Use of genetics in species-level taxonomy Pete Hollingsworth Royal Botanic Garden Edinburgh GCTTCACATTTTAACGCACATGACGTGTCACAGAACGAGTGCCTACGTCGAGCAATTAGATAATAC GCTTCACACATTAACGCACATTTCGTGTCACAGAACGAGTGCCTACGTCGAGCAATTAGCCAATAC GCCTCACACATTAACGCACATTTCGTGTCACAGAACGAGTGCCTACGTCGAGCAATTAGAGAAGAC GCTTCATACATTAACGCACATGACGTGTCACAGAACGAGTGCCTACGTCGAGCAATTAGAGAATAC
23
Embed
Use of genetics in species- level taxonomy Pete Hollingsworth Royal Botanic Garden Edinburgh GCTTCACATTTTAACGCACATGACGTGTCACAGAACGAGTGCCTACGTCGAGCAATTAGATAATAC.
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
• Application of multiple techniques to solve taxonomic problems in difficult groups– Individual solutions for individual problems– Our capacity to do this is getting much better...
• Can we use massive scale DNA sequencing of biodiversity to create a unified database of life?
• DNA barcoding: sequence one (or a few) ‘standard’ short stretches of DNA– Individuals of a species should be more similar in DNA sequence, than they
are to individuals of other species
• Establish reference database of high quality sequences from well identified material (supported by voucher specimens)– Take some tissue, sequence it, find out what it is, and what is known about it
• Provide a mechanism for speeding up the process of characterising biodiversity– Identification of unknown specimens to known species– Assist in the discovery of new species
• Approach not novel…..scale and coordination is……
This pioneering effort in DNA barcoding will set in motion the single most significant project in biology that I know today
Dan Janzen (2003)
“DNA barcoding generates information, not knowledge”
“…..the practice is counterproductive to furthering our understanding of life”
Ebach & Holdrege (2005) Nature 434, 697
“the noisome weed of DNA barcoding”Will et al. (2005) Syst. Biol. 54, 844–851
“an excursion into futility”Wheeler (2005) Cladistics 21, 405–407
What are these objections based on? • It won’t work in all groups• A sequence from a single locus is inadequate for describing new species• It is not as intellectually ‘worthwhile’ as detailed taxonomic research• It might draw attention away from traditional taxonomy/understanding organisms
Proposed solutions:Chase et al (2007): rpoC1 + rpoB + matK(Taxon 56, 295-299) rpoC1 + matK + trnH-psbA
Kim et al (2007): matK + atpF-H + psbK-I (unpublished) matK + atpF-H + trnH-psbA
Kress/Erickson (2007): rbcL + trnH-psbA(PLoS ONE 2, e508 )
Lahaye et al. (2008): matK (PNAS 105, 2923–2928Nature Precedings http://hdl.handle.net/10101/npre.2008.1896.1)
Plant working group (2007) matK + trnH-psbA + atpF-H (minutes of Taipei meeting)
Chloroplast barcode - will not discriminate between hybrids and their parents
A broadly applicable tool, rather than targeted at complex groups
• Species discrimination asymptotes at ca 70-75%Remaining species identified to “species groups”
• Adding >2 chloroplast loci on average leads to diminishing returns of discrimination
1 locus 2 locus 3 locus
80%
70%
60%
50%
40%
What is the likely discriminatory power of a plant barcode?
Predictions of plastid barcoding success
• High
• Recent radiation
• Agamosperms
• Heavily split micro-species
• Long-lived trees
• Poor
• Hybridisation and/or polyploidy frequency
• Species age
• Reproductive mode
• Taxonomic splitting
• Life-history
• Seed dispersal(angiosperms)
• Low
• More ancient divergence
• Sexuals
• Not-over split
• Herbs
• Good
Low High
LAND PLANTS• c. 400,000 species
VASCULAR PLANTS• > 350,000 species• c. 13,888 genera• c. 511 families
Using a plant
barcode
Applications of plant barcoding• Identification of CITES protected materials
– Ogden et al. (2008) Endang Species Res 9: 255–261
• Identification of plant material in diets– Jurado-Rivera et al. (2009) Proc R Soc Biol Sci SerB 276: 639-648
• Identification of fern gametophytes– Schneider et al. (2006) Molecular Ecology Resources 6: 989-991– Squirrell et al. unpublished
• Identification of invasive species– Van de Wiel et al. (2009) Molecular Ecology Resources 9: 1086-1091
• Identification of plants in horticultural trade– Pryer et al. (2010) Molecular Ecology Resources: online early
• Identification of herbal medicine components– Baker and Little, Scientific American online ‘Observations’ 18/4/2010
• Cryptic species discovery in orchids – Lahaye et al. (2008) PNAS 105: 2923-2928
• Species identification and discovery in liverworts– Hollingsworth et al. (2009) Molecular Ecology Resources 9: 439-457 and unpublished
Bryophyte identification is difficult and there is a shortage of experts
Develop system for rapid low-cost identification and species discovery
New species, Distinct ecology & morphology
H. borealisHerbertus
rbcLmatK+ trnH-psbA+ ITS
Aneura sp. nov.
Cryptothallus (=Aneura) mirabilis
Typical Aneura pinguis
Barcoding of Aneura pinguis in UK has led to one new species being described, and identification of another four candidate new species
Barcoding Aneura
Major Barcoding Projects• iBoL– 500K species, 5 million specimens by 2015– 100K species of plants
• Many research groups with active plant barcoding projects
• Tree-BoL: Barcoding all trees• Grass-BoL: Barcoding all grasses• Flora of Kruger National Park, • Flora of Area de Conservacion
Guanacaste Costa Rica• British liverworts and UK BAP mosses• Flora of Korea• Plant barcoding China• Various medicinal plant projects• ‘All plant genera’
• Where we were (1990-2010)– Individual taxon studies
• Small numbers of well-characterised genetic markers• Large numbers of poorly-characterised markers
• Where we are– High throughput coordinated sequencing of a small
number of DNA regions in lots of taxa (DNA barcoding)– Individual taxon studies using higher numbers of well
characterised markers
• Where we would like to be (2015 onwards)– High throughput sequencing of lots of well characterised
DNA regions in lots of taxa
• Establishing the reference database (field collections, herbarium vouchers, determinations) will be the rate limiting step– Important to commence this process now and establish “DNA
ready” herbaria for future improvements in sequencing technologies
• Vast quantities of DNA sequence data divorced morphological and ecological information will be meaningless– Integration with taxonomy and ecology, not replacement