Yeast Ull1/Siz1 Is a Novel SUMO1/Smt3-ligase for Septin

Yeast Ull1/Siz1 Is a Novel SUMO1/Smt3-ligase for Septin

Components and Functions as an Adaptor between

Conjugating Enzyme and Substrates

Yoshimitsu Takahashi* , Tomoaki Kahyo , Akio Toh-e*,

Hideyo Yasuda , and Yoshiko Kikuchi*‡‡

From *Department of Biological Sciences, Graduate School of Science,

The University of Tokyo, 7-3-1, Hongo, Bunkyo-ku, Tokyo, 113-0033,

Japan and School of Life Science, Tokyo University of Pharmacy and

Life Science, 1432-1 Horinouchi, Hachioji, Tokyo, 192-0392, Japan

Running title; Identification of a Novel Yeast SUMO1/Smt3-ligase

ƒ These authors contribute equally.

‡To whom correspondence should be addressed: Department of

Biological Sciences, Graduate School of Science, The University of

Tokyo, 7-3-1, Hongo, Bunkyo-ku, Tokyo, 113-0033, Japan. Tel. and

Fax: 81-3-5684-9420; E-mail: [email protected]

The abbreviations used are: DTT, dithiothreitol; GFP, green

fluorescent protein; GST, glutathione S-transferase; HA, hemagglutinin;

NEM, N-ethylmaleimide; PAGE, polyacrylamide gel electrophoresis;

PCR, polymerase chain reaction; PIAS, a protein inhibitor of activated

STAT; SMT3, suppressor of mif2; SUMO, small ubiquitin-like

modifier; ULL1, ubiquitin-like protein ligase 1.

by guest on Decem

ber 28, 2018http://w

ww

.jbc.org/D

ownloaded from

SUMMARY

SUMO1/Smt3, a ubiquitin-like protein modifier, is

known to conjugate to other proteins and modulate their

functions in various important processes. Similar to the

ubiquitin-conjugation system, SUMO/Smt3 is transferred to

substrate lysine residues through the thioester cascade of E1

(activating enzyme) and E2 (conjugating enzyme). In our

previous report (Takahashi, Y., Toh-e, A., & Kikuchi, Y.

(2001) Gene in press), we showed that Siz1/Ull1 (YDR409w)

of budding yeast, a member of human PIAS family containing

a Ring-like domain, is a strong candidate of SUMO1/Smt3

ligase, because the SUMO1/Smt3-modification of septin

components was abolished in the ull1 mutant and Ull1

associated with E2 (Ubc9) and the substrates (septin

components) in immunoprecipitation experiments. Here we

have developed an in vitro Smt3-conjugation system for a

septin component (Cdc3), using purified recombinant

proteins. In this system, Ull1 is additionally required, as well

as E1 (Sua1/Uba2-complex), E2 (Ubc9) and ATP. A cysteine

residue of the Ring-like domain was essential for the

conjugation both in vivo and in vitro. Furthermore, a region

containing the Ring-like domain directly interacted with

Ubc9 and Cdc3. Thus, this SUMO/Smt3-ligase functions as an

adaptor between E2 and the target proteins.

INTRODUCTION

SUMO (small ubiquitin-like modifier)/Smt3 is a member of

growing family of ubiquitin-related proteins and is known to be

by guest on Decem

ber 28, 2018http://w

ww

.jbc.org/D

ownloaded from

conjugated to RanGAP1, PML, IκBα, p53, septins, etc (1-4). Not only

are the amino acid sequences and the three-dimensional structures

similar between SUMO/Smt3 and ubiquitin, but their conjugation

systems and the enzymes involved are highly related (5-9). In the

ubiquitin pathway a third enzyme, ubiquitin ligase (E3), is often

required for the final transfer of this modifier and plays a crucial role

by recognizing target proteins and by promoting their conjugation (10).

It remains unknown, however, whether any SUMO1/Smt3 ligases (E3s)

are involved in this conjugation pathway.

In the ubiquitin pathway, some E3 components such as Apc11 of

the anaphase promoting complex and Rbx1 of the SCF-ubiquitin ligase

complex contain a zinc-binding Ring-domain with an octet of ordered

cysteine and histidine residues forming a cross-brace around two zinc

atoms (11, 12). This type of ubiquitin ligases (E3s) has to interact with

E2 and the substrate at the same time, because apparently they do not

form the thioester bond with ubiquitin. In the case of c-Cbl proto-

oncoprotein, its Ring-domain interacts with UbcH7 (E2), and TKB

domain, a region close to the Ring-domain, recognizes its substrate.

Thus, c-Cbl proto-oncoprotein functions as a bridging-molecule

between E2 and its substrate (13).

In budding yeast, Smt3 is the only member of the SUMO family,

and the Smt3-conjugation system is essential for mitotic growth. The

lethality of the smt3 deletion mutant can be suppressed by expressing

human SUMO1, suggesting that SUMO1 is a functional homologue of

yeast Smt3 (14). As the substrate proteins in yeast, three components of

septins (Cdc3, Cdc11 and Shs1) have been identified so far (14, 15).

Septins are a highly conserved group of GTP-binding proteins from

by guest on Decem

ber 28, 2018http://w

ww

.jbc.org/D

ownloaded from

yeast to human and required for the completion of cytokinesis, polar

growth and morphogenesis checkpoint control (16, 17).

In our previous work, we showed that Siz1 (YDR409w), a

member of a new family including human PIAS3 (18), containing a

Ring-like domain, is required for the Smt3-conjugation to septins in

vivo and associates with Ubc9 and septins, assayed by

immunoprecipitation experiments (19). Thereby, Siz1 could be a novel

Smt3/SUMO1 ligase. In this report, we have developed an in vitro

Smt3-conjugation system and demonstrate that Siz1 is a bona fide

SUMO1/Smt3-ligase. Thus we propose the gene name of YDR409w, as

ULL1 (Ubiquitin-like protein ligase). Furthermore, we show that a

region containing the Ring-like domain directly interacts with Ubc9 and

Cdc3.

EXPERIMENTAL PROCEDURES

Strains and Genetic Manipulations - Escherichia coli strains,

DH5α and BL21 (DE3), were used for plasmid propagation and protein

purification, respectively. Strains of Saccharomyces cerevisiae, T-13

(ull1::cgHIS3) and T-20 (ull1::cgHIS3 CDC3HA-TRP1), isogenic to

W303-1A (MATa ade2 ura3 trp1 leu2 his3 can1 ssd-d2), were described

previously (19). PJ69-4A (MATa ura3 trp1 leu2 his3 gal4 gal80

LYS2::GAL1-HIS3 GAL2-ADE2 met2::GAL7-lacZ) was used for the

two-hybrid system (20). Media and genetic techniques for yeast were

described by Kaiser et al (21).

Plasmids – pT-17 (pTS901CL-ULL1HA), pT-18 (pTS901CL-

ull1C377SHA), pT-20 (pTS904CU-ULL1myc), pT-21 (pTS904CU-

ull1C377Smyc) and pT-22 (pGBDU-Ring-like domain) were described

previously (19). Each plasmid pT-23 (pTS910CU-ULL1GFP), pT-24

(pTS910CU-ull1C361SGFP), pT-25 (pTS910CU-ull1C400SGFP), pT-26

by guest on Decem

ber 28, 2018http://w

ww

.jbc.org/D

ownloaded from

(pTS910CU-ull1 C377S, C400SGFP) or pT-27 (pTS910CU-ull1S460CGFP) has

the same fragment of pT-17 except carrying each mutation, on a GFP-

tagging vector pTS910CU (22). pT-29 (pTS901CL-ull1C361SHA), pT-30

(pTS901CL-ull1C361S, C400SHA), pT-31 (pTS901CL-ull1C377S, C400SHA) and

pT-32 (pTS901CL-ull1S460CHA) have the same fragment of pT-17 except

carrying each mutation, on an HA-tagging vector pTS901CL (22).

Mutations were introduced by PCR (polymerase chain reaction)-based

site-directed mutagenesis. For the mutations of C361S, C400S and

S460C, the following primer pairs were used, respectively; C361S-SS

(AGTCTGCAATCTCCAATTTCG) and C361S-AS

(CGAAATTGGAGATTGCAGACT), C400S-SS

(CGTGGCAATCCCCAGTATG) and C400S-AS

(CATACTGGGGATTGCCACG), S460C-SS

(TGGTAGTAGATGCCCAGAAAAA) and S460C-AS

(TTTTTCTGGGCATCTACTACCA) (mutant nucleotides are

underlined). Plasmids pT-33 (pTS904EU-ULL1myc) and pT-34

(pTS904EU-ull1C377Smyc) have the same fragments of pT-20 and pT-21,

respectively, on a multi-copy plasmid pTS904EU. To construct pT-35

(pGEX-KG-SMT3gg), a DNA fragment carrying the SMT3 open

reading frame (ORF) lacking the two C-terminal amino acids was

amplified by PCR using the following primers: SMT3-N1

(CGCGGATCCATGTCGGACTCAGAAGTCAAT) and SMT3-C-GG

(GCGCGTCGACTAACCACCAATCTGTTCTCTGT) and genomic

DNA as template, cut with BamHI and SalI, and inserted into pGEX-KG

vector. pT-36 (pET21b-CDC3); the DNA fragment containing the ORF

of CDC3 was cloned from pGAD-CDC3 (19) into pET21b (Novagen)

for expression of T7-tagged N-terminal and His-tagged C-terminal Cdc3

in E. coli. pT-37 (pGBDU-C1-ull1C377S) contains the same fragment of

by guest on Decem

ber 28, 2018http://w

ww

.jbc.org/D

ownloaded from

pT-22 except carrying the mutation C377S. pT-38 (pGAD-C1-UBC9)

and pT-42 (pET21a-UBC9) contain a PCR fragment of UBC9,

amplified using a pACT-cDNA bank (a gift of S. J. Elledge) as template

and cloned into pGAD-C1 (20) and pET21a, respectively. pT-39

(pGAD-C1-SMT3) contains the same fragment of pMK02 carrying ORF

and its 3’-region of SMT3, described previously (14). pT-40 (pGEX-

KG-Ring-like domain) contains the same fragment of pT-22 on pGEX-

KG. To construct pGSTFastBacHT-ULL1 and pGSTFastBacHT-ull1-

C377S, DNA fragments of the wild-type ULL1 and mutant ull1C377S

genes were inserted into the SalI site of pGSTFastBacHT vector

(GIBCOBRL) for expression of GST-tagged Ull1 proteins by the

bacurovirus protein expression system. pGAD-hSUMO1 (pGAD424-

hSUMO1) was derived from pAS2-1-SUMO1, described previously

(23). pGAD-mUbc9 (pACT-mUbc9) contains murine UBC9 cDNA on

pACT-I vector.

Preparation of Yeast Cell Lysates and Immunoblot Analysis -

Cells were grown in minimal medium at 25℃. To arrest cell growth at

G2/M phase, nocodazole (15 µg/ml; Sigma) was added to cultures for

3.5 h. The cells were collected, resuspended in 50 µl of lysis buffer 1

[100 mM Tris-HCl (pH 8.0), 200 mM NaCl, 1 mM EDTA, 5 %

glycerol, 0.5 mM dithiothreitol (DTT), 5 mM N-ethylmaleimide

(NEM), 0.1 % TritonX-100] containing proteinase inhibitors, and

disrupted by shaking with glass beads. Cell lysates were prepared and

immunoblotting was performed, as described previously (19), using 2

µg/ml α-HA (16B12; BAbCO) or α-myc (Ab-1; Oncogene) monoclonal

antibody, and 0.2 µg/ml α-PSTAIRE (sc-53; Santa Cruz Biotech.)

rabbit polyclonal antibody for 2 h, and 1.5 µl of goat anti-mouse IgG

conjugated to horseradish peroxidase (Promega) for 1 h at room

by guest on Decem

ber 28, 2018http://w

ww

.jbc.org/D

ownloaded from

temperature. Bands were detected with the detection reagent (New Life

Science Products), as instructed by the manufacturer.

Purification of the Proteins for in vitro Conjugation Assay - For

preparation of T7- and His-tagged Cdc3 (T7-Cdc3-His) protein, pT-36

was transformed into E. coli BL21 (DE3). The transformants were

grown to mid-log phase and isopropyl β-D-thiogalactopyranoside

(IPTG) was added to the culture (final concentration: 1 mM) to induce

the recombinant protein for 2 h. Cells from 200 ml cultures were

collected, resuspended in lysate buffer [10 mM Tris-HCl (pH 7.4), 3

mM MgCl2, 0.1 mM PMSF] plus 1 mM PMSF, 0.1% Nonidet P-40 and

200 mM NaCl, and disrupted by sonication. The lysates were

centrifuged at 15,000 x g for 15 min. TALON Metal Affinity Resin

(CLONTECH) was added to the supernatant for incubation at 4℃ for

30 min, washed three times with lysate buffer, loaded into a column and

washed stepwise with 0, 20, 50 and 100 mM imidazole in elution buffer

(50 mM sodium phosphate, 300 mM NaCl). The T7-Cdc3-His protein

was eluted with 150 mM imidazole in the elution buffer and dialyzed

against 50 mM Tris-HCl (pH 7.4) containing 0.1 mM PMSF. GST or

GST-Smt3gg was expressed from plasmid pGEX-KG or pT-35 in E.

coli BL21 (DE3). Each cell lysate was mixed and incubated with

Glutathione Sepharose 4B (Amersham Pharmacia) at 4℃ for 30 min.

After the beads were washed three times with lysate buffer, each protein

was eluted with 20 mM glutathione in 50 mM Tris-HCl (pH 8.0) and

dialyzed against 50 mM Tris-HCl (pH 7.4) containing 0.1 mM PMSF.

To prepare untagged Smt3gg, GST-Smt3gg bound to Glutathione

Sepharose 4B beads was treated with thrombin, and 2 mM PMSF was

added to the fraction of free Smt3gg. Purification of E1-complex (GST-

tagged human Sua1 and His-tagged Uba2) from the lysate of Sf-9 cells

by guest on Decem

ber 28, 2018http://w

ww

.jbc.org/D

ownloaded from

and T7-tagged hUbc9 from E. coli lysate was described previously (24).

To prepare GST-tagged Ull1 and GST-tagged ull1-C377S mutant

proteins, the recombinant proteins were expressed in Sf-9 cells by use

of the bacurovirus protein expression system (GIBCOBRL). About 3 x

107 cells were collected and resuspended in lysate buffer containing 1

mM PMSF, 0.1% Nonidet P-40 and 400 mM NaCl, and disrupted by

sonication. The low speed supernatant fractions were mixed and

incubated with Glutathione Sepharose 4B beads at 4℃ for 30 min. The

beads were washed three times with lysate buffer containing 0.01% Brij

58. The proteins were eluted by incubation with 50 mM Tris-HCl (pH

8.0) buffer containing 5 mM glutathione at 4℃ for 1 h.

In vitro Smt3-conjugation Assay - The complete in vitro system

using recombinant proteins contains: 0.5 µg E1-complex, 0.02 µg E2,

0.04 µg GST-Ull1, 0.8 µg His-T7-tagged Cdc3 and 1.0 µg GST-tagged

mature form of Smt3 in a 30-µl reaction mixture containing 50 mM

Tris-HCl (pH 7.4), 3.3 mM ATP, 5 mM MgCl2 and 2 mM DTT. Or 0.5

µg mature form of Smt3 was added in place of GST-Smt3gg. In a

negative control, GST (1.0 µg) was added in place of GST-Smt3gg. The

GST-tagged ull1-C377S mutant protein (0.04 µg) was added in place of

GST-Ull1. The mixtures were incubated at 25℃ for 40 min. Cdc3 was

probed with α-T7 (Novagen) in immunoblotting analysis.

In vitro Binding Assay – Transformants of E. coli BL21 (DE3)

with pT-40 (pGEX-KG-Ring-like domain), pGEX-KG, pT-42 (pET21a-

UBC9), pT-36 (pET21b-CDC3) or pET21a were grown to mid-log

phase and each recombinant protein was induced by adding 0.1 mM

IPTG at 37℃ for 3 h. Cells were collected, resuspended in lysis buffer

2 [10 mM Tris-HCl (pH 7.5), 1 mM EDTA, 0.1% Nonidet P-40 and 1

mM PMSF] and disrupted by sonication. Cell lysates were centrifuged at

by guest on Decem

ber 28, 2018http://w

ww

.jbc.org/D

ownloaded from

15,000 x g for 15 min and supernatant fraction containing GST or GST-

Ring-like domain was incubated with Glutathione Sepharose 4B beads,

as instructed by the manufacture (Amersham Pharmacia). To prepare

cell lysate containing T7-tagged Ubc9, T7-Cdc3 or untagged control,

100 µl of the supernatant fraction (about 100 µg proteins) was diluted

twice with lysis buffer 2, and 5 µl bead suspension (about 0.5 µg GST-

proteins were bound) was added. The mixtures were incubated at room

temperature for 1 h. The beads were washed three times with 75% lysis

buffer 2/25% RIPA buffer [50 mM Tris-HCl (pH 7.5), 200 mM NaCl,

1% TritonX-100, 0.5% sodium deoxycholate, 0.1% SDS, 1% BSA].

Bound proteins were subjected to immunoblotting analysis, using α-T7

and α-GST.

RESULTS

Cysteine Residues in the Ring-like Domain of Ull1 Are Necessary

for the Smt3-conjugation – Ull1 contains a Ring-like domain in the

central region (Fig. 1A ). When the cysteine-377 in this domain was

changed to serine, the Smt3-conjugation to septins was abolished in vivo

(19). In order to see whether other cysteine residues in the Ring-like

domain are also essential for septin-sumoylation, we constructed

plasmids carrying mutant genes (ull1C361S, ull1C400S, ull1C377S/C400S; see Fig.

1A ) and those plasmids were introduced into the ull1 disruptant that

expressed HA-tagged CDC3, replacing the endogenous wild-type CDC3

gene. Cultures of the transformants were treated with a microtubule-

depolymerizing drug, nocodazole, for 3.5 h to arrest cells at the G2/M

boundary. Cell extracts were prepared and subjected to immunoblotting.

Cdc3 was probed with anti-HA antibody. As shown in 1B, several

higher molecular weight bands of Smt3-Cdc3 conjugates were detected

by guest on Decem

ber 28, 2018http://w

ww

.jbc.org/D

ownloaded from

in extracts of ULL1 cells, in accordance with previous reports (15, 19).

In contrast, all the mutants failed to conjugate Smt3 to Cdc3 (Fig. 1B).

When wild-type or each mutant protein was tagged with the HA-

epitope and prepared as described above, the protein level of the mutant

proteins decreased by a few-fold, compared with the wild-type Ull1

protein (Fig. 1C). Even when a myc-tagged mutant protein (C377S) was

expressed from a multi-copy plasmid and the protein level was higher

than the wild-type level, it did not fully recover the Smt3-conjugation to

HA-tagged Cdc3, although the mutant protein may still retain some

activity (Fig. 1D). Thus we conclude that those cysteine residues in the

Ring-like domain of Ull1 are important for the Smt3-conjugation.

Ull1 is phosphorylated especially in the M-phase (19). There is

one potential CDK-target site (SPXK) near the Ring-like domain. We

changed this serine-460 residue to cysteine, but the septin-sumoylation

was not impaired (Fig. 1B).

Ull1 Promotes Septin-sumoylation In vitro – In order to

demonstrate that Ull1 is a bona fide Smt3/SUMO-ligase (E3), we have

developed an in vitro system for septin-sumoylation. As a substrate, T7-

His-tagged Cdc3 was purified from E. coli lysate. The mature form of

GST-tagged Smt3 was purified from E. coli lysate. The mature form of

untagged Smt3 was prepared from GST-Smt3 by the treatment with

thrombin. As E1 and E2 enzymes, we used GST-tagged human

Sua1/His-tagged Uba2-complex purified from Sf-9 cells and T7-tagged

human Ubc9 purified from E. coli lysate, respectively. These E1 and E2

enzymes successfully promoted the in vitro SUMO1-conjugation to

RanGAP1 (24). GST-tagged Ull1 or ull1C377S mutant protein was

expressed and purified by the bacurovirus protein expression system.

The purified recombinant proteins were subjected to SDS-PAGE and

by guest on Decem

ber 28, 2018http://w

ww

.jbc.org/D

ownloaded from

the gels were stained with Coomassie Brilliant Blue, as shown in Fig.

2A . The Smt3 fraction contained a break-down product of Smt3, since

the band of the smaller size was also stained with α-Smt3 (data not

shown). In the lane of the E1-complex fraction, the band of Uba2 was

very weak, since we purified the E1 fraction of GST-Sua1/Uba2

heterodimer through Glutathione Sepharose 4B resin. Also in this

fraction, GST from Sf-9 cells was co-purified, which is marked by

asterisk.

For an in vitro conjugation assay, the various reaction mixtures

shown in Fig. 2B, were incubated with 3.3 mM ATP and 2 mM DTT at

25℃ for 40 min and subjected to immunoblotting. Cdc3 was probed

with anti-T7 antibody. A new band corresponding to the Cdc3 modified

with GST-Smt3 was detected in the complete reaction mixture in lane 6.

Appearance of this new band depended on the presence of E1 (lane 1),

E2 (lane 2), GST-Ull1 (lane 3) or GST-Smt3 (lane 5). Higher molecular

weight bands detected by the antibody, were derived from the T7-Cdc3-

His fraction, since these bands were missing in lane 4, and were present

even without other components (lane 9 and lane 12). Whether those are

Cdc3-polymers or unrelated proteins that are reactive to this antibody,

remains unknown.

When untagged Smt3 was used in place of GST-Smt3, a new band

of a smaller size was detected in lane 7. The size difference between

these bands corresponds to the size of GST. Furthermore, production of

the new band was abolished in the presence of 5 mM NEM (Fig. 2C),

which is consistent with a notion that thioester bond formation should be

involved in these reactions. This is the first demonstration that

sumoylation requires an additional factor, besides E1 and E2. Taken

by guest on Decem

ber 28, 2018http://w

ww

.jbc.org/D

ownloaded from

together with our previous study (19), we conclude that Ull1 is a

SUMO1/Smt3-ligase for septin components.

When the ull1C377S mutant protein was added to this in vitro

system, the production of the Smt3-conjugates decreased at least several

fold (Fig. 2B, lane 8). Thus the cysteine-377 in the Ring-like domain is

essential for this conjugation in vitro, as well as in vivo.

The Ring-like domain interacts with Ubc9 and Cdc3 – We previously

showed that the region (from 327th to 465th) containing the Ring-like

domain of Ull1 interacted with Cdc3 in the two-hybrid system (19).

This region also interacted with human SUMO1 and mouse Ubc9 (Fig.

3A ), as well as yeast Smt3 and Ubc9 in the two-hybrid system (Fig. 3B).

The C377S mutation within the Ring-like domain impaired the

interaction both with Ubc9 and Smt3 (Fig. 3B).

In order to examine whether the Ring-like domain interacts with

E2 and the substrate directly, an in vitro binding assay was performed.

GST-tagged Ring-like domain (from 327th to 465th) of Ull1 or GST was

expressed in E. coli and bound to Glutathione Sepharose 4B beads. T7-

tagged Ubc9 and T7-Cdc3 were separately expressed in E. coli, and

each of those cell lysates was mixed with the beads bound with GST-

Ring-like domain or GST. After washing, bound proteins were

subjected to immunoblotting. As shown in Fig. 3C, both Ubc9 and Cdc3

were bound to the GST-Ring-like domain. In contrast, neither Ubc9 nor

Cdc3 interacted with GST. Thus both Ubc9 (E2) and Cdc3 (substrate)

directly and specifically interact with the region containing the Ring-

like domain of Ull1.

DISCUSSION

In our previous study, we showed that the SUMO1/Smt3-

conjugation to Cdc3 depends on Ull1 in vivo, and that Ull1 interacts

with E2 and the substrates in immunoprecipitation analysis (19). In the

by guest on Decem

ber 28, 2018http://w

ww

.jbc.org/D

ownloaded from

present study, we have developed an in vitro system, where Ull1 is

required for the Smt3-modification of Cdc3, in addition to E1 and E2

enzymes (Fig. 2). These results exclude a possibility that the absence of

septin-sumoylation in the ull1 mutant is due to a defect in expression of

hypothetical factors in the Smt3-conjugation pathway in the mutant.

Although it has been published that E3 is not required in the

SUMO1/Smt3 conjugation pathway (24), we suspect that it may be an in

vitro artifact, because only E1 and E2 enzymes promoted the

modification in our system, when a large amount of E2 was added to the

reaction (our unpublished results).

Human SUMO1 rescues the lethality of the yeast smt3 deletion

mutant (14), and both SUMO1 and mouse Ubc9 interacted with yeast

Ull1 in the two-hybrid system (Fig. 3A ). Furthermore, human E1 and

E2 enzymes successfully promoted the in vitro yeast Smt3-conjugation

to septin component (Fig. 2). These results indicate that enzymes in the

SUMO1/Smt3 conjugation pathway are well conserved from yeast to

human.

Certain ubiquitin ligases are known to carry a zinc-binding Ring-

finger domain that often interacts with ubiquitin conjugating enzymes.

In accordance with these facts, Ull1 as a SUMO1/Smt3-ligase contains a

Ring-like domain and the conserved cysteine residues in the domain are

important for the Smt3-protein conjugation in vivo (19, Fig. 1) and in

vitro (Fig. 2). It is not known, however, whether the structure of this

Ring-like domain is similar to the authentic Ring-finger domain of a

bracelet structure containing two zinc atoms. This issue remains to be

elucidated.

The region containing the Ring-like domain (from 327th to 465th)

of Ull1 interacted with Ubc9 in the two-hybrid system (Fig. 3B) and in

by guest on Decem

ber 28, 2018http://w

ww

.jbc.org/D

ownloaded from

vitro binding assay (Fig. 3C). On the other hand, the ull1-C377S mutant

protein did not interact with Ubc9 in the two-hybrid system (Fig. 3B).

Also, this domain directly interacted with Cdc3 (Fig. 3C). Among

ubiquitin ligases, only the hect-proteins are known to bind a ubiquitin

molecule through thioester bond formation. The other ubiquitin ligases

have to interact with E2 and the substrate at the same time, because

those ubiquitin ligases apparently do not form the thioester bond with

ubiquitin, and function as bridging molecules between E2 and the

substrates. In the case of c-Cbl proto-oncoprotein, the Ring-domain

interacts with UbcH7 (E2), and the region (TKB domain) close to the

Ring-domain is known to be a recognition site for its substrate (13). Just

like this c-Cbl proto-oncoprotein, the region containing the Ring-like

domain of Ull1 binds to Ubc9 (E2) and Cdc3 (substrate) (Fig. 3).

Taken together, Ull1 should be qualified as an E3 (SUMO1/Smt3

ligase) in the SUMO1/Smt3 conjugation pathway, and enzymes both in

the SUMO1/Smt3 and ubiquitin conjugation pathways are conserved.

Acknowledgments – We would like to thank S. J. Elledge for

cDNA bank, E. Craig and T. Sasaki for plasmids. Y. T. is a recipient of

the Japan Society for the Promotion of Science Fellowship for Young

Scientists. This work was partly supported by Grant-in-Aid from the

Ministry of Education, Science, Sports and Culture of Japan to Y. K.

and from Uehara Memorial Foundation to H. Y.

REFERENCES

1. Müller, S., Hoege, C., Pyrowolakis, G., and Jentsch, S. (2001)

Nature Rev. Mol. Cell. Biol. 2, 202-210

2. Melchior, F. (2000) Annu. Rev. Cell Dev. Biol. 16, 591-626

by guest on Decem

ber 28, 2018http://w

ww

.jbc.org/D

ownloaded from

3. Hochstrasser, M. (2000) Nature Cell Boil. 2, E153-E157

4. Weissman, A. M. (2001) Nature Rev. Mol. Cell Biol. 2, 169-178

5. Meluh, P. B., and Koshland, D. (1995) Mol. Biol. Cell 6, 793-

807

6. Dohmen, R. J., Stappen, R., McGrath, J. P., Forrová, H.,

Kolarov, J., Goffeau, A., and Varshavsky, A. (1995) J. Biol.

Chem. 270, 18099-18109

7. Johnson, E. S., Schwienhorst, I., Dohmen, R. J., and Blobel, G.

(1997) EMBO J. 16, 5509-5519

8. Johnson, E. S., and Blobel, G. (1997) J. Biol. Chem. 272, 26799-

26802

9. Schwarz, S. E., Matuschewski, K., Liakopoulos, D., Scheffner,

M., and Jentsch, S. (1998) Proc. Natl. Acad. Sci. USA 95, 560-

564

10. Hershko, A., and Ciechanover, A. (1998) Annu. Rev. Biochem.

67, 425-479

11. Saurin, A. J., Borden, K. L. B., Boddy, M. N., and Freemont, P.

S. (1996) Trends in Biochem. Sci. 21, 208-214

12. Jackson, P. K., Eldridge, A. G., Freed, E., Furstenthal, L., Hsu,

J. Y., Kaiser, B. K., and Reimann, J. D. R. (2000) Trends in Cell

Biol. 10, 429-439

13. Zheng, N., Wang, P., Jeffrey, P. D., and Pavletich, N. P. (2000)

Cell 102, 533-539

14. Takahashi, Y., Iwase, M., Konishi, M., Tanaka, M., Toh-e, A.,

and Kikuchi, Y. (1999) Biochem. Biophys. Res. Commun. 259,

582-587

15. Johnson, E. S., and Blobel, G. (1999) J. Cell Biol. 147, 981-994

by guest on Decem

ber 28, 2018http://w

ww

.jbc.org/D

ownloaded from

16. Longtine, M. S., DeMarini, D. J., Valencik, M. L., Al-Awar, O.

S., Fares, H., De Virgilio, C., and Pringle, J. R. (1996) Curr.

Opin. Cell Biol. 8, 106-119

17. Field, C. M., and Kellogg, D. (1999) Trends Cell Biol. 9, 387-

394

18. Chung, C. D., Liao, J., Liu, B., Rao, X., Jay, P., Berta, P., Shuai,

K. (1997) Science 278, 1803-1805

19. Takahashi, Y., Toh-e, A., and Kikuchi, Y. (2001) Gene in press

20. James, P., Halladay, J., and Craig, E. A. (1996) Genetics 144,

1425-1436

21. Kaiser, C., Michaelis, S., and Mitchell, A. (1994) in Methods in

Yeast Genetics (Cold Spring Harbor Laboratory Press, Cold

Spring Harbor, NY.

22. Sasaki, T., Toh-e, A., and Kikuchi, Y. (2000) Mol. Cell. Biol.

20, 7971-7979

23. Nishida, T., Tanaka, H., and Yasuda, H. (2000) Eur. J. Biochem.,

267, 6423-6427

24. Okuma, T., Honda, R., Ichikawa, G., Tsumagari, N., and Yasuda,

H. (1999) Biochem. Biophy. Res. Comm. 254, 693-698

FIGURE LEGENDS

FIG. 1. The Ring-like domain of Ull1 is essential for

septin-sumoylation. A , Schematic structure of Ull1 and amino acid

sequence of its Ring-like domain. The Ring-like domain (from 352th to

409th amino acid) and a potential CDK target site (marked by asterisk)

of Ull1 are shown. The cysteine residue-361, -377, or -400 within the

Ring-like domain was changed to serine. The region (from 327th to 465th

amino acid) containing the Ring-like domain, used for the two-hybrid

by guest on Decem

ber 28, 2018http://w

ww

.jbc.org/D

ownloaded from

system and binding assay, is shown as a box. B, Mutational analysis of

the Ring-like domain of Ull1. Cells of T-20 (ull1 CDC3HA) were

transformed with low-copy plasmid pT-23 (ULL1), pT-24 (ull1C361S),

pT-25 (ull1C400S), pT-26 (ull1C377S, C400S), pT-27 (ull1S460C) or vector (C;

control), and the transformants were arrested at G2/M with 15 µg/ml

nocodazole. Cell lysates were prepared and subjected to

immunoblotting. Cdc3 was probed with α-HA. The α-PSTAIRE

staining (lower panels) serves as internal control for loading. C, Protein

level of ull1 mutants. The ull1 disruptant (T-13) was transformed with a

low-copy plasmid pT-17 (HA-tagged ULL1), pT-29 (HA-tagged

ull1C361S), pT-18 (HA-tagged ull1C377S), pT-30 (HA-tagged ull1C361S, C400S),

pT-31 (HA-tagged ull1C377S, C400S), pT-32 (HA-tagged ull1S460C), or

pTS901CL vector (C; control). Cell lysates of the transformants were

prepared and immunoblotting was performed, using α-HA. A non-

specific band is marked by asterisk. Equal loading of each sample was

confirmed by α-PSTAIRE staining (lower panel). D, Excess amount of

the mutant protein did not fully recover the septin-sumoylation. Cells of

T-20 (ull1 CDC3HA) were transformed with low-copy plasmid pT-20

(myc-tagged ULL1) or pT-21 (myc-tagged ull1C377S), and multi-copy

plasmid pT-33 (myc-tagged ULL1) or pT-34 (myc-tagged ull1C377S).

Cell lysates were prepared and subjected to immunoblotting. Cdc3 and

Ull1 were probed with α-HA and α-myc, respectively. Equal loading of

each sample was confirmed by α-PSTAIRE staining. SE; short

exposure, LE; long exposure.

FIG. 2. Ull1 is required for in vitro Smt3-conjugation to

Cdc3. A, Preparation of recombinant proteins for in vitro assay. The

proteins prepared for the in vitro system, were subjected to SDS-PAGE

and the gels were stained with Coomassie Brilliant Blue. Loaded

by guest on Decem

ber 28, 2018http://w

ww

.jbc.org/D

ownloaded from

samples are; 6.3 µg GST, 3.9 µg GST-Smt3, 0.4 µg Smt3 (* indicates a

break-down product of Smt3), 1.2 µg E1-complex (His-Uba2, GST-

Sua1. * indicates GST co-purified from Sf-9 cells), 1.0 µg E2 (T7-

hUbc9), 0.8 µg T7-Cdc3-His, 0.08 µg GST-Ull1 and 0.08 µg GST-

ull1C377S. Each component is marked by an arrowhead. B, The Smt3-

conjugation to Cdc3 requires Ull1 in vitro and the cysteine-377 of Ull1

is essential for the modification. The complete reaction mixture contains

0.5 µg E1-complex (GST-Sua1/His-hUba2), 0.02 µg E2 (T7-hUbc9),

0.04 µg GST-Ull1, 0.8 µg T7-Cdc3-His and 1.0 µg GST-Smt3. +,

presence of the factor; -, absence of the factor; G, 1.0 µg GST was

added instead of GST-Smt3; S, 0.5 µg Smt3 was added instead of GST-

Smt3; M, 0.04 µg GST-ull1C377S mutant protein was added instead of

GST-Ull1. Various reaction mixtures as indicated, were incubated with

3.3 mM ATP and 2 mM DTT at 25℃ for 40 min, and were subjected to

immunoblotting. Cdc3 was probed with α-T7. The right-side panel

shows various control experiments with (+), or without (-) incubation in

the buffer containing ATP. Molecular weights of marker proteins are

shown in the leftside of the figure. Non-specific bands are marked by

asterisks. C, The conjugation is NEM sensitive. The reaction mixtures

contained all the components with (+) or without (-) 2 mM DTT or 5

mM NEM, as indicated.

FIG. 3. The Ring-like domain of Ull1 interacts with Ubc9

and Cdc3. A & B. Two-hybrid interaction. Yeast strain PJ69-4A was

co-transformed with pT-22 (pGBDU-Ring-like domain), pT-37

(pGBDU-Ring-like domainC377S) or pGBDU-vector, together with

various GAD-plasmids; pGAD-hSUMO1 (pGAD424-hSUMO1), pGAD-

mUbc9 (pACT-mUbc9), pT-38 (pGAD-Ubc9), pT-39 (pGAD-Smt3) or

pGAD-vector. The transformants were streaked on a minimal plate

by guest on Decem

ber 28, 2018http://w

ww

.jbc.org/D

ownloaded from

lacking histidine, uracil and leucine, and incubated at 30℃ for 3 days.

C. In vitro binding assay. GST and GST-tagged Ring-like domain of

Ull1 were bound to Glutathione Sepharose 4B beads. E. coli lysate

containing T7-Ubc9 or T7-Cdc3, as well as untagged control lysate, was

incubated with those beads. After washing, bound proteins were

subjected to immunoblotting. Ubc9 and Cdc3 were probed with α-T7

(lanes 1-9). GST and GST-Ring-like domain were probed with α-GST

(lanes 10-17). Lane 1, total lysate of untagged control; 2, total lysate of

T7-Ubc9; 3, total lysate of T7-Cdc3; 4, 11, GST-beads plus untagged

lysate; 5, 12, GST-beads plus T7-Ubc9 lysate; 6, 13, GST-beads plus

T7-Cdc3 lysate, 7, 15, GST-Ring-beads plus untagged lysate; 8, 16,

GST-Ring-beads plus T7-Ubc9 lysate; 9, 17, GST-Ring-beads plus T7-

Cdc3 lysate; 10, total lysate of GST; 14, total lysate of GST-Ring.

by guest on Decem

ber 28, 2018http://w

ww

.jbc.org/D

ownloaded from

L

T T ST

IM

SL

Q

CPISYTRM

KY

PS

K S

I

N

C

K

HLQ

CFDALWFL

S QL

QI

P

T

W

Q

CPVC

QIDI

A

Zn

Zn

S

377

361

400

S

S

1 904Ull1/Siz1

Ring-like-domain352 409

465327*

H

A

Takahashi Y, et al Fig. 1A

by guest on Decem

ber 28, 2018http://w

ww

.jbc.org/D

ownloaded from

by guest on Decem

ber 28, 2018http://w

ww

.jbc.org/D

ownloaded from

- + + +- - + -+ + + -

　　Ull1mM NEMmM DTT

Smt3-Cdc3

Cdc3

-T7 Takahashi Y, et al Fig. 2A, B, C22

C

A

B

lane 9 10 11 12 13 14 15-T7

E1+E2GST-Ull1T7-Cdc3-HisGST-Smt3Buf.+ATP+Inc.

- - - - - - +- + - - + - ++ - - + - - +- - + - - + +- - - + + + +

**

- + + + + + + ++ - + + + + + ++ + - + + + + M+ + + - + + + ++ + + + G + S +

66k

97k116k

200k

Cdc3Smt3-Cdc3GST-Smt3-Cdc3

lane 1 2 3 4 5 6 7 8-T7

45k

66k

97k116k

200k

GS

T-u

ll1(C

377S

)

GS

T-U

ll1 (

WT

)

T7-

Cdc

3-H

is

12ST-Ull17-Cdc3-HisST-Smt3

8k

14k

21k

31k

45k

97k66k

E1-

com

plex

E2

Sm

t3

GS

T-S

mt3

GS

T

*

*

**

GST-Smt3-Cdc3

Cdc3

by guest on Decem

ber 28, 2018http://w

ww

.jbc.org/D

ownloaded from

by guest on Decem

ber 28, 2018http://w

ww

.jbc.org/D

ownloaded from

Yoshimitsu Takahashi, Tomoaki Kahyo, Akio Toh-e, Hideyo Yasuda and Yoshiko Kikuchian adaptor between conjugating enzyme and substrates

Yeast Ull1/Siz1 is a novel SUMO1/Smt3-ligase for septin components and functions as

published online September 27, 2001J. Biol. Chem. 

  10.1074/jbc.M109295200Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

by guest on Decem

ber 28, 2018http://w

ww

.jbc.org/D

ownloaded from