Transcription Factor-Mediated Regulation of ...

DMD #43877

1

Transcription Factor-Mediated Regulation of Carboxylesterase Enzymes in Livers

of Mice

Youcai Zhang, Xingguo Cheng, Lauren Aleksunes, and Curtis D. Klaassen

Department of Pharmacology, Toxicology, and Therapeutics, University of Kansas

Medical Center, 3901 Rainbow Boulevard, Kansas City, KS, 66160, USA (Y.Z., X.C.,

L.A., and C.D.K)

DMD Fast Forward. Published on March 19, 2012 as doi:10.1124/dmd.111.043877

Copyright 2012 by the American Society for Pharmacology and Experimental Therapeutics.

This article has not been copyedited and formatted. The final version may differ from this version.DMD Fast Forward. Published on March 19, 2012 as DOI: 10.1124/dmd.111.043877

at ASPE

T Journals on N

ovember 11, 2021

dmd.aspetjournals.org

Dow

nloaded from

http://dmd.aspetjournals.org/

DMD #43877

2

Running title: Chemical regulation of mouse carboxylesterases

Corresponding to: Curtis D. Klaassen, Ph.D.

Department of Pharmacology, Toxicology, and Therapeutics

University of Kansas Medical Center

3901 Rainbow Boulevard

Kansas City, KS 66160

Phone: 1-913-588-7714

Fax: 1-913-588-7501

E-mail: [email protected]

Text pages: 35

Tables: 1

Figures: 7

References: 51

Words in the Abstract: 243

Words in the Introduction: 667

Words in the Discussion: 1480

Abbreviations: AhR, aryl hydrocarbon receptor; bDNA, branched DNA signal amplification assay; BHA, butylated hydroxyanisole; BNF, β-naphthoflavone; CAR, constitutive androstane receptor; CES, carboxylesterase; CLOF, clofibric acid; CPFB, ciprofibrate; DAS, diallyl sulfide; DEHP, diethylhexylphthalate; DEX, dexamethasone; ETH, ethoxyquin; Gapdh, glyceraldehydes-3-phosphate dehydrogenase; GR, glucocorticoid receptor; HNF4α, hepatocyte nuclear factor-4-alpha; IL, interleukin; MEI, microsomal enzyme inducer; Nqo1, NAD(P)H:quinone oxidoreductase 1; Nrf2, nuclear factor erythroid 2-related factor 2; OPZ, oltipraz; PB, phenobarbital; PCB126, polychlorinated biphenyl 126; PCN, pregnenolone-16α-carbonitrile; PXR, pregnane X receptor; PPARα, peroxisome proliferator activated receptor alpha; RLUs, relative light

units; SPR, spironolactone; TCDD, 2,3,7,8-tetrachlorodibenzo-p-dioxin; TCPOBOP, 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene; WT, wild-type.


at ASPE

T Journals on N

ovember 11, 2021


Dow

nloaded from


DMD #43877

3

Abstract

The induction of drug-metabolizing enzymes by chemicals is one of the major reasons

for drug-drug interactions. In the present study, the regulation of the mRNA expression

of one arylacetamide deacetylase (Aadac) gene and eleven carboxylesterase (Ces)

genes by fifteen microsomal enzyme inducers (MEIs) was examined in livers of male

C57BL/6 mice. The data demonstrated that mRNA of Aadac is suppressed by three aryl

hydrocarbon receptor (AhR) ligands, two constitutive androstane receptor (CAR)

activators, two pregnane X receptor (PXR) ligands, and one nuclear factor erythroid 2-

related factor 2 (Nrf2) activator. The mRNA of Ces1 subfamily is not altered by most of

the MEIs, whereas the mRNA of Ces2 subfamily is readily induced by the activators of

CAR, PXR, and Nrf2, but not peroxisome proliferator activated receptor alpha (PPARα).

Studies using null mice demonstrated that: 1) AhR is required for the 2,3,7,8-

tetrachlorodibenzo-p-dioxin (TCDD)-mediated suppression of Aadac and Ces3a; 2)

CAR is involved in the 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene (TCPOBOP)-mediated

induction of Aadac, Ces2c, 2a, and 3a; 3) PXR is required for the pregnenolone-16α-

carbonitrile (PCN)-mediated induction of Aadac, Ces2c, and 2a; 4) Nrf2 is required for

the oltipraz (OPZ)-mediated induction of Ces1g and 2c; and 5) PXR is not required for

the DEX-mediated suppression of Cess in livers of mice. In conclusion, the present

study systematically investigated the regulation of Cess by MEIs in livers of mice, and

demonstrated that MEIs modulate mRNA expression of mouse hepatic Cess via the

activation of AhR, CAR, PXR, and/or Nrf2 transcriptional pathways.


at ASPE

T Journals on N

ovember 11, 2021


Dow

nloaded from


DMD #43877

4

Introduction

Carboxylesterases (rodents: Cess; human:CESs) catalyze the hydrolysis of many

ester- and amide-containing chemicals, as well as drugs and prodrugs, to their

respective free acids (Satoh and Hosokawa, 1998). Based upon the extent of amino

acid homology and substrate selectivity, Satoh and Hosokawa classified the CES/Ces

enzymes across species into five groups, and revealed that the majority of identified

CES/Ces enzymes belong to either the CES1 or CES2 subfamily (Satoh and Hosokawa,

1998; Satoh and Hosokawa, 2006). Arylacetamide deacetylase (rodents: Aadac;

human: AADAC) is an important enzyme in the metabolic activation of arylamine

substrates to ultimate carcinogens, and also functions as a microsomal lipase during

lipoprotein secretion (Probst et al., 1994; Trickett et al., 2001). AADAC/Aadac was

categorized into CES5 family, with a structure different from other four CES families

(Satoh and Hosokawa, 2006; Hosokawa et al., 2008).

Due to the confusion in naming rodent Ces genes, a new nomenclature system

has been recommended for the five mammalian carboxylesterase gene families in

human, mouse, and rat (Holmes et al., 2010). In the new nomenclature system, six

human CESs on human chromosome 16, fifteen rat Cess on rat chromosome 19, and

twenty mouse Cess on mouse chromosome 8 have been recognized and described

(Holmes et al., 2010). However, AADAC/Aadac genes were not included in this new

system, probably due to their different chromosomal location than other CES/Ces genes.

CESs/Cess are found in a number of tissues including liver, kidney, small intestine,

heart, lung, brain, testis, nasal, and respiratory tissues, adipose tissues, leukocytes, and

blood (Satoh and Hosokawa, 1998). Among various tissues, the highest hydrolase


at ASPE

T Journals on N

ovember 11, 2021


Dow

nloaded from


DMD #43877

5

activity is present in liver. Microsomal enzyme inducers (MEIs) exert their effects on

target genes through the direct or indirect activation of transcription factors, such as aryl

hydrocarbon receptor (AhR), pregnane X receptor (PXR), constitutive androstane

receptor (CAR), peroxisome proliferator activated receptor alpha (PPARα), and nuclear

factor erythroid 2-related factor 2 (Nrf2) (Handschin and Meyer, 2003; Numazawa and

Yoshida, 2004). CES/Ces activity has been previously shown to be induced

phenobarbital (PB), aroclor1254, polycyclic aromatic hydrocarbons, synthetic

glucocorticoids, pregnenolone-16α-carbonitrile (PCN), and clofibrate (CLOF) (Satoh and

Hosokawa, 1998). CAR and PXR have been shown to play important roles in the

regulation of mouse Cess (Staudinger et al., 2010). Potential transcriptional factors that

depict binding sites in CES/Ces promoters include specificity protein 1 (Sp1), Sp3,

CCAAT/enhancer binding protein (C/EBP), upstream stimulatory factor 1 (USF1),

neurofibromin 1(NF-1), nuclear factor kappa B (NFkB), PPARα, glucocorticoid receptor

(GR), sterol regulatory element binding protein (SREBP), hepatocyte nuclear factor 1

(HNF1), HNF3, and HNF4 binding sites (Satoh and Hosokawa, 2006).

CES enzymes are considered to be one of the major determinants of the

metabolism and disposition of ester-containing drugs through their actions in liver and

intestine. CES substrates include numerous clinically prescribed anticancer prodrugs,

carbamate and pyrethroid insecticides, as well as environmental toxicants and

procarcinogens (Hosokawa et al., 2008). Moreover, an ester linkage methodology is

frequently utilized in rational drug design in order to target a prodrug, or to improve the

water solubility of a novel compound. Thus, it is of clinical significance to investigate the

regulation of CESs/Cess. Previous studies focused mainly on the regulation of human


at ASPE

T Journals on N

ovember 11, 2021


Dow

nloaded from


DMD #43877

6

and rat CESs/Cess. However, information on the regulation of mouse Cess is limited.

Therefore, the purpose of the present study was to systematically investigate the

regulation of Cess in livers of mice by prototypical MEIs that respectively activate 5

transcription factors. The present study focused on 1 mouse Aadac gene and 11

mouse Ces genes, which have been previously investigated, including Ces1c

(previously called Es1) (Genetta et al., 1988), Ces1d (previously Ces3) (Dolinsky et al.,

2001), Ces1e (previously Es22 or egasyn) (Ovnic et al., 1991), Ces1f (previously Es4 or

TGH-2) (Poole et al., 2001), Ces1g (previously Ces1 or Est1) (Ellinghaus et al., 1998),

Ces2a (previously Ces6) (The MGC Project Team 2004), Ces2b (previous Ces2A7)

(Satoh and Hosokawa, 2006), Ces2c (previously Ces2) (Furihata et al., 2003), Ces2e

(previously Ces5) (The MGC Project Team 2004), Ces3a (previously esterase 31 or

Est31)(Aida et al., 1993), and Ces5a (previously Ces7) (Miyazaki et al., 2003).


at ASPE

T Journals on N

ovember 11, 2021


Dow

nloaded from


DMD #43877

7

Materials and Methods

Chemicals. 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) was a kind gift from Dr.

Karl Rozman (University of Kansas Medical Center, Kansas City, KS). Oltipraz (OPZ)

was purchased from LKT laboratories, Inc. (St. Paul, MN). Polychlorinated biphenyl

126 (PCB126) was obtained from AccuStandard (New Haven, CT). β-Naphthoflavone

(BNF), diallyl sulfide (DAS), clofibric acid (CLOF), di-(2-ethylhexyl)-phthalate,

ethoxyquin (EXQ), dexamethasone (DEX), pregnenolone-16α-carbonitrile (PCN),

ciprofibrate, butylated hydroxyanisole (BHA), spironolactone (SPR), phenobarbital (PB),

and 1,4-bis[2-(3,5-dichloropuridyloxy)]benzene (TCPOBOP) were purchased from

Sigma-Aldrich Co. (St. Louis, MO). Sodium chloride, HEPES sodium salt, HEPES free

acid, lithium lauryl sulfate, EDTA, and D-(+)-glucose were purchased from Sigma-Aldrich

(St. Louis, MO). Micro-O-protect was purchased from Roche Diagnostics (Indianapolis,

IN). Chloroform, agarose, and ethidium bromide were purchased from AMRESCO Inc.

(Solon, OH). RNA Bee was purchased from TelTest Inc. (Friendswood, TX). All other

chemicals, unless indicated, were purchased from Sigma-Aldrich Co. (St. Louis, MO).

Animals. Eight-week old male C57BL/6 mice were purchased from Jackson

Laboratories (Bar Harbor, Maine). Male AhR-null mice (>99% congenic for C57BL/6J

background) from Jackson laboratories (stock #002831) have been described

previously (Schmidt et al., 1996). Breeding pairs of CAR-null mice in the C57BL/6

background were obtained as described previously (Ueda A, 2002). Breeding pairs of

PXR-null mice (Staudinger JL, 2001) in the C57BL/6 background were kindly provided

by Dr. Frank J. Gonzalez (National Institutes of Health/National Cancer Institute,

Bethesda, MD). PPARα-null mice originally engineered by the laboratory of Dr. Frank J.


at ASPE

T Journals on N

ovember 11, 2021


Dow

nloaded from


DMD #43877

8

Gonzalez (Lee SS, 1995) were backcrossed to a C57BL/6 background (Akiyama TE,

2001). Breeding pairs of Nrf2-null mice on a mixed C57BL/6 and AKR background were

provided by Dr. Jefferson Chan (University of California, Irvine) (Chan et al., 1996) and

backcrossed to a C57BL/6 background in our animal care facility. All mice were housed

in an American Animal Associations Laboratory Animal Care (AALAC) accredited facility

with a 12:12 hr light:dark cycle and provided chow and water ad libitum.

Microsomal Enzyme Inducer Treatment. Adult ( approximately 8-weeks of age)

male C57BL/6 mice were treated with five groups of prototypical drug-metabolizing

enzyme inducers as previously described (Cheng et al., 2005). Each class contained

three chemicals that are known to activate a specific signaling pathway. The dose and

dosing regimen of these compounds were previously shown to induce the

corresponding target genes in mice, namely Cyp1A1 for AhR ligands, Cyp2B1 for CAR

activators, Cyp3A11 for PXR ligands, Cyp4A14 for PPARα ligands, and

NAD(P)H:quinine oxidoreductase 1 (Nqo1) for Nrf2 activators (Cheng et al., 2005).

Similar inductions were also observed in the present study (Supplemental Fig 1).

In another experiment, five knockout mouse models and their corresponding wild-

type mice (n=5/group) were treated with one of five prototypical MEIs once daily for 4

days: AhR-null mice (TCDD, 40 µg/kg, ip in corn oil); CAR-null mice

(TCPOBOP, 300 μg/kg, ip in corn oil); PXR-null mice (PCN, 200 mg/kg, ip in corn oil);

PPARα-null mice (CLFB, 500 mg/kg, ip in saline); and Nrf2-null mice (OPZ, 150 mg/kg,

po in corn oil). Livers were collected on day 5, frozen in liquid nitrogen, and stored at -

80°C.


at ASPE

T Journals on N

ovember 11, 2021


Dow

nloaded from


DMD #43877

9

Low-dose and High-dose Dexamethasone Treatment. DEX at higher doses

(20-50mg/kg) have been shown to activate PXR in vivo (Xie et al., 2000), whereas lower

doses of DEX (2-6mg/kg) have little effect on PXR activation (Heuman et al., 1982). To

investigate the mechanism of DEX in regulation of mouse Cess, both a low dose (2

mg/kg/day ip for 2 days) and a high dose (50 mg/kg/day ip for 1 day) of DEX were

administered to wild-type (WT) and PXR-null mice.

Total RNA Isolation. Total RNA was isolated using RNA-Bee reagent (Tel-Test

Inc., Friendswood, TX) according to the manufacturer's protocol. Total RNA

concentrations were quantified spectrophotometrically at 260 nm, and purity was

confirmed by 260/280 and 260/230 nm ratios. Total RNA was diluted to 1µg of total

RNA per microliter with diethyl pyrocarbonate-treated deionized water. Integrity of RNA

samples was determined by formaldehyde-agarose gel electrophoresis with

visualization by ethidium bromide fluorescence under ultraviolet light.

Branched DNA Signal Amplification Assay. Mouse Ces mRNA expression was

quantified using the branched DNA (bDNA) assay (Quantigene bDNA signal

amplification kit; Panomics, Inc., Fremont, CA). The GenBank accession numbers of all

genes, the sequences, and functions of the probe sets for each mouse CES are shown

in Table 1. Reagents required for RNA analysis were supplied in the Quantigene®

bDNA signal amplification kit (Bayer Diagnostics, East Walpole, MA). The mRNAs were

analyzed as previously described (Hartley and Klaassen, 2000). Data are presented as

relative light units (RLUs) per 8 µg of total RNA.

Multiplex Suspension Array. Mouse Ces mRNA expression from the

chemical treatment experiment involving both WT and knockout mice were determined


at ASPE

T Journals on N

ovember 11, 2021


Dow

nloaded from


DMD #43877

10

by Mutiplex suspension array (Panomics-Affymetrix, Inc., Fremont, CA). Individual

gene accession numbers can be accessed at www.panomics.com (sets #21086).

Samples were analyzed using a Bio-Plex 200 System Array reader with Luminex 100

xMAP technology, and the data were acquired using Bio-Plex Data Manager version 5.0

(Bio-Rad, Hercules, CA). Assays were performed according to each manufactures’

protocol. RNA data were normalized to glyceraldehydes-3-phosphate dehydrogenase

(Gapdh) mRNA and are presented as relative light units (RLUs).

Statistical Analysis. Data were analyzed by one-way ANOVA, followed by

Duncan's post-hoc test. Statistical significance was set at p < 0.05. Bars represent

mean ±SEM (n=5).


at ASPE

T Journals on N

ovember 11, 2021


Dow

nloaded from


DMD #43877

11

Results

Regulation of mouse Aadac, Ces1c, 1d, 1e, 1f, and 1g. As shown in Fig 1,

Aadac mRNA was highly expressed in mouse livers, and suppressed by all three AhR

ligands: TCDD (67%), PCB (57%), and BNF (33%); two CAR activators: TCPOBOP

(68%) and DAS (50%); two PXR ligands: PCN (50%) and DEX (63%); as well as the

Nrf2 activator BHA (38%). Ces1c was decreased by the PXR ligand DEX (75%).

Ces1d was decreased 75% by the PXR ligand DEX. Ces1e was decreased about 70%

by the PXR ligand DEX and the Nrf2 activator BHA. Ces1f was decreased by the AhR

ligand BNF (40%), the CAR activator DAS (47%), and the PXR ligand DEX (74%).

Ces1g was decreased about 70% by the PXR ligand DEX, but increased by all three

Nrf2 activators BHA (56%), OPZ (132%), and EXQ (38%).

Regulation of mouse Ces2a, 2b, 2c, 2e, 3a, and 5a. As shown in Fig 2, Ces2a

was increased by all three CAR activators: TCPOBOP (90%), PB (49%), and DAS

(57%); two PXR ligands: PCN (222%) and SPR (177%); as well as the Nrf2 activator

ETH (53%). Ces2b was minimally expressed in livers of mice, and was induced by two

Nrf2 activators OPZ (70%) and ETH (100%). Ces2c was increased markedly by two

CAR activators TCPOBOP (85%) and PB (150%), two PXR ligands PCN (70%) and

SPR (90%), as well as two Nrf2 activators OPZ (140%) and ETH (110%). Ces2e was

minimally expressed in livers of mice, and was not altered by any MEI. Ces3a was

decreased by two AhR ligands: TCDD (75%) and BNF (63%), the CAR activator

TCPOBOP (56%), the PXR ligand DEX (74%), as well as the Nrf2 activator BHA (86%).

Ces5a was minimally expressed in mouse livers, and was not altered by any of the


at ASPE

T Journals on N

ovember 11, 2021


Dow

nloaded from


DMD #43877

12

MEIs. Due to the minimal expression in liver, the regulation of Ces2b, 2e, and 5a was

not further investigated in the present study.

Effect of TCDD on mRNA expression of Aadac and Ces3a in livers of WT and

AhR-null mice. To determine whether the inhibition of Aadac and Ces3a by TCDD was

dependent on AhR, both WT and AhR-null mice were treated with TCDD. As shown in

Fig 3, Aadac was similarly expressed in control WT and AhR-null mice. TCDD

decreased Aadac about 40% in WT mice, but not in AhR-null mice. Ces3a had lower

expression in AhR-null than WT mice. TCDD suppressed Ces3a approximately 57% in

WT mice, but not in AhR-null mice. Thus, TCDD-mediated inhibition of Aadac and

Ces3a is AhR-dependent.

Effect of TCPOBOP on mRNA expression of Aadac, Ces2a, 2c, and 3a in

livers of WT and CAR-null mice. To determine whether TCPOBOP regulation of

Aadac, Ces2a, 2c, and 3a was dependent on CAR, both WT and CAR-null mice were

treated with TCPOBOP. As shown in Fig 4, Aadac, Ces2a, and 2c had similar

expression in WT and CAR-null mice, whereas Ces3a was lower in CAR-null mice.

Aadac and Ces3a were suppressed by TCPOBOP in WT but not CAR-null mice.

TCPOBOP strongly induced Ces2a and 2c in WT but not CAR-null mice. Taken

together, CAR is required for the TCPOBOP-mediated suppression of Aadac and

Ces3a as well as induction of Ces2a and 2c in livers of mice.

Effect of PCN on mRNA expression of Aadac, Ces2a, and 2c in livers of WT

and PXR-null mice. To determine the role of PXR in PCN-mediated regulation of

Aadac, Ces2a, and 2c, both WT and PXR-null mice were treated with PCN. As shown

in Fig 5, Aadac and Ces2a were similarly expressed in livers of WT and PXR-null mice,


at ASPE

T Journals on N

ovember 11, 2021


Dow

nloaded from


DMD #43877

13

whereas Ces2c was higher in livers of PXR-null than WT mice. Aadac was decreased

by PCN in WT mice, but not in PXR-null mice. PCN increased Ces2a and 2c in WT

mice, but not in PXR-null mice. Thus, PXR is required for the PCN-mediated

suppression of Aadac as well as the induction of Ces2a and 2c in livers of mice.

Effect of OPZ on mRNA expression of Ces1g and 2c in livers of WT and Nrf2-

null mice. To determine whether the induction of Ces1g and 2c by OPZ was Nrf2

dependent, both WT and Nrf2-null mice were treated with OPZ. Ces1g and 2c mRNA

were lower in Nfr2-null than WT mice (Fig 6). OPZ increased Ces1g and 2c in WT but

not Nrf2-null mice. Thus, OPZ-mediated induction of Ces1g and 2c is Nrf2-dependent.

Effect of Low-dose and High-dose DEX on mRNA expression of Aadac,

Ces1c, 1d, 1e, 1f, 1g, and 3a in livers of WT and PXR-null mice. Both PXR and GR

are shown to be activated by DEX (Shi et al., 2008). Activation of PXR requires

micromolar, whereas activation of GR requires nanomolar concentrations of DEX. In

the present study, WT and PXR-null mice were treated with DEX at both low and high

doses. Aadac, Ces1d, 1e, and 3a were similarly expressed in control WT and control

PXR-null mice (Fig 7). In contrast, PXR-null mice had lower Ces1g but higher Ces1c

and 1f than WT mice. Aadac was suppressed by high-dose, but not low-dose DEX in

WT mice. In contrast, Ces1c, 1d, 1e, 1f, 1g, and 3a were suppressed by both low- and

high-dose DEX in WT mice. Aadac, Ces1g, and 3c were suppressed by high-dose but

not low-dose DEX in PXR-null mice. In contrast, Ces1c, 1d, 1e, and 1f were

suppressed by both low- and high-dose DEX in PXR-null mice. Interestingly, Ces1c, 1d,

1e, and 1f were suppressed more by high-dose than low-dose DEX in PXR-null mice.


at ASPE

T Journals on N

ovember 11, 2021


Dow

nloaded from


DMD #43877

14

Taken together, PXR does not appear to be involved in the DEX-mediated regulation of

Cess in livers of mice.


at ASPE

T Journals on N

ovember 11, 2021


Dow

nloaded from


DMD #43877

15

Discussion

The majority of identified CES/Ces enzymes belong to either the CES1 or CES2

subfamily (Satoh and Hosokawa, 2006). CES1 subfamily mainly hydrolyzes substrates

with small alcohol and large acyl groups, whereas CES2 subfamily prefers to hydrolyze

substrates with large alcohol or small acyl groups. The present study demonstrates that

the mRNA expression of the Ces1 subfamily is generally not altered by most MEIs,

whereas the mRNA expression of the Ces2 subfamily is readily induced by ligands of

CAR, PXR, and Nrf2 in livers of mice. This suggests that MEIs increase the liver

hydrolysis of ester-containing drugs, in particular those with large alcohol and small acyl

groups, such as irrinotecan, a carbamate prodrug used in the treatment of colorectal

cancers (Humerickhouse et al., 2000). Of the 11 Cess investigated, Ces2b, 2e, and 5a

are minimally expressed in livers of mice, and were not altered by most of the MEIs,

except that Ces2b is induced by two Nrf2 ligands, OPZ and ETH. Due to the minimal

expression of these Cess in liver, we did not further investigate their regulatory

mechanisms.

AADAC was purified from human liver when studying the metabolism of

carcinogens, and has been reported to be involved in the hydrolysis of various clinical

therapeutic drugs, such as flutamide, phenacetin, and rifamycins (Probst et al., 1994;

Watanabe et al., 2009; Watanabe et al., 2010; Nakajima et al., 2011). In the present

study, mouse liver Aadac mRNA is suppressed by three AhR ligands, two CAR ligands,

two PXR ligands, and one Nrf2 activator. The suppression of Aadac by TCDD,

TCPOBOP, and PCN is dependent on AhR, CAR, and PXR, respectively. Trickett et al.

(Trickett et al., 2001) reported that two PPARα ligands fibrate and Wy-14,643 increase


at ASPE

T Journals on N

ovember 11, 2021


Dow

nloaded from


DMD #43877

16

Aadac mRNA in the intestine, but not in livers of mice. Consistently, the present finding

demonstrates that Aadac mRNA in livers of mice is not altered by any of three PPARα

ligands.

In general, AhR ligands have little effect on most Cess in livers of mice. It is

reported that the AhR ligand, PCB (Aroclor 1254), tended to decrease rat Ces activities

in both whole liver and liver microsomes (Carr et al., 2002). In contrast, the present

data indicate that PCB has no effect on mouse liver Cess. AhR ligands BNF and TCDD

have been reported to decrease Ces1f mRNA in livers of rats (Morgan et al., 1994;

Yang et al., 2001). In the present study, mouse liver Ces1f mRNA is also suppressed

by BNF, but not altered by TCDD. Interestingly, both BNF and TCDD suppress mouse

liver Ces3a, and the TCDD-mediated suppression of Ces3a is AhR dependent. Ces3a

(or Es31) is expressed predominantly in male mouse livers (Aida et al., 1993). There is

little information on the substrate specificity of CES3/Ces3a. However, the pig homolog

of Ces3a was shown to be involved in the hydrolysis of indomethacin, a drug commonly

used to reduce fever, pain, and swelling (Terashima et al., 1996). Therefore, AhR

ligands in livers of mice may decrease the hydrolytic activity toward substrates such as

indomethacin.

CAR and PXR are two closely related xenobiotic-sensing nuclear receptors,

which are mainly expressed in hepatic tissue. The CAR activator PB has been shown to

induce hepatic microsomal CES activity in mice as well as two Ces isozymes in rat liver

microsomes (Ketterman et al., 1987; Hosokawa et al., 1988). Compared to CAR, a

critical role of PXR in the regulation of CES gene expression in both humans and

rodents has been suggested in many studies. PXR is implicated in the induction of


at ASPE

T Journals on N

ovember 11, 2021


Dow

nloaded from


DMD #43877

17

human CES2 by 8-methoxypsoralen (Yang and Yan, 2007). PCN markedly induces rat

Ces1e (also known as ES-3, Egasin or Ces RL2) (Hosokawa et al., 1993a). Over-

expression of constitutively active human PXR has a positive effect on Ces gene

expression in livers of mice (Rosenfeld et al., 2003). The present study demonstrates

that both Ces2a and 2c in livers of mice are induced by CAR and PXR ligands, and the

induction by TCPOBOP and PCN is dependent on CAR and PXR, respectively. Xu et al.

also reported that Ces2a is a target gene of both CAR and PXR in livers of mice (Xu et

al., 2009). Therefore, together with numerous other drug-metabolizing enzymes and

drug transporters, CAR and PXR also regulate the expression of key CES enzymes that

coordinately determine the pharmacokinetic and pharmacodynamic properties of drugs

and other xenobiotics.

PPARα is one of three subtypes of PPARs, and is predominantly expressed in

tissues with a high oxidative capacity, such as liver and heart. Feeding clofibrate, a

PPARα ligand, has little effect on Ces1d (also known as TGH) in livers of wild-type or

PPARα-null mice (Dolinsky et al., 2003). This is consistent with the present study.

Poole et al. showed that Ces1f (also known as Es-4) was down-regulated by the

peroxisome proliferator Wy-14,643 (Poole et al., 2001). In the present study, Ces1f

mRNA in livers of male mice tends to be, but not significantly decreased by two PPARα

ligands CLOF and DEHP. Ces1f has higher expression in livers of female than male

mice (Supplemental Fig 2a). Interestingly, the PPARα ligand CPFB decreased Ces1f

mRNA in a PPARα-dependent manner in livers of female, but not male mice

(Supplemental Fig 2b). Feeding 2% DEHP in the diet for 7 days significantly increased

the Ces protein and hydrolytic activity in mouse liver microsomes (Hosokawa et al.,


at ASPE

T Journals on N

ovember 11, 2021


Dow

nloaded from


DMD #43877

18

1994). Furihata et al. identified that Ces2c (also known as mCES2) is induced by

DEHP (Furihata et al., 2004). In contrast, in the present study, DEHP has little effect on

Cess in livers of mice. This may be due to the shorter-term (4 days) treatment in the

present study. Taken together, PPARα ligands have little effect on most Cess, which is

confirmed by the inducer treatment in PPARα-null mice (Supplemental Fig 3).

Nrf2 is the most important regulator of antioxidant proteins and phase II-enzymes

that protect against oxidative stress and electrophiles in cells. The Nrf2 ligand BHA

induces CES1 in human hepatocytes (Takakusa et al., 2008). Maruichi et al. also

reported that human CES1 (also known as CES1A1) is induced by tert-

butylhydroquinone and sulforaphane in a Nrf2-dependent manner (Maruichi et al., 2009).

Sulforaphane has been shown to moderately induce CES activity in livers of WT, but not

in Nrf2-null mice (Thimmulappa et al., 2002). The Nrf2 activator BHA increases the

microsomal Ces activity in mice ((Ketterman et al., 1987). The present study

demonstrates that the Nrf2 ligand BHA increases Ces1g, but decreases Ces1e and 3a

in mouse livers. Our previous study demonstrated that Ces1g and 2c are lower in Nrf2-

null mice and higher in Keap1-knockdown (Nrf2 activated) than in wilde-type mice

(Reisman et al., 2009). Consistently, the Nrf2 ligand OPZ induces Ces1g and 2c in

mouse livers in a Nrf2-dependent manner. Interestingly, whereas OPZ has no effect on

Ces2a or 3a in livers of male mice, OPZ increases Ces2a and decreases Ces3a in

livers of female WT, but not in female Nrf2-null mice (Supplemental Fig 4).

Species differences have been observed in DEX regulation of CESs. DEX

treatment decreased Ces1d (also known as Es-10) and 1f (also known as Es-4 and

hydrolase B) in rat liver, whereas it slightly increased human CES1 and 2 in cultured


at ASPE

T Journals on N

ovember 11, 2021


Dow

nloaded from


DMD #43877

19

human hepatocytes (Zhu et al., 2000; Furihata et al., 2005). In the present study, DEX

suppresses almost all the Ces1 isozymes, as well as Ces3a in livers of mice. Both PXR

and GR are known to mediate DEX regulation of rat Cess, and the concentration of

DEX determines the involvement of PXR and/or GR in the suppression of rat Ces1d and

1f (Shi et al., 2008). To determine the role of PXR in DEX suppression of mouse Cess,

both a low-dose (2mg/kg) and a high-dose (50mg/kg) of DEX were treated to WT and

PXR-null mice. Low-dose DEX is proposed to activate the GR, whereas high-dose DEX

is able to activate both GR and PXR. Low-dose DEX tended to, but not significantly,

increase Cyp3a11, whereas high-dose DEX significantly increased Cyp3a11 in livers of

WT mice (Supplemental Fig 5). However, neither low-dose nor high-dose DEX had

effect on Cyp3a11 in livers of PXR-null mice (Supplemental Fig 5). This suggests that

high-dose DEX is able to induce Cy3a11 in a PXR-dependent manner. High-dose DEX

suppressed Aadac, Ces1c, 1d, 1e, 1f, 1g, and 3a in both WT and PXR-null mice,

suggesting that PXR may not be required for the DEX-mediated suppression of Cess in

livers of mice.

Collectively, the current study provides important insights into the chemical

regulation of mouse liver Cess. Cess in livers of mice are shown to be regulated by

AhR, CAR, PXR, Nrf2, and PPARα. Future studies should be performed by using

primary human hepatocytes to determine whether these five signaling pathways are

conserved in humans. To conclude, the present study on the inductive abilities and

regulatory mechanism of MEIs on CESs/Cess will ultimately aid in rational drug design

and the development of novel prodrugs, and will be clinically beneficial to predict drug-

drug interactions and clarify the cause of individual responses to various drugs.


at ASPE

T Journals on N

ovember 11, 2021


Dow

nloaded from


DMD #43877

20

ACKNOWLEDGMENTS.

The authors would like to thank the members in Dr. Klaassen’s lab for their assistance

in tissue collection and manuscript review.

Authorship Contribution.

Participated in research design: Zhang, Cheng, and Klaassen.

Conducted experiments: Zhang, Cheng, and Aleksunes.

Contributed new reagents or analytic tools: Cheng and Aleksunes.

Performed data analysis: Zhang, Cheng, and Aleksunes.

Wrote or contributed to the writing of the manuscript: Zhang, Cheng, and Klaassen.


at ASPE

T Journals on N

ovember 11, 2021


Dow

nloaded from


DMD #43877

21

References

Aida K, Moore R and Negishi M (1993) Cloning and nucleotide sequence of a novel, male-predominant carboxylesterase in mouse liver. Biochim Biophys Acta 1174:72-74.

Akiyama TE NC, Fievet C, Staels B, Ward JM, Auwerx J, Lee SS, Gonzalez FJ, Peters JM. (2001) Peroxisome proliferator-activated receptor-alpha regulates lipid homeostasis, but is not associated with obesity: Studies with congenic mouse lines. J. Biol. Chem. 276:39088-39093.

Carr RL, Richardson JR, Guarisco JA, Kachroo A, Chambers JE, Couch TA, Durunna GC and Meek EC (2002) Effects of PCB exposure on the toxic impact of organophosphorus insecticides. Toxicol Sci 67:311-321.

Chan K, Lu R, Chang JC and Kan YW (1996) NRF2, a member of the NFE2 family of transcription factors, is not essential for murine erythropoiesis, growth, and development. Proc Natl Acad Sci U S A 93:13943-13948.

Cheng X, Maher J, Dieter MZ and Klaassen CD (2005) Regulation of mouse organic anion-transporting polypeptides (Oatps) in liver by prototypical microsomal enzyme inducers that activate distinct transcription factor pathways. Drug Metab Dispos 33:1276-1282.

Dolinsky VW, Gilham D, Hatch GM, Agellon LB, Lehner R and Vance DE (2003) Regulation of triacylglycerol hydrolase expression by dietary fatty acids and peroxisomal proliferator-activated receptors. Biochim Biophys Acta 1635:20-28.

Dolinsky VW, Sipione S, Lehner R and Vance DE (2001) The cloning and expression of a murine triacylglycerol hydrolase cDNA and the structure of its corresponding gene. Biochim Biophys Acta 1532:162-172.

Ellinghaus P, Seedorf U and Assmann G (1998) Cloning and sequencing of a novel murine liver carboxylesterase cDNA. Biochim Biophys Acta 1397:175-179.

Furihata T, Hosokawa M, Fujii A, Derbel M, Satoh T and Chiba K (2005) Dexamethasone-induced methylprednisolone hemisuccinate hydrolase: its identification as a member of the rat carboxylesterase 2 family and its unique existence in plasma. Biochem Pharmacol 69:1287-1297.

Furihata T, Hosokawa M, Koyano N, Nakamura T, Satoh T and Chiba K (2004) Identification of di-(2-ethylhexyl) phthalate-induced carboxylesterase 1 in C57BL/6 mouse liver microsomes: purification, cDNA cloning, and baculovirus-mediated expression. Drug Metab Dispos 32:1170-1177.

Furihata T, Hosokawa M, Nakata F, Satoh T and Chiba K (2003) Purification, molecular cloning, and functional expression of inducible liver acylcarnitine hydrolase in C57BL/6 mouse, belonging to the carboxylesterase multigene family. Arch Biochem Biophys 416:101-109.

Genetta TL, D'Eustachio P, Kadner SS and Finlay TH (1988) cDNA cloning of esterase 1, the major esterase activity in mouse plasma. Biochem Biophys Res Commun 151:1364-1370.

Handschin C and Meyer UA (2003) Induction of drug metabolism: the role of nuclear receptors. Pharmacol Rev 55:649-673.


at ASPE

T Journals on N

ovember 11, 2021


Dow

nloaded from


DMD #43877

22

Hartley DP and Klaassen CD (2000) Detection of chemical-induced differential expression of rat hepatic cytochrome P450 mRNA transcripts using branched DNA signal amplification technology. Drug Metab Dispos 28:608-616.

Heuman DM, Gallagher EJ, Barwick JL, Elshourbagy NA and Guzelian PS (1982) Immunochemical evidence for induction of a common form of hepatic cytochrome P-450 in rats treated with pregnenolone-16 alpha-carbonitrile or other steroidal or non-steroidal agents. Mol Pharmacol 21:753-760.

Holmes RS, Wright MW, Laulederkind SJ, Cox LA, Hosokawa M, Imai T, Ishibashi S, Lehner R, Miyazaki M, Perkins EJ, Potter PM, Redinbo MR, Robert J, Satoh T, Yamashita T, Yan B, Yokoi T, Zechner R and Maltais LJ (2010) Recommended nomenclature for five mammalian carboxylesterase gene families: human, mouse, and rat genes and proteins. Mamm Genome 21:427-441.

Hosokawa M, Furihata T, Yaginuma Y, Yamamoto N, Watanabe N, Tsukada E, Ohhata Y, Kobayashi K, Satoh T and Chiba K (2008) Structural organization and characterization of the regulatory element of the human carboxylesterase (CES1A1 and CES1A2) genes. Drug Metab Pharmacokinet 23:73-84.

Hosokawa M, Hattori K and Satoh T (1993) Differential responses of rat hepatic microsomal carboxylesterase isozymes to glucocorticoids and pregnenolone 16 alpha-carbonitrile. Biochem Pharmacol 45:2317-2322.

Hosokawa M, Hirata K, Nakata F, Suga T and Satoh T (1994) Species differences in the induction of hepatic microsomal carboxylesterases caused by dietary exposure to di(2-ethylhexyl)phthalate, a peroxisome proliferator. Drug Metab Dispos 22:889-894.

Hosokawa M, Maki T and Satoh T (1988) Differences in the induction of carboxylesterase isozymes in rat liver microsomes by xenobiotics. Biochem Pharmacol 37:2708-2711.

Humerickhouse R, Lohrbach K, Li L, Bosron WF and Dolan ME (2000) Characterization of CPT-11 hydrolysis by human liver carboxylesterase isoforms hCE-1 and hCE-2. Cancer Res 60:1189-1192.

Ketterman AJ, Pond SM and Becker CE (1987) The effects of differential induction of cytochrome P-450, carboxylesterase and glutathione S-transferase activities on malathion toxicity in mice. Toxicol Appl Pharmacol 87:389-392.

Lee SS PT, Drago J, Lee EJ, Owens JW, Kroetz DL, Fernandez-Salguero PM, Westphal H, Gonzalez FJ. (1995) Targeted disruption of the alpha isoform of the peroxisome proliferator-activated receptor gene in mice results in abolishment of the pleiotropic effects of peroxisome proliferators. . Mol. Cell. Biol. 15:3012-3022.

Maruichi T, Fukami T, Nakajima M and Yokoi T (2009) Transcriptional regulation of human carboxylesterase 1A1 by nuclear factor-erythroid 2 related factor 2 (Nrf2). Biochem Pharmacol 79:288-295.

Miyazaki M, Kamiie K, Soeta S, Taira H and Yamashita T (2003) Molecular cloning and characterization of a novel carboxylesterase-like protein that is physiologically present at high concentrations in the urine of domestic cats (Felis catus). Biochem J 370:101-110.

Morgan EW, Yan B, Greenway D and Parkinson A (1994) Regulation of two rat liver microsomal carboxylesterase isozymes: species differences, tissue distribution,


at ASPE

T Journals on N

ovember 11, 2021


Dow

nloaded from


DMD #43877

23

and the effects of age, sex, and xenobiotic treatment of rats. Arch Biochem Biophys 315:513-526.

Nakajima A, Fukami T, Kobayashi Y, Watanabe A, Nakajima M and Yokoi T (2011) Human arylacetamide deacetylase is responsible for deacetylation of rifamycins: rifampicin, rifabutin, and rifapentine. Biochem Pharmacol 82:1747-1756.

Numazawa S and Yoshida T (2004) Nrf2-dependent gene expressions: a molecular toxicological aspect. J Toxicol Sci 29:81-89.

Ovnic M, Swank RT, Fletcher C, Zhen L, Novak EK, Baumann H, Heintz N and Ganschow RE (1991) Characterization and functional expression of a cDNA encoding egasyn (esterase-22): the endoplasmic reticulum-targeting protein of beta-glucuronidase. Genomics 11:956-967.

Poole M, Bridgers K, Alexson SE and Corton JC (2001) Altered expression of the carboxylesterases ES-4 and ES-10 by peroxisome proliferator chemicals. Toxicology 165:109-119.

Probst MR, Beer M, Beer D, Jeno P, Meyer UA and Gasser R (1994) Human liver arylacetamide deacetylase. Molecular cloning of a novel esterase involved in the metabolic activation of arylamine carcinogens with high sequence similarity to hormone-sensitive lipase. J Biol Chem 269:21650-21656.

Reisman SA, Yeager RL, Yamamoto M and Klaassen CD (2009) Increased Nrf2 activation in livers from Keap1-knockdown mice increases expression of cytoprotective genes that detoxify electrophiles more than those that detoxify reactive oxygen species. Toxicol Sci 108:35-47.

Rosenfeld JM, Vargas R, Jr., Xie W and Evans RM (2003) Genetic profiling defines the xenobiotic gene network controlled by the nuclear receptor pregnane X receptor. Mol Endocrinol 17:1268-1282.

Satoh T and Hosokawa M (1998) The mammalian carboxylesterases: from molecules to functions. Annu Rev Pharmacol Toxicol 38:257-288.

Satoh T and Hosokawa M (2006) Structure, function and regulation of carboxylesterases. Chem Biol Interact 162:195-211.

Schmidt JV, Su GH, Reddy JK, Simon MC and Bradfield CA (1996) Characterization of a murine Ahr null allele: involvement of the Ah receptor in hepatic growth and development. Proc Natl Acad Sci U S A 93:6731-6736.

Shi D, Yang J, Yang D and Yan B (2008) Dexamethasone suppresses the expression of multiple rat carboxylesterases through transcriptional repression: Evidence for an involvement of the glucocorticoid receptor. Toxicology 254:97-105.

Staudinger JL GB, Jones SA, Hawkins-Brown D, MacKenzie KI, LaTour A, Liu Y, Klaassen CD, Brown KK, Reinhard J (2001) The nuclear receptor PXR is a lithocholic acid sensor that protects against liver toxicity. Proc. Natl. Acad. Sci. U. S. A. 98:3369-3374.

Staudinger JL, Xu C, Cui YJ and Klaassen CD (2010) Nuclear receptor-mediated regulation of carboxylesterase expression and activity. Expert Opin Drug Metab Toxicol 6:261-271.

Takakusa H, Masumoto H, Mitsuru A, Okazaki O and Sudo K (2008) Markers of electrophilic stress caused by chemically reactive metabolites in human hepatocytes. Drug Metab Dispos 36:816-823.


at ASPE

T Journals on N

ovember 11, 2021


Dow

nloaded from


DMD #43877

24

Terashima K, Takai S, Usami Y, Adachi T, Sugiyama T, Katagiri Y and Hirano K (1996) Purification and partial characterization of an indomethacin hydrolyzing enzyme from pig liver. Pharm Res 13:1327-1335.

Thimmulappa RK, Mai KH, Srisuma S, Kensler TW, Yamamoto M and Biswal S (2002) Identification of Nrf2-regulated genes induced by the chemopreventive agent sulforaphane by oligonucleotide microarray. Cancer Res 62:5196-5203.

Trickett JI, Patel DD, Knight BL, Saggerson ED, Gibbons GF and Pease RJ (2001) Characterization of the rodent genes for arylacetamide deacetylase, a putative microsomal lipase, and evidence for transcriptional regulation. J Biol Chem 276:39522-39532.

Ueda A HH, Webb HK, Yamamoto Y, Sueyoshi T, Afshari CA, Lehmann JM, Negishi M. (2002) Diverse roles of the nuclear orphan receptor CAR in regulating hepatic genes in response to phenobarbital. Mol. Pharmacol. 61:1-6.

Watanabe A, Fukami T, Nakajima M, Takamiya M, Aoki Y and Yokoi T (2009) Human arylacetamide deacetylase is a principal enzyme in flutamide hydrolysis. Drug Metab Dispos 37:1513-1520.

Watanabe A, Fukami T, Takahashi S, Kobayashi Y, Nakagawa N, Nakajima M and Yokoi T (2010) Arylacetamide deacetylase is a determinant enzyme for the difference in hydrolase activities of phenacetin and acetaminophen. Drug Metab Dispos 38:1532-1537.

Xie W, Barwick JL, Downes M, Blumberg B, Simon CM, Nelson MC, Neuschwander-Tetri BA, Brunt EM, Guzelian PS and Evans RM (2000) Humanized xenobiotic response in mice expressing nuclear receptor SXR. Nature 406:435-439.

Xu C, Wang X and Staudinger JL (2009) Regulation of Tissue-Specific Carboxylesterase Expression by Pregnane X Receptor and Constitutive Androstane Receptor. Drug Metab Dispos.

Yang D, Li Y, Yuan X, Matoney L and Yan B (2001) Regulation of rat carboxylesterase expression by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD): a dose-dependent decrease in mRNA levels but a biphasic change in protein levels and activity. Toxicol Sci 64:20-27.

Yang J and Yan B (2007) Photochemotherapeutic agent 8-methoxypsoralen induces cytochrome P450 3A4 and carboxylesterase HCE2: evidence on an involvement of the pregnane X receptor. Toxicol Sci 95:13-22.

Zhu W, Song L, Zhang H, Matoney L, LeCluyse E and Yan B (2000) Dexamethasone differentially regulates expression f carboxylesterase genes in humans and rats. Drug Metab Dispos 28:186-191.


at ASPE

T Journals on N

ovember 11, 2021


Dow

nloaded from


DMD #43877

25

Footnotes: This work was supported by the National Institute of Health [grant

ES009649, ES019487, and ED081461].


at ASPE

T Journals on N

ovember 11, 2021


Dow

nloaded from


DMD #43877

26

Figure Legends

Figure 1. mRNA expression of Aadac, Ces1c, 1d, 1e, 1f, and 1g in mouse livers

after treatment with prototypical drug-metabolizing enzyme inducers. Total RNA

from livers of treated male C57BL/6 mice (n = 5/treatment) was analyzed by the bDNA

assay. All data are expressed as mean ± S.E. for five mice in each group, except for

control groups, which were combined from the four individual control groups after it was

determined that they were not statistically different. Asterisks (*) indicate statistically

significant differences between control and treated mice (p < 0.05).

Figure 2. mRNA expression of Ces2a, 2b, 2c, 2e, 3a, and 5a in mouse livers after

treatment with prototypical drug-metabolizing enzyme inducers. Total RNA from

livers of treated male C57BL/6 mice (n = 5/treatment) was analyzed by the bDNA assay.

All data are expressed as mean ± S.E. for five mice in each group, except for control

groups, which were combined from the four individual control groups after it was

determined that they were not statistically different. Asterisks (*) indicate statistically

significant differences between control and treated mice (p < 0.05).

Figure 3. Effect of TCDD on mRNA expression of Aadac and Ces3a in livers of

WT and AhR-null mice. Total RNA from livers of control and TCDD-treated male

C57BL/6 and AhR-null mice (n = 5/group) was analyzed by the Quantigene Plex assay.

The data are reported as ratio of carboxylesterase mRNA to GAPDH mRNA expression

per 500ng of total RNA. All data were expressed as mean ± S.E. Asterisks (*) indicate

statistically significant differences between control and treated mice of the same


at ASPE

T Journals on N

ovember 11, 2021


Dow

nloaded from


DMD #43877

27

genotype (p<0.05). Dagges (#) indicate statistically significant differences between

control WT and control null mice (p<0.05).

Figure 4. Effect of TCPOBOP on mRNA expression of Aadac, Ces2a, 2c, and 3a in

livers of WT and CAR-null mice. Total RNA from livers of control and TCPOBOP-

treated male C57BL/6 and CAR-null mice (n = 5/group) was analyzed by the

Quantigene Plex assay. The data are reported as ratio of carboxylesterase mRNA to

GAPDH mRNA expression per 500ng of total RNA. All data were expressed as mean ±

S.E. Asterisks (*) indicate statistically significant differences between control and

treated mice of the same genotype (p<0.05). Dagges (#) indicate statistically significant

differences between control WT and control null mice (p<0.05).

Figure 5. Effect of PCN on mRNA expression of Aadac, Ces2a, and 2c in livers of

WT and PXR-null mice. Total RNA from livers of control and PCN-treated male

C57BL/6 and PXR-null mice (n = 5/group) was analyzed by the Quantigene Plex assay.

The data are reported as ratio of carboxylesterase mRNA to GAPDH mRNA expression

per 500ng of total RNA. All data were expressed as mean ± S.E. Asterisks (*) indicate

statistically significant differences between control and treated mice of the same

genotype (p<0.05). Dagges (#) indicate statistically significant differences between

control WT and control null mice (p<0.05).

Figure 6. Effect of OPZ on mRNA expression of Ces1g and 2c in livers of WT and

Nrf2-null mice. Total RNA from livers of control and OPZ-treated male C57BL/6 and


at ASPE

T Journals on N

ovember 11, 2021


Dow

nloaded from


DMD #43877

28

Nrf2-null mice (n = 5/group) was analyzed by the Quantigene Plex assay. The data are

reported as ratio of carboxylesterase mRNA to GAPDH mRNA expression per 500ng of

total RNA. All data were expressed as mean ± S.E. Asterisks (*) indicate statistically

significant differences between control and treated mice (p< 0.05). Dagges (#) indicate

statistically significant differences between control WT and control null mice (p<0.05).

Figure 7. Effect of Low-dose (2 mg/kg) and High-dose (50 mg/kg) DEX on mRNA

expression of Aadac, Ces1c, 1d, 1e, 1f, 1g, and 3a in livers of WT and PXR-null

mice. Wild-type and PXR-null mice were administered with both a low dose (2

mg/kg/day ip for 2 days) and a high dose (50 mg/kg/day ip for 1 day) of DEX. Total

RNA from liver of control and DEX-treated male C57BL/6 and male PXR-null mice (n =

5/group) was analyzed by the bDNA assay. The data are reported as the mRNA fold

change to the carboxylesterase mRNA of control WT mice. All data were expressed as

mean ± S.E. Single asterisks (*) indicate statistically significant differences between

treated and control mice of the same genotype (p<0.05). Double asterisks (**) indicate

statistically significant differences between low-dose and high-dose DEX-treated mice

(p<0.05). Dagges (#) indicate statistically significant differences between control WT

and control null mice (p<0.05).


at ASPE

T Journals on N

ovember 11, 2021


Dow

nloaded from


DMD #43877

29

Table 1. Oligonucleotide probes generated for analysis of mouse Ces mRNA

expression by Quantigene branched DNA signal amplification assay

Functiona Probe Sequence Function Probe Sequence

Ces1c (NM_007954) Ces1e (Cont’d) CE ccagttggtccaggtgagccTTTTTctcttggaaagaaagt LE caatcacagatggtacaccgaataTTTTTaggcataggacccgtgtct

CE cccctgatgactctccaaagatTTTTTctcttggaaagaaagt BL Aaaagattcaattttagtgtggtcc

CE agaggtccttgcccagaggaTTTTTctcttggaaagaaagt BL Tccatcaagcacagtgggaac

CE cagcctgtatattcttcttgcccTTTTTctcttggaaagaaagt BL Ggcatctttggcagcaacac

LE ggttactaccaccacgttctcatgTTTTTaggcataggacccgtgtct BL Tgtagggcactgtgttgaagttc

LE tcacctgtgctaaataatccccTTTTTaggcataggacccgtgtct BL Cgtcatctggtccaattttacatca

LE cagtttcctgggctgtgttcaTTTTTaggcataggacccgtgtct BL Ctcagggaggttaagaagaaaaga

LE ggtcacggaatccgggttcTTTTTaggcataggacccgtgtct BL Gtgtaatctttatctcttaaatacttctcaa

LE gataagacaaggacagagacactgatacTTTTTaggcataggacccgtgtct BL Agaagttggtctttatttctgcct

LE acgtttgtatttatgaccacaccaTTTTTaggcataggacccgtgtct Ces1f (NM_144930)

LE gcagctgatgaggtgtcattacactTTTTTaggcataggacccgtgtct CE tctttggggtgatgagaagcttTTTTTctcttggaaagaaagt

LE gcgcaagcactgaaccatgTTTTTaggcataggacccgtgtct CE attgatctcctcttcggaggcTTTTTctcttggaaagaaagt

BL Aaatacccaggcggtattgaat CE tcttggcttctctggtataagccTTTTTctcttggaaagaaagt

BL Tggacccagcgtagtgcag LE gggtagtattgatactcatacatgtaggtTTTTTaggcataggacccgtgtct

BL Cctccaaagtttgcaatgttatct LE ttgccattagggttcccattTTTTTaggcataggacccgtgtct

BL Ctctcagaaatggctctgtgga LE aagatatccttctttctgatcatactttTTTTTaggcataggacccgtgtct

BL Gggaaagagtagctattatttcattca LE tgggtggtgccaccaatatgTTTTTaggcataggacccgtgtct

Ces1d (NM_053200) b LE tggcagagctttgcattcacTTTTTaggcataggacccgtgtct

CEc tctgggctgcctgagttgagTTTTTctcttggaaagaaagt LE tcccttccctgggctctgTTTTTaggcataggacccgtgtct

CE cctctgggctgactccttggTTTTTctcttggaaagaaagt BL Atggtctcctactacattcttggg

CE gaaggagataaatatttcctttttaatgTTTTTctcttggaaagaaagt BL Cgaagacagagtagacatcatctgc

LE cttctggtcatattctggccagtTTTTTaggcataggacccgtgtct BL Accctctcttaaaattggagcac

LE gcaccaatcttcagatacccttcTTTTTaggcataggacccgtgtct BL Gaatttcatcaccatcttgctgag

LE actcacttctttgtccttcagccTTTTTaggcataggacccgtgtct BL Ccgagcaaagttggccca

LE acatgttccctgtgggatggTTTTTaggcataggacccgtgtct BL Ccttcagtctctgggcttgc

LE tgaccctcctgatcagagctcaTTTTTaggcataggacccgtgtct BL Gtgtccagaaagtcacttcctctt

LE gactccaggttcttaagcacagcTTTTTaggcataggacccgtgtct BL Ggttgtttcttggcaagggact

BL ccctgagctcagcccaaaa BL Agctcattgtggtatggctgg

BL aaatcttctgtggaataatactccttt BL Acatacactgttagtggaagaaccata

BL cttcaaagataagtgttatttttctacaa BL Cctccaagatccatcttggattt

BL catttgtatgaaataccatataatgttatag BL Cctatatctatgacaaagttcttcaggat

BL tcaaaacattattttattttttacaagtt BL Ggccaatgaggcagccct

Ces1e (NM_133660) Ces1g (BC026897)

CE aaagggatggctctgtctggaTTTTTctcttggaaagaaagt CE cccaaatttcattttcagtgagaTTTTTctcttggaaagaaagt

CE ttctcagccaggatctcctcaTTTTTctcttggaaagaaagt CE ggaggaagggatagctctctctgTTTTTctcttggaaagaaagt

CE ggcagaatccagccaaactcTTTTTctcttggaaagaaagt CE cagcttttcagagatgttaagaattgTTTTTctcttggaaagaaagt

LE gtctccatgcaaatccagcttaTTTTTaggcataggacccgtgtct LE gcaacactccatcaatcacagtagTTTTTaggcataggacccgtgtct


at ASPE

T Journals on N

ovember 11, 2021


Dow

nloaded from


DMD #43877

30

LE ttgcttgttgattcccacgaTTTTTaggcataggacccgtgtct LE gccaaactcatgcttgttgatgTTTTTaggcataggacccgtgtct

LE gagggtgggtagttcatcatagttTTTTTaggcataggacccgtgtct LE gatgcagctgtcttctggtccTTTTTaggcataggacccgtgtct

LE ggacttcttcaagagagacatggcTTTTTaggcataggacccgtgtct LE ggtaggcctgccacaggatgTTTTTaggcataggacccgtgtct

LE tggccactgcaattgcatcTTTTTaggcataggacccgtgtct LE gcagggtcttctgtccctcctaTTTTTaggcataggacccgtgtct

LE ccacatccccaatcaattccTTTTTaggcataggacccgtgtct LE ccaggaacaggtctgtcattgtgTTTTTaggcataggacccgtgtct

Ces1g (Cont’d) Ces2b (Cont’d)

LE ccgaacataatgtctccaatcaagtTTTTTaggcataggacccgtgtct BL accagggcctctgagtccat

BL Cctccaagagctcatcttcagtct BL ttaatagccagaatctctgcttcac

BL Gggtctccaagaaaatcaacagt BL gggatcatctggacaagcttg

BL Ttgaaactcttctcagccagaatc BL ttgggatgcctggggaag

BL Cccaccatgtaggggacagtg BL atgctggggacagggtgaa

BL Ccaaaaacattggaatgatcca BL aggttctctctggttatttcctttat

BL Agttttctttcagagagtgggaagt Ces2c (NM_145603)

BL Aatacttttcaatagctgctggaat CE gcaggttagagccctcatggTTTTTctcttggaaagaaagt

BL Tcttctggtgcctttggca CE tctggcatgctggtctccagTTTTTctcttggaaagaaagt

Ces2a (NM_133960) CE cgtagggcagctgcttggtTTTTTctcttggaaagaaagt

CE agctcctcctcctcagtgaggTTTTTctcttggaaagaaagt LE tgttgagatacaggcagtcctcaTTTTTaggcataggacccgtgtct

CE catttcttgcgaaattggccTTTTTctcttggaaagaaagt LE ccatggatccacaccatcacagTTTTTaggcataggacccgtgtct

CE gaactgcagccttctggccTTTTTctcttggaaagaaagt LE ccaccaagtcctcattgactgtcTTTTTaggcataggacccgtgtct

CE ctctgcatgcttgtcctgagaaTTTTTctcttggaaagaaagt LE cccagacgatactggatagtaacaaTTTTTaggcataggacccgtgtct

LE tccaaattcatgtcccacaaataTTTTTaggcataggacccgtgtct LE ccaggtatccccagttgccTTTTTaggcataggacccgtgtct

LE caggtactgctcatcatggtccTTTTTaggcataggacccgtgtct LE cgatgttctgctggacccagTTTTTaggcataggacccgtgtct

LE caggctgggtgtccagctgTTTTTaggcataggacccgtgtct BL Ccattcctataaccagtgcacct

LE ttcagggctcgacccacagTTTTTaggcataggacccgtgtct BL Aatagagatccatcaaacatggaag

LE ccctgacacaggacgctacagTTTTTaggcataggacccgtgtct BL Tgctgaaaaagcccaggaca

LE atctgcttttaatctcacacaccttTTTTTaggcataggacccgtgtct Ces2e (NM_172759) LE ggactttgtaacctcagaattacaccTTTTTaggcataggacccgtgtct CE tgattatttctgttattgagttacaggtcTTTTTctcttggaaagaaagt

BL Cagtacttcatcatcatcctctttagc CE ggaaaggatgcgatttcctctTTTTTctcttggaaagaaagt

BL Ccctcactgttggggttcc CE attcttggccttgcttgaggTTTTTctcttggaaagaaagt

BL Aacacaggccaggagggtaga LE ttgctatgttgtccatggtggtTTTTTaggcataggacccgtgtct

BL Ggggcagagtcttggtcca LE gtttgcaagttaccccagctagTTTTTaggcataggacccgtgtct

BL Cccttgagctcctggatcttct LE ccacagaactttacatacatttctgttTTTTTaggcataggacccgtgtct

Ces2b (BC015286) LE cattttctcaccctctatttctcataTTTTTaggcataggacccgtgtct

CE aatgttctgctggatccagcTTTTTctcttggaaagaaagt LE gacatcagaggtctagtagctgagcTTTTTaggcataggacccgtgtct

CE cactctccatgatggctccatTTTTTctcttggaaagaaagt LE atagggacaatggacacagtttttTTTTTaggcataggacccgtgtct

CE tgtttgagcagagcccatgaTTTTTctcttggaaagaaagt LE gcctgctggtcaacccccTTTTTaggcataggacccgtgtct

LE gtagggcagccacttgatccTTTTTaggcataggacccgtgtct BL Cctgaaagactgtatggctcaagtt

LE tgtgccacctgcagactcgTTTTTaggcataggacccgtgtct BL Agtagctggaatgttcagtggct

LE ggcctcacatccagagagcttTTTTTaggcataggacccgtgtct BL Ttcacaaaagtagataatggcaattt

LE ttttgcctctcagacagcgcTTTTTaggcataggacccgtgtct BL Tgtctataaacataccaagtcaagctt

LE aactctccatccaccacagcaTTTTTaggcataggacccgtgtct Ces3a (BC061004)

LE aatcctcagatgccaacaactctTTTTTaggcataggacccgtgtct CE cccaggctggcttgaacttTTTTTctcttggaaagaaagt

LE actcatcgttgttgacaccaatgTTTTTaggcataggacccgtgtct CE tctgggaaggccaggaggTTTTTctcttggaaagaaagt


at ASPE

T Journals on N

ovember 11, 2021


Dow

nloaded from


DMD #43877

31

LE ccacaggaatggtccaaccaaTTTTTaggcataggacccgtgtct CE gcaaactggctccattgggTTTTTctcttggaaagaaagt

LE ttgtattcttcaaaacagcctgcTTTTTaggcataggacccgtgtct LE cagaggaatggtcagccttcaTTTTTaggcataggacccgtgtct

BL gtttgcctccaaagtgggc LE cctccaaaaacaaaggcattctTTTTTaggcataggacccgtgtct

BL ccaaaaatagtgacccggtcag LE ccatcatggtcaggctcagcTTTTTaggcataggacccgtgtct

BL ggacacaacatgggaagacacact LE cattgggatttcctgtgcgtTTTTTaggcataggacccgtgtct

BL ggaagagtcctttggacatggg LE aggaggcagccccttgcTTTTTaggcataggacccgtgtct

BL aggaagcagggccaccc LE tctagaccaatctccaagtattgttctTTTTTaggcataggacccgtgtct

BL atctcagaggtgtcagtgataaggta LE cttcaccccagtccgtggtTTTTTaggcataggacccgtgtct

BL ggccaccgtagtggagacc LE aactgtagccgacccttctttagTTTTTaggcataggacccgtgtct

Ces3a (Cont’d) Ces5a (Cont’d)

BL Tgcaaaagaactgggtgtatgc BL Agagcagtagactcattggagcc

BL gaactctcatcagtgaggaaagga BL Tgcagcaaagtatgtatcaaggtg

BL Tgcttctcttcctctgtggcc BL Catggaagtactctttagtcacaatgt

BL Aactggtttaattggggcca BL Aagtccagtaaagtgtctcggatg

Ces5a (AB186393) Aadac (NM_023383) CE aagaagacttttccctcaggcaTTTTTctcttggaaagaaagt CE cgcctgagagccattgactttTTTTTctcttggaaagaaagt

CE tcgagtgaatgattttgctttctTTTTTctcttggaaagaaagt CE tgggctgtccatctcgatagagTTTTTctcttggaaagaaagt

CE tcctggttattgactccaatgatagTTTTTctcttggaaagaaagt CE ccatcgtaaactacgatacacatcttcTTTTTctcttggaaagaaagt

CE tcggtcggagaatgcttgcTTTTTctcttggaaagaaagt LE cttttgggtatgtatatgcggacTTTTTaggcataggacccgtgtct

LE gcaaccacctgcaaatcatgTTTTTaggcataggacccgtgtct LE caccatgaatataaaacaagcccTTTTTaggcataggacccgtgtct

LE tgatacattgcaatcacaaacatttTTTTTaggcataggacccgtgtct LE ctccccaaacaccagccacTTTTTaggcataggacccgtgtct

LE ggctaaggctcatcaactccaTTTTTaggcataggacccgtgtct LE tgacacaacaacagcatcaagtttaTTTTTaggcataggacccgtgtct

LE aaggtactattttcaatgtcttttgagTTTTTaggcataggacccgtgtct LE gactctcctaggatctacaccatatttTTTTTaggcataggacccgtgtct

LE acgggcaatatgtagccacacTTTTTaggcataggacccgtgtct LE cagcactgtctccagacacaccTTTTTaggcataggacccgtgtct

LE acaaatgctgggtggggataTTTTTaggcataggacccgtgtct LE agctgcggctaagtttccacTTTTTaggcataggacccgtgtct

BL Tttcagatcattatcagagctcttca BL Tgtcataggagaagtgagcagca

BL Cttcagcaaagccttggagtc BL Tggggctaagccatagtcagt

BL Agaagaaagaaccgtcgaccac BL Aaactgtcttggaaaatggtgttt

BL Acaacagttctagtggttcttcgg BL Ttcaaggacgtcctcttgtaagaa

BL Gaggagaatctcaggagtgtctctc

Note:

aFunction refers to the type of bDNA oligonucleotide probe represented by each sequence.

bGenBank accession numbers for each transcript are given in cell under the gene name.

cCE, capture extender; LE, label extender; BL, blocker.


at ASPE

T Journals on N

ovember 11, 2021


Dow

nloaded from



at ASPE

T Journals on N

ovember 11, 2021


Dow

nloaded from



at ASPE

T Journals on N

ovember 11, 2021


Dow

nloaded from



at ASPE

T Journals on N

ovember 11, 2021


Dow

nloaded from



at ASPE

T Journals on N

ovember 11, 2021


Dow

nloaded from



at ASPE

T Journals on N

ovember 11, 2021


Dow

nloaded from



at ASPE

T Journals on N

ovember 11, 2021


Dow

nloaded from



at ASPE

T Journals on N

ovember 11, 2021


Dow

nloaded from


Transcription Factor-Mediated Regulation of ...

Documents