-2 mRNA expression than those from DS, DSI and DE groups. 253
The release of H2O2 in isolated heart mitochondria was monitored (Fig. 4). The representative experiment (Fig. 4A) and average data 254
(Fig. 4B) show that heart mitochondria from sedentary diabetic rats release lower amounts (factor effect: p<0.05) of H2O2 as compared to those 255
from controls (control: 0.67 ± 0.02; diabetes: 0.41± 0.01; insulin: 0.52 ± 0.04 – in nmol.mg-1.min-1). Neither exercise training nor insulin 256
treatment alone affected the reduced mitochondrial H2O2 release (factor effect: p>0.05). However, there was interaction between factors 257
(p<0.05). Swimming training associated with insulin reversed the reduced H2O2 release in heart mitochondria from diabetic rats, since heart 258
mitochondria from DEI group presented higher H2O2 values as compared to those of DS, DSI and DE groups. 259
Diabetes slightly increased the capacity of Ca2+ uptake (Fig. 5A) in isolated heart mitochondria (control: 180.00 ± 12.00; diabetes: 260
209.33 ± 20.27; insulin: 147.27 ± 15.55 – in nmol.mg-1), which was reduced below control levels by insulin treatment (factor effect: p<0.05). 261
14
Exercise training had no independent effect (factor effect: p<0.05), nevertheless interaction between factors was observed (p<0.05). Heart 262
mitochondria from DS group showed higher capacity of Ca2+ uptake than those from DE and DSI and mitochondria from DEI group exhibited 263
higher capacity of Ca2+ uptake when compared to those from DSI group. It indicates that exercise training either alone or in combination with 264
insulin restored the Ca2+ uptake to control levels in diabetic animals. 265
The Ca2+ retention capacity was monitored to check the susceptibility to MPTP opening in isolated heart mitochondria (Fig. 5B). Traces 266
of the external Ca2+ concentration dynamics in response to sequential additions of Ca2+ show that heart mitochondria isolated from DS rats did 267
not sustain the preloaded Ca2+ (after 6 additions of 20 nmol Ca2+), in contrast to those isolated from CS rats, indicating an increased susceptibility 268
to Ca2+-induced inner membrane permeabilization (Fig. 5B). This condition was only reversed by exercise training combined with insulin 269
treatment (DEI group). Surprisingly, both swimming training and insulin treatment separately further reduced the capacity of Ca2+ retention in 270
heart mitochondria of diabetic rats. Cyclosporin A (CSA), a classical inhibitor of MPTP opening, totally prevented the release of accumulated 271
Ca2+ in heart mitochondria of DS, DE or DEI groups, and partially prevented it in heart mitochondria of DSI (Fig. 5C). Together, these results 272
indicate that diabetes induces high Ca2+ uptake and thus increases the susceptibility to MPTP opening in heart mitochondria. Higher Ca2+ uptake 273
and the susceptibility to MPTP opening, as well as the respiratory, UCP-2 expression and H2O2 release patterns were reversed by insulin 274
treatment combined with exercise training. 275
276
4. Discussion 277
278
We examined the effects of swimming training and insulin therapy, either alone or in combination, on the intracellular Ca2+ homeostasis, 279
oxidative stress and mitochondrial functions in diabetic rat hearts. Our data showed that endurance training associated with insulin treatment was 280
more effective in attenuating intracellular Ca2+ homeostasis disruptions, cardiac oxidative stress and mitochondrial dysfunctions caused by STZ-281
induced diabetes in rat hearts. 282
15
Here, diabetes impaired the in vivo cardiac systolic and diastolic functions as it reduced the ejection fraction and fractional shortening as 283
well as it increased peak E/peak A ratio in rats. These dysfunctions were also evident at the cellular level inasmuch as diabetes reduced the 284
amplitude and prolonged the time to half decay of the [Ca2+]i transient in left ventricular myocytes. These disruptions in experimental diabetes 285
have been shown previously and are related to dysfunctions in the cellular Ca2+ regulatory proteins (23). Regarding the systolic dysfunction, the 286
Ca2+ release from the SR is not uniform in cardiomyocytes of diabetic rodents which is due to reductions in the number of functional ryanodine 287
receptor 2 (RyR2) (6), reduced Ca2+ channel activities (23) and depressed sarco(endo)plasmic reticulum Ca2+-ATPase (SERCA2) expression or 288
activity and hence intra-SR Ca2+ stores (23). This would help to explain the observed reduced [Ca2+]i transient amplitude. As for the diastolic 289
dysfunction, the prolonged Ca2+ transient decay observed here is consistent with a prolonged cytosolic Ca2+ removal via decreased SERCA2 290
expression or activity in diabetic hearts (23). It is noteworthy that an increased activity of sodium-calcium exchanger (NCX) may contribute to 291
reduced SR Ca2+ load in diabetic myocytes, although the relative contribution of NCX to cytosolic Ca2+ removal in rats is small (~ 7%) and in 292
diabetic hearts increased or unchanged NCX activity or decreased NCX expression were reported (10). Nevertheless, as we did not measure 293
either the expression or the activity of these proteins, their role in these results found in this study should be taken with caution. 294
Despite the fact that cytosolic removal of Ca2+ into mitochondria in rats is small (~ 1%) and seems not to impact on the [Ca2+]i transient 295
(5), we observed an increased capacity of mitochondrial Ca2+ uptake in mitochondria isolated from diabetic hearts. Mitochondria are sensitive to 296
Ca2+ concentration, which is important for the modulation of mitochondrial metabolism. These organelles may act as a Ca2+ buffering system 297
removing and modulating the local Ca2+ concentration. Calcium is transported through the inner membrane matrix by two mechanisms: a 298
uniporter (MCU) and a rapid uptake mode (RaM) that are dependent of the electrochemical gradient for Ca2+. Calcium flux rates through the 299
MCU are fast, equivalent to fast gated pores but slower than the most channels. Calcium uptake through the RaM occurs very rapidly, faster than 300
MCU and at the beginning of Ca2+ pulse. The localization of mitochondria close to Ca2+ release sites of the endoplasmic or sarcoplasmic 301
reticulum or even near plasma membrane Ca2+ channels also facilitates mitochondrial Ca2+ handling [see (15) for review]. Furthermore, in 302
different cell types an increased peak of mitochondrial Ca2+ concentration in response to Ca2+ mobilizing stimuli has been described to be 303
16
increased by UCP-2 and UCP-3 overexpression (45). In fact, we found elevated UCP-2 expression and indications of increased UCP activity, 304
such as enhanced resting respiration rate and reduced mitochondrial H2O2 release in diabetic hearts. Although the role of UCPs in the heart be 305
controversial and incompletely understood, mild uncoupling promoted by UCP decreases ROS formation by accelerating electron transport rates 306
through respiratory chain, thus decreasing the lifetime of intermediates capable of donating electrons toward superoxide radical formation (42). 307
This process could represent a mechanism to protect the cell against oxidative damage. Anyway, our findings agree with previous works (18) 308
showing that mitochondria per se apart from the insulin-deficient diabetic profile remain free from ROS production, despite considerable 309
evidences suggesting that diabetes is associated with oxidative tissue damage in the heart of diabetic rodents (2). However, mitochondrial 310
uncoupling may augment oxygen consumption without proportionately increasing mitochondrial ATP production. The resulting energy deficit 311
may explain the lack of increase in cardiac systolic and diastolic functions, resulting in reduced cardiac efficiency, as found hearts of db/db mice 312
(7). 313
Our results showed that cardiac oxidative damage could be related to upregulation of Nox-4 expression, as showed previously by 314
Maalouf and coworkers (27) and also found in LV dysfunctions such as heart failure progression and aging (1). Nox-4 is localized in perinuclear 315
organelles, including mitochondria (1), and is supposed to be constitutively active, not requiring cytosolic factors for its activation. Therefore, its 316
expression levels determine the amount of O2•- production in the cells. Oxidative damage is also favored when O2
•- production is associated to an 317
impaired antioxidant system, as demonstrated here by diminished SOD in hearts of diabetic rats. Reductions in SOD content and/or activity have 318
been shown previously in STZ-induced diabetic cardiomyopathy (28). Thus, oxidative damage in LV of diabetic rats could be a consequence of 319
high production and low inactivation of O2•- promoted by high Nox-4 expression and low SOD content. We also suggest that increased Nox-4 320
activity could also sensitize MPTP opening in the heart mitochondria of STZ-induced diabetic rats, inasmuch as Nox-4 activity leads to cysteine 321
oxidation of mitochondrial proteins including components of the MPTP complex and mitochondrial damage as reported previously (1). This 322
sensibility associated to an excessive mitochondrial Ca2+ load could trigger MPTP opening, following dissipation of the inner mitochondrial 323
membrane potential and swelling. 324
17
It is possible that the impaired intracellular Ca2+ homeostasis in our diabetic rat heart have increased oxidative stress by activating 325
CaMKII. Nishio et al. (30) demonstrated an augmented [Ca2+]i in cardiomyocytes exposed to high glucose concentrations due to increased 326
sodium-hydrogen exchanger (NHE) expression and activity which activated NCX in reverse mode. High glucose also up-regulated the 327
phosphorylated CaMKII expression that was suppressed by inhibiting NCX in reverse mode. In addition, a CaMKII inhibitor attenuated the ROS 328
level in these myocytes. In STZ-induced diabetic rat hearts they observed up-regulation of ROS level and components of NADPH oxidase, 329
p47phox and p67phox, which were attenuated by a CaMKII inhibitor. In fact, our diabetic rat hearts exhibited augmented expression Nox-4, the 330
major catalytic component of NADPH oxidase. 331
More important, our results showed that eight weeks of combined swimming training and insulin therapy is more effective in restoring 332
intracellular Ca2+ homeostasis as well as cardiac oxidative stress and mitochondrial dysfunctions. Regarding the Ca2+ homeostasis, both exercise 333
training and insulin treatment either alone or in combination restored the time course as well as the amplitude of the [Ca2+]i transient in left 334
ventricular myocytes of diabetic rats. Although we did not measure Ca2+ handling proteins, exercise training has been shown to improve SR Ca2+ 335
resequestration via increases in SERCA2a and phospholamban expression and/or activity along with augments of Ca2+ efflux via NCX in 336
diabetic rat hearts (24, 31). It is noteworthy that SR Ca2+-induced Ca2+ release is insulin-dependent as insulin regulates the cardiac function by 337
stimulating ICaL. Insulin also interacts with SERCA2 via IRS indicating that IRS proteins bind to the SERCA2 in an insulin-regulated fashion (3). 338
Our echocardiographic data show that diabetic rats exercised and treated with insulin had their systolic function partially restored, despite no 339
recovery of diastolic function. 340
On the subject of cardiac oxidative stress, the combined treatments normalized Nox-4 expression and reduced the content of carbonyl 341
proteins. Among the factors known for NADPH oxidase modulation in diabetic heart [see (44) for review], exogenous insulin replacement can 342
act controlling blood glucose levels (27) and thereby the intracellular Ca2+ homeostasis (32) as described above, drastically down regulating Nox-343
4 expression; exercise training can act increasing the levels of protein kinase C (17), reestablishing Nox-4 expression to the control levels. 344
18
As for the mitochondrial STZ-induced dysfunctions, the combination of insulin with exercise training was able to reduce UCP-2 345
expression, Ca2+ uptake, O2 consumption and MPTP opening susceptibility and increased H2O2 release. Insulin itself is known to improve the 346
activities of complexes I, II and/or IV after four weeks, as shown by others (38). It is probably related to the levels of mRNA for the peroxisome 347
proliferator-activated receptor γ co-activator 1α that up-regulate nuclear genes required for mitochondrial biogenesis (31). Long-term treadmill 348
running (14 weeks) prevented the elevation of proteins involved in MPTP pore formation and apoptotic signaling in hearts of diabetic rats (26). 349
Nevertheless, in our eight-week treatment, endurance exercise training or insulin alone restored the mitochondrial Ca2+ uptake only. 350
Finally, we observed that diabetes reduced the RHR in rats, as shown elsewhere (21). This can be explained in part by the reduction in the 351
expression of beta adrenergic receptors (β1 e β2) in diabetic rats (29). As expected, bradycardia was normalized in sedentary and exercised 352
animals by insulin, as demonstrated previously (37). Insulin exerts positive inotropic and chronotropic effects on the myocardium (25). Along 353
with the impaired growth of the animals induced by STZ, by the end of the experiment diabetic rats exhibit lower HW. In rats with diabetes, in 354
addition to insulin, the secretion of hormones such as the growth hormone, glucagon, pancreatic polypeptide and, consequently, growth factor 355
similar to that of insulin, are altered and affect their growth (14, 30). We observed that insulin therapy increased the HW gain and the HW to BW 356
ratio in both sedentary and exercised diabetic animals. The increased HW/BW in diabetic rats treated with insulin reflects the recovering of 357
growth in the heart of these animals, inasmuch as their final HW did not change. 358
359
360
4. Conclusion 361
The combination of an eight-week swimming training program with daily insulin replacement was more effective than isolated treatments 362
in attenuating oxidative stress, Ca2+ homeostasis disruptions and mitochondrial dysfunctions in the hearts of rats with STZ-induced type 1 363
diabetes. 364
365
19
Acknowledgments 366
This study was funded by the Fundação de Amparo à Pesquisa do Estado de Minas Gerais (FAPEMIG – CDS APQ 01171/11) and 367
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP – 2010/17259-9). A. J. Natali is a CNPq fellow. M. F. da Silva was recipient 368
of a doctoral scholarship from FAPEMIG. The confocal experiments were performed in the facilities of the Núcleo de Microscopia e 369
Microanálise at the Federal University of Viçosa (UFV). We acknowledge Ieda M.R. Prado for the technical support. 370
371
Duality of interest 372
The authors declare that there is no duality of interest associated with this manuscript. 373
374
5. References 375
1. Ago T, Kuroda J, Pain J, Fu C, Li H, Sadoshima J. Upregulation of Nox4 by hypertrophic stimuli promotes apoptosis and 376
mitochondrial dysfunction in cardiac myocytes. Circ Res. 2010 Apr 16;106(7):1253-64. 377
2. Aragno M, Mastrocola R, GAlloatti G. Vercellinatto I, Bardini P, Geuna S, Catalano MG, Danni O, Boccuzzi G. Oxidative stress 378
triggers cardiac fibrosis in the heart of diabetic rats. Endocrinology. 2008; 149:380-388 379
3. Aulbach F, Simm A, Maier S, Langenfeld H, Walter U, Kersting U, Kirstein M. Insulin stimulates the L-type Ca2+ current in rat 380
cardiac myocytes. Cardiovasc Res. 1999 Apr;42(1):113-20. 381
4. Barbosa MR, Sampaio IH, Teodoro BG, Sousa TA, Zoppi CC, Queiroz AL, Passos MA, Alberici LC, Teixeira FR, Manfiolli AO, 382
Batista TM, Cappelli AP, Reis RI, Frasson D, Kettelhut IC, Parreiras-e-Silva LT, Costa-Neto CM, Carneiro EM, Curi R, Silveira 383
20
LR. Hydrogen peroxide production regulates the mitochondrial function in insulin resistant muscle cells: effect of catalase 384
overexpression. Biochim Biophys Acta. 2013 Oct;1832(10):1591-604. 385
5. Bers DM. Calcium cycling and signaling in cardiac myocytes. Annu Rev Physiol. 2008;70:23-49. 386
6. Bidasee KR, Dinçer UD, Besch HR Jr. Ryanodine receptor dysfunction in hearts of streptozotocin-induced diabetic rats. Mol 387
Pharmacol. 2001 Dec;60(6):1356-64. 388
7. Boudina S, Sena S, Theobald H, Sheng X, Wright JJ, Hu XX, Aziz S, Johnson JI, Bugger H, Zaha VG, Abel ED. Mitochondrial 389
energetics in the heart in obesity-related diabetes: direct evidence for increased uncoupled respiration and activation of uncoupling 390
proteins. Diabetes. 2007; 56: 2457-66. 391
8. Bugger H, Abel ED. Mitochondria in the diabetic heart. Cardiovasc Res. 2010 Nov 1;88(2):229-40. 392
9. Carneiro-Júnior MA, Prímola-Gomes TN, Quintão-Júnior JF, Drummond LR, Lavorato VN, Drummond FR, Felix LB, 393
Oliveira EM, Cruz JS, Natali AJ, Mill JG. Regional effects of low-intensity endurance training on structural and mechanical properties 394
of rat ventricular myocytes. J Appl Physiol (1985). 2013 Jul 1;115(1):107-15. 395
10. Choi KM, Zhong Y, Hoit BD, Grupp IL, Hahn H, Dilly KW, Guatimosim S, Lederer WJ, Matlib MA. Defective intracellular 396
Ca(2+) signaling contributes to cardiomyopathy in Type 1 diabetic rats. Am J Physiol Heart Circ Physiol. 2002 Oct;283(4):H1398-408. 397
11. Dent CL, Bowman AW, Scott MJ, Allen JS, Lisauskas JB, Janif M, Wickline SA, Kovács SJ. Echocardiographic characterization of 398
fundamental mechanisms of abnormal diastolic filling in diabetic rats with a parameterized diastolic filling formalism. J Am Soc 399
Echocardiogr. 2001 Dec;14(12):1166-72. 400
12. Fang ZY, Prins JB, Marwick TH. Diabetic cardiomyopathy: evidence, mechanisms, and therapeutic implications.. Endocr Rev. 2004 401
Aug;25(4):543-67. 402
13. Gomes RJ, de Mello MA, Caetano FH, Sibuya CY, Anaruma CA, Rogatto GP, Pauli JR, Luciano E. Effects of swimming training 403
on bone mass and the GH/IGF-1 axis in diabetic rats. Growth Horm IGF Res. 2006 Oct-Dec;16(5-6):326-31. 404
21
14. Gomes RJ1, Leme JA, de Moura LP, de Araújo MB, Rogatto GP, de Moura RF, Luciano E, de Mello MA. Growth factors and 405
glucose homeostasis in diabetic rats: effects of exercise training Cell Biochem Funct. 2009 Jun;27(4):199-204. 406
15. Gunter TE, Buntinas L, Sparagna G, Eliseev R, Gunter K. Mitochondrial calcium transport: mechanisms and functions. Cell Calcium. 407
2000 Nov-Dec;28(5-6):285-96. 408
16. Hattori Y, Matsuda N, Kimura J, Ishitani T, Tamada A, Gando S, Kemmotsu O, Kanno M. Diminished function and expression of 409
the cardiac Na+-Ca2+ exchanger in diabetic rats: implication in Ca2+ overload. J Physiol. 2000 Aug 15;527 Pt 1:85-94. 410
17. Hao Z, Pan SS, Shen YJ, Ge J. Exercise preconditioning-induced early and late phase of cardioprotection is associated with protein 411
kinase C epsilon translocation. Circ J. 2014;78:1636-45. 412
18. Herlein JA, Fink BD, O'Malley Y, Sivitz WI. Superoxide and respiratory coupling in mitochondria of insulin-deficient diabetic rats. 413
Endocrinology. 2009 Jan;150(1):46-55. 414
19. Hidaka S, Kakuma T, Yoshimatsu H, Sakino H, Fukuchi S, Sakata T. Streptozotocin treatment upregulates uncoupling protein 3 415
expression in the rat heart. Diabetes. 1999 Feb;48(2):430-5. 416
20. Hissin PJ, Hilf R. A fluorometric method for determination of oxidized and reduced glutathione in tissues. Anal Biochem. 1976 417
Jul;74(1):214-26. 418
21. Howarth FC, Jacobson M, Shafiullah M, Adeghate E. Effects of insulin treatment on heart rhythm, body temperature and physical 419
activity in streptozotocin-induced diabetic rat. Clin Exp Pharmacol Physiol. 2006 Apr;33(4):327-31. 420
22. Kim JD; Yu BP; MCCarter, RJM; Lee SY; Herlihy JT. Exercise and diet modulate cardiac lipid peroxidation and antioxidant 421
defenses. F Radic Biol & Medic. 1996; 20:283-288. [16] 422
23. Lacombe VA, Viatchenko-Karpinski S, Terentyev D, Sridhar A, Emani S, Bonagura JD, Feldman DS, Györke S, Carnes CA. 423
Mechanisms of impaired calcium handling underlying subclinical diastolic dysfunction in diabetes. Am J Physiol Regul Integr Comp 424
Physiol. 2007 Nov;293(5):R1787-97. 425
22
24. Le Douairon Lahaye S, Gratas-Delamarche A, Malardé L, Zguira S, Vincent S, Lemoine Morel S, Carré F, Rannou Bekono F. 426
Combined insulin treatment and intense exercise training improved basal cardiac function and Ca(2+)-cycling proteins expression in type 427
1 diabetic rats. Appl Physiol Nutr Metab. 2012 Feb;37(1):53-62 428
25. Lucchesi BR, Medina M, Kniffen, FJ. The positive inotropic action of insulin in the canine heart. Eur J Pharmacol. 1972 429
Apr;18(1):107-15. 430
26. Lumini-Oliveira J, Magalhaes J, Pereira CV, Moreira AC, Oliveira PJ, Ascensao A. Endurance training reverts heart mitochondrial 431
dysfunction, permeability transition and apoptotic signaling in long-term severe hyperglycemia. Mitochondrion. 2010; 11:54-63. 432
27. Maalouf RM, Eid AA, Gorin YC, Block K, Escobar GP, Bailey S, Abboud HE. Nox4-derived reactive oxygen species mediate 433
cardiomyocyte injury in early type 1 diabetes. Am J Physiol Cell Physiol. 2012 Feb 1;302(3):C597-604. 434
28. Maritim AC, Sanders RA, Watkins JB. Effects of alpha-lipoic acid on biomarkers of oxidative stress in streptozotocin-induced diabetic 435
rats. J Nutr Biochem. 2003 May;14(5):288-94. 436
29. Matsuda N, Hattori Y, Kimura J, Ishitani T, Tamada A, Gando S, Kemmotsu O, Kanno M. Diminished function and expression of 437
the cardiac Na+-Ca2+ exchanger in diabetic rats: implication in Ca2+ overload. J Physiol. 2000 Aug 15;527 Pt 1:85-94. 438
30. Menon RK, Stephan DA, Rao RH, Shen-Orr Z, Downs LS Jr, Roberts CT Jr, LeRoith D, Sperling MA. Tissue-specific regulation 439
of the growth hormone receptor gene in streptozocin-induced diabetes in the rat. J Endocrinol. 1994 Sep;142(3):453-62. 440
31. Mootha VK, Bunkenborg J, Olsen JV, Hjerrild M, Wisniewski JR, Stahl E, Bolouri MS, Ray HN, Sihag S, Kamal M, Patterson N, 441
Lander ES, Mann M. Integrated analysis of protein composition, tissue diversity, and gene regulation in mouse mitochondria. Cell. 2003 442
Nov 26;115(5):629-40. 443
32. Nishio S, Teshima Y, Takahashi N, Thuc LC, Saito S, Fukui A, Kume O, Fukunaga N, Hara M, Nakagawa M, Saikawa T. 444
Activation of CaMKII as a key regulator of reactive oxygen species production in diabetic rat heart. J Mol Cell Cardiol. 2012 445
May;52(5):1103-11. 446
23
33. Pedersen PL, Greenawalt JW, Reynafarje B, Hullihen J, Decker GL, Soper JW Bustamante E. Preparation and characterization of 447
mitochondria and submitochondrial particles of rat liver and liver derived tissues. Methods Cell Biol. 1978;20:411-81. 448
34. Pierce GN, Ganguly PK, Dzurba A, Dhalla NS. Modification of the function of cardiac subcellular organelles by insulin. Adv 449
Myocardiol. 1985; 6:113–125. [17] 450
35. Prímola-Gomes TN, Campos LA, Lauton-Santos S, Balthazar CH, Guatimosim S, Capettini LS, Lemos VS, Coimbra CC, Soares 451
DD, Carneiro-Júnior MA, Quintão-Júnior JF, Souza MO, Cruz JS, Natali AJ. Exercise capacity is related to calcium transients in 452
ventricular cardiomyocytes, J Appl Physiol (1985). 2009 Aug;107(2):593-8. 453
36. Rajdev S, Reynolds IJ. Calcium green-5N, a novel fluorescent probe for monitoring high intracellular free Ca2+ concentrations 454
associated with glutamate excitotoxicity in cultured rat brain neurons. Neurosci. Lett. 1993; 162:149–152. [27] 455
37. Ramanadham S, Decker P, Tenner TE. Effect of insulin replacement on streptozotocin-induced effects in the rat heart. Life Sci. 1983; 456
33:289-6. 457
38. Remor AP, de Matos FJ, Ghisoni K, da Silva TL, Eidt G, Búrigo M, de Bem AF, Silveira PC, de León A, Sanchez MC, Hohl A, 458
Glaser V, Gonçalves CA, Quincozes-Santos A, Borba Rosa R, Latini A. Differential effects of insulin on peripheral diabetes-related 459
changes in mitochondrial bioenergetics: involvement of advanced glycosylated end products. Biochim Biophys Acta. 2011 460
Nov;1812(11):1460-71. 461
39. Reznick AZ, Packer L. Oxidative damage to proteins: spectrophotometric method for the carbonyl assay. Methods Enzymol. 1994; 233: 462
357–63. 463
40. Saks VA, Khuchua ZA, Kuznetsov AV, Veksler VI, Sharov VG. Heart mitochondria in physiological salt solution: not ionic strength 464
but salt composition is important for association of creatine kinase with the inner membrane surface. Biochem Biophys Res Commun 465
1986; 139:1262–71. 466
24
41. Shao CH, Wehrens XH, Wyatt TA, Parbhu S, Rozanski GJ, Patel KP, Bidasee KR. Exercise training during diabetes attenuates 467
cardiac ryanodine receptor dysregulation. J Appl Physiol. 2009 Apr;106(4):1280-92. 468
42. Skulachev VP. Uncoupling: new approaches to an old problem of bioenergetics. Biochim. Biophys. Acta 1998; 1363: 100–24. 469
43. Teshima Y, Takahashi N, Saikawa T, Hara M, Yasunaga S, Hidaka S, Sakata T. Diminished expression of sarcoplasmic reticulum 470
Ca2+-ATPase and ryanodine sensitive Ca2+ Channel mRNA in streptozotocin-induced diabetic rat heart J Mol Cell Cardiol. 2000 471
Apr;32(4):655-64. 472
44. Teshima Y, Takahashi N, Nishio S, Saito S, Kondo H, Fukui A, Aoki K, Yufu K, Nakagawa M, Saikawa T. Production of Reactive 473
Oxygen Species in the Diabetic Heart – Roles of Mitochondria and NADPH Oxidase. Circ J. 2014;78(2):300-6. 474
45. Trenker M, Malli R, Fertschai I, Levak-Frank S, Graier WF. Uncoupling proteins 2 and 3 are fundamental for mitochondrial Ca2+ 475
uniport. Nat Cell Biol. 2007; 9:445-52. [32] 476
46. Winnick JJ, Sherman WM, Habash DL, Stout MB, Failla ML, Belury MA, Schuster DP. Short-term aerobic exercise training in 477
obese humans with type 2 diabetes mellitus improves whole-body insulin sensitivity through gains in peripheral, not hepatic insulin 478
sensitivity. J Clin Endocrinol Metab. 2008 Mar;93(3):771-8. 479
47. Yu T, Sheu SS, Robotham JL, Yoon Y. Mitochondrial fission mediates high glucoseinduced cell death through elevated production of 480
reactive oxygen species. Cardiovasc Res. 2008; 79:341–51. 481
48. Zhao XY, Hu SJ, Li J, Mou Y, Chen BP, Xia Q. Decreased cardiac sarcoplasmic reticulum Ca2+-ATPase activity contributes to cardiac 482
dysfunction in streptozotocininduced diabetic rats. J Physiol Biochem. 2006; 62: 1–8. 483
49. Zhou M, Diwu Z, Panchuk-Voloshina N, Haugland R P. A stable nonfluorescent derivative of resorufin for the fluorometric 484
determination of trace hydrogen peroxide: applications in detecting the activity of phagocyte NADPH oxidase and other oxidases. Anal. 485
Biochem. 2007; 15: 162–168. 486
487
25
488
Table 1. Forward and Reverse sequences of primers used in the real time RT-PCR assays. 489
Gene Forward Reverse
Nox-4 5′TTCTGGACCTTTGTGCCTATAC3′ 5′CCATGACATCTGAGGGATGATT3′
UCP 5′ATGTGGTAAAGGTCCGCTTC3′ 5′CATTTCGGGCAACATTGGG3′
β-actin 5′CACTTTCTACAATGAGCTGCG3′ 5′CTGGATGGCTACGTACATGG3′
UCP-2, uncoupling protein-2; Nox-4, NADPH oxidase-4. 490
491
492
26
493
Table 2. General characteristics of animals in the experimental groups. 494
CS DS DSI CE DE DEI
Initial BG (mg/dL) 66.61±3.81 68.61±3.01 64.21±3.21 70.20±1.60 67.21±1.71 62.60±2.61
Final BG (mg/dL) 90.21±2.81 529.21±22.70a 338.20±39.00ad 87.21±3.80 492.20±34.50ab 316.81±67.01abcd
Initial BW (g) 83.40±1.61 85.20±3.40 85.80±2.71 84.81±2.91 85.80±2.71 83.60±1.80
Final BW (g) 351.20±23.31 198.80±20.40a 200.81±16.11a 286.60±25.10d 190.80±16.60ab 232.60±11.80abcd
HW (g) 1.86±0.08 1.00±0.10a 1.43±0.15ad 1.95±0.12d 1.01±0.07ab 1.62±0.07cd
HW/BW (mg/g) 5.43±0.47 5.07±0.20 7.46±1.28d 7.07±0.83d 5.48±0.68 7.02±0.39cd
RHR (bpm) 345.90±9.01 267.00±11.3a 345.3±17.8d 337.30±7.61 277.20±15.8b 349.21±9.81cd
Data expressed as mean ± SEM of 10 animals in each group. BW, body weight. BG, blood glucose. HW, heart weight. RHR, resting heart rate. 495
CS, control sedentary. DS, diabetic sedentary. DSI, diabetic sedentary with insulin. CE, control exercised. DE, diabetic exercised. DEI, diabetic 496
exercised with insulin. a different from CS; b different from CE; c different from DE; d different from DS. 497
498
27
Table 3. Left ventricular systolic and diastolic functions measured by resting echocardiography at the end of the experimental period. 499
CS
(n=7)
DS
(n=7)
DSI
(n=7)
CE
(n=7)
DE
(n=7)
DEI
(n=7)
Ejection fraction (%) 77.33±2.86 64.80±3.14a 63.33±2.86a 83.75±2.48 58.66±2.86ab 71.41±2.86bce
Fractional shortening (%) 41.00 ± 1.54 30.80 ± 1.69a 30.16 ± 1.54a 47.43 ± 1.33a 29.41 ± 1.54ab 35.91 ± 1.54bce
Peak E (m/s) 0.497±0.041 0.621±0.045 0.615±0.038 0.504±0.038 0.539±0.045 0.563±0.041
Peak A (m/s) 0.316±0.031 0.223±0.031 0.208±0.032 0.285±0.031 0.216±0.033 0.208±0.030
E/A ratio 1.66 ± 0.16 3.10 ± 0.18ab 3.02 ± 0.15ab 1.77 ± 0.15 2.54 ± 0.18 2.95 ± 0.16
Data expressed as mean ± SEM of n (number of animals) in each group. Peak E, early filling wave. Peak A, late filling wave. CS, control 500
sedentary. DS, diabetic sedentary. DSI, diabetic sedentary with insulin. CE, control exercised. DE, diabetic exercised. DEI, diabetic exercised 501
with insulin. a different from CS; b different from CE; c different from DE; e different from DSI. 502
503
504 505 506
28
Table 4. Phosphorylating (State III) and resting (State IV) respiration rates, and respiratory control ratio (RCR, State III/State IV) in heart 507
mitochondria. 508
CS DS DSI CE DE DEI
State III 26.50±2.20 23.50±3.00 23.80±2.40 27.90±1.80 20.10±0.13 21.00±1.5
State IV 2.32±0.13 3.03±0.2a 3.13±0.22a 3.34±0.48 3.09±0.09a 2.59±0.17
RCR 10.66±0.65 7.71±0.81a 7.61±0.55a 8.82±1.01 6.51±0.16a 8.13±0.50
Data expressed as mean ± SEM of 6 animals in each group. Mitochondria (0.5 mg protein/ml) were added in the standard medium supplemented 509
with 0.1 mM EGTA, under the conditions described in Materials and methods. Respiration rates given in nmols oxygen/mg protein/min. State III 510
was induced by the addition of 200 nmol ADP. State IV was determined by the addition of 1 µg/ml oligomycin, a classical inhibitor of FOF1 ATP 511
synthase. CS, control sedentary. DS, diabetic sedentary. DSI, diabetic sedentary with insulin. CE, control exercised. DE, diabetic exercised. DEI, 512
diabetic exercised with insulin. a Different from CS. 513
514
515
516 517
518
29
6. Figure legends 519
520
Figure 1. Intracellular global Ca2+ transient in isolated left ventricular myocytes. (A) Amplitude of transient. (B) Time to peak. (C) Time from 521
peak transient to half resting value. F/F0, fluorescence ratio [fluorescence intensity (F) normalized to the minimal intensity measured between 1-522
Hz contractions at diastolic phase (F0)]. CS, control sedentary. DS, diabetic sedentary. DSI, diabetic sedentary with insulin. CE, control 523
exercised. DE, diabetic exercised. DEI, diabetic exercised with insulin. a different from CS; b different from CE; c different from DE; d different 524
from DS; e different from DSI. n = 87 to103 cells per group. N = 87 to103 cells per group. 525
526
Figure 2. Redox state parameters in rat hearts. (A) mRNA relative expression of Nox-4. (B) SOD content. (C) GSH/GSSG. (D) Protein carbonyl 527
content. CS, control sedentary. DS, diabetic sedentary. DSI, diabetic sedentary with insulin. CE, control exercised. DE, diabetic exercised. DEI, 528
diabetic exercised with insulin. a different from CS; b different from CE; c different from DE; d different from DS; e different from DSI. n = 6 529
animals per group. 530
531
Figure 3. mRNA relative expression of UCP-2 in left ventricles. CS, control sedentary. DS, diabetic sedentary. DSI, diabetic sedentary with 532
insulin. CE, control exercised. DE, diabetic exercised. DEI, diabetic exercised with insulin. a different from CS; b different from CE; c different 533
from DE; d different from DS; e different from DSI. n = 6 animals per group. 534
535
Figure 4. H2O2 release in heart isolated mitochondria. (A) Typical traces and (B) Mean ± SEM data of H2O2 release rates are presented. Traces 536
are representative of five experiments with different mitochondrial preparations of each group. CS, control sedentary. DS, diabetic sedentary. 537
DSI, diabetic sedentary with insulin. CE, control exercised. DE, diabetic exercised. DEI, diabetic exercised with insulin. a different from CS; b 538
different from CE; c different from DE; d different from DS; e different from DSI. n = 6 animals per group. 539
30
540
Figure 5. Calcium dynamics in heart isolated mitochondria. (A) Mean ± SEM data of Ca2+ uptake measured in the presence of 1 µM CSA (to 541
prevent MPTP opening). (B) Representative raw experiments of Ca2+ retention capacity induced by MPTP opening in the absence of 1 µM CSA. 542
(C) Representative raw experiments of Ca2+ retention capacity induced by MPTP opening in the presence of 1 µM CSA. Where indicated were 543
added 20 nmol Ca2+ or 1 μM CCCP. CCCP was used to collapse membrane potential and release the full accumulated Ca2+. Traces are 544
representative of 5 experiments with different mitochondrial preparations of each group. CS, control sedentary. DS, diabetic sedentary. DSI, 545
diabetic sedentary with insulin. CE, control exercised. DE, diabetic exercised. DEI, diabetic exercised with insulin. a different from CS; d 546
different from DS; e different from DSI. 547
548
549