Integrated DNA Technologies Understanding Variations in Oligonucleotide OD and Yield CHIA Jin Ngee Click icon to add picture
Aug 28, 2014
Integrated DNA Technologies
Understanding Variations in Oligonucleotide OD and YieldCHIA Jin Ngee
Click icon to add picture
Terminology
Scale is the starting amount of material nanomoles (nmol)
Yield is the delivered amount of material nanomoles (nmol) OD units
OD (optical density) is a measure of concentration
Areas of Confusion
1 OD of single-stranded DNA = 33 µg/mL True for large single-stranded DNA 1 kb and longer
Why does this not apply to short oligonucleotides? Each base exerts an influence on the overall absorbance Each neighboring base exerts an influence on the overall absorbance Each oligonucleotide is custom made and has a unique sequence Therefore, what constitutes 1 OD is unique for each oligonucleotide
What is Absorbance or OD?
Beer-Lambert Law
is absorbance (or optical density (OD))
is absorption coefficient is concentration (M) is molar extinction coefficient is path length
Molar Extinction Coefficient for Oligonucleotides
Nearest-neighbor method For sequence: 5 –dATGCTTC–3′ ′
ƐdATGCTTC = ƐdApdT + ƐdTpdG + ƐdGpdC + ƐdCpdT + ƐdTpdT + ƐdTpdC - ƐpdT - ƐpdG - ƐpdC - ƐpdT - ƐpdT
Wavelength of 260 nm, neutral pH General constant extinction coefficient for single-stranded DNA
33 ng-cm/µL* Use IDT OligoAnalyzer® program to determine the value of 1 OD
http://sg.idtdna.com/analyzer/Applications/OligoAnalyzer/
*Some instruments use this constant extinction coefficient by default
Molar Extinction Coefficient for BasesDNA RNA
Stack or monomer Extinction coefficient Stack or monomer Extinction coefficientpdA 15400 pA 15400pdC 7400 pC 7200pdG 11500 pG 11500pdT 8700 pU 9900dApdA 27400 ApA 27400dApdC 21200 AdC 21000dApdG 25000 ApG 25000dApdT 22800 ApU 24000dCpdA 21200 CpA 21000dCpdC 14600 CpC 14200dCpdG 18000 CpG 17800dCpdT 15200 CpU 16200dGpdA 25200 GpA 25200dGpdC 17600 GpC 17400dGpdG 21600 GpG 21600dGpdT 20000 GpU 21200dTpdA 23400 UpA 24600dTpdC 16200 UpC 17200dTpdG 19000 UpG 20000dTpdT 16800 UpU 19600
Sequence-Influenced OD Results
Name GC+AT=Length Sequence Mol.
wt Ɛ nmol/OD µg/OD
50/50 mix 10+10=20 AGAGAGAGAGAGAGAGAGAG 6362.2 23470
0 4.26 27.11
50/50 separated 10+10=20 AAAAAAAAAAGGGGGGGGG
G 6362.2 223900 4.47 28.42
Actin B F 10+10=20 TTGCTGACAGGATGCAGAAG 6206.1 20050
0 4.99 30.95
Actin B R 10+10=20 TGATCCACATCTGCTGGAAG 6117.0 19080
0 5.24 32.06
Tubb5 F 11+10=21 GATCGGTGCTAAGTTCTGGGA 6517.3 20590
0 4.86 31.65
Tubb5 R 11+10=21 AGGGACATACTTGCCACCTGT 6406.2 19930
0 5.02 32.14
Variation Due to Calculation Method Used
Assume absorbance = 1.0 and path length = 1.0 cm
Nearest neighbor ConstantSequence (5 –3 )′ ′
AGAGAGAGAGAGAGAGAGAG 4.26 27.11 5.81 33.00AAAAAAAAAAGGGGGGGGGG 4.47 28.42 5.81 33.00
TTGCTGACAGGATGCAGAAG 4.99 30.95 5.32 33.00TGATCCACATCTGCTGGAAG 5.24 32.06 5.39 33.00
GATCGGTGCTAAGTTCTGGGA 4.86 31.65 5.06 33.00
AGGGACATACTTGCCACCTGT 5.02 32.14 5.15 33.00
OD Unit
Mass of oligo present 1 OD = mass of oligo in 1 mL neutral pH solution measured in a cell with 1 cm
path length Example: 5 –′ TTGCTGACAGGATGCAGAAG–3′
Delivery of Same sequence as above, but in reverse:
5 –GAAGACGTAGGACAGTCGTT–3′ ′ (from OligoAnalyzer tool) Therefore, delivery of
Variation Due to Instruments
A major source of variation IDT calibrates spectrophotometers regularly Variations between our measurements and customers’ are always
observed Despite using the same nearest neighbor method
20–30% variation between IDT readings and yours
Yield
Yield is calculated from OD Variation between your measured and calculated OD and ours
Yield is based on OD; therefore, variations are due to the OD measurements For more details, see the article:
“Oligo Quantification—Getting it Right” in DECODED 3.1 (January 2013 issue) at www.idtdna.com/decoded
Conclusions
OD variation will always exist between us and you due to differences in instruments used
Do not be alarmed at these variations What if your OD determinations reveal a very large variation?
Contact us: [email protected] Chat with us through our webpage www.idtdna.com Call us at +65 6775 9187 (IDT Asia)
Follow Us!
pinterest.com/idtdna