Genetic modifications within Genetic modifications within TLR4 TLR4 and and TLR9 TLR9 genes contribute into genes contribute into congenital toxoplasmosis and congenital toxoplasmosis and cytomegaly development cytomegaly development Wioletta Wujcicka Wioletta Wujcicka 1 1 , Jan Wilczyński , Jan Wilczyński 1,2 1,2 , Dorota , Dorota Nowakowska Nowakowska 1,2 1,2 1 Department of Fetal-Maternal Medicine and Gynecology, Polish Department of Fetal-Maternal Medicine and Gynecology, Polish Mother's Memorial Hospital Research Institute, Lodz, Poland; Mother's Memorial Hospital Research Institute, Lodz, Poland; 2 Department of Fetal-Maternal Medicine and Gynecology, III Department of Fetal-Maternal Medicine and Gynecology, III rd rd Chair of Chair of Gynecology and Obstetrics, Medical University of Lodz Gynecology and Obstetrics, Medical University of Lodz 3rd International Conference on Clinical 3rd International Conference on Clinical Microbiology and Microbial Genomics Microbiology and Microbial Genomics Valencia, Spain Valencia, Spain September 24 September 24 th th - - 26 26 th th 2014 2014
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Genetic modifications within Genetic modifications within TLR4TLR4 and and TLR9TLR9 genes genes contribute into congenital toxoplasmosis and contribute into congenital toxoplasmosis and
cytomegaly developmentcytomegaly development
Wioletta WujcickaWioletta Wujcicka11, Jan Wilczyński, Jan Wilczyński1,21,2, Dorota Nowakowska, Dorota Nowakowska1,21,2
11 Department of Fetal-Maternal Medicine and Gynecology, Polish Mother's Memorial Department of Fetal-Maternal Medicine and Gynecology, Polish Mother's Memorial Hospital Research Institute, Lodz, Poland; Hospital Research Institute, Lodz, Poland; 22 Department of Fetal-Maternal Medicine and Department of Fetal-Maternal Medicine and Gynecology, IIIGynecology, IIIrdrd Chair of Gynecology and Obstetrics, Medical University of Lodz Chair of Gynecology and Obstetrics, Medical University of Lodz
3rd International Conference on Clinical Microbiology 3rd International Conference on Clinical Microbiology and Microbial Genomicsand Microbial GenomicsValencia, SpainValencia, Spain September 24 September 24thth-26-26thth 2014 2014
T. gondiiT. gondii and HCMV infections within pregnancy and HCMV infections within pregnancy
CCommon cause of intrauterine infectionsommon cause of intrauterine infections
T. gondii T. gondii seroprevalence between 4% and 100% with seroprevalence between 4% and 100% with values over 60% in Central and values over 60% in Central and South America,South America, Africa and Asia Africa and Asia
HCMV prevalence between 40% and 100% dependent on the continents and countriesHCMV prevalence between 40% and 100% dependent on the continents and countries
Pappas G. (2009) Int J Parasitol. 39: 1385-1394
http
://scienceray.co
m/b
iolo
gy/th
e-parasite-to
xop
lasma-g
on
dii/
Role of TLRs in immune responseRole of TLRs in immune response
Transduction of signals from PAMPs to the cell interior, activation of these cells and the first line of host defense against pathogens
Important molecules activating and inducing both innate and adaptive immune response
Mis
ch E
A an
d H
awn
TR. (
2008
) Clin
Sci
. 114
(5):3
47-6
0
Ho J et al. (2004) Tannaffos. 3(11):7-14
Contribution of TLR2, TLR4 and TLR9 Contribution of TLR2, TLR4 and TLR9 in the immunity against in the immunity against T. gondiiT. gondii
Wujcicka W et al. (2013) Eur J Clin Microbiol Infect Dis. 32(4): 503-511
TLRs activity in the immune response TLRs activity in the immune response against HCMV against HCMV
Wujcicka W et al. (2014) Pathog Dis. Dis. 70(1):3-1670(1):3-16
Aims of study:Aims of study:
DDeterminetermination ofation of a distribution of genotypes at a distribution of genotypes at TLR4TLR4 and and TLR9TLR9 polymorphic polymorphic sites in fetuses and newborns congenitally infected with sites in fetuses and newborns congenitally infected with T. gondiiT. gondii
Comparison ofComparison of the genotypic profiles at the genotypic profiles at TLRTLR SNPs between the offsprings SNPs between the offsprings with congenital toxoplasmosis and cytomegalywith congenital toxoplasmosis and cytomegaly
Materials and Methods: Collection of clinical Materials and Methods: Collection of clinical specimens from fetuses and newbornsspecimens from fetuses and newborns
Eighteen (18)Eighteen (18) fetuses and newborns with congenital fetuses and newborns with congenital toxoplasmosis and 41 control cases without toxoplasmosis and 41 control cases without T. gondiiT. gondii intrauterine infectionintrauterine infection
Samples collected Samples collected retrospectively (15 retrospectively (15 T. gondiiT. gondii infected infected cases and 23 controls) cases and 23 controls) and and prospectively (three prospectively (three T. gondiiT. gondii infected cases and 18 controls)infected cases and 18 controls)
Fifteen (Fifteen (1515)) fetuses and newborns with fetuses and newborns with HCMV HCMV infection infection and 18 control cases of HCMV-seronegative statusand 18 control cases of HCMV-seronegative status
http
://pro
top
las
mix
.wo
rdp
res
s.c
om
/tag
/tox
op
las
ma
-go
nd
ii/
Classification of clinical specimens for Classification of clinical specimens for molecular studiesmolecular studies
Serological screeningSerological screening::
Screening for Screening for T. gondiiT. gondii IgG and IgM IgG and IgM antibodies as well as IgG avidity performed antibodies as well as IgG avidity performed with an enzyme-linked fluorescent assay with an enzyme-linked fluorescent assay (ELFA) (Vidas Toxo IgG II; IgM; or IgG (ELFA) (Vidas Toxo IgG II; IgM; or IgG Avidity, bioMérieux, France)Avidity, bioMérieux, France)
HCMV screening with HCMV screening with Eti-Cytok G-Plus and Eti-Cytok G-Plus and Eti-Cytok M-Reverse Plus tests Eti-Cytok M-Reverse Plus tests (Diasorin/Biomedica, Italy) (Diasorin/Biomedica, Italy) used used between between 2000 and 2001, VIDAS CMV IgG and IgM tests 2000 and 2001, VIDAS CMV IgG and IgM tests (bioMérieux, France) between 2001 and 2006, (bioMérieux, France) between 2001 and 2006, anti-CMV IgG and IgM tests anti-CMV IgG and IgM tests (Diasorin/Biomedica, Italy) between 2006 and (Diasorin/Biomedica, Italy) between 2006 and 2011 years and ELFA assays from 2012 year2011 years and ELFA assays from 2012 year
Clinical symptoms observed in pregnant Clinical symptoms observed in pregnant women and their fetuseswomen and their fetuses::
Flu-like symptoms in mothersFlu-like symptoms in mothers
UUltrasound markers in fetusesltrasound markers in fetuses with with toxoplasmosis:toxoplasmosis:
hydrocephalus, chorioretinitis, cerebralhydrocephalus, chorioretinitis, cerebral calcification and strokecalcification and stroke, as well as , as well as microcephaly, hepatosplenomegaly, fetal microcephaly, hepatosplenomegaly, fetal hydrops and IUGR hydrops and IUGR
UUltrasound markers in fetusesltrasound markers in fetuses with with cytomegaly: cytomegaly:
ventriculomegaly, hydrocephalus and fetalventriculomegaly, hydrocephalus and fetalhydropshydrops as well as IUGR, ascites, as well as IUGR, ascites, pericardial effusion, cardiomegaly and pericardial effusion, cardiomegaly and the the presence of hyperechogenic foci in different presence of hyperechogenic foci in different organs likeorgans likethe fetal brain, liver and pancreasthe fetal brain, liver and pancreas
Detection and quantification of Detection and quantification of T. gondiiT. gondii and and HCMV DNAHCMV DNA
LocusGene Sequences of primers and probe (5' →3’) GenBank Annealing
temperature (oC)PCR product
(bp)
AF 179871B1
CAAGCAGCGTATTGTCGAGTAGATGCGTCTCTTTCATTCCCACATTTT
6-FAM- CAGAAAGGAACTGCATCCGTT-NFQ
AF 179871 60 83
Amplification of HCMV Amplification of HCMV UL55UL55 gene fragments of 150 bp using primers and probes of gene fragments of 150 bp using primers and probes of the following sequences: the following sequences: 5’-GAGGACAACGAAATCCTGTTGGGCA-3’, 5’-GAGGACAACGAAATCCTGTTGGGCA-3’,
5’-TCGACGGTGGAGATACTGCTGAGG-3’, and5’-TCGACGGTGGAGATACTGCTGAGG-3’, and 5’-6-FAM-CAATCATGCGTTTGAAGAGGTAGTCCA-TAMRA-3’5’-6-FAM-CAATCATGCGTTTGAAGAGGTAGTCCA-TAMRA-3’
Genotyping of SNPs located at Genotyping of SNPs located at TLR4TLR4 and and TLR9TLR9 genesgenes
Sequencing of randomly selected PCR products for distinct genotypes at Sequencing of randomly selected PCR products for distinct genotypes at TLR4TLR4 896 A>G, 896 A>G, TLR4TLR4 1196 C>T and 1196 C>T and TLR9TLR9 1635 G>A SNPs 1635 G>A SNPs
GeneGene SNP nameSNP name Primer sequences (5'-3')Primer sequences (5'-3')Annealing Annealing
Agarose gel electrophoresis of PCR-RFLP products for profiling of genotypes at Agarose gel electrophoresis of PCR-RFLP products for profiling of genotypes at TLR4TLR4 896 A>G SNP ( 896 A>G SNP (AA), ), TLR4TLR4 1196 C>T SNP ( 1196 C>T SNP (BB) and ) and TLR9TLR9 1635 G>A SNP ( 1635 G>A SNP (CC))
Results: Products of multiplex nested PCR-RFLP Results: Products of multiplex nested PCR-RFLP analysis of analysis of TLR4TLR4 and and TLR9TLR9 SNPs SNPs
Chromatograms for DNA fragments encompassing Chromatograms for DNA fragments encompassing TLR4TLR4 896 A>G SNP ( 896 A>G SNP (A, BA, B), ), TLR4TLR4 1196 1196 C>T SNP (C>T SNP (C, DC, D) and ) and TLR9TLR9 1635 G>A SNP ( 1635 G>A SNP (E-GE-G))
Sequencing of the selected amplicons for Sequencing of the selected amplicons for TLR4TLR4 and and TLR9TLR9 SNPs SNPs
Relationship between Relationship between TLRTLR polymorphisms and polymorphisms and congenital toxoplasmosis congenital toxoplasmosis
Gene polymorphismGene polymorphism Genetic modelGenetic model GenotypeGenotype
Genotype frequencies; n (%)Genotype frequencies; n (%)aa
aa n, number of tested fetuses and newborns; n, number of tested fetuses and newborns; bb OR, odds ratio; OR, odds ratio; cc 95% CI, confidence interval; 95% CI, confidence interval; dd logistic regression logistic regression model;model; P P≤0.050 is considered as significant≤0.050 is considered as significant
Frequencies of alleles at Frequencies of alleles at TLR4TLR4 and and TLR9TLR9 SNPs SNPs
Gene polymorphismGene polymorphismNo.No.aa of carriers with of carriers with TLRTLR alleles (%) alleles (%)
aa No., number; No., number; bb Pearson's Chi-squared test; P ≤ 0.050 is considered as significant Pearson's Chi-squared test; P ≤ 0.050 is considered as significant
Genotypic profiles at Genotypic profiles at TLR4TLR4 and and TLR9TLR9 SNPs in SNPs in congenital toxoplasmosis and cytomegalycongenital toxoplasmosis and cytomegaly
Significantly less frequent GC Significantly less frequent GC haplotype at haplotype at TLR4TLR4 SNPs in congenital SNPs in congenital toxoplasmosis than in cytomegaly (toxoplasmosis than in cytomegaly (PP≤0.0001)≤0.0001)
GC haplotype at GC haplotype at TLR4TLR4 SNPs and multiple GCG genotypes at SNPs and multiple GCG genotypes at TLR4TLR4 and and TLR9TLR9 SNPs significantly more frequent in SNPs significantly more frequent in congenitally congenitally infected than infected than control cases (control cases (PP≤0.0001)≤0.0001)
ConclusionsConclusions
Genetic modifications within Genetic modifications within TLR4TLR4 and and TLR9TLR9 genes might genes might contribute to congenital toxoplasmosis and cytomegalycontribute to congenital toxoplasmosis and cytomegaly
Thank You for Your attention!Thank You for Your attention!