YOU ARE DOWNLOADING DOCUMENT

Please tick the box to continue:

Transcript
Page 1: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.

Antisense Approach to Target MDR Tuberculosis

Diane MeasMichael Nguyen

Michael DeSalvioMichael Boateng-Antwi

Page 2: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.

Agenda

• Introduction & Objectives• Background & Significance

o Overview of MDR TBo Impact and Importance

• Research Design & Methodso Previous studies and findingso Mechanism to new approacho Assay Methods

• Conclusion

Page 3: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.

Introduction• TB – Overview

o Infectious airborne disease caused by Mycobacterium tuberculosiso 2009 incident cases 9.4 milliono 2009 prevalent cases 14 milliono Mortality: - 1.8 milliono Funding : $5 billiono Estimated Funding for 2011: $6 billion (source: WHO Global TB Report, 2010)

Page 4: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.

TB – Global Distribution

Page 5: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.

Interventions

• Anti-TB drugs (www.cdc.gov/tb/publications)o Frontline: rifampicin, isoniazid, pyrizinamide, and ethambutol o Second line: fluoroquinolones, amikacin, kanamycin, or

capreomycin

• Drug Resistance: 250,000 reported (WHO-TB, 2010)

• Options for Disease controlo Development of new line of drugso Reversal of drug resistance

• Antisense Technology

Page 6: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.

Objectives

• Design an antisense molecule against a gene in mycobacterium.

 • Develop in vitro assay to test the maximum

effect of antisense molecule in mycobacterium

 

Page 7: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.

Background & Significance

Antibiotics Mechanism of Action (Michel J. Cloutier2, 1995)• Protein Synthesis• Folate

Metabolism• Cell wall

Synthesis• Cell Membrane• DNA gyrase• DNA-directed

RNA-polymerase

Page 8: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.

Background and Significance

Mechanisms of Antibiotic Resistance (Morris et al,

1995)• Antibiotic modification by bacterial enzymes• Preventing the antibiotic from entering the

cell or pumping it out (efflux) faster than it can flow in.

• Production of an alternative target (usually an enzyme) that is resistant to inhibition

• Alterations in the primary site of action

Page 9: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.

Background & Significance 1. Penicillin 2. Cephalosporin

Red Structure - β-lactam core ringβ-lactam antibiotics

• broad class of drugs with β-lactam ring as nucleus of molecular structure

• Inhibit 4 – 8 enzymes (PBP) engaged in cell wall biosynthesis.

β-lactamases cleave β-lactam ring in antibiotic to make drug ineffective

Page 10: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.

Antisense Overview• Made up of RNA• Generally short strands• Complementary to the mRNA strand• Intercept and bind mRNA

o Prevent Translationo No Gene Expression!

http://cdn.venturebeat.com/wp-content/uploads/2007/11/800px-antisense_dna_oligonucleotide.jpg

Page 11: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.

Antisense Treatments

• Used to treat various treatmentso Cytomegalovirus retinitiso Hemorrhagic fever viruseso Cancer (TGF-beta2)o HIV/AIDSo High cholesterol (mipobersen, 2010 ph-IV)

Page 12: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.

Proof of Principle

• Harth et.al: o Used phophorothioate-modified

oligodeoxyribonucleotides (PS-ODNs) o targeted mycolyl transferases to inhibit

essential genes

Page 13: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.

Proof of Principle

• Harth et.al:o Saw a reduction in antigen 85A, 85B and 85C

(Refered to as 32A, 30 and 32B) Reduction in expression also reduced bacterial

growth Demonstrated successfully that antisense strategy

is effective Successfully inhibited growth in M. tuberculosis

(human)

Page 14: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.

Proof of Principle

• Dasgupta et al:o Knocked out Penicillin Binding Proteins (PBPA)

serine acyl transferases involved in cell wall expansion, cell shape maintenance, septum formation and cell division

o Relied on mutation of PknB precursor proteins responsible for the phosphorylation of the PBPA

o Inactivation of PnkB results in no phosphorylation of PBPA Cell death

Page 15: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.

Current Solutions

• Clavulanic Acido GlaxoSmithKlineo B-lactamase inhibitoro Competitive inhibition

Binds to active site, causing irreversible covalenceo Derived from S. clavuligeruso Concurrent Administration with Amoxicillin

Page 16: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.

Current Solutions

• Adverse Effects!o Increased Cholestatic Jaundiceo Acute hepatitiso Some microbial resistanceo Allergy

Page 17: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.

Midpoint Recap

• Rifampicin resistance in M. tuberculosis• PS-ODNs and gene knockouts were

shown as effective means of bypassing drug resistance and restore drug sensitivity to microorganism

• Current approach can develop serious side effects

• New Antisense approach will have reduced side effects

Page 18: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.

Overview of PknB Proposal

• PknB prevents the synthesis of PBPA (penicillin binding protein)

• PknB phosphorlyates b-lactamase for insertion into the cell membraneo No PknB means no lactamase expression

• Antisense mRNA peptide nucleotides (PNAs) bind to the active site of PknB and prevent PknB synthesis by steric hindrance

• Downstream effects would be the loss of B-lactamase synthesis leading drug sensitivity

• No b-lactamase may also weaken cell wall structure leading to cell death

Page 19: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.

Research Design & Methods

• Target other essential genes:o Target a Serine/ Threonine protein kinase

(STPK)o PknB o Indirectly affects synthesis of B-Lactamaseso Effectively causes bacteria to be sensitive to

B-Lactam Class antibiotics

Page 20: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.

Gene Identification

• PknB = transmembrane serine/threonine-protein kinase B

• From M. tuberculosis H37Rv

Page 21: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.

Nucleotide SequenceATGACCACCCCTTCCCACCTGTCCGACCGCTACGAACTTGGCGAAATCCTTGGATTTGGGGGCATGTCCGAGGTCCACCTGGCCCGCGACCTCCGGTTGCACCGCGACGTTGCGGTCAAGGTGCTGCGCGCTGATCTAGCCCGCGATCCCAGTTTTTACCTTCGCTTCCGGCGTGAGGCGCAAAACGCCGCGGCATTGAACCACCCTGCAATCGTCGCGGTCTACGACACCGGTGAAGCCGAAACGCCCGCCGGGCCATTGCCCTACATCGTCATGGAATACGTCGACGGCGTTACCCTGCGCGACATTGTCCACACCGAAGGGCCGATGACGCCCAAACGCGCCATCGAGGTCATCGCCGACGCCTGCCAAGCGCTGAACTTCAGTCATCAGAACGGAATCATCCACCGTGACGTCAAGCCGGCGAACATCATGATCAGCGCGACCAATGCAGTAAAGGTGATGGATTTCGGCATCGCCCGCGCCATTGCCGACAGCGGCAACAGCGTGACCCAGACCGCAGCAGTGATCGGCACGGCGCAGTACCTGTCACCCGAACAGGCCCGGGGTGATTCCGTCGACGCCCGATCCGATGTCTATTCCTTGGGCTGTGTTCTTTATGAAGTCCTCACCGGGGAGCCACCTTTCACCGGCGACTCACCCGTCTCGGTTGCCTACCAACATGTGCGCGAAGACCCGATCCCACCTTCGGCGCGGCACGAAGGCCTCTCCGCCGACCTGGACGCCGTCGTTCTCAAGGCGCTGGCCAAAAATCCGGAAAACCGCTATCAGACAGCGGCGGAGATGCGCGCCGACCTGGTCCGCGTGCACAACGGTGAGCCGCCCGAGGCGCCCAAAGTGCTCACCGATGCCGAGCGGACCTCGCTGCTGTCGTCTGCGGCCGGCAACCTTAGCGGTCCGCGCACCGATCCGCTACCACGCCAGGACTTAGACGACACCGACCGTGACCGCAGCATCGGTTCGGTGGGCCGTTGGGTTGCGGTGGTCGCCGTGCTCGCTGTGCTGACCGTCGTGGTAACCATCGCCATCAACACGTTCGGCGGCATCACCCGCGACGTTCAAGTTCCCGACGTTCGGGGTCAATCCTCCGCCGACGCCATCGCCACACTGCAAAACCGGGGCTTCAAAATCCGCACCTTGCAGAAGCCGGACTCGACAATCCCACCGGACCACGTTATCGGCACCGACCCGGCCGCCAACACGTCGGTGAGTGCAGGCGACGAGATCACAGTCAACGTGTCCACCGGACCCGAGCAACGCGAAATACCCGACGTCTCCACGCTGACATACGCCGAAGCGGTCAAGAAACTGACTGCCGCCGGATTCGGCCGCTTCAAGCAAGCGAATTCGCCGTCCACCCCGGAACTGGTGGGCAAGGTCATCGGGACCAACCCGCCAGCCAACCAGACGTCGGCCATCACCAATGTGGTCATCATCATCGTTGGCTCTGGTCCGGCGACCAAAGACATTCCCGATGTCGCGGGCCAGACCGTCGACGTGGCGCAGAAGAACCTCAACGTCTACGGCTTCACCAAATTCAGTCAGGCCTCGGTGGACAGCCCCCGTCCCGCCGGCGAGGTGACCGGCACCAATCCACCCGCAGGCACCACAGTTCCGGTCGATTCAGTCATCGAACTACAGGTGTCCAAGGGCAACCAATTCGTCATGCCCGACCTATCCGGCATGTTCTGGGTCGACGCCGAACCACGATTGCGCGCGCTGGGCTGGACCGGGATGCTCGACAAAGGGGCCGACGTCGACGCCGGTGGCTCCCAACACAACCGGGTCGTCTATCAAAACCCGCCGGCGGGGACCGGCGTCAACCGGGACGGCATCATCACGCTGAGGTTCGGCCAGTAG

Page 22: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.
Page 23: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.

Amino Acid Sequence

MTTPSHLSDRYELGEILGFGGMSEVHLARDLRLHRDVAVKVLRADLARDPSFYLRFRREAQNAAALNHPAIVAVYDTGEAETPAGPLPYIVMEYVDGVTLRDIVHTEGPMTPKRAIEVIADACQALNFSHQNGIIHRDVKPANIMISATNAVKVMDFGIARAIADSGNSVTQTAAVIGTAQYLSPEQARGDSVDARSDVYSLGCVLYEVLTGEPPFTGDSPVSVAYQHVREDPIPPSARHEGLSADLDAVVLKALAKNPENRYQTAAEMRADLVRVHNGEPPEAPKVLTDAERTSLLSSAAGNLSGPRTDPLPRQDLDDTDRDRSIGSVGRWVAVVAVLAVLTVVVTIAINTFGGITRDVQVPDVRGQSSADAIATLQNRGFKIRTLQKPDSTIPPDHVIGTDPAANTSVSAGDEITVNVSTGPEQREIPDVSTLTYAEAVKKLTAAGFGRFKQANSPSTPELVGKVIGTNPPANQTSAITNVVIIIVGSGPATKDIPDVAGQTVDVAQKNLNVYGFTKFSQASVDSPRPAGEVTGTNPPAGTTVPVDSVIELQVSKGNQFVMPDLSGMFWVDAEPRLRALGWTGMLDKGADVDAGGSQHNRVVYQNPPAGTGVNRDGIITLRFGQ

Page 24: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.
Page 25: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.

Kinase Domain

Page 26: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.

RNA Active Site w/ DomainsUACGAACUUGGCGAA AUCCUUGGAUUUGGG GGCAUGUCCGAGGUC CACCUGGCCCGCGAC CUCCGGUUGCACCGC GACGUUGCGGUCAAG GUGCUGCGCGCUGAU CUAGCCCGCGAUCCC AGUUUUUACCUUCGC UUCCGGCGUGAGGCG CAAAACGCCGCGGCA UUGAACCACCCUGCA AUCGUCGCGGUCUAC GACACCGGUGAAGCC GAAACGCCCGCCGGG CCAUUGCCCUACAUC GUCAUGGAAUACGUC GACGGCGUUACCCUG CGCGACAUUGUCCAC ACCGAAGGGCCGAUG ACGCCCAAACGCGCC AUCGAGGUCAUCGCC GACGCCUGCCAAGCG CUGAACUUCAGUCAU CAGAACGGAAUCAUC CACCGUGACGUCAAG CCGGCGAACAUCAUG AUCAGCGCGACCAAU GCAGUAAAGGUGAUG GAUUUCGGCAUCGCC CGCGCCAUUGCCGAC AGCGGCAACAGCGUG ACCCAGACCGCAGCA GUGAUCGGCACGGCG CAGUACCUGUCACCC GAACAGGCCCGGGGU GAUUCCGUCGACGCC CGAUCCGAUGUCUAU UCCUUGGGCUGUGUU CUUUAUGAAGUCCUC ACCGGGGAGCCACCU UUCACCGGCGACUCA CCCGUCUCGGUUGCC UACCAACAUGUGCGC GAAGACCCGAUCCCA CCUUCGGCGCGGCAC GAAGGCCUCUCCGCC GACCUGGACGCCGUC GUUCUCAAGGCGCUG GCCAAAAAUCCGGAA AACCGCUAUCAGACA GCGGCGGAGAUGCGC GCCGACCUGGUC

Page 27: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.

Efficiency of PNA

• PNA stands for peptide nucleic acids• Antisense PNAs are larger than most drugs

o PNA size/length is an important parameter for efficiency

o PNAs targeted to the start codon region of the chromosomal β-galactosidase gene (lacZ) were synthesized over 7- to 15-mer size range

• E. coli outer cell wall is a major barrier to PNAs, so need to find a more efficient technique

Page 28: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.

Concentrations of PNA (100nM – 500nM)

Page 29: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.

Concentrations of PNA(1mM – 5mM)

Page 30: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.

Efficiency of the KFFKFFKFFK cap

• Also expressed as (KFF)3K• This is a synthetic peptide and it is a cell

wall-permeating peptide• When this cap is conjugated to PNA

oligomers, it could enhance the uptake and efficiency of antisense PNAs

Page 31: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.

Efficacy of Cap Peptide

Page 32: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.

Peptide Nucleic Acids

• Outperforms Oligonucleotides• 7-15 mer lengths• Capped with KFFKFFKFFK – synthetic

molecule shown to increase PNA uptake into cell

• PNA immune to exonuclease activity

Page 33: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.

Comparison of Nucleotides

Page 34: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.

mRNA and its Antisense PNA5’-GACGUUGCGUCAAGGUGUCUGCGCGCUGAU-3’3’-CUGCAACGCAGUUCGACAGACGCGCGACUA-CAP-5’

5’-CACCGUGACGUCAAGCCGGCGAACAUCAUG-3’3’-GUGGCACUGCAGUUCGGCCGCUUGUAGUAC-CAP-5’

5’-GCAGUAAAGGUGAUGGAUUUCGGCAUCGCC-3’3’-CGUCAUUUCCACUACCUAAAGCCGUAGCGG-CAP-5’

5’-AGCGGCAACAGCGUGACCCAGACCGCAGCA-3'3’-UCGCCGUUGUCGCUCUGGGUCUGGCGUCGU-CAP-5’

5’-AGAUAGCGCAAUGACCACCCCUUCCCACCU-3’3’-UCUAUCGCGUUACUGGUGGGGUUGGGUGGA-CAP-5’

Page 35: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.

Whole Cell Assay

•  BioSafety Level 1• Mycobacteria smegmatis• Middlebrook 7H9 Broth Media • Middlebrook 7H10 Agar Media• β-Lactam Antibiotic Library

Page 36: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.

Assay Method

• Grow Mycobacteria for 7 days @ 35oC in 7H9• Take OD reading (A600)• Transfer culture to 96-well plates• Screen against various PNAs (going across) • Vary concentrations of PNAs (doing down)• Screen multiple B-lactam class antibiotics• HTS Method • 2-Day OD readings (up to 8 weeks)

o Can change depending on growth rate

Page 37: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.

Assay Plate

1 2 3 4 5 6 7 8 9 10 11 12

A Buffer PNA110 nM

PNA2 PNA3 PNA4 PNA5 PNA6 PNA7 PNA8 PNA9 PNA10 ClavulanicAcid

B 1:2

C 1:4

D 1:8

E 1:16

F 1:32

G 1:64

H 0 nM

- One B-lactam antibiotic treated across entire plate- Every well contains M. smegmatis

Page 38: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.

Antibiotics: Beta-Lactams

• Glycopeptides– Vancomycin, Teicoplanin

• Penicillins– Amoxicillin, Ampicillin, Azlocillin, Mecillinam– Benzylpenicillin, Clometocillin– *Cloxacillin, *Oxacillin, *Nafcillin (*B-lactamase resistant)

• Cephalosporins– Cefazolin, Cefapirin, Ceftezole– Cefamandole, Cefprozil, Cefminox– Cefixime, Ceftrixone, Cefpimizole– Ceftiofur

• Monobactams– Aztreonam, Tigemonam

Page 39: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.

Expected Results

• No effect on Proliferation in Buffer wells

• Reduction in Mycobacteria growth over time on PNA wells

• Higher concentration PNA results in lower OD

• Clavulanic Acid shows greatest change in growth

Page 40: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.

Future Studies

• Select Promising PNAs for additional screening

• Screen Against other microorganisms

• Design PNAs for other essential genes or pathways

Page 41: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.

Contingency AssaysIn the event Mycobacteria does not grow in 96-well plate or detection is poor:

Large Scale Assay •Assay repeated using tubes of 7H9 Media (1mL)•Smaller β-Lactam library•Measure OD via spectroscopy

Zone of Inhibition Assay•Use of 7H10 Agar media•Impregnate with β-Lactam•Spots of various concentration PNAs•Measure inhibition zones

Page 42: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.

Some Issues with Assay

• PNAs not very well studied– Mode of transport and toxicity still unclear

• Not much information with in vivo assays• Assumes Mycobacteria can be sensitized to B-

Lactam• Assumes β-Lactam will remain active

– Not cleaved or lysed by Lactamases

Page 43: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.

Summary

• Tuberculosis is a worldwide epidemic• Wide proliferation have created Multi-Drug Resistant Strains• First Line defense, Rifampicin, Ineffective• New Approach: Return sensitivity to B-Lactam• Inhibit Expression of PknB at mRNA level

– Prevents Phosphorylation of Penicllin Binding Proteins– Prevents expression of PBP on Cell surface (B-Lactamases)

• Synthesize Peptide Nucleic Acids (PNAs) for specificity• HTS Assays

– Against B-Lactam Library      

Page 44: Antisense Approach to Target MDR Tuberculosis Diane Meas Michael Nguyen Michael DeSalvio Michael Boateng-Antwi.

Questions?


Related Documents