Role of HDAC6 in Transcription Factor EB Mediated Clearance of Misfolded Proteins in Chronic Kidney Disease by Angela Brijmohan A thesis submitted in conformity with the requirements for the degree of Master of Science Institute of Medical Science University of Toronto © Copyright by Angela Brijmohan 2017
Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Role of HDAC6 in Transcription Factor EB Mediated Clearance of Misfolded Proteins in Chronic Kidney
Disease
by
Angela Brijmohan
A thesis submitted in conformity with the requirements for the degree of Master of Science
Institute of Medical Science University of Toronto
© Copyright by Angela Brijmohan 2017
ii
Role of HDAC6 in Transcription Factor EB Mediated Clearance of
Misfolded Proteins in Chronic Kidney Disease
Angela Brijmohan
Master of Science
Institute of Medical Science, University of Toronto
2017
Abstract
The autophagy-lysosomal pathway is a homeostatic mechanism to prevent the accumulation
of misfolded proteins. Here, we observed a downregulation in a master regulator of
autophagy, transcription factor EB (TFEB) and an increase in misfolded protein
accumulation in kidneys from humans with diabetic kidney disease and in subtotally
nephrectomized (SNx) rats, pointing to dysregulated autophagy as a common occurrence in
chronic kidney disease (CKD). In assessing methods to induce autophagy, we found that
inhibition of histone deacetylase 6 (HDAC6) caused hyperacetylation and nuclear
translocation of TFEB, and reduced cell death in cultured proximal tubule cells. Similarly,
in SNx rats, HDAC6 inhibition decreased misfolded protein accumulation in tubule
epithelial cells, attenuated tubule cell death, diminished fibrosis and blunted proteinuria.
These findings point to the occurrence of dysregulated autophagy in CKD and identify
HDAC6 inhibitors as a novel method to activate TFEB mediated upregulation of the
autophagy-lysosomal pathway that may confer renoprotective benefits.
iii
Acknowledgements
I would like to sincerely thank my supervisor and mentor Dr. Andrew Advani, for his guidance,
constructive feedback and patience during my time as a student. I would like to thank him for
giving me the opportunity to grow, contribute to the wealth of knowledge in the lab and to
collaborate with my fellow trainees. I would also like to thank him for teaching me strategies in
resilience and for his words of encouragement during times of adversity. Beyond our time in the
lab, I would like to thank him for his excellent career advice and for the opportunity to shadow
him in the clinic. Dr. Advani’s approach to medicine, both as a provider and an innovator, has
inspired me to pursue a similar career path. I am truly grateful to have found such an important
mentor.
I would also like to thank Dr. Andras Kapus and Dr. Kim Connelly for their time and feedback
on my project during our Professional Advisory Committee meetings. They challenged me to
think about my study in new ways and I have developed my scientific inquiry skills greatly
because of this exchange of ideas. Furthermore, I would like to thank my committee members
for taking the time to meet with me to provide career mentorship and advice as I prepare for the
next chapter of my educational journey.
I am indebted to the excellent technical support that brought this study to fruition. Specifically, I
would like to sincerely thank Bridgit Bowskill, Dr. Golam Kabir, Suzanne Advani and Dr. Youan
Liu for their patience in teaching me new skills at the bench and contributing to experimental
work presented in this thesis.
iv
I would like to thank our post-doctoral fellows Dr. Syamantak Majumder and Dr. Sri Batchu for
their time and patience in teaching me foundational scientific skills that I will carry with me in
my future career as a scientist. Thank you for constantly engaging me in conversations about new
literature in our field, patiently answering my questions and for helping me trouble-shoot
numerous experiments.
It is a pleasure to thank our collaborators, Dr. Laurette Geldenhuys and Dr. Ferhan S. Siddiqi for
providing samples for our human correlative studies, and for their feedback on our manuscript of
this work.
I would like to extend a very special thank you to my fellow graduate student Tamadher Alghamdi
in whom, I have found a lifelong friend and mentor. Thank you for the laughs and impromptu
karaoke sessions during our weekend experiments at the bench. More importantly, thank you for
your continued support and for being an exceptional role model. Thank you to Benjamin
Markowitz for patiently practicing PAC presentations with me and for your supportive words.
I would like to dedicate this thesis to my supportive parents, Jay Brijmohan and Shanta Brijmohan,
my twin sister Amanda Brijmohan, and to my late grandparents Ramdei Brijmohan and Ragnauth
Bridgemohan, for always encouraging me to be resolute in the pursuit of my goals.
v
Contributions
Dr. Laurette Geldenhuys and Dr. Ferhan S. Siddiqi provided archival human kidney samples for
human correlative studies (Figure 1 and Figure 2).
Dr. Golam Kabir performed the rat sham and subtotal nephrectomy surgeries throughout this study.
Bridgit B. Bowskill contributed to the assessment of proteinuria (Figure 16), systolic blood pressure,
glomerular filtration rate, body weight and kidney weight and general conductance of the
interventional study (Table 1).
Suzanne L. Advani contributed to the preparation of tissue for immunohistological stains for p62 in
human kidney sections (Figure 2) and collagen IV in rat kidney sections (Figure 17).
Dr. Youan Liu contributed to the isolation of RNA from paraffin-embedded human kidney sections
(Figure 1) and maintenance of NRK-52E cells for in-vitro experiments.
Dr. Syamantak Majumder contributed to assessment of TFEB mRNA levels in human kidney samples
(Figure 1) and preparation of samples for immunoprecipitation with TFEB (Figure 10).
Sarah McGaugh contributed to the quantification of nuclear TFEB in NRK-52E cells (Figure 11).
Dr. Sri N. Batchu contributed to the assessment of cell death in-vitro (Figure 12-13) and to the nuclear
fractionation procedure used to assess nuclear TFEB levels in kidney homogenates (Figure 18).
I sincerely thank the generosity of my funders from the Banting and Best Diabetes Centre, Faculty of
Medicine and the Queen Elizabeth II Scholarship in Science and Technology, University of Toronto.
I would also like to thank the Heart and Stroke Foundation of Canada for generously providing
operating grant funds. Support from these funders has been invaluable in helping me lay the
foundation for a career in scientific research.
vi
Table of Contents
ABSTRACT___________________________________________________________ii
ACKNOWLEDGEMENTS AND CONTRIBUTIONS____________________________iii
TABLE OF CONTENTS_________________________________________________vi
LIST OF ABBREVIATIONS______________________________________________xii
LIST OF TABLES_____________________________________________________xvi
LIST OF FIGURES___________________________________________________xvii
LIST OF APPENDICES________________________________________________xix
CHAPTER 1. LITERATURE REVIEW______________________________________1
1. Chronic Kidney Disease: Scope of the Problem__________________________1
2. Proteostasis and Kidney Disease______________________________________4
2.1 Overview: Endoplasmic Reticulum Stress and Quality Control_________________4
2.2 Endoplasmic Reticulum Stress in the Pathogenesis of Kidney Disease__________6
3. Regulation of the Autophagy-Lysosomal Pathway________________________7
3.1 Overview__________________________________________________________7
3.2 Transcription Factor EB (TFEB): A Master Regulator of the Autophagy-Lysosomal
Pathway______________________________________________________________9
3.3 Mechanisms of TFEB Activation_________________________________________9
3.4 TFEB as a therapeutic target__________________________________________13
4. HDAC6___________________________________________________________15
vii
4.1 Overview of Protein Acetylation________________________________________15
4.2 The 18 Members of the Histone Deacetylase Family________________________17
4.3 The Cytosolic HDAC: Histone Deacetylase 6 (HDAC6)______________________17
4.4 HDAC6 Enzymatic Substrates_________________________________________19
4.5 Non-Enzymatic Actions of HDAC6______________________________________19
5. HDAC6 as a Potential Regulator of TFEB_______________________________20
5.1 HDAC6 in Nuclear Translocation of Transcription Factors______________20
5.2 HDAC6 in Misfolded Protein Clearance____________________________21
6. Pharmacological Inhibitors of HDAC6_________________________________23
7. HDAC6, Proteostasis and Disease____________________________________28
8. HDAC6 and Kidney Disease__________________________________________30
CHAPTER 2. HYPOTHESIS AND RESEARCH AIMS_______________34
1. Hypothesis_______________________________________________________34
2. Research Aims____________________________________________________35
CHAPTER 3. MATERIALS AND METHODS______________________36
1. Human Studies____________________________________________________36
2. Real-Time PCR____________________________________________________36
2.1 RNA Isolation________________________________________________36
2.2 First Strand cDNA Synthesis____________________________________37
viii
2.3 Primer Selection_____________________________________________37
2.4 Plate Preparation and Analysis__________________________________38
3. Immunoblotting___________________________________________________39
3.1 Lysate Preparation____________________________________________39
3.2 Protein Concentration Determination______________________________40
3.3 Gel Electrophoresis___________________________________________40
3.4 Membrane Transfer___________________________________________40
3.5 Blocking the Membrane and Antibody Incubation____________________41
3.6 Detection and Analysis of Labelled Proteins________________________42
3.7 Re-probing the Nitrocellulose Membrane___________________________42
4. Cell Culture_______________________________________________________42
4.1 Cell Lines Used______________________________________________42
4.2 Tubastatin A Experiments______________________________________43
4.3 Endoplasmic Reticulum Stress Induced Apoptosis Experiments_________43
4.4 PE/Annexin V Apoptosis Detection Assay__________________________44
4.5 Immunoprecipitation__________________________________________44
5. Animals__________________________________________________________45
5.1 Subtotal Nephrectomy and Sham Surgery__________________________45
5.2 In-vivo Pharmacological HDAC6 Inhibition in Sham and SNx Rats_______46
5.2.1 Administration of Tubastatin A In-vivo_____________________46
5.2.2 Metabolic Caging and Urine Protein Excretion______________46
5.2.3 Glomerular Filtration Rate (GFR)________________________47
5.2.4 Systolic Blood Pressure_______________________________47
ix
6. Histology_________________________________________________________48
6.1 Tissue Sectioning____________________________________________48
6.2 Immunohistochemistry________________________________________48
6.3 Histological Analysis__________________________________________50
7. Immunofluorescence_______________________________________________51
7.1 Fixation____________________________________________________51
7.2 Immunofluorescent stain_______________________________________51
7.3 Analysis of Immunofluorescent Staining___________________________52
8. Statistics_________________________________________________________53
CHAPTER 4. RESULTS_____________________________________54
1. TFEB mRNA levels are diminished and p62-protein levels are increased in
kidneys of patients with diabetic kidney disease___________________________54
1.1 Clinical Characteristics of patients with diabetic kidney disease_________54
1.2 p62 protein levels are increased in renal tubules from patients with diabetic
kidney disease__________________________________________________55
2. Diminished TFEB expression and increased p62-protein aggregates are also a
feature of chronic kidney disease in subtotally nephrectomized rats__________57
2.1 Downregulation of TFEB mRNA is accompanied by increased p62 in kidneys
from subtotally nephrectomized rats_________________________________57
3. HDAC6 inhibition increases TFEB acetylation and nuclear localization in NRK-
52E cells____________________________________________________________64
3.1 Tubastatin A administration increases acetylation of the HDAC6 substrate α-
tubulin in NRK-52E cells___________________________________________64
3.2 HDAC6 inhibition increases TFEB acetylation_______________________65
x
3.3 HDAC6 inhibition increases TFEB nuclear translocation and transcriptional
activity in NRK-52E cells___________________________________________67
3.4 Tubastatin A prevents programmed cell death in NRK-52E cells_________68
4. Tubastatin A administration attenuates progressive proteinuria and structural
remodelling in experimental CKD_______________________________________72
4.1 Tubastatin A inhibits HDAC6 in rat kidneys_________________________72
4.2 Tubastatin A attenuates progressive proteinuria in subtotally nephrectomized
rats___________________________________________________________74
4.3 Physiological parameters of sham and subtotally nephrectomized rats treated
with vehicle or Tubastatin A________________________________________77
4.4 Tubastatin A attenuates tubulointerstitial, but not glomerular, collagen IV
deposition______________________________________________________79
4.5 Tubastatin A increases nuclear translocation of TFEB and reduces p62
accumulation in-vivo______________________________________________81
4.6 Tubastatin A attenuates tubule epithelial cell death in subtotally
nephrectomized rats______________________________________________83
CHAPTER 5. DISCUSSION___________________________________85
1. Overview_________________________________________________________85
2. TFEB downregulation is associated with increased p62-accumulation in human
diabetic kidney disease_______________________________________________86
3. Diminished TFEB and increased misfolded protein accumulation occur in
subtotally nephrectomized____________________________________________88
4. HDAC6 inhibition induces TFEB activity in NRK-52E cells_________________92
5. Tubastatin A prevents programmed cell death in NRK-52E cells____________95
xi
6. Tubastatin A is renoprotective in subtotally nephrectomized rats___________97
CHAPTER 6. CONCLUSION_________________________________101
CHAPTER 7. FUTURE DIRECTIONS__________________________102
REFERENCES____________________________________________105
APPENDICES____________________________________________128
xii
List of Abbreviations
7-AAD: 7-Amino-actinomycin
ATF6: activating transcription factor 6
AGEs: advanced glycated end products
ACEi: angiotensin converting enzyme inhibitor
ARB: angiotensin receptor blocker
ALP: autophagy-lysosomal pathway
ATGs: autophagy-related proteins
Bcl-2: B-cell lymphoma 2
Bcl-XL: B-cell lymphoma-extra large
Aβ: β-amyloid
PB1: Bem1p
BiP: binding immunoglobulin protein
BSA: bovine serum albumin
CIHI: Canadian Institute for Health Information
CORR: Canadian Organ Replacement Register
ChIP-seq: chromatin immunoprecipitation sequencing
CKD: chronic kidney disease
CLEAR: Coordinated Lysosomal Expression and Regulation network
DD: deacetylase domains
DiaComp Diabetic Complications Consortium
DMSO: Dimethyl sulfoxide
DMB: dynein motor binding domain
xiii
ER: endoplasmic reticulum
ESRD: end-stage renal disease
ECL: enhanced chemiluminescent substrate
eGFR: estimated glomerular filtration rate
eIF2α: eukaryotic initiation factor 2 alpha
FBS: fetal bovine serum
FOXO: Forkhead box O
GATA-1: GATA binding factor 1
GATA4: GATA binding protein 4
GFR: glomerular filtration rate
GEF: guanine nucleotide exchange factor
HSP90: heat shock protein 90
HSF1: heat-shock transcription factor 1
HATS: histone acetyltransferases
HDAC: histone deacetylase
HDAC6: histone deacetylase 6
IMPC International Mice Phenotyping Consortium
IRE1alpha: inositol-requiring enzyme 1
KDOQI: Kidney Disease Outcomes Quality Initiative
Klf-4 Kruppel-like factor 4
LcoR: ligand-dependent corepressor
LAMP1: lysosomal associated membrane protein 1
LSD: lysosomal storage disorder
mTORC1: mammalian target of rapamycin complex 1
xiv
LC3 microtubule associated protein 1A/1B light chain 3B
MCOLN1: mucolipin 1
NES: nuclear export signal
NF-κB: nuclear factor kappa-light-chain enhancer of activated B cells
NLS: nuclear localization signal
NRK: normal rat kidney
sequestosome 1: p62/SQSTM1
PBS: phosphate buffer saline
PS: phospholipid phosphatidylserine
PERK: protein kinase R-like endoplasmic reticulum kinase
Rags: Rag GTPases
RT-PCR: real time polymerase chain reaction
RIN RNA integrity number
ACY-1215 rocilinostat
RUNX2: runt-related transcription factor 2
SE14: Ser-Glu-containing tetrapeptide
siRNA: small interfering RNA
SGLT2 sodium glucose cotransporter 2
s.c: subcutaneous
SBP: systolic blood pressure
TUNEL: terminal deoxynucleotidyl transferase dUTP nick end
labeling
TFEB: transcription factor EB
TGF-ß: transforming growth factor-ß
xv
TBS-T: tris-buffer saline-tween 20
ZnF-UBP or BUZ: ubiquitin binding zinc finger domains
UPS: ubiquitin proteasome system
UPR: unfolded protein response
UUO unilateral ureteral obstruction
v-ATPase: vacuolar-type H+-ATPase
xvi
List of Tables
Table 1. Functional characteristics of sham-operated and subtotally nephrectomized
(SNx) rats treated with vehicle or Tubastatin A.
xvii
List of Figures
Chapter 1. Literature Review
Figure A. Summary of the autophagy-lysosomal pathway.
Figure B. Structure of HDAC6.
Figure C. Role of HDAC6 in the cellular response to protein misfolding.
Figure D. Typical structure of HDAC inhibitors.
Figure E. Conditions associated with altered HDAC6 activity or in which HDAC6 inhibition
may confer therapeutic benefit.
Chapter 4. Results
Figure 1. TFEB mRNA levels are diminished in kidney tissue from people with diabetic
kidney disease.
Figure 2. p62 levels increase in renal tubules of patients with diabetic kidney disease relative
to control.
Figure 3. TFEB mRNA levels are diminished in the kidneys of subtotally nephrectomized
rats relative to sham-operated controls.
Figure 4. p62 immunostaining is increased in subtotally nephrectomized rat kidneys relative
to sham-operated controls as determined by immunohistological stain.
Figure 5. p62 protein levels are increased in kidneys from subtotally nephrectomized rats
compared to sham-operated controls, as determined by immunoblot.
Figure 6. Total ubiquitin levels are increased in subtotally nephrectomized rat kidneys
relative to sham-operated rats.
Figure 7. Protein levels of the endoplasmic reticulum stress marker phospho-eIF2α are
increased in subtotally nephrectomized rat kidneys relative to sham-operated rats.
xviii
Figure 8. p62 does not co-localize with the lysosomal membrane protein LAMP-1 in rat
kidney tubule epithelial cells.
Figure 9. Tubastatin A induces a dose-dependent increase in acetylated α-tubulin levels in
NRK-52E cells.
Figure 10. Tubastatin A increases TFEB acetylation in NRK-52E cells.
Figure 11. Tubastatin A increases TFEB nuclear localization in NRK-52E cells.
Figure 12. Tubastatin A attenuates programmed cell death in NRK-52E cells as assessed
by cleaved caspase-3.
Figure 13. Tubastatin A attenuates programmed cell death in NRK-52E cells as assessed
by annexin V positive staining.
Figure 14. Tubastatin A increases acetylated α-tubulin levels in rat kidney homogenates.
Figure 15. Flow diagram of in-vivo pharmacological study of HDAC6 inhibition in subtotally
nephrectomized rats (SNx).
Figure 16. Tubastatin A attenuates progressive proteinuria in subtotally nephrectomized
rats.
Figure 17. Immunohistological stain for collagen IV in sham and subtotally nephrectomized
rats treated with vehicle or Tubastatin A.
Figure 18. Tubastatin A increases nuclear localization of TFEB which is accompanied by a
reduction in p62-labelled protein aggregates in the kidneys of subtotally nephrectomized rats.
Figure 19. Tubastatin A reduces the number of TUNEL positive nuclei in subtotally
nephrectomized rats.
Chapter 6. Conclusion
Figure F. HDAC6 inhibition facilitates transcription factor EB mediated clearance of
misfolded protein in chronic kidney disease.
xix
List of Appendices
Recipes for buffers and solutions
10X Transfer Buffer
10X Running Buffer
10X TBS Buffer
5% Blocking Solution (for Immunoblot)
2% Blocking Solution (for Immunofluorescence)
Citric Acid Buffer
Scott’s Tap Water
Homogenization Buffer
5% FITC-inulin
1
Chapter 1
Literature Review
Sections have been modified from Batchu SN*, Brijmohan AS*, Advani A [2016]. The Therapeutic Hope for HDAC6
Inhibitors in Malignancy and Chronic Disease. Clinical Science 987-1003. *These authors contributed equally to this
publication.
1 Chronic Kidney Disease: Scope of the Problem
Chronic kidney disease (CKD) can be a devastating condition that shortens the quality and
quantity of life for many Canadians, and its prevalence is increasing at an alarming rate.
According to the Canadian Organ Replacement Register (CORR) annual report by the Canadian
Institute for Health Information (CIHI), three million Canadians are affected by CKD today,
reflecting an increase of 35% over the last decade (CORR, 2015). This increase is associated with
a 60% increase in the prevalence of diabetes, named the leading cause of CKD in the industrialized
world (CORR, 2015). Presently, the best therapeutic option for patients faced with end-stage
renal disease (ESRD), is kidney transplantation, but the demand for kidneys consistently
outweighs supply, requiring alternative forms of renal replacement therapy such as dialysis.
While a large proportion of patients will ultimately depend on dialysis, this is a time intensive
option that costs the Canadian health care system an average of $95,000-$107,000 per person per
year (Klarenbach et al., 2014). In addition, mortality for patients on dialysis is high, with less
than 45% surviving after five years (CORR, 2015). With serious questions about the economic
sustainability of current kidney disease treatments, coupled with a growing margin between
kidney supply and demand for transplantation, new therapies must be explored to manage the
growing kidney disease burden in an aging Canadian population (CORR, 2015).
2
CKD encompasses a group of disorders that impair the structure and function of the kidney. This
leads to impairment in the kidney’s ability to complete its normal roles of excretion of waste,
reabsorption of nutrients, pH and fluid balance, and blood pressure regulation. Impaired function
in these roles is captured in laboratory analyses of glomerular filtration rate (GFR) and urine
albumin and therefore, these tests are used clinically in determining the presence and severity of
CKD. According to the National Kidney Foundation’s KDOQI Guidelines, measures of GFR are
used to classify kidney disease into five stages: greater than 90 mL/min per 1.73 m2 (stage 1), 60-
89 mL/min per 1.73 m2 (stage 2), 30-59 mL/min per 1.73 m2 (stage 3), 15-29 mL/min per 1.73 m2
(stage 4) and less than 15 mL/min per 1.73 m2 (stage 5 or ESRD) (National Kidney Foundation,
2002). In addition to GFR decline, increasing albuminuria levels positively correlate with
mortality, worsening kidney outcomes and an increased risk of cardiovascular disease (Astor et
al., 2011; de Jong and Curhan, 2006). Over time, trace amounts of albumin, termed
microalbuminuria (200 µg/min or 30-300 mg/d), may appear in the urine as a marker of early
kidney disease. While very common amongst people with diabetes, with 20-40% of patients
experiencing microalbuminuria early in their disease, untreated microalbuminuria can result in
macroalbuminuria (urine albumin excretion rate greater than 200 µg/min), and correlates with
declining GFR. In addition to a progression to ESRD, declining GFR is associated with a five-
fold increased risk of cardiovascular disease relative to the general population (Stenvinkel, 2010).
Beyond an increased cardiovascular risk, progressively declining kidney function is also
associated with acute kidney injury, infection, cognitive decline, and frailty (Hailpern et al., 2007;
James et al., 2010; James et al., 2009), thus further complicating the management of an already
complex disease.
In the industrialized world, the major pathological processes leading to CKD are 1) diabetes and
2) hypertensive nephrosclerosis, both of which are associated with diabetes, hypertension,
3
cardiovascular disease, obesity and old age (Pinto, 2007). With 50% of people with diabetes
developing some form of kidney disease, diabetic kidney disease is the most common cause of
renal failure (Saran et al., 2016) and is likely related to both local and systemic changes to the
renal milieu under hyperglycemic conditions. For example, in terms of its pathophysiology,
increased protein and glycated products in the urinary filtrate leads to damage of the
tubulointerstitium, the compartment of the kidney that comprises 80% of the renal volume
(Remuzzi et al., 2006). Under conditions of deranged hyperglycemic and metabolic conditions,
products such as advanced glycated end products (AGEs) can accumulate. In the proximal tubule,
reabsorption of AGEs can trigger profibrotic and proapoptotic signalling, the deposition and
impaired clearance of fibrotic matrix components such as collagen and a consequent reduction in
renal function (Yamagishi and Matsui, 2010). In addition to increased fibrogenic factors,
inflammatory cytokines in the renal parenchyma and impaired clearance of matrix proteins also
contribute to the manifestation of maladaptive fibrotic remodelling (Hodgkins and Schnaper,
2012).
Irrespective of the primary cause however, research shows that once kidney disease progresses
past a critical point, further decline is irreversible and independent of the initial insult, suggesting
cellular derangements that may precede the classical pathological changes noted above. In
shifting the focus from parenchymal changes to cellular changes, accumulating evidence points
to a derangement in the homeostatic capacity of tubule cells to maintain protein folding fidelity
under stressful disease conditions (Cybulsky, 2013). This increase in protein misfolding at the
site of the endoplasmic reticulum (ER), termed endoplasmic reticulum stress (ER stress), may be
a precipitating factor that leads the tubule cell along a slippery slope of maladaptive signaling and
4
irreversible damage that manifests itself as increased fibrosis and impaired renal function as
discussed below.
2 Proteostasis and Kidney Disease
2.1 Overview: Endoplasmic Reticulum Stress and Quality Control
Cells maintain protein homeostasis (proteostasis) through intricate networks of regulation of the
endoplasmic reticulum and mitochondria, acting to maintain the fidelity and diversity of the
proteome (Balch 2008, Powers 2013). These networks are two-fold. They include i) coordination
of chaperones, such as heat shock proteins, to optimize protein folding, and ii) degradation
systems for the removal of misfolded, aggregated or dysfunctional proteins. These degradation
systems include, initially, the ubiquitin proteasome system (UPS), and then, the autophagy-
lysosomal pathway (ALP).
The endoplasmic reticulum has developed mechanisms to sense the accumulation of misfolded
proteins, and can impart signalling to the nucleus to increase transcription of chaperones to assist
in refolding of individual peptides; an adaptive reaction known as the unfolded protein response
(UPR) (Inagi et al., 2014). The presence of misfolded protein in the endoplasmic reticulum
signals the release of ER membrane bound binding immunoglobulin protein (BiP), which initiates
the UPR pathway through activating transcription factor 6 (ATF6), inositol-requiring enzyme 1
(IRE1α) and protein kinase R-like endoplasmic reticulum kinase (PERK) signalling (Cybulsky,
2013). While ATF6, and IRE1α increase the transcription of chaperones, PERK signalling leads
5
to phosphorylation of eukaryotic initiation factor 2 α (eIF2α). Phosphorylation of eIF2α reduces
the rate of translation by inhibiting the formation of the preinitiation complex for translation (de
Haro et al., 1996). This effectively halts the formation of new peptides as chaperones attempt to
refold aberrant proteins in the ER.
When the amount of misfolded proteins surpasses the refolding ability of molecular chaperones
and the UPR, misfolded proteins are shuttled towards the ubiquitin proteasome system (UPS) for
bulk protein degradation (Cybulsky, 2013; Dobson, 2003). In this system, misfolded protein
substrates are covalently tagged with ubiquitin through a three step ubiquitin ligase enzymatic
reaction. The addition of this polyubiquitin tag shuttles misfolded protein to the 26S proteasome,
a barrel shaped structure that recognizes, unfolds and degrades substrates into smaller peptide
fragments (Olzmann et al., 2008).
When the ubiquitin proteasome system fails to contend with the growing number of misfolded
proteins, misfolded proteins are sequestered into large protein aggregates, known as aggresomes,
through the adaptor protein, p62, also known as sequestosome 1 (SQSTM1) (Komatsu and
Ichimura, 2010). As a key signalling molecule in the autophagosome-lysosomal pathway, p62,
along with additional binding partners, sequesters protein aggregates for bulk degradation through
the autophagy-lysosomal pathway through its ubiquitin recognition domain and self-
oligomerization through its N terminal Phox and Bem1p (PB1) domain (Komatsu et al., 2007;
Nezis et al., 2008). During autophagy, under the coordination of autophagy-related proteins
(ATGs), a large, double membrane structure known as the autophagosome develops and
6
sequesters cytoplasm, organelles and p62-tagged protein aggregates (Komatsu and Ichimura,
2010). Whereas the proteasomal system is dependent on deubiquitination and unfolding of its
substrates for degradation, the autophagosome degrades large numbers of protein aggregates
through fusion with the lysosome in a pathway known as the autophagy-lysosomal pathway
(Mizushima, 2009; Periyasamy-Thandavan et al., 2008). This process is summarized in Figure
A.
2.2 Endoplasmic Reticulum Stress in the Pathogenesis of Kidney Disease
Proximal tubule epithelial cells are highly specialized for the reabsorption and secretion of water,
solutes and proteins into the filtrate for maintenance of pH and osmotic regulation. They contain
extensive endoplasmic reticulum for the management and modification of secreted or reabsorbed
products. Because of this role, proximal tubule cells are sensitive to impaired proteostasis and
depend heavily on the UPR to ensure proper protein folding. However, states of chronic ER stress
can overwhelm the UPR and cause cells to initiate apoptosis (Inagi, 2010; Yamahara et al., 2013),
leading to loss of tubule cells and a progression to CKD (Taniguchi and Yoshida, 2015). Known
inducers of ER stress in renal tubules include proteinuria (Ohse et al., 2006), hyperglycemia
(Lindenmeyer et al., 2008), uremic toxins (Kawakami et al., 2010) and nephrotoxins such as
cisplatin (Khan et al., 2013). Not only do these factors increase ER stress, but they also reduce
the efficiency of the UPR, resulting in the cellular decision to undergo UPR mediated apoptosis
(Inagi et al., 2014). This accelerated rate of tubule cell loss stimulates fibrotic remodelling and a
progressive decline in renal function.
7
In the setting of chronic impairment of proteostasis, it is possible that the apoptotic result of long
term ER stress could also result from a dysregulation in autophagic capacity to clear away
misfolded proteins. Aberrant autophagy/lysosomal function is a common feature of many non-
renal disorders, including lysosome storage disorders (LSD), neurodegenerative disorders, and
aging. Since an appropriate autophagic response is necessary to eliminate damaged proteins, these
disorders are associated with accumulation of damaged mitochondria and protein aggregates that
can impair cell survival (Vitner et al., 2010). However, mechanisms of dysregulated autophagy
have yet to be fully defined in the setting of CKD.
3 Regulation of the Autophagy-Lysosomal Pathway
3.1 Overview
Cells have developed mechanisms to upregulate levels of autophagy to meet the demands of stress
conditions, such as protein misfolding, oxidative stress and starvation. In addition to post-
translational modification of regulatory proteins, several transcription factors play key roles in
autophagy activation and/or repression by changing expression levels of proteins involved in the
autophagy pathway. For example, transcription factors such E2F1, GATA binding factor 1
(GATA-1) and members of the Forkhead box O (FOXO) family upregulate autophagic processes,
while GATA binding protein 4 (GATA4) represses these pathways (Fullgrabe et al., 2014). These
transcription factors fine-tune control of different proteins involved in autophagy. Equally
important however, is the ability to regulate the lysosome’s capacity to manage increased
autophagic activity and degrade autophagic substrates.
8
Originally identified in the early 1950s, lysosomes are organelles rich in acidic hydrolases that
breakdown cytosolic components such as macromolecules and damaged organelles upon fusion
of the autophagosome and the lysosome. Whereas it was once believed that lysosomes served a
housekeeping, rather, that regulated process, recent evidence shows that under conditions of
cellular stress, lysosomal biogenesis can be transcriptionally induced to meet growing degradative
demands. In their analysis of the promoter regions of lysosomal genes, Sardiello and colleagues
identified a key 10-base-pair motif (GTCACGTGAC) located within 200 base pairs of the
transcriptional initiation site of lysosomal genes. This motif contained an E-box (CANNTG) that
binds a family of transcription factors known as the MiTF/TFE family. Collectively, this
suggested that lysosomal biogenesis can be induced through concurrent upregulation of lysosomal
genes to meet the growing demands of the cell. The network of lysosomal genes, under shared
transcriptional control, is known as the Coordinated Lysosomal Expression and Regulation
network (CLEAR network) (Sardiello et al., 2009). While the previously discussed transcription
factors impart fine-tuned control of autophagic proteins, the CLEAR network, as the name
suggests, allows for a larger, coordinated response to increase lysosomal biogenesis and the
collective activity of the autophagy-lysosomal pathway. Because of this, transcription factors that
regulate the CLEAR network have been termed “master regulators” of autophagy (Settembre and
Medina, 2015). A transcription factor that has gained a lot of attention as a master regulator is
transcription factor EB (TFEB) (Figure A).
9
3.2 Transcription Factor EB (TFEB): A Master Regulator of the
Autophagy-Lysosomal Pathway
TFEB belongs to the MiTF/TFE family of basic helix-loop-helix transcription factors and is
related to three additional family members: TFE3, MiTF, and TFEC. While MiTF and TFE3 are
not considered major regulators of lysosomal biogenesis (Hershey and Fisher, 2004; Meadows et
al., 2007; Motyckova et al., 2001), TFEB is unique in its breadth of lysosomal targets.
Overexpression of TFEB induced transcription of multiple lysosomal genes, namely, subunits of
the vacuolar-type H+-ATPase (v-ATPase), lysosomal transmembrane proteins such as the
lysosomal associated membrane protein 1 (LAMP1), and lysosomal enzymes, indicative of an
increase in lysosomal number (Sardiello et al., 2009). Furthermore, genome-wide chromatin
immunoprecipitation sequencing (ChIP-seq) found that CLEAR elements in the promoter regions
for lysosomal genes were highly enriched with TFEB, suggestive of TFEB’s ability to upregulate
large networks of lysosomal genes simultaneously (Palmieri et al., 2011). In addition to lysosomal
genes, TFEB can also bind to the promoter regions of genes associated with autophagy, such as
beclin-1 (Palmieri et al., 2011). Because of its ability to upregulate both of these degradative
pathways, TFEB is now viewed as a master regulator of the autophagy-lysosomal pathway
(Settembre et al., 2011).
3.3 Mechanisms of TFEB Activation
Under conditions of cellular stress, cells reduce rates of protein synthesis and increase autophagic
breakdown of macromolecules to maintain the supply of ATP and amino acids for new protein
synthesis. Cells have developed methods of sensing cellular stress though the activation of
10
mammalian target of rapamycin complex 1 (mTORC1), a serine/threonine kinase that regulates
cell division and nutrient management. Under normal conditions, mTORC1 is active and is
recruited to the lysosomal surface where it directs normal protein synthesis and prevents
autophagy. Under stressed conditions however, mTORC1 is inactivated and thus triggers a
cascade of events that stimulate autophagic processes (Raben and Puertollano, 2016). One of
these signalling events includes the regulation of TFEB.
Under conditions of nutrient abundance, TFEB is localized to the cytosol where it is recruited to
the lysosomal surface. Once there, mTORC1 phosphorylates TFEB at serine 211.
Phosphorylation at this site stimulates binding to the cytosolic chaperone 14-3-3, forming a
binding complex that sequesters TFEB in the cytosol and prevents its nuclear translocation
(Roczniak-Ferguson et al., 2012; Settembre et al., 2012).
This regulation of TFEB is achieved through interactions with the lysosomal surface protein
Ragulator, a pentameric protein complex with guanine nucleotide exchange factor (GEF) function
(Zoncu et al., 2011). Ragulator interacts with v-ATPases on the lysosomal surface to detect
changes in amino acid availability. In addition, Ragulator tethers Rag GTPases (Rags) to the
lysosomal surface and regulates its nucleotide state depending on nutrient availability. Under
conditions of abundance, Rags will interact with TFEB and recruit mTORC1 to the lysosomal
surface thus promoting spatial-temporal colocalization of TFEB and mTORC1 to the outer
lysosomal membrane. As a result, mTORC1 can phosphorylate TFEB, promote its interaction
with 14-3-3 and maintain TFEB in the cytosol (Zoncu et al., 2011). However, under conditions
11
of nutrient deprivation, the conformation of Rags proteins change, preventing their interaction
with TFEB and mTORC1. This prevents mTORC1 mediated inhibition of TFEB, leading to
calcineurin mediated dephosphorylation of TFEB (Medina et al., 2015), release from its binding
partner 14-3-3 and its subsequent nuclear translocation. Once in the nucleus, TFEB can
upregulate the CLEAR network to increase the activity of the autophagy-lysosomal pathway
(Martina et al., 2014). This processed is summarized in Figure A. The essential nature of TFEB
in increasing autophagy-lysosomal pathway activity means that it has the potential to clear
misfolded proteins efficiently upon induction. Indeed, many researchers have found initial
success in inducing TFEB activity in the treatment of model diseases characterized by protein
misfolding.
12
Figure A. Summary of the autophagy-lysosomal pathway. Under conditions of increased endoplasmic reticulum stress, misfolded proteins aggregate and are tagged by the protein aggregate marker p62, marking it as a substrate for autophagy mediated degradation. A double membrane structure known as the autophagosome forms around protein aggregates and fuses with the lysosome for degradation by lysosomal enzymes. The autophagy-lysosomal pathway is regulated by transcription factor EB (TFEB), which can increase the degradative capacity of this pathway as needed. Under basal conditions, mTORC1 phosphorylates TFEB thereby promoting its interaction with its binding partner 14-3-3 and sequestering it in the cytosol. Upon sensing cellular stress, mTORC1 is inactivated, resulting in dephosphorylation of TFEB, its release from 14-3-3 and subsequent nuclear translocation. There, it can upregulate a network of autophagy and lysosomal genes to increase the activity of the autophagy-lysosomal pathway.
13
3.4 TFEB as a Therapeutic Target
Neurodegenerative Disease
Studies have identified modulation of TFEB activity as a promising therapy for diseases
associated with impaired autophagic-lysosomal function. Specifically, in the context of
neurodegenerative disease, induction of TFEB activity has been found to improve protein
clearance in several models of Alzheimer’s disease, tauopathies and Parkinson’s disease.
Alzheimer’s disease is characterized by the abnormal deposition of protein aggregates known as
β-amyloid (Aβ) plaques and neurofibrillary tangles composed of aggregates of phosphorylated
tau protein (Himmelstein et al., 2012). This accumulation of protein aggregates has been linked
to a dampened autophagic response, as evidenced by a downregulation in TFEB and LAMP1 in
brain tissues from Alzheimer’s patients. In aged mice, normalization of TFEB levels decreased
Aβ plaques in both astrocytes and neurons, alleviated Aβ pathology and improved cognitive
function (Xiao et al., 2015). Similarly, in models of tauopathies, characterized by the abnormal
aggregation of neuronal phosphorylated tau protein, overexpression of TFEB increased clearance
of phosphorylated tau aggregates (Chauhan et al., 2015).
Parkinson’s disease results from a loss in dopamine producing neurons in the substantia nigra due
to the development of α-synuclein aggregates in their cytoplasm. Toxicity of these protein
aggregates has been linked to a downregulation of TFEB, resulting in lysosomal depletion and
insufficient autophagy (Dehay et al., 2013). As such, pharmacological inhibition of mTORC1
14
was found to activate residual TFEB, induce its nuclear translocation, improve clearance of α-
synuclein aggregates and reduce neurotoxicity (Decressac et al., 2013). Given this success,
modulation of TFEB is now being investigated as a therapy for other neurological conformational
disorders, namely, spinal and bulbar muscular atrophy and Huntington’s disease (Raben and
Puertollano, 2016).
Lysosomal Storage Diseases
Lysosomal storage disorders (LSD) encompass 50 related conditions in which defective
lysosomal hydrolysis results in an accumulation of toxic macromolecules (Vellodi, 2005).
Upregulation of TFEB has been shown to increase clearance of these macromolecules in several
models of LSD, namely, mucopolysaccharidosis, lipofuscinosis (Batten disease), and Pompe’s
disease (Medina et al., 2015; Spampanato et al., 2013). In addition to the upregulation of
lysosomal biogenesis, the benefit of TFEB upregulation in LSD has also been credited to its role
in increasing exocytosis, a process by which a local spike in calcium stimulates fusion of
lysosomes with the plasma membrane, allowing release of their degraded contents (Medina et al.,
2015). In addition to increasing lysosome number, TFEB also regulates this stimulatory calcium
flux through upregulation of the cation channel mucolipin 1 (MCOLN1) (Medina et al., 2015).
Given the benefit of increased TFEB activation in conformational diseases such as
neurodegeneration and LSD, researchers have explored methods of inducing its translocation,
namely through inhibition of mTORC1. Such inhibitors include rapamycin, rapalogs and ATP-
competitive inhibitors (Pallet and Legendre, 2013). However, clinical use of these drugs has been
15
limited due to their unpredictability and adverse side effects profiles, especially in the kidney.
Rapamycin analogs, (e.g sirolimus, everolimus and temsirolimus) for example, have been shown
to induce proteinuria or worsen pre-existing proteinuria (Diekmann et al., 2012), a side effect that
would preclude their use for the clearance of misfolded proteins in CKD, if found to be a
pathogenic feature of the disease.
Given the adverse kidney risks with mTORC1 inhibitors, identifying mTORC1 independent
methods of regulating TFEB nuclear translocation may allow for therapeutic upregulation of
TFEB mediated pathways without adverse side effects on renal function. Interestingly, while
modulation of TFEB’s phosphorylation status is the most widely studied form of its regulation,
recent literature points to another form of post-translational regulation of TFEB, namely, through
its acetylation (Bao et al., 2016). Therefore, just as kinases impart regulation of TFEB’s
phosphorylation, regulators of acetylation may offer insight into novel mechanisms of regulating
TFEB cellular localization and function. One enzyme that affects protein acetylation and controls
nuclear translocation is histone deacetylase 6 (HDAC6).
4 HDAC6
4.1 Overview of Protein Acetylation
Post translational modification is the covalent modification of chemical moieties to a protein
following its biosynthesis, commonly through an enzymatic reaction. In this way, post
translational modification increases the diversity of protein behavior and enables cells to adapt to
16
changing internal and external microenvironments. The most studied form of post translational
modification is (de)phosphorylation, the addition of a phosphate group regulated by kinase and
phosphatase enzymes. As changes in post-translational phosphorylation have been implicated in
disease states, the development of kinase inhibitors has enabled the in depth study of therapeutic
regulators of phosphorylation in the treatment of disease (Li et al., 2013). The addition or removal
of acetyl groups to proteins is a chemical modification known as (de)acetylation. These reactions
are regulated by a family of enzymes known as histone deacetylases and histone acetyltransferases
because they were first recognized for their role in (de)acetylating histones proteins (Brown et al.,
2000).
Two major types of protein acetylation have been described. The first type is the transfer of an
acetyl group to a nitrogen, a co-translational process occurring on the N-terminus of a growing
peptide (Polevoda and Sherman, 2000). The second type of acetylation is lysine acetylation. This
occurs on the ɛ-amino group of lysines on the N termini of histones and other proteins. Histone
acetyltransferases (HATS) add acetyl groups at these sites. HATS decondense the surrounding
chromatin and promote transcription. In contrast, histone deacetylases (HDACs) remove acetyl
moieties, and on histones, this results in chromatin condensation and transcriptional repression
(Brown et al., 2000).
Whereas HATS and HDACS were first appreciated for their role in (de)acetylation of histones,
they also have numerous non-histone substrates throughout the cell. In fact, the number of
17
acetylated substrates, or the acetylome, rivals the phosphoproteome in size, with one study
identifying 3600 acetylation sites on 1750 proteins (Choudhary et al., 2009).
4.2 The 18 Members of the Histone Deacetylase Family
The HDAC family consists of 18 isoforms that are categorized into four classes based on their
homology to yeast deacetylases: class I (HDAC1, 2, 3 and 8), class II, subdivided into class IIa
(HDAC4, 5, 7, 9) and IIb (HDAC6 and HDAC10), and class IV (HDAC11). These enzymes
contain a zinc binding domain in their catalytic site. Broadspectrum HDAC inhibitors can chelate
zinc at these sites and inhibit catalytic activity of HDAC enzymes. Class III HDACs are non-zinc
dependent and instead, exert their catalytic function through an NAD+ dependent mechanism.
Whereas most members of the HDAC family function to modulate histone acetylation and
transcription, a few members regulate cellular function through cytosolic substrates. HDAC6 is
unique in its subcellular localization. Unlike most HDACs which reside in the nucleus, HDAC6
is a predominantly cytosolic protein. Because of this localization, HDAC6 may exert its
enzymatic effects on a wide array of cytosolic substrates (Batchu et al., 2016).
4.3 The Cytosolic HDAC: Histone Deacetylase 6 (HDAC6)
Mammalian HDAC6 was discovered in 1990 based on its homology with the Saccharomyces
cerevisiae histone deacetylase, HDAC1 (Grozinger et al., 1999; Verdel and Khochbin, 1999). In
humans, HDAC6 is encoded on chromosome Xp11.22-23 (Voelter-Mahlknecht and Mahlknecht,
2003). An analysis of global expression patterns of HDAC6 showed that HDAC6 is most highly
18
expressed in the renal tubules of the kidney and seminiferous ducts of the testis (Uhlen et al.,
2015). HDAC6 is 1215 amino acids in length and has a molecular weight of 131 kDa. Human
HDAC6 contains an N-terminal nuclear export signal (Verdel et al., 2000) and a Ser-Glu
tetrapeptide motif, both of which are responsible for the cytosolic localization of HDAC6. It also
contains an N-terminus nuclear localization signal, which, when acetylated, sequesters HDAC6
in the nucleus and affects its catalytic function (Han et al., 2009; Liu et al., 2012b). Unlike other
HDACs, HDAC6 contains a full duplication of its catalytic deacetylase domains (DD), termed
DD1 and DD2. In addition, HDAC6 contains non-catalytic binding regions, namely, a dynein
binding domain and a C-terminus ubiquitin binding zinc finger domain (ZnF-UBP or BUZ
domain), allowing the protein to exert noncatalytic regulation of various cellular processes
(Seigneurin-Berny et al., 2001). The structure of HDAC6 is shown in Figure B.
Figure B. Structure of HDAC6. The protein possesses two NES. Human HDAC6 also contains a SE14 motif that helps to retain the enzyme within the cytoplasm. A NLS at the N-terminal helps the protein to shuttle between the nucleus and the cytoplasm. There are two catalytic domains (DD1 and DD2). A dynein motor-binding domain and a ZnF-UBP are important for the non-enzymatic actions of the protein (Batchu et al., 2016).
19
4.4 HDAC6 Enzymatic Substrates
Over the past two decades, a number of HDAC6 cytosolic substrates have been identified. The
microtubular protein α tubulin has been the most extensively studied with several independent
reports showing that HDAC6 deacetylates α-tubulin on lysine residue 40 (Hubbert et al., 2002;
Matsuyama et al., 2002; Zhang et al., 2003). By reducing the acetylation status of α-tubulin,
HDAC6 has been implicated in microtubule stability and cytoskeletal dynamics (Valenzuela-
Fernandez et al., 2008). Because α-tubulin is ubiquitously expressed, and deacetylated by
HDAC6 across cell types, the hyperacetylation of α-tubulin is an established marker of HDAC6
inhibition or depletion (Zhang et al., 2003). This has served as an important marker in testing the
efficacy of HDAC6 specific inhibitors which would be expected to increase α-tubulin acetylation
levels. Additional substrates include the redox regulatory protein peroxiredoxin (Parmigiani et
al., 2008), the cytoskeleton associated protein cortactin (Zhang et al., 2007) and the chaperone
binding protein heat shock protein 90 (HSP90) (Kovacs et al., 2005).
4.5 Non-Enzymatic Actions of HDAC6
Beyond its catalytic DD1 and DD2 domains, HDAC6 exerts non-enzymatic effects on cellular
function through its non-catalytic domains (Figure A). Through its ubiquitin binding zinc finger
(Zn-UBP) domain, and its dynein binding domain, HDAC6 interacts with polyubiquitinated
proteins and shuttles them as cargo through retrograde transport along microtubules, aggregating
them into large, insoluble protein structures known as aggresomes (Kawaguchi et al., 2003b).
These aggresomes are then tagged as substrates for clearance through the autophagy-lysosomal
pathway (Kopito, 2000). Indeed, HDAC6 plays a key role in the cellular response to protein
20
misfolding through both its catalytic and non-catalytic functions as elaborated upon in section 5.2
below.
5 HDAC6 as a Potential Regulator of TFEB
5.1 HDAC6 in Nuclear Translocation of Transcription Factors
As a cytosolic deacetylase, HDAC6 has been shown to regulate the nuclear shuttling of multiple
transcription factors through post-translational modification of lysine acetylation. This makes it
a plausible candidate in the search for deacetylase-mediated regulation of transcription factor EB
nuclear translocation. There are several examples by which HDAC6 regulates transcription factor
shuttling. Under basal conditions, HDAC6 forms a tri-complex with the chaperone protein HSP90
and the transcription factor heat-shock transcription factor 1 (HSF1) (Boyault et al., 2006b),
sequestering HSF1 in the cytosol. Upon sensing cellular stress as evidenced by an increase in
misfolded proteins, HDAC6 dissociates from the complex, leading to the nuclear translocation of
HSF1 and subsequent transcription of molecular chaperones for protein folding (Boyault et al.,
2006b). Similarly, HDAC6 imparts regulation of glucocorticoid receptor nuclear translocation
through a HSP90 dependent mechanism (Kovacs et al., 2005). Because of this role, HDAC6
inhibitors have shown promise in increasing nuclear translocation and, subsequent upregulation
of downstream pathways. For example, HDAC6 mediated deacetylation of the protein survivin
leads to its cytoplasmic retention (Riolo et al., 2012), and inhibition of HDAC6 consequently
increases nuclear translocation of survivin in breast cancer cells (Lee et al., 2016). Other such
transcriptional regulators subject to HDAC6 post translational modification include: runt-related
transcription factor 2 (RUNX2) (Westendorf et al., 2002), nuclear factor kappa-light-chain
21
enhancer of activated B cells (NF-κB) (Zhang and Kone, 2002) and the nuclear receptor
corepressor ligand-dependent corepressor (LcoR) (Palijan et al., 2009). In our search to identify
novel deacetylase regulators of transcription factor EB, HDAC6 satisfied our first query
surrounding a deacetylase enzyme that is known to regulate nuclear translocation of transcription
factors and misfolded protein disposal.
5.2 HDAC6 in Misfolded Protein Clearance
In addition to its role in transcription factor shuttling, HDAC6 has also been shown to play
multiple roles in the regulation of autophagy. The unique structure, and cytosolic localization of
HDAC6 lends itself to this function. The ZnF-UBP domain at its C-terminus enables HDAC6 to
bind to ubiquitinated proteins and the dynein motor binding domain enables HDAC6 to bind to
dynein. Dynein is a motor protein that uses ATP to migrate along microtubules generally through
retrograde transport towards the nucleus. Thus, the binding of HDAC6 to dynein enables the
transport of its cellular cargo of misfolded proteins along microtubules into a growing protein
aggregate structure known as the aggresome (Johnston et al., 2002) as shown in Figure C. As
such, HDAC6 is considered to favour the accumulation of misfolded proteins into aggresomes
and decreases their clearance through the UPS by reducing the catalytic activity of the 26S
proteasome (Boyault et al., 2006a). Interestingly, although the physical interactions between
ubiquitinated proteins, HDAC6 and dynein motors are mediated by its non-catalytic ubiquitin
binding domain, deacetylase activity is required for this function, with the reintroduction of
deacetylase-deficient HDAC6 to HDAC6 knockout cells being unable to restore aggresome
formation (Kawaguchi et al., 2003a). Further down the pathway of misfolded protein degradation,
HDAC6 also functions to recruit and deacetylate cortactin, which is necessary for
22
autophagosome-lysosome fusion under basal conditions (Lee and Yao, 2010) as seen in Figure C.
Despite these apparently enabling actions of HDAC6, its role appears far more complex under
disease settings, in which HDAC6 appears dispensable in promoting autophagosome-lysosome
fusion (Lee et al., 2010) and in some cases, HDAC6 inhibition actually promotes protein
clearance (Selenica et al., 2014) in neurodegenerative disease, a disease characterized by the
accumulation of misfolded proteins. Secondly, misfolded protein accumulation is a feature of
certain cancer therapies that exert their cytotoxic effects through inhibition of the proteasome and
it is in these two major disease classes that the effects of HDAC6 inhibitors have been most
extensively investigated to date.
23
Figure C. Role of HDAC6 in the cellular response to protein misfolding. HDAC6 binds ubiquitinated proteins through its ZnF-UBP domain and, after binding to dynein, transports its misfolded cargo along microtubules towards perinuclear aggresomes. Aggresomes are disposed of by autophagy and HDAC6 itself facilitates autophagy completion by recruiting and deacetylating cortactin, which is necessary for fusion of autophagosomes with lysosomes. HDAC6 also forms a tri-complex with HSP90 and HSF1. On sensing of ubiquitinated aggregates, HDAC6 dissociates from this tri-complex, allowing HSF1 migration to the nucleus and the transcription of molecular chaperone HSPs (Batchu et al., 2016).
6 Pharmacological Inhibitors of HDAC6
There are three broad categories of HDAC inhibitors: “pan” or broad-spectrum inhibitors, class-
specific inhibitors, and isoform-specific inhibitors. Two pan-HDAC inhibitors that have reached
the clinic, vorinostat (also known as suberoylanilide hydroxamic acid, SAHA) and romidepsin,
both inhibit zinc-dependent HDAC isoforms. Structurally, these HDAC inhibitors are composed
of a zinc binding group, namely, hydroxamic acid, thiol, carboxylic acid, ketone or substituted
aniline, that chelates zinc ions at the catalytic site; a linker domain and a cap group that blocks
24
binding of the substrate to the binding pocket (Dallavalle et al., 2012; Li et al., 2013) as shown in
Figure D. Variations in the cap region can confer isoform specificity because HDAC enzymes
differ in the pockets surrounding their enzymatic binding region (Nielsen et al., 2005). Whereas
these pan-HDAC inhibitors have gained regulatory approval for the treatment of some
hematological malignancies (Hymes, 2010), their use for the treatment of chronic conditions has
been limited by their hematological toxicity and QT prolongation (Shultz et al., 2011).
Figure D. Typical structure of HDAC inhibitors. Most HDAC inhibitors are made up of a zinc-binding group which chelates the zinc ion at the enzyme’s active site joined by a linker region to a cap group which binds to the substrate-binding region of the enzyme. The figure shows the HDAC inhibitor structure as it would fit within the catalytic DD2 region of HDAC6 (Batchu et al., 2016).
Unlike the deletion of other HDACs, deletion of HDAC6 yields a comparatively benign
phenotype in mice, suggesting that inhibiting this particular isoform may be better tolerated.
Specifically, whereas the genetic deletion of a number of HDAC isoforms (Haberland et al., 2009;
Lagger et al., 2002; Montgomery et al., 2007; Montgomery et al., 2008; Vega et al., 2004) has led
to perinatal lethality, HDAC6 knockout mice are viable and develop normally with only minor
abnormalities in cancellous bone density and a mildly underdeveloped immune response (Zhang
et al., 2008).
25
Tubacin, which stands for tubulin acetylation inducer (Haggarty et al., 2003b), was the first
generation of HDAC6 specific inhibitors. Identified from a screen of 7392 small molecule
inhibitors, it consists of a large cap composed of six hydrophobic rings and a 1,2 dioxane ring. Its
success as an HDAC6 specific inhibitor was evidenced by a marked increase in α-tubulin
acetylation, without altering histone acetylation. However, the application of tubacin for in-vivo
use has been limited due to its inefficient biosynthesis, hydrophobicity and lack of drug like
structure (Haggarty et al., 2003a; Haggarty et al., 2003b).
The HDAC6 inhibitor that has been most widely reported on in the biomedical literature to date
is Tubastatin A, the synthesis of which was originally described by Butler and co-workers in 2010
(Butler et al., 2010a; Butler et al., 2010b). The rational design of Tubastatin A is especially
interesting. To select for isoform specificity, the investigators set out to compare HDAC6 with
the Class I HDAC isoform, HDAC1. Because crystal structures have not been defined for
HDAC6 and HDAC1, the investigators instead elected to use a bioinformatic tool for predicting
protein structure based upon amino acid sequence (Roy et al., 2010). By comparing the modeled
catalytic pockets of HDAC1 and HDAC6, they discovered that although the active site is
conserved, the catalytic channel rim differs between the two isoforms being substantially wider
in HDAC6 than HDAC1 (Butler et al., 2010b). The investigators therefore set out to design
compounds based upon the canonical HDAC inhibitor structure (i.e. zinc binding group
[hydroxamic acid], linker and cap group) with a cap group that was large enough and inflexible
enough to occupy the catalytic channel rim of HDAC6 but not HDAC1 (Butler et al., 2010b). The
cap group that best fulfilled these requirements was the tricyclic structure of a carbazole cap
26
(Butler et al., 2010b). However, carbazoles are generally too lipophilic to make good drugs
offering suboptimal ADMET (absorption, distribution, metabolism, excretion and toxicity)
properties (Arnott and Planey, 2012). So, the investigators introduced a tertiary amine to disrupt
the planarity of the tricyclic ring and reduce lipophilicity (Butler et al., 2010b). Finally,
recognizing that the modeled catalytic channels of HDAC1 and HDAC6 also differ, with the
HDAC6 channel being wider and shallower, the investigators sought to adapt the linker region,
replacing the typical alkyl chain with bulkier and shorter aromatic moieties (Butler et al., 2010b).
The result was the synthesis of Tubastatin A, which has an IC50 for HDAC6 of 0.015 µM,
representing >1000-fold selectivity versus all other HDAC isoforms (except HDAC8, 57-fold
selectivity) (Butler et al., 2010b). In primary cultured neurons, Tubastatin A increased α-tubulin
acetylation without affecting histone acetylation and it dose-dependently protected against
oxidative stress-induced neuronal death (Butler et al., 2010b).
Whereas Tubastatin A has been relatively widely adopted into pre-clinical mechanistic studies,
the only preferentially HDAC6-specific inhibitor to have reached clinical trial is rocilinostat.
Rocilinostat is a hydroxamic acid derivative with an IC50 for HDAC6 of 5nM. However, it also
has activity against other HDAC isoforms with IC50s for HDACs 1, 2, 3 and 8 of 58 nM, 48 nM,
51 nM and 100 nM respectively (IC50 >1 µM for the other HDAC isoforms) (Santo et al., 2012).
As with other HDAC6 inhibitors, rocilinostat dose-dependently increased α-tubulin acetylation
without affecting the acetylation status of histone proteins (Santo et al., 2012). It also induced
less cytotoxicity in peripheral blood mononuclear cells and T cells than the pan-HDAC inhibitor,
vorinostat (Santo et al., 2012). Rocilinostat has mostly been studied for its role in combination
27
with proteasome inhibitors for the treatment of multiple myeloma or lymphoid malignancies
(Amengual et al., 2015; Dasmahapatra et al., 2014; Mishima et al., 2015; Santo et al., 2012).
Although Tubacin, Tubastatin A and rocilinostat have been the most extensively studied agents
to date, other HDAC6 inhibitors have also been synthesized. In 2008, Kozikowski and co-workers
reported the synthesis of HDAC inhibitors containing a phenylisoxazole as the cap group,
generating an HDAC6 inhibitor with picomolar potency (Kozikowski et al., 2008). Arylalanine
containing hydroxamic acids have also been reported as another class of HDAC6 selective
inhibitors, potent in low micromolar concentrations (Schafer et al., 2008; Schafer et al., 2009).
Because most HDAC inhibitors share a common structure, to enhance the HDAC inhibitor pool,
Inks and co-workers elected to screen the Library of Pharmacologically Active Compounds for
agents that exhibit HDAC inhibitory properties in a search for novel compounds with a novel
structure (Inks et al., 2012). Out of the library of 1280 compounds, they identified five with
HDAC inhibitory properties, one of which (a dual-specificity phosphatase inhibitor, NSC-95397)
being selective for HDAC6 (Inks et al., 2012). A number of analogues of the parent compound
were synthesized and one, NQN-1, demonstrated an IC50 for HDAC6 of 5.5 µM, with minimal
inhibitory activity against other HDAC isoforms (Inks et al., 2012). Molecules with a cyclic
peptide scaffold or chiral structure derivatives (Olsen and Ghadiri, 2009; Smil et al., 2009) and
sulfamide- (Jones et al., 2006), thiolate- (Itoh et al., 2007), trithiocarbonate- (Dehmel et al., 2008)
and mercaptoacetamide- (Kozikowski et al., 2007) based compounds have also been explored as
potential selective HDAC6 inhibitors.
28
7 HDAC6, Proteostasis and Disease
Like TFEB, the implication of HDAC6 in maintaining proteostasis highlights it as a potential
therapeutic target. Indeed, HDAC6 inhibitors have found preliminary success in multiple
disorders involving misfolded protein accumulation. Interestingly however, the collective
insights indicate that the role of HDAC6 is likely to be more complicated than simply being
protective or detrimental, and is likely related to the multifaceted role of HDAC6’s catalytic and
non-catalytic actions in the autophagy pathway.
Neurodegeneration
In the case of Parkinson’s disease, HDAC6 promotes aggregate formation and protects
dopaminergic neurons from the injurious cellular effects of α-synuclein (Du et al., 2010) and, in
brain sections from people with Parkinson’s disease, Lewy bodies are enriched for HDAC6
(Kawaguchi et al., 2003a). Together, these observations suggest that HDAC6 upregulation in
brain tissue of people with Parkinson’s disease may be a protective response suggesting that
therapeutic augmentation of HDAC6 may slow the progression of the disease (Yan, 2014).
In contrast however, the role of HDAC6 in the context of tauopathies and Alzheimer’s disease is
less clear. Tau is a client protein for HSP90 (Karagoz et al., 2014) and HDAC6 levels correlate
with tau burden, with a decrease in HDAC6 expression or activity favouring clearance of tau,
potentially through the promotion of HSP90 acetylation and consequent attenuation of its tau-
chaperoning actions (Cook et al., 2012). Even though HDAC6 has been associated with
29
Alzheimer’s disease in a number of studies, its precise role has not yet been fully established.
Early upregulation of HDAC6 may confer protective benefits, but overtime this may lead to
accelerated neuronal damage (Zhang et al., 2013). Nonetheless, two separate groups have each
recently reported an improvement in cognition with HDAC6 inhibition in mouse models of
Alzheimer’s disease (Selenica et al., 2014; Zhang et al., 2014).
Cancer
Whereas HDAC6 undoubtedly plays a role (albeit complex) in the pathogenesis of or protection
against neurodegenerative disease, to date clinical trials of HDAC6 inhibitors have been restricted
to the treatment of certain malignancies. The link between HDAC6 and aggresome formation
represents probably the most clearly defined and (at present) clinically significant relationship
between modulation of HDAC6 activity and altered cancer outcomes. Transformed cells
accumulate misfolded proteins at a faster rate than non-transformed cells and, for cancer cell
survival, these misfolded proteins must be appropriately disposed of through either the UPS or
the aggresome-autophagy pathway (Rodriguez-Gonzalez et al., 2008). Proteasome inhibitors
prevent disposal of misfolded proteins by the UPS and their use in combination with HDAC6
inhibitors may promote cytotoxicity by inhibiting both the UPS and the aggresome-autophagy
pathway (Hideshima et al., 2005). However, although HDAC6 inhibition may promote cell death
in cancer, it may serve a protective role in non-cancer cells, as has been noted in chronic
conditions such as cardiovascular and renal diseases.
30
Cardiovascular disease
Cardiomyocytes are essentially post-mitotic and therefore unable to regenerate. As a result, they
are vulnerable to the deleterious effects of the accumulation of misfolded proteins, which can
cause heart failure. McLendon and co-workers observed that hyperacetylation of α-tubulin
occurred in a mouse model of proteinopathy-induced heart failure (McLendon et al., 2014).
Reasoning that this is an adaptive response, the investigators observed that knockdown or
inhibition of HDAC6 increased autophagy and reduced aggresome accumulation in cultured
cardiomyocytes and that pan-HDAC inhibition in-vivo prevented aggresome formation and
improved cardiac function (McLendon et al., 2014). Because the aging heart has a reduced
capacity to remove protein aggregates (De Meyer et al., 2010), this has led investigators to
postulate that HDAC6 inhibition may improve cardiac function in the elderly given the
relationship between aging and impaired autophagy (Ferguson and McKinsey, 2015).
8 HDAC6 and Kidney Disease
Whereas the contribution of HDAC6 to the regulation of misfolded protein clearance in CKD
remains the topic of this thesis, it is worth noting that preliminary research suggests that inhibition
of HDAC6 may be protective in the kidney generally. This is interesting, given that the kidney is
one of the sites where HDAC6 is most highly expressed. In terms of pathology, HDAC6 may
play a role in renal fibrosis as evidenced by a requirement for HDAC6 in transforming growth
factor-ß (TGF-ß) induced epithelial to mesenchymal transition (Shan et al., 2008) and a reduction
in TGF-ß expression in the kidneys of angiotensin II-infused mice treated with Tubastatin A (Choi
et al., 2015a). Separately, HDAC6 has also been implicated in cystic diseases of both the liver
31
(Gradilone et al., 2014) and the kidney (Mergen et al., 2013). This association likely relates to
the importance of HDAC6 in the formation of the primary cilium. Nearly all mammalian cells
possess a single primary cilium. Far from being vestigial organelles, primary cilia play an
important role in intracellular signaling and in the regulation of cell division through their
assembly and disassembly, their dysfunction contributing to renal diseases such as polycystic
kidney disease (Singla and Reiter, 2006). Because cyst growth occurs as a result of persistent
proliferation of de-differentiated epithelial cells (Wilson, 2004), dysregulation of HDAC6 can
impair ciliary disassembly and contribute to the development of renal cysts due to impaired cell
division regulation (Mergen et al., 2013).
The regulation of primary cilium disassembly is not the sole mechanism through which HDAC6
may contribute to the development of renal cysts. Through its α-tubulin deacetylating actions,
HDAC6 also regulates the intracellular transport of the epidermal growth factor receptor (EGFR)
(Gao et al., 2010), whose increased activity promotes cyst formation (Richards et al., 1998). In
kidney epithelial cells with a mutation in the PKD1 gene, that encodes the protein polycystin-1
and that is associated with autosomal dominant polycystic kidney disease, HDAC6 expression
was observed to be increased, whereas HDAC6 inhibition promoted EGFR degradation and
normalized EGFR localization (Liu et al., 2012a). Autosomal dominant polycystic kidney disease
can be caused by mutations in either the PKD1 gene or in the PKD2 gene, the latter encoding the
protein polycystin-2. Polycystin-1 and -2 interact with each other (Cebotaru et al., 2014).
Separate to its role in EGFR trafficking, HDAC6 also binds polycystin-2 and expression of full-
length polycystin-1 accelerates transport of the polycystin-2/HDAC6 complex towards
aggresomes, facilitating the degradation of polycystin-2 by autophagy and thus negatively
32
regulating its expression (Cebotaru et al., 2014). The balance between increased and decreased
activity of polycystin-1 and -2 therefore appears to be tightly regulated in renal epithelial cells
and either upregulation or downregulation of either protein may result in cyst formation (Cebotaru
et al., 2014). It is possible that inhibiting HDAC6 can redress an imbalance in polycystin-1/2
activity attenuating the development of renal cysts. Indeed, Cebotaru and colleagues recently
showed that pharmacological inhibition of HDAC6 with Tubacin slowed renal cyst growth and
improved kidney function in a rodent model of polycystic kidney disease (Cebotaru et al., 2016).
In summary, despite its name, HDAC6 is unique from other HDAC isoforms in its cytoplasmic
functionality and in its druggability. It deacetylates non-histone proteins and, independent of its
catalytic activity, it acts as a bridge linking the UPS and the aggresome-autophagy pathway,
regulating the disposal of misfolded proteins. It also plays an important role in transcription factor
nuclear translocation and therefore, can impart regulation on transcriptional networks. HDAC6
expression or activity is altered in cancer, neurodegenerative diseases, cardiovascular disease and
other diseases, where it may contribute to the pathogenesis of the condition or play a
compensatory role (Figure E). In the kidney, HDAC6 inhibition may serve a protective role, but
whether this protection is related to its autophagic activity remains to be seen. While knowledge
about TFEB in the kidney is limited, its success in clearing misfolded proteins in other disease
settings highlights its role as a potential therapeutic target. Since current therapies aimed at
mediating its phosphorylation status are limited due to renal toxicity, modifying the acetylation
status of TFEB may offer another avenue of regulation. Therefore, we set out to determine if and
to what extent misfolded proteins accumulate in CKD; whether misfolded protein accumulation
33
is linked to TFEB; and whether HDAC6 is involved and can itself alter TFEB activity in kidney
cells.
Figure E. Conditions associated with altered HDAC6 activity or in which HDAC6 inhibition may confer therapeutic benefit. HDAC6 inhibition has been most extensively studied for its role in the treatment of haematological malignancies and HDAC6 itself has been implicated in the pathogenesis (or protection against) a number of neurodegenerative diseases. The protein may also play important roles in other forms of cancer, in cardiovascular disease and in inflammation, whereas its actions in the development of mood disorders and kidney diseases and in the regulation of thrombosis and haemostasis are beginning to be recognized (Batchu et al., 2016).
34
Chapter 2
Hypothesis and Research Aims
1 Hypothesis
There is growing appreciation for the sensitivity of proximal tubule cells to impaired proteostasis
with recent studies pointing to chronically impaired quality control mechanisms as a precursor to
tubule cell apoptosis and a decline in renal function. Although the contribution of the autophagy-
lysosomal pathway has been studied in conformational disorders, its contribution to renal disease
is less clear. Transcription factor EB (TFEB) has been described as a master regulator of the
autophagy-lysosomal pathway and we hypothesize that kidney disease may be associated with
1) dysregulation of renal TFEB and 2) may manifest as an accumulation of misfolded
proteins. Current therapies aimed at increasing TFEB activation are limited due to adverse renal
outcomes. Recent research has uncovered a role for TFEB acetylation as an alternative method of
regulation. HDAC6 is a known regulator of transcription factor shuttling and its inhibition has
improved protein clearance in conformational diseases. Therefore, we hypothesize that histone
deacetylase (HDAC6) may impart a regulatory role on TFEB activation and that inhibition
of HDAC6 may activate TFEB mediated autophagy-lysosomal pathways, improve cellular
misfolded protein clearance and serve a renoprotective role.
35
2 Research Aims
1) To determine whether TFEB expression levels are dysregulated in kidneys from humans with
diabetic kidney disease and rats with CKD induced by subtotal nephrectomy surgery.
2) To assess the degree of misfolded protein aggregates in kidneys from humans with diabetic
kidney disease and in kidneys from subtotally nephrectomized rats.
3) To determine whether HDAC6 inhibition alters TFEB activity.
4) To determine whether HDAC6 inhibition attenuates CKD progression in subtotally
nephrectomized rats and whether this is associated with altered TFEB activity and misfolded
protein accumulation.
The remainder of this thesis details materials and methodology used to assess these aims, results,
conclusions, discussion on the implications of these findings, limitations of the current study and
suggestions for future research.
36
Chapter 3
Materials and Methods
1 Human Studies
Archival formalin-fixed, paraffin-embedded kidney tissue was examined from 12 patients with
diabetic glomerulosclerosis and 12 individuals without diabetes. The study was approved by the
Nova Scotia Health Authority Research Ethics Board and the Research Ethics Board of St.
Michael’s Hospital and was conducted in accordance with the Declaration of Helsinki.
2 Real-Time PCR
2.1 RNA Isolation
RNA was extracted from cultured cells using Trizol reagent (ThermoFisher Scientific, Waltham,
MA). Briefly, samples were incubated with Trizol for 5 minutes before the addition of 200 µL of
chloroform. Following five seconds of rapid agitation, samples were centrifuged at 12,000 g for
15 minutes to allow for phase separation. RNA was precipitated from the aqueous phase by
addition of 500 µL of 100% isopropanol. Following incubation and centrifugation at 12,000 g for
10 minutes, supernatants were removed and RNA pellets were washed with 75% ethanol, air-
dried, re-suspended in RNAse DNAse free water and heated at 60οC prior to quantification.
37
RNA was extracted from paraffin embedded human kidney sections using the Qiagen RNeasy
FFPE Kit and was extracted from rat kidney tissue using the Qiagen RNeasy Mini Kit as per the
manufacturer’s instructions (Qiagen, Hilden, Germany). RNA concentration was determined by
light absorbance of RNA and DNA at wavelengths of 260 nm and 280 nm on a Nanodrop 2000
Spectrophotometer (ThermoFisher Scientific), with a 260/280 nm ratio of greater than 1.8 used
for cDNA synthesis. Similarly, RNA integrity was further assessed using the Agilent 2100
Bioanalyzer using the RNA 6000 NanoChip kit for total eukaryotic RNA (Agilent Technologies,
Santa Clara, CA). Samples with an RNA integrity number (RIN) of greater than 7 were used for
cDNA synthesis.
2.2 First Strand cDNA Synthesis
RNA (1 µg total RNA) was reversed transcribed to 20 µL reaction volume using 1 µL of
oligo(dT)20 , 1 µL of 10 mM dNTP mix, sterile distilled water, 4 µL 5X First-Strand Buffer, 1 µL
0.1 M DTT, 1 µL RNAseOUT, 1 µL of 200 units/ µL SuperScript III Reverse Transcriptase with
the recommended thermocycler settings. All reagents for cDNA synthesis were purchased from
ThermoFisher Scientific.
2.3 Primer Selection
Primer sequences were designed using the online primer design tool Primer Blast
(http://www.ncbi.nlm.nih.gov/tools/primer-blast/). Gene transcript FASTA sequences were
obtained from NCBIs Nucleotide database and entered into Primer Blast. Selected primer
sequences were double-checked in Primer Blast to ensure transcript specificity. Primers were
38
purchased from Integrated DNA Technologies (IDT) (Coralville, IA) and these sequences were
as follows: human TFEB, forward GTAGAGAATGATGCCTCCGCA, reverse
CAGCCTGAGCTTGCTGTCAT; human RPL32, forward
CAACATTGGTTATGGAAGCAACA, reverse TGACGTTGTGGACCAGGAACT; rat TFEB,
forward AGATCTGCTTCTTCTTCCGATA, reverse GCAGCAAACTTGTTGCCGTA; rat
RPL13a, forward ATGAACACCAACCCGTCTCG, reverse GCCTCTTTTGGTCTTGTGCG;
rat LAMP1, forward AGAAGGCTCCACGCATTTGA, reverse
TGCAGCCTAACCACCATCAG.
2.4 Plate Preparation and Analysis
Gene expression was assessed using SYBR green master mix (Wisent, Saint-Jean-Baptiste, QC)
on a ViiATM 7 Real-Time PCR System (ThermoFisher Scientific). Samples were loaded onto a
386 well block, set at standard thermocycler conditions and relative gene expression was assessed
using the Comparative CT method. CT, or threshold cycle, is the PCR cycle at which the
fluorescent signal of the reporter dye crosses a set threshold. The relative gene expression of the
gene of interest was expressed as a fold change relative to an internal control (housekeeping) gene
that displays stable expression levels across treatment groups. The fold change was calculated
from the following equation (Schmittgen and Livak, 2008):
Fold change = 2-ΔΔ CT
= [(CT gene of interest- CT internal control) sample A- (CT gene of interest-
CT internal control) sample B)]
39
3 Immunoblotting
3.1 Lysate Preparation
NRK-52E Cells
NRK-52E cells were cultured in 6 well plates. Following treatment, cells were washed twice with
sterile PBS and then collected by scraping wells with 70-100 µL of homogenization buffer with
phosphatase inhibitor (Appendix). Cells were homogenized using a hand held homogenizer prior
to protein quantification.
Tissue
Tissues were dissected with cleaned tools, placed in Eppendorf tubes and snap frozen in liquid
nitrogen prior to storage at -80 οC. During homogenization, 300 µL of cold homogenization buffer
with phosphatase inhibitor (Appendix) were added per 5 mg of tissue. Samples were
homogenized with an ultrasonic homogenizer, model 3000 (BioLogics Inc., Manassas, VA) prior
to protein quantification.
Nuclear fractionation
Nuclear fractionation was performed by centrifuging samples for 1 minute at 16,000 x g at 4°C
and collecting the supernatant for use as the cytosolic fraction. The resulting pellet was
resuspended in homogenization buffer and subsequently centrifuged for 15 minutes at 16,000 x g
at 4°C. The supernatant was isolated for use as the nuclear fraction. Equal amounts of cytosolic
and nuclear protein were assessed by Western blot.
40
3.2 Protein Concentration Determination
Protein concentration was determined using Bio-Rad’s Quick Start Bradford 1X Dye Reagent
(Bio-Rad, Hercules, CA) which assesses Coomassie Brilliant Blue G-250 dye binding to proteins.
The standard of Bovine Serum Albumin (BSA) (Sigma-Aldrich, St. Louis, MO) was used in serial
dilutions ranging from 2 mg/mL to 0 mg/mL. Standards and samples (5 µL) were pipetted into a
96 well plate in duplicate. Then, 245 µL of dye reagent was added to each well and incubated at
room temperature for 5 minutes. Samples were assessed on a SpectraMax M5e spectrophotometer
(Molecular Devices, Sunnyvale, CA) set at an excitation wavelength of 595 nm.
3.3 Gel Electrophoresis
Lysed proteins were denatured by addition of 5 µL of 5X lane marker reducing sample buffer
(ThermoFisher Scientific), and boiled in a heat block set at 100οC for 5 minutes. Following
boiling, 25 µg of total protein was loaded into wells of 10% SDS-PAGE gels, along with 5 µL of
Precision Plus Protein Dual colour standard (Bio-Rad) as the molecular weight protein ladder.
The gel was placed in a Mini-Protean Tetra System (Bio-Rad), the tank was filled with 1L of 1X
running buffer (Appendix) and ran at 100V for 1-2 hours at room temperature.
3.4 Membrane Transfer
Proteins were transferred to a nitrocellulose membrane (Bio-Rad). Two filter papers, two sponges
and one nitrocellulose membrane were soaked in 1X transfer buffer containing 20% methanol
(v/v) per gel (Appendix). Gels were removed from glass plates and loaded into the transfer
41
cassette in the following order: sponge, filter paper, gel, nitrocellulose membrane, filter paper,
sponge. Transfer was run at 100V for two hours at 4οC.
3.5 Blocking the Membrane and Antibody Incubation
Following transfer, nitrocellulose membranes were removed and submerged in 5% blocking
solution (Appendix) for 1 hour, with constant agitation. After blocking, membranes were washed
in fresh 1X TBS-T (Appendix) for 10 minute intervals, over a period of 30 minutes. Membranes
were incubated with the recommended dilution of primary antibody prepared in 10 mL of 5%
BSA in PBS, overnight at 4οC with constant agitation. Primary antibodies were prepared in the
following concentrations: p62 1:1000 (Cell Signaling Technology), ubiquitin 1:1000 (Cell
Signaling Technology), phospho-eIF2α 1:1000 (Cell Signaling Technology), eIF2α 1:1000 (Cell
Signaling Technology), acetylated α-tubulin 1:1000 (Sigma-Aldrich), total α-tubulin 1:1000
(Sigma-Aldrich), cleaved caspase 3 1:1000 (Cell Signaling Technology, Danver, MA), TFEB
1:700 (Abcam, Cambridge MA), β-actin 1:10,000 (Sigma-Aldrich), acetylated lysine 1:1000 (Cell
Signaling Technology) and histone H3 1:2000 (Cell Signaling Technology). Following primary
incubation, membranes were washed in fresh TBS-T for 10 minute intervals over a 30 minute
period. Then, they were incubated in the recommended dilution of horseradish peroxidase (HRP)
conjugated secondary antibody (Bio-Rad) in 5% blocking solution for 1-2 hours. Membranes
were then washed with TBS-T for 30 minutes prior to detection.
42
3.6 Detection and Analysis of Labelled Proteins
Proteins were detected using a luminol based enhanced chemiluminescent (ECL) substrate that
reacts with HRP tagged proteins (ThermoFisher Scientific). Membranes were submerged in ECL
for 4 minutes, with constant pipetting. Following incubation, membranes were placed between
two transparent films in a Western blot cassette. In the dark room, film was placed over the
membrane for 1-5 minutes, and repeated as necessary for optimal exposure prior to development.
Alternatively, following ECL incubation, blots were exposed and photographed on a ChemiDoc
Touch Imaging System (Bio-Rad) for 30 seconds-10 minutes as needed. Protein expression was
quantified using densitometry measures on ImageJ 1.46r software (National Institute of Health,
Bethesda, MD).
3.7 Re-probing the Nitrocellulose Membrane
Membranes were submerged in 1X Antibody Stripping Buffer (GeneBio-Application L.T.D,
Kfar-HaNagid, Israel) for 15-30 minutes as needed. Membranes were washed with distilled water
for 10 minutes prior to blocking and re-probing as stated above.
4 Cell Culture
4.1 Cell Lines Used
In-vitro experiments were conducted in proximal tubule lineage NRK-52E cells (ATCC,
Manassas, VA) (Advani et al., 2009). Cells were cultured in Dulbecco’s Modified Eagle’s
Medium (DMEM) (Sigma-Aldrich), with 20% fetal bovine serum (FBS) or 10% FBS (Sigma-
43
Aldrich) when subjected to starvation conditions. Cells were incubated at 37οC and 95% O2 and
5% CO2. Each experiment was performed in triplicate, with the exception of cells used for
RTqPCR, which was performed with six replicates.
4.2 Tubastatin A Experiments
The efficacy of Tubastatin A in inhibiting HDAC6 in-vitro was determined by assessing for a
dose dependent increase in α-tubulin acetylation in NRK-52E cells. Cells were treated with
vehicle (0.1% DMSO) or Tubastatin A (MedChem Express, Monmouth Junction, NJ) in the
following concentrations: 0.6 µM, 1.2 µM, 2.5 µM, 5 µM, 10 µM. Cells were incubated with
Tubastatin A for 24 hours before preparation of lysates for immunoblotting as discussed.
4.3 Endoplasmic Reticulum Stress Induced Apoptosis Experiments
Apoptosis was assessed in-vitro following treatment with the ER stress inducer, thapsigargin
(Oslowski and Urano, 2011). NRK-52E cells were plated and serum starved overnight before
pre-treament with 2.5 µM of Tubastatin A or vehicle (0.1% DMSO). Following a 4 hour
incubation period, the culture media was supplemented with 500 nM thapsigargin (Sigma-
Aldrich) for 24 hours. Cell lysates were either collected for immunoblotting for cleaved caspase-
3 (Cell Signaling Technology) or prepared for flow cytometric analysis of PE Annexin V
labelling.
44
4.4 PE/Annexin V Apoptosis Detection Assay
Flow cytometric analysis of apoptotic cell death was determined using a PE Annexin V apoptosis
detection assay (BD Biosciences, San Jose, CA). Following treatment, cells were washed twice
with cold PBS and re-suspended in 1X binding buffer at a concentration of 1 X 106 cells/mL as
per the manufacturer’s instructions. An aliquot of 100 µL of cells was supplemented with 5 µL
of PE Annexin V and 5 µL of 7-Amino-actinomycin (7-AAD). Annexin V is a calcium-dependent
phospholipid binding protein that binds to exposed phospholipid phosphatidylserine (PS) on the
surface of apoptotic cells. Likewise, 7-AAD is a viability marker that enters cells when cell
membranes are compromised, as is the case during late stage apoptosis and necrosis. Cells were
incubated for 15 minutes, at room temperature in the dark, before the addition of binding buffer.
Ten thousand events were analyzed for PE/Annexin V and 7AAD by flow cytometry using a
MACSQuant (Miltenyi Biotec, Auburn, CA).
4.5 Immunoprecipitation
An immunoprecipitation experiment for TFEB was conducted in NRK-52E cells following
treatment with Tubastatin A. Cells were plated in Petri dishes at approximately 70% confluency
and treated with vehicle (0.1% DMSO) or 2.5 µM Tubastatin A for 24 hours. Cells were collected
in 300 µL of homogenizing buffer and protein concentration was measured as described. Primary
antibodies against TFEB (Abcam, Cambridge MA) were incubated with cell lysates at a ratio of
1 µg primary antibody to 500 µg of total protein. Negative controls were incubated with an
equivalent ratio of goat IgG primary antibody (Abcam). Samples were incubated overnight, at
4οC under constant rotation conditions. The following day, agarose G beads (Roche, Basel,
Switzerland) were prepared by washing beads in 1mL of chilled PBS, followed by centrifugation
45
at 1000 rpm for two minutes, three times. Beads were then added to each sample to incubate
overnight, at 4οC under constant rotation. Afterwards, samples were centrifuged at 1000 rpm for
two minutes. Supernatants were removed and the protein-bead mix was washed with 1 mL of
chilled PBS and centrifuged (1000 rpm for 2 minutes) for eight consecutive cycles. Next, 5X lane
marker reducing sample buffer (ThermoFisher Scientific) was added to each sample in a 1:5 µL
ratio, and boiled for 10 minutes. An aliquot of 30 µL was obtained from the supernatant of each
sample, and subjected to gel electrophoresis for immunoblot as described.
5 Animals
5.1 Subtotal Nephrectomy and Sham Surgery
The subtotally nephrectomized (SNx) rat model is generated by the complete removal of one
kidney, and selective infarction of 2/3 of the remaining kidney, leading to progressive proteinuria
and renal failure. Anesthesia was induced through inhalation of 2.5% isoflurane in a designated
gas chamber. Pre-operative pain management was achieved by injection of 0.05 mg/kg
buprenorphine by designated staff. Toe pinch reflex, body temperature and limb extremities were
monitored to ensure the rats were anesthetized. Following confirmation, the abdomen of the rat
was shaved and cleaned with alcohol and betadine. Using sterile technique, a 2-3cm incision was
made through the skin and underlying muscle, exposing the right kidney. The kidney was resected,
and the remaining kidney was ligated with a 4-0 silk suture. The peritoneum and abdominal
muscle was closed with a 3-0 Vicryl suture and the overlaying skin was stapled. Sham surgery
paralleled SNx surgery in methodology. Instead of removal, kidneys were manipulated prior to
abdominal closure.
46
5.2 In-vivo Pharmacological HDAC6 Inhibition in Sham and SNx Rats
5.2.1 Administration of Tubastatin A In-vivo
Male Sprague Dawley rats were given subcutaneous injections of 30mg/kg Tubastatin A or
vehicle (5% dextrose), three times a week for 3 weeks. Kidneys were collected and
immunoblotted for acetylated α-tubulin. Following confirmation of HDAC6 inhibition with
Tubastatin A, we proceeded to the interventional study. Male Sprague Dawley rats were subjected
to SNx or Sham surgery as previously described. Then, urine protein excretion was assessed four
weeks post-surgery to randomize rats to receive thrice weekly injections of vehicle or 30 mg/kg
Tubastatin A for the remaining three weeks of the study. At week seven, urine protein excretion,
systolic blood pressure and glomerular filtration rate were assessed. Following sacrifice, renal
tissue was collected for structural and molecular biological analysis.
5.2.2 Metabolic Caging and Urine Protein Excretion
Rats were individually housed in metabolic cages for 24 hours, following a 1-2 hour habituation
period. Standard rat chow and RO water were provided throughout the caging period. Urine
volume was measured, and urine protein excretion was determined via absorbance using the
benzethonium chloride method.
47
5.2.3 Glomerular Filtration Rate (GFR)
Assessment of GFR used an adaptation of the FITC-inulin protocol acquired from the Diabetic
Complications Consortium (DiaComp):
https://www.diacomp.org/shared/showFile.aspx?doctypeid=3&docid=28. An infusion of 3.74
µL/g of 5% FITC-inulin was infused into the tail vein with a 25G needle. A sample of 150 µL of
blood was then collected in heparinized capillary tubes at 3, 7, 10, 15, 35, 55 and 75 minutes
through tail vein collection with a fresh 25G needle. Samples were titrated by mixing 10 µL of
plasma with 400 µL of 500 mM HEPES to maintain pH. Then, 50 µL of the titrated samples were
pipetted into a 96 well plates. Fluorescence was assessed using a spectrophotometer set at 485
nm excitation and read at 538 nm emission.
5.2.4 Systolic Blood Pressure
Systolic blood pressure (SBP) was assessed by tail cuff plethysmography. Rats were warmed and
monitored under a heat lamp for 10 minutes to promote vasodilation. A tail cuff and transducer
were wrapped around the rat’s tail and inflated to a pressure of 200mmHg followed by slow
deflation (Powerlab, ADInstruments, Colorado Springs, CO).
At sacrifice, kidney and body weights were collected and tissues were fixed in 10% NBF for
paraffin embedding, flash frozen in liquid nitrogen or cryoembedded in OCT for biochemical
assessment as described.
48
6 Histology
6.1 Tissue Sectioning
Tissues were formalin fixed at collection, processed and embedded in paraffin wax using a Leica
TP1020 Tissue Processor and Leica EG1160 Paraffin Embedder respectively (Leica, Wetzlar,
Germany). Blocks were chilled on wet ice for 30 minutes prior to sectioning on a Leica RM2145
Rotary Microtome. Blades were set at an angle of 3ο and sections were cut into ribbons at a
thickness of 3 µm. Ribbons were placed in a heated water bath to prevent wrinkling. Sections
were separated and transferred onto charged microscope slides. Slides were dried at 37οC for 48
hours before use. Alternatively, tissues were cryoembedded in Tissue-Tek OCT compound
(VWR, Radnor, PA), flash frozen in liquid nitrogen and stored at -80οC. OCT blocks were
sectioned on a Leica cryostat CM 1900 at a thickness of 4 µM. Sections were transferred onto
charged microscope slides and stored at -80οC until use.
6.2 Immunohistochemistry
Formalin fixed paraffin embedded rodent and human kidney sections were immunohistologically
stained over a period of two days, as previously described (Advani et al., 2007). Slides were
dewaxed by three consecutive incubations in xylene, three minutes each. Slides were then
progressively hydrated in two washes of 100% ethanol, a single wash of 70% ethanol and three
washes of distilled water for 3 minutes each. Antigen retrieval was achieved by submerging
sections in citric acid buffer (Appendix), under boiling conditions for 10 minutes. Sections were
cooled for 30 minutes before a single wash in PBS for five minutes. The sections were then
49
incubated in a solution of 3% H2O2 (Bio-Basics, Markham, ON, Canada) for 10 minutes, followed
by two, five minute washes in PBS.
Next, a wax pen was used to draw a boundary around the kidney section, preventing spillage of
the small volume of solution and ensuring maximum tissue coverage. Sections were incubated in
two drops of serum-free protein blocking solution (Agilent Technologies) for 1 hour. Following
incubation, sections were washed in three, 5 minute washes of PBS prior to antibody incubation.
Sections were incubated in a 100 µL of primary antibody diluted in PBS at the desired
concentration. Antibodies were prepared in the following concentrations: collagen IV 1:100
(Southern Biotech, Birmingham, AL) and p62 1:100 (Cell Signaling Technology). Incubation
with an equivalent volume of PBS was used as the negative control. Sections were incubated at
4οC, overnight.
The following day, the primary antibody solution was washed off each section by three washes in
PBS, 5 minutes each. The corresponding HRP-labelled polymer secondary antibody was added
to each section and incubated at room temperature for 1 hour: anti-mouse (Agilent Technologies)
and anti-rabbit (Agilent Technologies). After incubation, secondary antibodies were washed off
as previously described and stained with liquid Diaminobenzidine and substrate chromogen
system (DAB) (Agilent Technologies) for 10 minutes, and subsequently submerged in distilled
water for 5 minutes. Sections were then counterstained in Mayer’s haematoxylin (Electron
Microscopy Sciences, Hatfield, PA) for 1 minutes and flushed with running tap water to clear off
excess stain. Then, sections were submerged in Scott’s tap water for five seconds, followed by
distilled H2O for 5 minutes. Finally, sections were dehydrated through successive incubations in
50
70% ethanol, three incubations in 100% ethanol and three incubations in xylene, for 3 minutes
each. Sections were sealed by application of coverslips following the addition of a drop of
dibutylphthalate polystyrene xylene (DPX) and air dried for 24 hours prior to analysis.
6.3 Histological Analysis
Immunohistologically stained kidney sections were scanned (Leica Microsystems Inc., Concord,
ON, Canada) and analysed using Aperio’s ImageScope (Leica Microsystems Inc.) in a blinded
manner. Estimation of glomerular collagen IV was measured as the proportion of positive
immunostaining in 30 randomly selected glomeruli per section. Similarly, tubulointerstitial
collagen IV was quantified as the proportional area of positive immunostaining in 10 randomly
selected cortical fields at 100X. Positively stained tubules were defined as tubule cross-sections
containing a minimum of one epithelial cell with cytoplasmic immunostaining for p62. The
number of tubules positively staining for p62 was manually counted in 6-10 randomly selected
100X fields per section, and is represented as fold change relative to control. Terminal
deoxynucleotidyl transferase dUTP nick end labelling (TUNEL) stain was conducted by the
Pathology Research Program at Toronto General Hospital (Toronto, Ontario, Canada) and
quantified as the number of TUNEL positive nuclei in 10 randomly selected cortical fields at a
magnification of 100X.
51
7 Immunofluorescence
7.1 Fixation
NRK-52E cells were cultured on coverslips at a confluency of 50%. After treatment, cells were
fixed in freshly prepared 2% paraformaldehyde (Electron Microscopy Sciences) in PBS (pH 7.2-
7.4) for 12 minutes at room temperature. After fixation, cells were permeabilized with 0.2%
Triton X-100 (Sigma-Aldrich) prepared in PBS for 3 minutes. Cryoembedded tissue sections
were fixed and permeabilized after submersion in chilled 100% methanol for 10 minutes, followed
by 3 washes of PBS, at 5 minutes each. Tissue sections were circled in wax pen as previously
mentioned. Following fixation, immunofluorescent stain of cells and tissues was achieved
through the same series of steps detailed below.
7.2 Immunofluorescent stain
Samples were incubated in 2% blocking buffer (Appendix) for 1 hour (1mL for cells, 100µL for
tissue). Following incubation, blocking buffer was replaced with primary antibody, diluted in
blocking buffer at the following concentrations: TFEB 1:100 (Abcam), p62 1:100 (Cell Signaling
Technology), LAMP-1 1:100 (Cell Signaling Technology). For dual stains, both primary
antibodies were added concurrently. The equivalent volume of blocking buffer was used for
negative controls. Samples were incubated in primary antibody overnight, at 4οC.
The next day, primary antibodies were removed and samples were washed in PBS three times, 5
minutes per wash. The corresponding Alexa Fluor tagged secondary antibodies was prepared in
52
PBS and added to the samples in the following concentrations: Alexa Fluor 555 donkey anti-goat
IgG 1:100 (Abcam) and Alexa Fluor 488 donkey anti-mouse IgG 1:100 (Abcam) and Alexa Fluor
555 donkey anti-rabbit IgG 1:100 (Abcam). Following a 1 hour incubation period, samples
received 3 washes of PBS, at 5 minutes each. To visualize nuclei, DAPI (Cell Signaling
Technologies) was applied at a concentration of 1:12,000 for two minutes, followed by two quick
washes in PBS. Coverslips were sealed to charged glass slides by the addition of a single drop of
fluoromount-aqueous mounting media (Sigma-Aldrich) and air dried in the dark for 24 hours prior
to use.
7.3 Analysis of Immunofluorescent Staining
Images were collected on a Zeiss LSM700 Confocal microscope (Zeiss, Oberkochen, Germany)
at a magnification of 630X, and fluorescently labelled antibodies were visualized at excitation
lines 358 nm, 488 nm and 555 nm using Zen 2011 imaging software (Zeiss). Subsequently,
channels were merged into a single image using Fiji ImageJ software (Schindelin et al., 2012) for
analysis. Nuclear TFEB levels were quantified using Adobe Photoshop (CS4) (San Jose, CA).
Nuclei were outlined using the lasso tool and histogram tool, and the ratio of red pixels to total
pixels was used to indicate the relative amount of nuclear TFEB. In NRK-52E cells, TFEB
nuclear translocation was assessed as the amount of red pixels in 6 randomly selected nuclei per
630X field.
53
8 Statistics
Statistical significance was determined by one-way ANOVA with a Fisher’s least significant
difference test for comparison of multiple groups and paired or unpaired Student t test for
comparison between two groups (or Mann-Whitney test for non-parametric data). Data were
normalized to the average of the experimental controls and are expressed as mean ± standard error
of the mean. Statistical analyses were performed using GraphPad Prism 6 (GraphPad Software
Inc., San Diego, CA).
54
Chapter 4: Results
1 TFEB mRNA levels are diminished and p62-protein levels
are increased in kidneys of patients with diabetic kidney
disease
1.1 Clinical Characteristics of patients with diabetic kidney disease
Given the growing appreciation for the role of TFEB in upregulation of the autophagy-lysosomal
pathway under conditions of cellular stress, and the paucity of information about TFEB expression
levels in CKD, we set out to determine expression levels of TFEB in human diabetic kidney
disease, the leading cause of CKD globally. For this experiment, we assessed archival biopsy
tissue derived from 12 patients with histopathologically confirmed diabetic glomerulosclerosis
and 12 individuals without diabetes. Tissue was obtained at the time of tumour nephrectomy
along with tissue acquired from the unaffected region of the kidney. The mean age of the twelve
patients without diabetes (controls) was 65±3 years, with eight out of twelve patients being male.
All patients had an eGFR greater than 60 mL/min/1.73m2. Six out of the twelve patients were
hypertensive, with four out of the six individuals receiving treatment with an angiotensin
converting enzyme inhibitor (ACEi) or angiotensin receptor blocker (ARB). The mean age of
patients with diabetic glomerulosclerosis was 67±2 years, with eight out of twelve patients being
male. Eleven of the twelve patients had Type 2 diabetes and five patients experienced stage 3
CKD or worse as evidenced by an estimated glomerular filtration rate (eGFR) of less than 60
mL/min/1.73m2. Ten out of twelve patients were hypertensive, with seven out of those ten
receiving treatment with either an ACEi or an ARB. RTqPCR assessment of TFEB mRNA levels
in archival tissue from controls and people with diabetic kidney disease revealed an approximate
55
50% reduction in TFEB expression in kidney samples from people with diabetic kidney disease
(Figure 1).
Figure 1. TFEB mRNA levels are diminished in kidney tissue from people with diabetic kidney disease.
Real-time PCR quantitative assessment of fold change in renal TFEB mRNA expression in human kidney
tissue from controls (h_Control, n=12) and people with diabetic kidney disease (h_Diabetes, n=12).
AU=arbitrary units. *p<0.05.
1.2 p62 protein levels are increased in renal tubules from patients with
diabetic kidney disease
To determine whether the downregulation in TFEB mRNA levels was associated with misfolded
protein levels in renal cells, kidney sections were immunostained for the protein aggregate marker
p62. There was an approximate 3 fold increase in the number of renal tubules immunopositive
for p62 from patients with diabetic kidney disease relative to controls (Figure 2).
56
Figure 2. p62 levels increase in renal tubules of patients with diabetic kidney disease relative to control.
(a) Representative photomicrographs of immunohistological stain for p62 and (b) quantitative assessment
of fold change in the number of p62 positive tubules in kidney sections from patients without diabetic kidney
disease (h_Control, n=10) and patients with diabetic kidney disease (h_Diabetes, n=10). Arrowheads
identify p62 positive tubules. Scale bar=50 µm. *p<0.01.
57
2 Diminished TFEB expression and increased p62-protein
aggregates are also a feature of chronic kidney disease in
subtotally nephrectomized rats
2.1 Downregulation of TFEB mRNA is accompanied by increased p62 in
kidneys from subtotally nephrectomized rats
Next, to gain mechanistic insight into the relationship between the downregulation of TFEB, p62
accumulation and kidney disease, we moved to an experimental model of chronic kidney disease
reminiscent of the human condition, namely, the subtotally nephrectomized rat (SNx).
Assessment of TFEB mRNA levels by RTqPCR revealed a reduction in TFEB mRNA levels in
SNx rat kidneys comparable to the decline in TFEB expression observed in kidneys from patients
with diabetic kidney disease (Figure 3). Likewise, immunostaining for p62 revealed an
approximate two-fold increase in immunopositive p62-aggregates in tubule epithelial cells of SNx
rats relative to sham-operated controls (Figure 4).
58
Figure 3. TFEB mRNA levels are diminished in the kidneys of subtotally nephrectomized rats relative to
sham-operated controls. Real-time PCR quantitative assessment of fold change in renal TFEB mRNA
expression in kidney homogenates from sham-operated (n=11) and subtotally nephrectomized (SNx) rats
(n=12). AU=arbitrary units. *p<0.01.
59
Figure 4. p62 immunostaining is increased in subtotally nephrectomized rat kidneys relative to sham-
operated controls as determined by immunohistological stain. (a) Representative photomicrographs of
immunohistological stain and (b) quantitative assessment of fold change in the number of p62 positive
tubules in kidney sections from sham-operated (Sham, n=10) and subtotally nephrectomized rats (SNx,
n=8). Arrowheads identify p62 positive tubules. Scale bar=50 µm. *p<0.001.
60
Immunohistological stain for p62 uncovered an increase in p62 levels in renal tubule epithelial
cells in both humans and rats with chronic kidney disease. To determine whether this observed
increase in p62 was due to increased p62 expression, or an increase in p62-tagged protein
aggregates, I set out on a series of experiments. In the first experiment, immunoblotting for p62
in kidney homogenates from sham and SNx rats revealed an increase in p62 levels in SNx rats
(Figure 5).
Figure 5. p62 protein levels are increased in kidneys from subtotally nephrectomized rats compared to
sham-operated controls, as determined by immunoblot. Representative immunoblot assessing p62
levels from sham (n=3) and subtotally nephrectomized (SNx, n=3) rat kidney homogenates. AU=arbitrary
units. *p<0.05.
To determine whether the increase in p62 immunostaining was specific to p62 or a consequence
of an increase in generalized protein misfolding, I probed for a secondary marker of misfolded
proteins, namely, ubiquitin. Prior to p62 mediated aggregate formation, misfolded proteins that
cannot be salvaged through chaperone mediated refolding are chemically modified with ubiquitin,
targeting it for aggresome formation and bulk degradation through the UPS or autophagy-
lysosomal pathway (Olzmann et al., 2008). Given the increase in p62 in SNx kidneys, I
61
hypothesized that I would also observe an increase in total ubiquitin levels, indicative of
irreparable misfolded protein and a greater dependence on bulk degradative processes. To assess
this, kidney homogenates from sham and SNx rats were immunoblotted for total ubiquitin levels.
This assessment revealed an increase in total ubiquitin levels in SNx rat kidneys relative to sham-
operated controls (Figure 6).
Figure 6. Total ubiquitin levels are increased in subtotally nephrectomized rat kidneys relative to sham-
operated rats. Representative immunoblot assessing total ubiquitin levels from sham (n=4) and subtotally
nephrectomized (SNx, n=4) rat kidney homogenates. AU=arbitrary units. *p<0.05.
Next, reasoning that increased rates of protein misfolding often occur as a consequence of
increased ER stress, I compared ER stress in kidneys from sham and SNx rats. For this
experiment, I immunoblotted for the ER stress marker, phosphorylated eIF2α, in kidney
homogenates from sham-operated and SNx rats. Upon sensing ER stress, membrane ER proteins
initiate a series of pathways, one of which involves phosphorylation of the translation initiation
factor eIF2α. In its phosphorylated form, eIF2α prevents translation, effectively halting new
protein synthesis under conditions of ER stress (de Haro et al., 1996). Protein levels of
62
phosphorylated and total eIF2α were quantified by immunoblot and revealed an increase in
phosphorylated eIF2α levels in SNx kidneys relative to control (Figure 7).
Figure 7. Protein levels of the endoplasmic reticulum stress marker phospho-eIF2α are increased in
subtotally nephrectomized rat kidneys relative to sham-operated rats. Representative immunoblot and
quantitative assessment of fold change in phosphorylated and total eIF1α in kidney homogenates from
sham (n=3) and subtotally nephrectomized (SNx, n=3) rats. AU=arbitrary units. *p<0.001.
Lastly, it is appreciated that proximal tubules play a role in protein reabsorption from the urinary
filtrate, introducing the possibility that the observed increase in protein aggregates in renal tubule
epithelial cells could be due to increased reabsorption of urinary proteins under disease conditions.
Reabsorbed proteins from the urinary filtrate are endocytosed into vesicles that then fuse with
lysosomes where they are hydrolyzed to their constituent amino acids (Nielsen, 1994). Therefore,
to exclude this possibility, I conducted a dual immunofluorescence stain for p62 and the lysosomal
membrane protein LAMP-1 in sham and SNx rat kidneys. Whereas we observed a marked
increase in p62 labelled aggregates in the tubules of SNx kidneys relative to control, these
aggregates did not co-localize with LAMP-1, indicating that the observed protein aggregates were
not concentrated in lysosomes, and therefore, were likely endogenous in origin (Figure 8).
63
Figure 8. p62 does not co-localize with the lysosomal membrane protein LAMP-1 in rat kidney tubule
epithelial cells. Immunofluorescence microscopy for p62 and LAMP-1 in cryoembedded kidney sections
from sham-operated (Sham) and subtotally nephrectomized (SNx) rats depicting little co-localization
between p62 tagged protein aggregates (arrowheads) and LAMP-1 labelled lysosomes (arrows). Scale
bar=15 µm.
In summary, our study of kidney disease from humans with CKD caused by diabetes and in rats
with CKD caused by renal ablation, revealed a consistent downregulation of TFEB and an
associated increase in p62-tagged misfolded protein aggregates. In considering mechanisms to
remedy these features, we wondered whether HDAC6 inhibition could alter TFEB activity.
64
3 HDAC6 inhibition increases TFEB acetylation and nuclear
localization in NRK-52E cells
3.1 Tubastatin A administration increases acetylation of the HDAC6
substrate α-tubulin in NRK-52E cells
To determine whether HDAC6 inhibition alters TFEB activity, I treated proximal tubule lineage
NRK-52E cells with the small molecule HDAC6 inhibitor Tubastatin A. In initial experiments to
determine the efficacy of Tubastatin A in NRK-52E cells, a dose response experiment was
performed by exposing cells to increasing concentrations of Tubastatin A before immunoblotting
for acetylated α-tubulin, a known substrate of HDAC6. Taking this approach, I observed a dose-
dependent increase in acetylated α-tubulin following treatment with Tubastatin A (Figure 9).
Although specific for HDAC6 (IC50=15 nM), it has been suggested that higher doses of Tubastatin
A (10 µM) may also inhibit other HDAC isoforms (Butler et al., 2010a; Oehme et al., 2013).
Therefore, I opted to use a concentration of 2.5 µM. This selection is consistent with previous
literature that has demonstrated effective HDAC6 inhibition at this dose (Butler et al., 2010a).
65
Figure 9. Tubastatin A induces a dose-dependent increase in acetylated α-tubulin levels in NRK-52E
cells. Immunoblot and quantitative assessment for acetylated and total α-tubulin in NRK-52E cells
(n=3/group) treated with increasing doses of Tubastatin A at the following concentrations: 0µM, 0.6µM,
1.2µM, 2.5µM, 5µM and 10µM over a period of 24 hours. AU=arbitrary units. *p<0.01 vs. control, †p<0.001
vs. control, ‡p<0.0001 vs. control, §p<0.05 vs. 0.6µM, ¶p<0.05 vs. 1.2µM, ||p<0.0001 vs. 0.6µM, **p<0.01
vs. 1.2µM, ††p<0.01 vs. 2.5µM.
3.2 HDAC6 inhibition increases TFEB acetylation
Next, having observed that Tubastatin A increased the acetylation status of the known HDAC6
substrate, α-tubulin, I wondered if Tubastatin A could alter the acetylation status of TFEB. For
this experiment, NRK-52E cells were incubated with 2.5 µM of Tubastatin A for 24 hours. Then,
immunoprecipitation for TFEB was conducted. By immunoblot, I assessed levels of acetylated
66
lysine, the amino acid known to be deacetylated by HDAC6. It was found that under basal
conditions, TFEB is acetylated, and that levels of TFEB lysine acetylation increased following
treatment with Tubastatin A (Figure 10).
Figure 10. Tubastatin A increases TFEB acetylation in NRK-52E cells. Immunoblot and quantitative
assessment for acetylated lysine in NRK-52E cells (n=3/group) subjected to immunoprecipitation for TFEB
following a 24 hour incubation period with vehicle or 2.5 µM Tubastatin A. AU=arbitrary units. *p<0.05.
67
3.3 HDAC6 inhibition increases TFEB nuclear translocation and
transcriptional activity in NRK-52E cells
We next set out to determine whether increased TFEB acetylation following HDAC6 inhibition
with Tubastatin A could alter TFEB activity. TFEB activity is regulated by its cellular
localization. Whereas TFEB resides in the cytosol under basal conditions, the induction of
cellular stress causes an increase in the nuclear translocation of TFEB. Therefore, to assess the
functional consequence of HDAC6 inhibition on TFEB activity, I treated NRK-52E cells with 2.5
µM of Tubastatin for 24 hours. By immunoblot of the cytosolic and nuclear fraction, and
immunofluorescent stain for co-localization of TFEB with the nuclear marker 4’6-diamino-2-
phenylindole (DAPI), we observed an increase in the proportion of nuclear TFEB in NRK-52E
cells treated with Tubastatin A (Figure 11). This increase in nuclear translocation of TFEB was
accompanied by an approximate 30% increase in mRNA levels of the TFEB target LAMP-1
(LAMP-1 mRNA:RPL13a mRNA [arbitrary units]: Control, 1.0±0.0; Tubastatin A 1.3± 0.1.
p<0.05).
68
Figure 11. Tubastatin A increases TFEB nuclear localization in NRK-52E cells. (a) Immunoblotting for
nuclear TFEB in NRK-52E cells treated with vehicle or 2.5 µM Tubastatin A for 24 hours (n=3/group). (b)
Immunofluorescence staining for nuclear TFEB in NRK-52E cells treated with vehicle (n=6) or 2.5 µM
Tubastatin (n=9) for 24 hours. Scale bar= 15 µm. *p<0.05, †p<0.001.
3.4 Tubastatin A prevents programmed cell death in NRK-52E cells
Next, to determine whether the increase in TFEB nuclear translocation following HDAC6
inhibition affects cell survival, assays for programmed cell death were performed following
exposure of cells to conditions of increased endoplasmic reticulum stress. In cultured NRK-52E
cells, 500 nM of the ER stress inducer thapsigargin was administered following pre-treatment
with 2.5 µM Tubastatin A. Then, samples were immunoblotted for cleaved caspase-3 or subjected
to flow cytometric assessment of annexin V labelling. Cleavage of caspase-3 leads to its
69
activation of downstream signalling that culminates in apoptosis. Because of its essential role, it
is an established marker of programmed cell death. Similarly, annexin V is a calcium-dependent
phospholipid that binds to the exposed phospholipid phosphotidylserine (PS) on the surface of
cells undergoing programmed cell death. As such, an increase in annexin V positive cells is
indicative of a greater proportion of cells undergoing programmed cell death. Whereas cells
incubated with the ER stress inducer thapsigargin had a greater proportion of cells undergoing
programmed cell death, pre-treatment of NRK-52E cells with Tubastatin A prior to incubation
with thapsigargin significantly reduced levels of cleaved caspase 3 (Figure 12). Similarly,
Tubastatin A significantly reduced the amount of early-apoptotic cells (annexin V+/ 7AAD-)
(Figure 13) and necrotic cells (annexin V+/7-AAD+ cells [%]: Control, 2.3±0.4; Tubastatin A
2.5±0.1; thapsigargin, 2.8±0.4; *thapsigargin + Tubastatin A, 1.6±0.1. *p<0.05 vs. thapsigargin)
following exposure to thapsigargin.
70
Figure 12. Tubastatin A attenuates programmed cell death in NRK-52E cells as assessed by cleaved
caspase-3. Immunoblot and quantitative assessment of cleaved caspase 3 protein levels in NRK-52E
cells treated with 500 nM of the ER stress inducer thapsigargin for 24 hours following preincubation with
2.5 µM Tubastatin A or respective controls. *p<0.05 vs. thapsigargin + vehicle.
71
Figure 13. Tubastatin A attenuates programmed cell death in NRK-52E cells as assessed by annexin V
positive staining. Flow cytometric analysis of annexin V staining in NRK-52E cells treated with 500 nM of
the ER stress inducer thapsigargin for 24 hours following preincubation with 2.5 µM Tubastatin A or
respective controls. *p<0.01 vs. control, ‡‡p<0.05 vs. Tubastatin A, §§p<0.05 vs. thapsigargin.
An
nex
in V
+/7
AA
D-
cell
s (
%)
72
4 Tubastatin A administration attenuates progressive
proteinuria and structural remodelling in experimental CKD
4.1 Tubastatin A inhibits HDAC6 in rat kidneys
Having identified that HDAC6 inhibition increases nuclear translocation of TFEB and improves
tubule epithelial cell viability under conditions of ER stress in-vitro, we next sought to determine
the effect of Tubastatin A on renal function in a rodent model of advanced chronic kidney disease,
namely, the SNx rat model. Given the downregulation of TFEB in kidneys from SNx rats, we
queried whether adapting a method of increasing TFEB nuclear translocation and activity through
HDAC6 inhibition would serve a renoprotective role. In initial experiments, sham rats were
randomized to receive a subcutaneous (s.c) injection of either vehicle (5% dextrose) or Tubastatin
A (30mg/kg) administered thrice weekly for a period of three weeks. By immunoblot, we found
that this dose induced an increase in acetylated α-tubulin levels in rat kidney homogenates, thus
confirming the efficacy of the small molecule inhibitor Tubastatin A in inhibiting renal HDAC6
at the selected dosing regimen (Figure 14).
73
Figure 14. Tubastatin A increases acetylated α-tubulin levels in rat kidney homogenates. Immunoblot
and quantitative assessment for acetylated and total α-tubulin in kidney homogenates from rats treated
with vehicle (n=5) or 30 mg/kg s.c injection of Tubastatin A (n=6), administered thrice weekly over three
weeks. AU=arbitrary units. *p<0.05.
74
4.2 Tubastatin A attenuates progressive proteinuria in subtotally
nephrectomized rats
Next, renal ablation or sham surgery was conducted on male Sprague Dawley rats to generate
sham-operated or SNx rats. Four weeks after surgery, assessment of urine protein levels was
conducted to confirm the onset of kidney dysfunction. Then, rats were randomized to receive
vehicle or Tubastatin A (30 mg/kg s.c) thrice weekly for the remaining three weeks of the study.
A detailed outline of the study design is summarized in the Figure 15.
Figure 15. Flow diagram of in-vivo pharmacological study of HDAC6 inhibition in subtotally
nephrectomized rats (SNx). Male Sprague Dawley (age 8 weeks) underwent sham or subtotal (5/6)
nephrectomy. Rats were studied for 4 weeks before the assessment of urine protein, and then randomized
to receive Tubastatin A (30 mg/kg in 5% dextrose by thrice weekly subcutaneous injection) or vehicle for
three weeks. Then, urine protein levels and functional parameters (glomerular filtration rate, systolic blood
pressure, body weight) were assessed (7 weeks post-surgery) prior to collection of kidneys for biochemical
assessment.
After surgery, proteinuria was measured as an indicator of declining renal function. Four weeks
following surgery, SNx rats displayed a four fold increase in their urine protein relative to sham-
operated rats (Figure 16a). After establishing comparable renal damage between those rats that
75
had received renal ablation surgery, rats were randomized to receive either vehicle or 30 mg/kg
(s.c) of Tubastatin A for the remaining three weeks of the study. At the study’s conclusion,
proteinuria was once again measured. Whereas SNx rats receiving vehicle showed an
approximate doubling of their urine protein by week seven, those rats that received Tubastatin A
show a stabilization of their urine protein, comparable to their four week levels (Figure 16b).
76
Figure 16. Tubastatin A attenuates progressive proteinuria in subtotally nephrectomized rats. (a) Urinary
protein excretion in sham and subtotally nephrectomized (SNx) rats four weeks after surgery and before
the initiation of treatment. (b) Urinary protein excretion in sham and SNx rats treated with vehicle or
30mg/kg s.c. Tubastatin A administered thrice weekly for the remaining three weeks of the seven week
study. *p<0.05 vs. sham + vehicle, †p<0.05 vs. sham + Tubastatin A, ‡p<0.01 vs. sham + Tubastatin A,
§p<0.05 vs. SNx + vehicle.
77
4.3 Physiological parameters of sham and subtotally nephrectomized
rats treated with vehicle or Tubastatin A
At the end of the study period, measures of kidney function (Table 1) were assessed, and renal
tissue was harvested from all rats for structural analysis. SNx surgery resulted in a significant
decrease in body weight relative to sham-operated rats, with Tubastatin A causing mild decreases
in body weight in both sham and SNx rats. In addition, SNx surgery led to a significant increase
in remnant kidney weight, whereas Tubastatin A administration prevented renal enlargement in
SNx rats, with final kidney weights being comparable to sham-operated rats receiving vehicle.
By the end of the study, SNx rats displayed pathophysiological changes resulting from progressive
renal decline as evidenced by a significant increase in systolic blood pressure (SBP) and a
significant decrease in glomerular filtration rate (GFR) (Table 1). Whereas Tubastatin A led to
very mild improvements in SBP and GFR in SNx rats, these changes were not statistically
significant.
78
Table 1. Functional characteristics of sham-operated and subtotally nephrectomized
(SNx) rats treated with vehicle or Tubastatin A.
Body
weight (g)
Left kidney
weight (g)
Left
kidney:body
weight (%)
SBP
(mmHg)
GFR
(ml/min/kg)
Sham +
vehicle
610±20 1.69±0.06 0.28±0.01 126±2 8.5±0.5
Sham +
Tubastatin A
562±16* 1.56±0.04 0.28±0.01 123±2 8.8±1.0
SNx +
vehicle
516±11* 2.42±0.07‡§ 0.47±0.01‡§ 204±12‡§ 2.8±0.7‡§
SNx +
Tubastatin A
513±15† 1.86±0.10¶|| 0.36±0.02‡§|| 189±12‡§ 3.3±0.3‡§
SBP = systolic blood pressure, GFR = glomerular filtration rate
*p<0.05 vs. sham + vehicle, †p<0.001 vs. sham + vehicle, ‡p<0.0001 vs. sham + vehicle, §p<0.0001 vs.
sham + Tubastatin A, ¶p<0.01 vs. sham + Tubastatin A, ||p<0.0001 vs. SNx + vehicle.
79
4.4 Tubastatin A attenuates tubulointerstitial, but not glomerular, collagen
IV deposition
Next, to assess the effect of Tubastatin A on structural remodelling, we immunohistologically
stained for collagen IV in formalin fixed paraffin embedded kidney sections from sham-operated
and SNx rats that received treatment with either vehicle or Tubastatin A (Figure 17).
Tubulointersitial fibrosis was quantified as the proportional area of cortical tubulointerstitial
collagen IV immunostaining. No observable histological changes in collagen IV deposition were
observed in sham-operated animals treated with Tubastatin A relative to vehicle. Renal ablation
significantly increased the degree of cortical tubulointerstitial fibrosis relative to sham-operated
rats. However, whereas SNx rats treated with vehicle had a four-fold increase in the proportional
area of collagen IV immunostaining, SNx rats treated with Tubastatin A only showed a two-fold
increase in collagen IV immunostaining relative to sham-operated animals. Similarly, renal
ablation also resulted in significant glomerular fibrosis as evidenced by a three-fold increase in
glomerular collagen IV deposition in SNx rats relative to sham-operated rats. However, whereas
Tubastatin A was associated with a very mild decrease in glomerular collagen IV in SNx rats, this
reduction was not statistically significant.
80
Figure 17. Immunohistological stain for collagen IV in sham and subtotally nephrectomized rats treated
with vehicle or Tubastatin A. Representative photomicrographs and quantification of immunohistological
stain for (a) tubulointerstitial collagen IV and (b) glomerular collagen IV in sham or subtotally
nephrectomized (SNx) rats treated with vehicle or Tubastatin A. (Sham: vehicle, n=10; Tubastatin A, n=10.
SNx: vehicle, n=6; Tubastatin A, n=10). Scale bar= 50 µm. *p<0.05 vs. sham + vehicle, †p<0.05 vs. sham
+ Tubastatin A, ‡ p<0.05 vs. SNx + vehicle.
81
4.5 Tubastatin A increases nuclear translocation of TFEB and reduces
p62 accumulation in-vivo
Having discovered that HDAC6 inhibition by Tubastatin A attenuates functional and structural
decline in SNx rats, I set out to determine if this was associated with an increase in TFEB activity
as seen in our in-vitro experiments. To assess this, the proportion of nuclear TFEB was measured
by immunoblot on nuclear fractions isolated from kidney homogenates from sham and SNx rats
treated with vehicle or Tubastatin A. Consistent with our in-vitro findings, HDAC6 inhibition by
Tubastatin A increased the proportion of nuclear TFEB in kidneys of sham and SNx rats relative
to their vehicle treated counterparts (Figure 18a). Having demonstrated that HDAC6 inhibition
increased TFEB translocation both in-vitro and in-vivo, we hypothesized that an increase in TFEB
activity would be accompanied by a reduction in p62 accumulation in kidney tubules of SNx rats.
To assess this, formalin-fixed paraffin embedded kidney sections from sham and SNx rats treated
with vehicle or Tubastatin A were immunohistologically assessed for the protein aggregate
marker p62. Similar to kidneys from patients with diabetic kidney disease, and our initial screen
of SNx kidneys, there was a significant increase in p62-labelled aggregates in renal tubules of
SNx rats. Interestingly, treatment with Tubastatin A was accompanied by a marked reduction in
p62 immunostaining in renal tubules (Figure 18b and 18c).
82
Figure 18. Tubastatin A increases nuclear localization of TFEB which is accompanied by a reduction in
p62-labelled protein aggregates in the kidneys of subtotally nephrectomized rats. (a) Immunoblot for TFEB
on nuclear and cytosolic fractions of kidney homogenates from sham and subtotally nephrectomized (SNx)
rats treated with vehicle or Tubastatin A. Immunoblot is representative of at least three samples per group.
(b) Representative photomicrographs and quantification of immunohistological stain for p62 in sham or
SNx rats treated with vehicle or Tubastatin A. Arrow heads point to p62 positive tubules. (Sham: vehicle,
n=10; Tubastatin A, n=10. SNx: vehicle, n=8; Tubastatin A, n=10). Scale bar=50 µm. *p<0.001 vs. sham
+ vehicle, †p<0.001 vs. sham + Tubastatin A, ‡ p<0.05 vs. sham + Tubastatin A, §p<0.001 vs. SNx +
vehicle.
83
4.6 Tubastatin A attenuates tubule epithelial cell death in subtotally
nephrectomized rats
In my final series of experiments, I set out to assess the renoprotective role of Tubastatin A on
tubule epithelial cell viability. Formalin fixed, paraffin embedded kidney sections from sham-
operated and SNx rats treated with vehicle or Tubastatin A were assessed for cell death using
terminal deoxynucleotidyl transferase dUTP nick end labelling (TUNEL). As expected, SNx rats
displayed an increase in tubule epithelial cell death relative to their sham-operated counterparts.
However, SNx rats receiving treatment with Tubastatin A had less TUNEL positive nuclei (Figure
19).
84
Figure 19. Tubastatin A reduces the number of TUNEL positive nuclei in subtotally nephrectomized rats.
Representative photomicrographs and quantification of TUNEL stain in sham or subtotally nephrectomized
(SNx) rats treated with vehicle or Tubastatin A. Arrow heads point to TUNEL positive nuclei. (Sham:
vehicle, n=9; Tubastatin A, n=9. SNx: vehicle, n=8; Tubastatin A, n=9). *p<0.001 vs. sham + vehicle,
†p<0.001 vs. sham + Tubastatin A, ‡ p<0.05 vs. SNx + vehicle.
85
Chapter 5
Discussion
1 Overview
In this study, I found that TFEB downregulation was associated with an increase in p62-labelled
aggregates in human and rodents with diabetic and experimental CKD, highlighting misfolded
protein accumulation as a feature of chronic kidney disease. Secondly, I found that HDAC6
inhibition by Tubastatin A increased TFEB activity through alteration of its acetylation status.
Increased TFEB acetylation following Tubastatin A treatment was associated with increased
TFEB nuclear localization and induction of TFEB transcriptional activity. Induction of TFEB
activity correlated with a reduction in tubule epithelial cell death. In-vivo, HDAC6 inhibition by
Tubastatin A attenuated progressive proteinuria and blunted structural remodelling. This was
associated with increased nuclear translocation of TFEB in renal tissue from rats treated with
Tubastatin A and was accompanied by both improved clearance of misfolded protein aggregates
in renal tubules, and improved tubule cell viability. Collectively, this study highlights HDAC6
inhibition as one method of inducing TFEB activity which may provide a new treatment option
for CKD.
86
2 TFEB downregulation is associated with increased p62-
accumulation in human diabetic kidney disease
In the first series of experiments, samples of human cortical kidney tissue from patients with and
without histopathologically confirmed diabetic glomerulosclerosis were assessed for changes in
TFEB expression. While the use of archival human kidney tissue in this manner provides the
strength of assessing pathological processes within an intrinsically variable patient population, we
are cognizant of a number of issues that can arise from its use. For example, in this study, samples
were acquired during tumour nephrectomy which is a process that requires surgically induced
renal clamp ischemia prior to acquisition of the biopsy. In addition to in-vivo ischemic conditions,
once acquired, the sample is subjected to ex-vivo ischemic conditions during collection, storage
and transport before fixation. Studies have shown that this period is associated with degradation
of RNA and a change in gene expression in the isolated tissue, namely, in the induction of hypoxia
inducible factors, and upregulation of apoptotic pathways (Sun et al., 2016). Since we are
evaluating changes in gene expression, ischemia induced perturbations in transcription could
serve as a potential confounding variable. However, kidney tissue from patients without diabetes
that served as controls were acquired under similar conditions and would be expected to have
comparable alterations in gene expression, a factor that would be minimized upon normalization.
In our isolation of RNA, we opted to acquire RNA from paraffin embedded renal tissue using
practices that are already established in our lab (Advani et al., 2009). To account for the risk of
RNA degradation, I assessed the integrity of an isolated RNA sample from paraffin embedded
tissue and found that the isolated RNA had a RNA integrity number (RIN) of 7.20, indicating
suitable RNA quality for our downstream assessments (Schroeder et al., 2006).
87
Accepting the limitations of experimentation in archival formalin-fixed paraffin embedded tissue,
quantitative assessment of TFEB expression levels by RTqPCR revealed that TFEB was
downregulated in kidney tissue from humans with diabetic kidney disease. Suggestive of a
downregulation of autophagy, we postulated that this would manifest as an increase in misfolded
protein accumulation. Therefore, an immunohistological stain was conducted for p62, a protein
aggregate marker known for its role in sequestering misfolded proteins into aggregates for bulk
degradation through the autophagy-lysosomal pathway. Immunohistological assessment revealed
a marked and consistent increase in p62-labelled aggregates in renal tubules of patients with
diabetic kidney disease relative to controls. This finding is consistent with other studies that have
noted an increase in p62 aggregates in the tubules of obese mice with marked renal dysfunction
(Yamahara et al., 2013), but the contribution of these protein aggregates to the progression of
kidney disease remains unclear.
Clinically, dysregulation in TFEB and p62 accumulation seems to precede major reductions in
GFR, with most of the patients with diabetic kidney disease in the present study having an eGFR
of greater than 60 mL/min/1.73m2. In its present form however, this study is mechanistically
limited and unable to establish a temporal or causal relationship between TFEB decline and
impaired renal function. Since proteinuria precedes GFR decline in earlier stages of disease
(Regeniter et al., 2009), it would be interesting to assess the correlation between proteinuria and
the onset of TFEB decline in the earlier stages of the disease (stage 1-2), as well as the endurance
of TFEB decline and protein aggregates in more advanced stages of CKD associated with greater
declines in GFR (stage 4-5) Unfortunately, historical urine protein data were not available for
some of the patients from whom kidney tissue had been obtained. Secondly, most patients with
diabetic kidney disease received blood pressure lowering therapy through an ACEi or ARB. It is
88
unknown whether the changes in TFEB gene expression and protein aggregation could be
influenced by these medications and thus presents as a potential confounder. Given these
limitations, and our interest in gaining mechanistic insight into the relationship between TFEB
and CKD, we moved to assess TFEB levels and protein aggregation in an experimental model of
CKD.
3 Diminished TFEB and increased misfolded protein
accumulation occur in subtotally nephrectomized rats
In selecting a model of experimental CKD, we chose to assess TFEB levels and protein
aggregation in SNx rats, a model of progressive proteinuric kidney disease generated through
renal ablation. The reduction in renal mass in SNx rats is accompanied by hyperfiltration,
proteinuria, compensatory growth, glomerular and tubulointerstitial fibrosis and GFR decline
reminiscent of human CKD including diabetic kidney disease even though rats are
normoglycemic (Kaufman et al., 1974). Correspondingly, most rodent models of diabetes do not
develop GFR decline, and do not mimic the tubulointerstitial injury increasingly appreciated as a
key contributor to human diabetic kidney disease (Gilbert, 2017). In the SNx model, we also
observed downregulation of TFEB and an accumulation of p62 immunostaining in tubules of SNx
rats, highlighting these features as common factors of CKD.
The downregulation of TFEB and the accumulation of p62 in renal tubules was suggestive of
increased protein misfolding and impaired autophagic clearance of misfolded proteins through
dampening of the autophagy-lysosomal pathways. However, unsure as to whether the increase in
89
p62 was reflective of increased p62 accumulation or p62 expression, I blotted kidney
homogenates from sham and SNx rats for p62, which revealed a marked increase in p62 in
diseased rat kidneys. Whereas this may be suggestive of impaired clearance of p62-tagged
proteins, the use of p62 as a sole marker of misfolded protein aggregation is limited due to the
fact that p62 is itself, a transcriptional target of TFEB, and is known to participate in other
signalling cascades (Ivankovic et al., 2016). Therefore, to further assess the degree of misfolded
protein accumulation, I moved upstream to assess the degree of endoplasmic reticulum stress (ER
stress), a causal factor in increased rates of protein misfolding that often precedes the
accumulation of misfolded protein aggregates. I blotted kidney homogenates from sham and SNx
rats for the ER protein phospho-eIF2α and found a significant increase in this marker of ER stress
in SNx kidneys. The finding of increased ER stress in the diseased kidney is consistent with a
growing body of literature that points to ER stress as a key cellular perturbation in the
pathogenesis of kidney disease, and has been observed in multiple cases of kidney injury,
including proteinuria (Ohse et al., 2006), hyperglycemia and the development of AGEs in the
urinary filtrate (Lindenmeyer et al., 2008), and uremic toxins (Kawakami et al., 2010).
Under conditions of ER stress, chaperones are employed as a first line measure to re-fold proteins
into their proper configurations (Hetz, 2012). When the demands of re-folding surpass the ability
of chaperones to salvage proteins, proteins are tagged with ubiquitin for bulk degradation
(Olzmann et al., 2008). Therefore, to further validate whether the increase in p62 was reflective
of increased misfolded protein accumulation, I immunoblotted kidney homogenates for ubiquitin
and observed an increase in total ubiquitin levels in SNx rat kidneys relative to sham rats,
supporting the presence of irreparable, misfolded proteins that have not been degraded by the
proteasome or autophagy-lysosomal pathway.
90
Having confirmed the presence of misfolded protein aggregates in renal tubules of SNx rats, and
cognizant of the vital role of proximal tubules in protein reabsorption, I queried whether the
increase in protein aggregation was reflective of protein uptake from the urinary filtrate, for
which, reabsorbed proteins fuse with lysosomes for degradation into their constituent amino acids
(Nielsen, 1994). To assess this, I probed for the lysosomal marker LAMP-1 and p62 and found
no colocalization, indicating that the aggregates of misfolded proteins originated from within the
cell. Collectively, these findings indicate that TFEB expression is diminished in CKD and
coincides with an increase in misfolded protein accumulation.
As a master regulator of autophagy, TFEB remains bound to activated mTORC1 and its binding
partner 14-3-3, in the cytosol. Upon nutrient deprivation, mTORC1 is inactivated, allowing for
TFEB de-phosphorylation, subsequent release from 14-3-3 and its translocation to the nucleus
where it can induce 1) upregulation of the CLEAR network and 2) its own self-inducible
transcription (Martini-Stoica et al., 2016). The apparent downregulation of TFEB in diabetic
kidney disease is consistent with previous research noting hyperactive mTORC1 in CKD.
Hypothetically, this would effectively sequester TFEB in the cytosol and prevent TFEB mediated
autophagy-lysosomal pathway upregulation, thus dampening the autophagic response.
Interestingly, the downregulation of TFEB, which may be a contributing factor in the
downregulation of autophagy, may also contribute to the accumulation of misfolded protein by
way of its regulation of the UPR. TFEB plays a role in the integrated stress response and
upregulates the responsiveness of the UPR to misfolded proteins by increasing levels of ATF4, a
transcription factor that increases expression of genes involved in the unfolded protein response
91
(Martini-Stoica et al., 2016). It is plausible that the increase in protein aggregates could be due
to a number of circumstances, starting with an increase in ER stress, and accompanied by
downregulation of both the UPR and autophagy systems, resulting in the accumulation of
misfolded proteins in the cytosol. Furthermore, ubiquitinated protein aggregates in the cytoplasm
participate in a feedback loop to the UPS, reducing the efficiency of the proteasome, further
precipitating an increase in accumulated misfolded protein (Kopito, 2000).
Given the finding that misfolded protein accumulation is a feature of human and experimental
CKD, identifying methods to increase TFEB activity may hold therapeutic promise in increasing
clearance of protein aggregates. While the most obvious method of achieving this goal is
modulation of TFEB phosphorylation through inhibition of mTORC1, the use of mTORC1
inhibitors is itself associated with adverse renal outcomes (Diekmann et al., 2012). Recent work
by Bao and colleagues has identified novel TFEB regulation through acetylation, suggesting
mTORC1 independent mechanisms of regulation (Bao et al., 2016). Therefore, we set out to
assess modulators of TFEB acetylation status as potential regulators of its activation.
92
4 HDAC6 inhibition induces TFEB activity in NRK-52E cells
We opted to study HDAC6 as a potential regulator of TFEB acetylation and activation. As a
cytosolic deacetylase, HDAC6 imparts regulation of transcriptional activity through regulation of
nuclear shuttling of a number of transcription factors. For example, under basal conditions
HDAC6 forms a tri-complex with HSF1 and HSP90, effectively sequestering HSF1 in the cytosol
(Boyault et al., 2006b). To assess the effect of HDAC6 inhibition on TFEB, I first tested the
efficacy of a small molecule inhibitor of HDAC6, Tubastatin A in NRK-52E cells, an
immortalized cell line of proximal tubule lineage. Tubastatin A is highly selective for the DD2
domain of HDAC6 as evidenced by an IC50 of 0.015 µM±0.001 (Butler et al., 2010a). Incubation
of NRK-52E cells with increasing concentrations of Tubastatin A led to a dose-dependent increase
in hyperacetylation of the HDAC6 substrate α-tubulin. However, a key limitation of the use of
small molecule inhibitors is the potential off-target inhibition of other isoforms. Indeed, while
Tubastatin A has an IC50 of greater than 30 for most HDAC isoforms, it has an IC50 of 0.0854
µM±0.040 for HDAC8 (Butler et al., 2010a), suggesting its potential inhibition at higher doses.
Furthermore, when administered at 10 µM in a separate study, Tubastatin A led to acetylation of
histones, indicative of class I HDAC inhibition (Butler et al., 2010a). Administration of
Tubastatin A at 2.5 µM has been found to induce α-tubulin without the acetylation of histone,
indicative of HDAC6 specific inhibition at this dose (Butler et al., 2010a). Therefore, I opted to
use a dose of 2.5 µM for all in-vitro experiments conducted in this study.
By way of immunoprecipitation in NRK-52E cells, I found that TFEB is a direct substrate for
HDAC6 mediated deacetylation. HDAC6 inhibition led to hyperacetylation of TFEB at its lysine
residues and greater nuclear localization following treatment with Tubastatin A. However, given
93
the potential for off-target effects of the small molecule inhibitor, in future experiments, I would
seek to recapitulate these findings by administering a small interfering RNA duplex (siRNA)
designed for degradation of HDAC6 mRNA. Following knockdown of HDAC6, I would assess
acetylation and nuclear localization of TFEB to confirm that the changes we observed were
governed by HDAC6. In spite of this limitation, increased acetylation and nuclear localization of
TFEB following Tubastatin A treatment suggests that HDAC6 may participate in sequestering
TFEB in the cytosol.
The mechanism by which increased TFEB acetylation contributes to its nuclear localization is
unknown. Previous literature has shown that HDAC6 inhibition blocks the interaction between
14-3-3 proteins and its binding partners (Mortenson et al., 2015). It is possible that acetylation
could change the electrostatic interaction between TFEB and its cytosolic binding partner 14-3-3,
potentially weakening their interaction and promoting the nuclear translocation of TFEB. In
future experiments, I could assess this by conducting mass spectrometry analysis of acetylated
residues following both pharmacological inhibition and knockdown of HDAC6. Then, by way of
site directed mutagenesis at the identified acetylation sites, I could assess 14-3-3’s binding affinity
to acetylation resistant TFEB mutants and hyperacetylated TFEB mutants to gain insight into the
mechanism behind the association between TFEB acetylation and its increased nuclear
translocation.
Next, to assess the functional consequence of TFEB hyperacetylation and nuclear translocation, I
quantified gene expression changes in a TFEB transcriptional target known to change during
induction of the autophagy-lysosomal pathway. Tubastatin A led to upregulation of the lysosomal
94
protein LAMP-1 mRNA levels, suggestive of CLEAR network activation. To further validate
this finding, in future experiments, it would be prudent to assess transcriptional changes in
multiple CLEAR network genes. Secondly, to determine a causal relationship between HDAC6
inhibition and subsequent TFEB activation of transcriptional networks, one would knockdown
TFEB using siRNA and assess changes in LAMP-1 expression following incubation with
Tubastatin A. Nonetheless, the observation that Tubastatin A induced upregulation of LAMP-1
suggests that HDAC6 inhibition may upregulate the autophagy-lysosomal pathway, plausibly
through an acetylated TFEB dependent mechanism.
Whereas the acetylation of TFEB has been reported by Bao and colleagues, they found that TFEB
deacetylation by the Class III HDAC SIRT1 increased nuclear translocation, and subsequent
activation of CLEAR network genes (Bao et al., 2016). Our finding that hyperacetylation leads
to a comparable result indicates that HDAC6 may act at a different residue. Future work using
mass spectrometry assessment of acetylated residues following HDAC6 inhibition may provide
insight as to its site of action. Interestingly, Bao and colleagues only reported partial changes in
CLEAR network activation, but not upregulation of the full spectrum of CLEAR network genes.
It would be interesting to determine whether hyperacetylation of TFEB imparts preferential
binding to different promoter regions, which could lead to partial upregulation of portions of the
autophagy lysosomal pathway, such as late stage lysosomal biogenesis as we observed, and not
all TFEB mediated genes. Indeed, other transcription factors, e.g. Kruppel-like factor 4 (Klf-4),
demonstrates preferential binding based on post-translational modifications in which methylation
sites increase the binding affinity of Klf-4 to CpG sites in promotor regions (Hashimoto et al.,
2016). Whether acetylation imparts preferential binding to promotor regions in a similar fashion
may be a topic for future study. One means to assess this would be to conduct a chromatin
95
immunoprecipitation (ChIP) experiment following Tubastatin A treatment in NRK-52E cells and
assess for enrichment of acetylated TFEB at multiple promotors to assess for preferential
enrichment for certain genes relative to the entire CLEAR network.
5 Tubastatin A prevents programmed cell death in NRK-52E
cells
To assess downstream effects of increased TFEB activity, we opted to study changes in
programmed cell death in proximal tubule cells. This is because proximal tubule cell
programmed cell death has been widely associated with CKD development in the literature
(reviewed in (Schelling, 2016). Proximal tubule cells were subjected to ER stress based on the
finding that ER stress was increased in diseased SNx rat kidneys. Whereas ER stress increased
programmed cell death in NRK-52E cells, HDAC6 inhibition attenuated programmed cell death
and was associated with induction of TFEB activity as evidenced by an increase in LAMP-1
transcript levels. Functionally, increased cell death of proximal tubule cells is known to contribute
to the release of inflammatory cytokines, and fibrotic remodelling in the tubulointerstitium
(Hodgkins and Schnaper, 2012), and the reduction of programmed cell death points to a
potentially renoprotective role of HDAC6 inhibition and its associated increase in TFEB
activation of the autophagy-lysosomal pathway. This finding is consistent with research that
shows a bi-directional relationship between programmed cell death and autophagy. While
autophagy increases as an initial protective step, chronic disease can initiate pro-death pathways
that dampen the autophagic response and favour programmed cell death. For example, an increase
an ER stress activates an intrinsic signalling pathway mediated by the B-cell lymphoma 2 (Bcl-2)
family. As a consequence, Bcl-2 interacts with the autophagy protein beclin-1 and prevents the
96
formation of beclin-1 mediated autophagosome formation (Li et al., 2015). Furthermore,
activated caspases in the apoptosis pathway cleave autophagy related proteins such as ATGs,
further dampening the autophagic response (De Rechter et al., 2016). In contrast, increasing
autophagy, as we have potentially done by increasing TFEB translocation, can also reduce pro-
apoptotic pathways, placing greater dependence on cellular degradative processes before the
cellular decision to undergo programmed cell death. For example, an increase in autophagy is
accompanied by an increase in autophagy related genes such as Atg12 and Atg3. Atg12
conjugation with Atg3 increases Bcl-XL expression, a potent inhibitor of apoptosis (Tait et al.,
2014). Therefore, increasing the autophagy-lysosomal pathway by way of increased TFEB
activity may also increase autophagy mediated suppression of apoptosis. A limitation of the
present study is our choice to focus on the ultimate downstream consequences of altered TFEB
activity, namely, the accumulation of misfolded proteins, programmed cell death and renal
decline. As a result, we have not defined whether and to what extent HDAC6 inhibition directly
affects autophagic processes in a TFEB dependent manner. In-vivo, at least, it has been difficult
to tease out given the temporal nature of autophagy in both its pro and anti-apoptotic effects.
Mechanistically, our in-vitro experiments point to a potential role of TFEB acetylation in
regulating TFEB activity. However, de-phosphorylation of TFEB is the classically understood
method of nuclear translocation and in this study, I did not assess the effect of HDAC6 inhibition
on the enzymatic activity of phosphatases, such as calcineurin (Medina et al., 2015), that are
involved in regulating de-phosphorylation and nuclear translocation of TFEB. Nonetheless, this
study demonstrates that HDAC6 inhibition alters TFEB activity, a clinically relevant finding
given the observation that TFEB is dysregulated and misfolded proteins accumulate in CKD.
With the goal of assessing HDAC6 mediated regulation of TFEB as a potential avenue to reduce
97
the burden of CKD, in the next phase of this study, I assessed the effect of HDAC6 inhibition on
renal structure and function in an experimental model of CKD, namely, the SNx rat.
6 Tubastatin A is renoprotective in subtotally nephrectomized
rats
Consistent with our findings in-vitro, Tubastatin A enhanced the nuclear localization of TFEB in
rat kidneys. While p62 labelled aggregates accumulated in renal tubules of vehicle treated SNx
rats, Tubastatin A treatment prevented the accumulation of p62 in SNx rats. The increase in TFEB
nuclear translocation and reduction in p62-labelled protein aggregates were associated with a
reduction in tubule epithelial cell death in Tubastatin A treated SNx rats. Structurally, this was
accompanied by a reduction in tubulointerstitial (but not glomerular) fibrosis and functionally this
was associated with attenuation of urine protein excretion without significant improvements in
GFR.
A key strength of this study’s design was that treatment was initiated after the onset of proteinuria,
four weeks after renal ablation. This is clinically relevant because it mirrors a clinical scenario in
which patients may present with proteinuria in the earlier stages of CKD (Regeniter et al., 2009).
Following the initiation of Tubastatin A treatment in SNx rats after the fourth week, urine protein
levels stabilized and did not significantly progress by the seventh week of study, suggestive of
stabilization of kidney function over time. This attenuation of proteinuria was accompanied by a
decrease in misfolded protein accumulation, a reduction in tubule epithelial programmed cell
death and an attenuation of tubulointerstitial fibrosis. Although it is tempting to speculate that a
98
causal relationship exists between the decrease in misfolded protein accumulation and
improvements in kidney structure and function under diseased conditions, it should be recognized
that it has not been proven in the present study. In other diseases however, such as
neurodegenerative diseases, a reduction in misfolded protein aggregates has been implicated in
improved outcomes (Ciechanover and Kwon, 2015; Sarkar et al., 2007; Tanaka et al., 2004).
Whether the same processes apply to the replicating tubule epithelial cells in CKD requires further
study.
Interestingly, kidney weight was also reduced in SNx rats treated with Tubastatin A. The reasons
for this are unclear. It could effect a change in cell size (hypertrophy) or cell number
(hyperplasia). HDAC6 inhibition reduces tubule cell proliferation in polycystic kidney disease
(Cebotaru et al., 2016). Whether the change in renal mass is attributable to anti-proliferative
effects of HDAC6 inhibition in SNx rats remains unclear.
Importantly, although Tubastatin A appears to attenuate renal decline as measured by proteinuria,
I did not see significant changes in GFR between vehicle and Tubastatin A treated SNx rats. This
is perhaps unsurprising. While GFR decline begins to appear by stage 3 CKD, with further
declines becoming evident as the disease progresses, the changes in GFR in the SNx model are
largely governed by acute changes following subtotal nephrectomy, for which, reports have noted
an immediate drop in GFR shortly after renal ablation surgery (Kaufman et al., 1974). This acute
drop in GFR may be the driving force in the decline in GFR observed seven weeks after surgery.
In contrast, proteinuria does not occur as an acute result of the surgery itself and is evidence of
99
progressive changes in the SNx kidney as a result of hyperfiltration, intraglomerular hypertension
and subsequent proteinuria (Palatini, 2012).
Furthermore, in their work assessing the ACEi enalapril on glomerular injury in SNx rats, which
today is main-stay therapy for CKD, Anderson and colleagues observed that ACE inhibition
attenuated proteinuria 8 weeks after renal ablation without significant changes in GFR (Anderson
et al., 1985). Therefore, the fact that Tubastatin A imparts renoprotective benefits on proteinuria
and not in GFR does not negate the therapeutic potential of HDAC6 inhibition. While Tubastatin
A has demonstrated comparable renoprotective benefits to current therapies for CKD, other
HDAC6 inhibitors that are already being tested for safety in patient populations will likely see
more success in transferability to the clinic. For example, whereas Tubastatin A has not
progressed to clinical study, rocilinostat (ACY-1215) is another HDAC6 inhibitor (IC50=5 nM)
that is currently in phase I/II clinical trials for multiple myeloma (NCT01323751) and lymphoid
malignancies (NCT02091063).
However, in considering the renoprotective effect of HDAC6 inhibition in CKD, and its regulation
of TFEB, which is itself involved in autophagy, it is worth considering the alternative roles of
HDAC6 in other steps of the autophagy-lysosomal pathway. HDAC6 plays multiple roles in
promoting the autophagy-lysosomal pathway, which may, at first glance, be discordant with our
observation of a renoprotective effect of its inhibition. As an aggresome organizer, HDAC6
serves as an adaptor protein between polyubiquitinated proteins and the dynein motor complex
for microtubule retrograde transport to the peri-nuclear aggresome (Kawaguchi et al., 2003b;
Kopito, 2000; Olzmann et al., 2008). However, work by Lee and colleagues draw a distinction
100
between quality control autophagy and nutrient-starvation autophagy. Whereas HDAC6 is
important for cortactin mediated F-actin cytoskeletal remodelling for autophagosome lysosome
fusion, this function is only apparent under basal, quality control autophagy. Under stressed
conditions, HDAC6 appears dispensable for this role, and may instead, play an alternative,
pathological role by dampening the cell’s ability to mount an autophagic response by sequestering
TFEB in the cytoplasm.
Finally, it remains possible that the effects of HDAC6 inhibition on improving renal structure and
function in SNx rats are multifactorial and not solely due to increased TFEB activity. Current
established therapies that are known to improve renal outcomes (e.g. ACEi (Jafar et al., 2003) and
sodium glucose cotransporter 2 (SGLT2) inhibition (Cherney et al., 2014) likely have multiple
cell and organ effects. It seems likely therefore, that HDAC6 inhibitors may likewise have
multiple sites of action. For example, HDAC6 inhibition improved renal function and decreased
TGF-β (Choi et al., 2015b) and also prevented the development of polycystic kidney disease
(Cebotaru et al., 2016). In line with these finding, the experiments detailed here confirm the
renoprotective effect of HDAC6 inhibition and they identify TFEB acetylation as a novel means
by which these effects may occur.
101
Chapter 6
Conclusion
In conclusion, this study found that in human diabetic kidney tissue and SNx rats, mRNA levels
of transcription factor EB (TFEB) were decreased. This was accompanied by an accumulation of
p62-labelled protein aggregates in renal tubules. Given the apparent inability to contend with
increasing amounts of protein aggregates in CKD, we set out to identify methods to increase
activation of TFEB by facilitating its nuclear localization by way of HDAC6 inhibition. We found
that inhibition of HDAC6 increased acetylation of TFEB, increased its nuclear translocation and
reduced tubule epithelial cell death and this was associated with an attenuation of progressive
proteinuria and reduced structural remodelling in SNx rats. The main findings of this study are
summarized in Figure F. Collectively, this study highlights a regulatory relationship between
HDAC6 and TFEB and it points to the therapeutic benefit of augmented quality control
mechanisms in the treatment of CKD.
Figure F. HDAC6 inhibition facilitates transcription factor EB mediated clearance of misfolded protein in
chronic kidney disease.
102
Chapter 7
Future Directions
My thesis aimed to evaluate a potential regulatory relationship between HDAC6 and TFEB in
increasing the clearance of misfolded proteins in CKD. We demonstrated a dysregulation of
TFEB in human diabetic kidney disease and in a model of advanced chronic kidney disease.
Through in-vitro work, I found that HDAC6 inhibition led to hyperacetylation of TFEB and
improved tubule epithelial cellular viability. In-vivo, HDAC6 inhibition induced TFEB nuclear
translocation, increased clearance of misfolded proteins and attenuated renal functional and
structural decline.
Beyond the limitations and future experiments already discussed, there are a number of additional
directions to consider. Whereas a downregulation of TFEB is associated with advanced kidney
disease in humans and SNx rats, we have not demonstrated a causal link between a
downregulation in TFEB and the development of CKD. To gain more insight into the contribution
of dysregulated TFEB in CKD, we could assess the effect of TFEB knockout on kidney function
in a model of progressive renal disease such as the unilateral ureteral obstruction model (UUO)
(Chevalier et al., 2009). Homozygous knockout of TFEB in mice is embryonically lethal
(Steingrimsson et al., 1998) and this creates a limitation to the use of a conventional knockout
mouse system. Instead, we could approach this problem in one of two ways. First, we could opt
to study the progression of kidney disease following UUO in TFEB heterozygous mice, which,
according to the International Mice Phenotyping Consortium (IMPC), develop normally with mild
103
skeletal defects and changes in body mass
(http://www.mousephenotype.org/data/genes/MGI:103270). While this would provide some
insight, the global deficiency of TFEB may impart effects on other organs. For example,
enhancement of TFEB activity is protective against myocardial dysfunction (Unuma et al., 2013)
which is itself, an independent contributor to CKD (Keith et al., 2004). As such, this would limit
our ability to discern a causal relationship between downregulation of TFEB in diseased kidney
tissue and changes in renal function. To address this issue, we could generate an inducible, kidney
specific TFEB mouse model. To target TFEB knockout to renal epithelial cells, we could mate
tamoxifen-inducible KspCad-CreERT2 (Cre) mice (Lantinga-van Leeuwen et al., 2007) with
TFEB floxed mice (http://www.informatics.jax.org/allele/allgenoviews/MGI:4431759).
In addition, having demonstrated increased TFEB activity through its nuclear localization, I am
aware that this study is limited in its lack of direct demonstration of increased autophagy-
lysosomal activity, beyond transcriptional changes in LAMP-1. To better characterize a temporal
relationship between HDAC6 inhibition, TFEB translocation and autophagic activity, additional
measures of autophagosome formation and lysosomal biogenesis could be assessed in future
experiments. These assessments could include immunoblotting to assess changes in protein levels
of proteins involved in autophagy, such as the conversion of microtubule associated protein
1A/1B light chain 3B (LC3), autophagy related proteins (ATGs) and beclin-1 (Mizushima et al.,
2010) in NRK-52E cell treated with Tubastatin A in the presence or absence of TFEB knockdown
with siRNA as well as RT-qPCR to assess multiple TFEB targets (Palmieri et al., 2011).
104
Next, given the multi-faceted role of HDAC6 in the autophagy pathway, through both its catalytic
and non-catalytic function, it would be important to better characterize the effect of
inhibition/deletion of HDAC6 on renal function and structure. In the present study, I compared
TFEB transcript levels between humans with diabetic kidney disease and non-diabetic rats with
CKD. In future studies, it would be useful to explore TFEB transcript levels and misfolded protein
accumulation in a diabetic mouse model. Accordingly, to address both of these queries, we are
currently in the process of breeding HDAC6-deficient mice with Akita diabetic mice that develop
diabetes and subsequently, diabetic kidney disease due to a mutation in the insulin 2 (Ins2) gene
(Gurley et al., 2010). In these experiments, we will survey TFEB mRNA and p62 protein levels
and we will compare the effects of HDAC6 inhibition with Tubastatin A and HDAC6 knockdown
in Akita diabetic mice. In addition to these in-vivo assessments, to gain mechanistic insight, one
could turn to an in-vitro system to determine which of the two catalytic sites of HDAC6 (DD1 or
DD2 or both) are responsible for mediating the acetylation of TFEB and its nuclear localization.
DD1, DD2 and DD1/DD2 HDAC6 mutants have been developed (Ran et al., 2015) and we have
recently received them in the lab. In future work, we will knockdown native HDAC6 with siRNA
and transfect NRK-52E cells with these HDAC6 mutants to assess the consequences of DD1,
DD2 and DD1/DD2 mutations on TFEB acetylation (immunoprecipitation) and nuclear
localization (immunoblotting and immunofluorescence microscopy).
Finally, while HDAC6 inhibition serves a renoprotective role, we did not explore the potential of
dual therapy with both renin-angiotensin blockade and HDAC6 inhibition. A future in-vivo study
could assess the renoprotective effect of Tubastatin A and ACE inhibition or angiotensin II
receptor blockade in a model of kidney disease reminiscent of human CKD, namely, the SNx rat
model. From a clinical perspective, this is important because any new therapy is likely to be
105
applied to patients on top of standard of care, which is currently renin-angiotensin blockade (Jafar
et al., 2003) and this study will enable us to assess whether any additional benefit can be gleaned
by the addition of an HDAC6 inhibitor to current therapy.
Despite these limitations, this study is, to the best of my knowledge, the first to demonstrate that
TFEB is diminished in CKD and the first to show a functional relationship between TFEB and
HDAC6. Both TFEB and HDAC6 represent viable targets to explore in future studies aimed at
slowing renal decline in CKD.
106
References
Advani, A., Gilbert, R.E., Thai, K., Gow, R.M., Langham, R.G., Cox, A.J., Connelly, K.A.,
Zhang, Y., Herzenberg, A.M., Christensen, P.K., et al. (2009). Expression, Localization, and
Function of the Thioredoxin System in Diabetic Nephropathy. Journal of the American Society
of Nephrology 20, 730-741.
Advani, A., Kelly, D.J., Advani, S.L., Cox, A.J., Thai, K., Zhang, Y., White, K.E., Gow, R.M.,
Marshall, S.M., Steer, B.M., et al. (2007). Role of VEGF in maintaining renal structure and
function under normotensive and hypertensive conditions. Proceedings of the National Academy
of Sciences of the United States of America 104, 14448-14453.
Amengual, J.E., Johannet, P., Lombardo, M., Zullo, K., Hoehn, D., Bhagat, G., Scotto, L., Jirau-
Serrano, X., Radeski, D., Heinen, J., et al. (2015). Dual Targeting of Protein Degradation
Pathways with the Selective HDAC6 Inhibitor ACY-1215 and Bortezomib Is Synergistic in
Lymphoma. Clin Cancer Res.
Anderson, S., Meyer, T.W., Rennke, H.G., and Brenner, B.M. (1985). CONTROL OF
GLOMERULAR HYPERTENSION LIMITS GLOMERULAR INJURY IN RATS WITH
REDUCED RENAL MASS. Journal of Clinical Investigation 76, 612-619.
Arnott, J.A., and Planey, S.L. (2012). The influence of lipophilicity in drug discovery and design.
Expert Opin Drug Discov 7, 863-875.
Astor, B.C., Matsushita, K., Gansevoort, R.T., van der Velde, M., Woodward, M., Levey, A.S.,
de Jong, P.E., Coresh, J., and Chronic Kidney Dis, P. (2011). Lower estimated glomerular
filtration rate and higher albuminuria are associated with mortality and end-stage renal disease. A
collaborative meta-analysis of kidney disease population cohorts. Kidney International 79, 1331-
1340.
107
Bao, J.T., Zheng, L.J., Zhang, Q., Li, X.Y., Zhang, X.F., Li, Z.Y., Bai, X., Zhang, Z., Huo, W.,
Zhao, X.Y., et al. (2016). Deacetylation of TFEB promotes fibrillar A beta degradation by
upregulating lysosomal biogenesis in microglia. Protein & Cell 7, 417-433.
Batchu, S.N., Brijmohan, A.S., and Advani, A. (2016). The therapeutic hope for HDAC6
inhibitors in malignancy and chronic disease. Clinical science (London, England : 1979) 130, 987-
1003.
Boyault, C., Gilquin, B., Zhang, Y., Rybin, V., Garman, E., Meyer-Klaucke, W., Matthias, P.,
Muller, C.W., and Khochbin, S. (2006a). HDAC6-p97/VCP controlled polyubiquitin chain
turnover. The EMBO journal 25, 3357-3366.
Boyault, C., Gilquin, B., Zhang, Y., Rybin, V., Garman, E., Meyer-Klaucke, W., Matthias, P.,
Muller, C.W., and Khochbin, S. (2006b). HDAC6-p97/VCP controlled polyubiquitin chain
turnover. Embo Journal 25, 3357-3366.
Brown, C.E., Lechner, T., Howe, L., and Workman, J.L. (2000). The many HATs of transcription
coactivators. Trends in Biochemical Sciences 25, 15-19.
Butler, K.V., Kalin, J., Brochier, C., Vistoli, G., Langley, B., and Kozikowski, A.P. (2010a).
Rational Design and Simple Chemistry Yield a Superior, Neuroprotective HDAC6 Inhibitor,
Tubastatin A. Journal of the American Chemical Society 132, 10842-10846.
Butler, K.V., Kalin, J., Brochier, C., Vistoli, G., Langley, B., and Kozikowski, A.P. (2010b).
Rational design and simple chemistry yield a superior, neuroprotective HDAC6 inhibitor,
tubastatin A. J Am Chem Soc 132, 10842-10846.
Cebotaru, L., Liu, Q.G., Yanda, M.K., Boinot, C., Outeda, P., Huso, D.L., Watnick, T., Guggino,
W.B., and Cebotaru, V. (2016). Inhibition of histone deacetylase 6 activity reduces cyst growth
in polycystic kidney disease. Kidney International 90, 90-99.
108
Cebotaru, V., Cebotaru, L., Kim, H., Chiaravalli, M., Boletta, A., Qian, F., and Guggino, W.B.
(2014). Polycystin-1 negatively regulates Polycystin-2 expression via the
aggresome/autophagosome pathway. The Journal of biological chemistry 289, 6404-6414.
Chauhan, S., Ahmed, Z., Bradfute, S.B., Arko-Mensah, J., Mandell, M.A., Choi, S.W., Kimura,
T., Blanchet, F., Waller, A., Mudd, M.H., et al. (2015). Pharmaceutical screen identifies novel
target processes for activation of autophagy with a broad translational potential. Nature
Communications 6.
Cherney, D.Z.I., Perkins, B.A., Soleymanlou, N., Maione, M., Lai, V., Lee, A., Fagan, N.M.,
Woerle, H.J., Johansen, O.E., Broedl, U.C., et al. (2014). Renal Hemodynamic Effect of Sodium-
Glucose Cotransporter 2 Inhibition in Patients With Type 1 Diabetes Mellitus. Circulation 129,
587-597.
Chevalier, R.L., Forbes, M.S., and Thornhill, B.A. (2009). Ureteral obstruction as a model of renal
interstitial fibrosis and obstructive nephropathy. Kidney Int 75, 1145-1152.
Choi, S.Y., Ryu, Y., Kee, H.J., Cho, S.N., Kim, G.R., Cho, J.Y., Kim, H.S., Kim, I.K., and Jeong,
M.H. (2015a). Tubastatin A suppresses renal fibrosis via regulation of epigenetic histone
modification and Smad3-dependent fibrotic genes. Vascul Pharmacol 72, 130-140.
Choi, S.Y., Ryu, Y., Kee, H.J., Cho, S.N., Kim, G.R., Cho, J.Y., Kim, H.S., Kim, I.K., and Jeong,
M.H. (2015b). Tubastatin A suppresses renal fibrosis via regulation of epigenetic histone
modification and Smad3-dependent fibrotic genes. Vascular Pharmacology 72, 130-140.
Choudhary, C., Kumar, C., Gnad, F., Nielsen, M.L., Rehman, M., Walther, T.C., Olsen, J.V., and
Mann, M. (2009). Lysine Acetylation Targets Protein Complexes and Co-Regulates Major
Cellular Functions. Science 325, 834-840.
Ciechanover, A., and Kwon, Y.T. (2015). Degradation of misfolded proteins in neurodegenerative
diseases: therapeutic targets and strategies. Experimental and Molecular Medicine 47.
109
Cook, C., Gendron, T.F., Scheffel, K., Carlomagno, Y., Dunmore, J., DeTure, M., and Petrucelli,
L. (2012). Loss of HDAC6, a novel CHIP substrate, alleviates abnormal tau accumulation. Human
molecular genetics 21, 2936-2945.
CORR (2015). Canadian Organ Replacement Register Annual Report: Treatment of End-Stage
Organ Failure in Canada, 2004 to 2013.
Cybulsky, A.V. (2013). The intersecting roles of endoplasmic reticulum stress, ubiquitin-
proteasome system, and autophagy in the pathogenesis of proteinuric kidney disease. Kidney
International 84, 25-33.
Dallavalle, S., Pisano, C., and Zunino, F. (2012). Development and therapeutic impact of
HDAC6-selective inhibitors. Biochemical Pharmacology 84, 756-765.
Dasmahapatra, G., Patel, H., Friedberg, J., Quayle, S.N., Jones, S.S., and Grant, S. (2014). In vitro
and in vivo interactions between the HDAC6 inhibitor ricolinostat (ACY1215) and the
irreversible proteasome inhibitor carfilzomib in non-Hodgkin lymphoma cells. Molecular cancer
therapeutics 13, 2886-2897.
de Haro, C., Mendez, R., and Santoyo, J. (1996). The eIF-2alpha kinases and the control of protein
synthesis. Faseb j 10, 1378-1387.
de Jong, P.E., and Curhan, G.C. (2006). Screening, monitoring, and treatment of albuminuria:
Public health perspectives. Journal of the American Society of Nephrology 17, 2120-2126.
De Meyer, G.R., De Keulenaer, G.W., and Martinet, W. (2010). Role of autophagy in heart failure
associated with aging. Heart Fail Rev 15, 423-430.
De Rechter, S., Decuypere, J.P., Ivanova, E., van den Heuvel, L.P., De Smedt, H., Levtchenko,
E., and Mekahli, D. (2016). Autophagy in renal diseases. Pediatr Nephrol 31, 737-752.
Decressac, M., Mattsson, B., Weikop, P., Lundblad, M., Jakobsson, J., and Bjorklund, A. (2013).
TFEB-mediated autophagy rescues midbrain dopamine neurons from alpha-synuclein toxicity.
110
Proceedings of the National Academy of Sciences of the United States of America 110, E1817-
E1826.
Dehay, B., Martinez-Vicente, M., Caldwell, G.A., Caldwell, K.A., Yue, Z.Y., Cookson, M.R.,
Klein, C., Vila, M., and Bezard, E. (2013). Lysosomal impairment in Parkinson's disease.
Movement Disorders 28, 725-732.
Dehmel, F., Weinbrenner, S., Julius, H., Ciossek, T., Maier, T., Stengel, T., Fettis, K., Burkhardt,
C., Wieland, H., and Beckers, T. (2008). Trithiocarbonates as a novel class of HDAC inhibitors:
SAR studies, isoenzyme selectivity, and pharmacological profiles. J Med Chem 51, 3985-4001.
Diekmann, F., Andres, A., and Oppenheimer, F. (2012). mTOR inhibitor-associated proteinuria
in kidney transplant recipients. Transplantation Reviews 26, 27-29.
Dobson, C.M. (2003). Protein folding and misfolding. Nature 426, 884-890.
Du, G., Liu, X., Chen, X., Song, M., Yan, Y., Jiao, R., and Wang, C.C. (2010). Drosophila histone
deacetylase 6 protects dopaminergic neurons against {alpha}-synuclein toxicity by promoting
inclusion formation. Molecular biology of the cell 21, 2128-2137.
Ferguson, B.S., and McKinsey, T.A. (2015). Non-sirtuin histone deacetylases in the control of
cardiac aging. J Mol Cell Cardiol 83, 14-20.
National Kidney Foundation (2002). K/DOQI clinical practice guidelines for chronic kidney
disease: evaluation, classification and stratification. (American Journal of Kidney Diseases), pp.
S1-266.
Fullgrabe, J., Klionsky, D.J., and Joseph, B. (2014). The return of the nucleus: transcriptional and
epigenetic control of autophagy. Nature Reviews Molecular Cell Biology 15, 65-74.
Gao, Y.S., Hubbert, C.C., and Yao, T.P. (2010). The microtubule-associated histone deacetylase
6 (HDAC6) regulates epidermal growth factor receptor (EGFR) endocytic trafficking and
degradation. The Journal of biological chemistry 285, 11219-11226.
111
Gilbert, R.E. (2017). Proximal Tubulopathy: Prime Mover and Key Therapeutic Target in
Diabetic Kidney Disease. Diabetes 66, 791-800.
Gradilone, S.A., Habringer, S., Masyuk, T.V., Howard, B.N., Masyuk, A.I., and Larusso, N.F.
(2014). HDAC6 is overexpressed in cystic cholangiocytes and its inhibition reduces cystogenesis.
The American journal of pathology 184, 600-608.
Grozinger, C.M., Hassig, C.A., and Schreiber, S.L. (1999). Three proteins define a class of human
histone deacetylases related to yeast Hda1p. Proceedings of the National Academy of Sciences of
the United States of America 96, 4868-4873.
Gurley, S.B., Mach, C.L., Stegbauer, J., Yang, J.H., Snow, K.P., Hu, A., Meyer, T.W., and
Coffman, T.M. (2010). Influence of genetic background on albuminuria and kidney injury in
Ins2(+/C96Y) (Akita) mice. American Journal of Physiology-Renal Physiology 298, F788-F795.
Haberland, M., Mokalled, M.H., Montgomery, R.L., and Olson, E.N. (2009). Epigenetic control
of skull morphogenesis by histone deacetylase 8. Genes & Development 23, 1625-1630.
Haggarty, S.J., Koeller, K.M., Wong, J.C., Butcher, R.A., and Schreiber, S.L. (2003a).
Multidimensional chemical genetic analysis of diversity-oriented synthesis-derived deacetylase
inhibitors using cell-based assays. Chemistry & Biology 10, 383-396.
Haggarty, S.J., Koeller, K.M., Wong, J.C., Grozinger, C.M., and Schreiber, S.L. (2003b).
Domain-selective small-molecule inhibitor of histone deacetylase 6 (HDAC6)-mediated tubulin
deacetylation. Proceedings of the National Academy of Sciences of the United States of America
100, 4389-4394.
Hailpern, S.M., Melamed, M.L., Cohen, H.W., and Hostetter, T.H. (2007). Moderate chronic
kidney disease and cognitive function in adults 20 to 59 years of age: Third National Health and
Nutrition Examination Survey (NHANES III). Journal of the American Society of Nephrology
18, 2205-2213.
112
Han, Y., Jeong, H.M., Jin, Y.H., Kim, Y.J., Jeong, H.G., Yeo, C.Y., and Lee, K.Y. (2009).
Acetylation of histone deacetylase 6 by p300 attenuates its deacetylase activity. Biochemical and
Biophysical Research Communications 383, 88-92.
Hashimoto, H., Wang, D.X., Steves, A.N., Jin, P., Blumenthal, R.M., Zhang, X., and Cheng, X.D.
(2016). Distinctive Klf4 mutants determine preference for DNA methylation status. Nucleic Acids
Research 44, 10177-10185.
Hershey, C.L., and Fisher, D.E. (2004). Mitf and Tfe3: members of a b-HLH-ZIP transcription
factor family essential for osteoclast development and function. Bone 34, 689-696.
Hetz, C. (2012). The unfolded protein response: controlling cell fate decisions under ER stress
and beyond. Nature Reviews Molecular Cell Biology 13, 89-102.
Hideshima, T., Bradner, J.E., Wong, J., Chauhan, D., Richardson, P., Schreiber, S.L., and
Anderson, K.C. (2005). Small-molecule inhibition of proteasome and aggresome function induces
synergistic antitumor activity in multiple myeloma. Proceedings of the National Academy of
Sciences of the United States of America 102, 8567-8572.
Himmelstein, D.S., Ward, S.M., Lancia, J.K., Patterson, K.R., and Binder, L.I. (2012). Tau as a
therapeutic target in neurodegenerative disease. Pharmacology & Therapeutics 136, 8-22.
Hodgkins, K.S., and Schnaper, H.W. (2012). Tubulointerstitial injury and the progression of
chronic kidney disease. Pediatric Nephrology 27, 901-909.
Hubbert, C., Guardiola, A., Shao, R., Kawaguchi, Y., Ito, A., Nixon, A., Yoshida, M., Wang,
X.F., and Yao, T.P. (2002). HDAC6 is a microtubule-associated deacetylase. Nature 417, 455-
458.
Hymes, K.B. (2010). The role of histone deacetylase inhibitors in the treatment of patients with
cutaneous T-cell lymphoma. Clin Lymphoma Myeloma Leuk 10, 98-109.
113
Inagi, R. (2010). Endoplasmic reticulum stress as a progression factor for kidney injury. Current
Opinion in Pharmacology 10, 156-165.
Inagi, R., Ishimoto, Y., and Nangaku, M. (2014). Proteostasis in endoplasmic reticulum-new
mechanisms in kidney disease. Nature Reviews Nephrology 10, 369-378.
Inks, E.S., Josey, B.J., Jesinkey, S.R., and Chou, C.J. (2012). A novel class of small molecule
inhibitors of HDAC6. ACS Chem Biol 7, 331-339.
Itoh, Y., Suzuki, T., Kouketsu, A., Suzuki, N., Maeda, S., Yoshida, M., Nakagawa, H., and
Miyata, N. (2007). Design, synthesis, structure--selectivity relationship, and effect on human
cancer cells of a novel series of histone deacetylase 6-selective inhibitors. J Med Chem 50, 5425-
5438.
Ivankovic, D., Chau, K.Y., Schapira, A.H.V., and Gegg, M.E. (2016). Mitochondrial and
lysosomal biogenesis are activated following PINK1/parkin-mediated mitophagy. Journal of
Neurochemistry 136, 388-402.
Jafar, T.H., Stark, P.C., Schmid, C.H., Landa, M., Maschio, G., de Jong, P.E., de Zeeuw, D.,
Shahinfar, S., Toto, R., Levey, A.S., et al. (2003). Progression of chronic kidney disease: The role
of blood pressure control, proteinuria, and angiotensin-converting enzyme inhibition - A patient-
level meta-analysis. Annals of Internal Medicine 139, 244-252.
James, M.T., Hemmelgarn, B.R., Wiebe, N., Pannu, N., Manns, B.J., Klarenbach, S.W., Tonelli,
M., and Alberta Kidney Dis, N. (2010). Glomerular filtration rate, proteinuria, and the incidence
and consequences of acute kidney injury: a cohort study. Lancet 376, 2096-2103.
James, M.T., Quan, H., Tonelli, M., Manns, B.J., Faris, P., Laupland, K.B., Hemmelgarn, B.R.,
and Alberta Kidney Dis, N. (2009). CKD and Risk of Hospitalization and Death With Pneumonia.
American Journal of Kidney Diseases 54, 24-32.
114
Johnston, J.A., Illing, M.E., and Kopito, R.R. (2002). Cytoplasmic dynein/dynactin mediates the
assembly of aggresomes. Cell Motil Cytoskeleton 53, 26-38.
Jones, P., Altamura, S., Chakravarty, P.K., Cecchetti, O., De Francesco, R., Gallinari, P., Ingenito,
R., Meinke, P.T., Petrocchi, A., Rowley, M., et al. (2006). A series of novel, potent, and selective
histone deacetylase inhibitors. Bioorg Med Chem Lett 16, 5948-5952.
Karagoz, G.E., Duarte, A.M., Akoury, E., Ippel, H., Biernat, J., Moran Luengo, T., Radli, M.,
Didenko, T., Nordhues, B.A., Veprintsev, D.B., et al. (2014). Hsp90-Tau complex reveals
molecular basis for specificity in chaperone action. Cell 156, 963-974.
Kaufman, J.M., DiMeola, H.J., Siegel, N.J., Lytton, B., Kashgarian, M., and Hayslett, J.P. (1974).
Compensatory adaptation of structure and function following progressive renal ablation. Kidney
Int 6, 10-17.
Kawaguchi, Y., Kovacs, J.J., McLaurin, A., Vance, J.M., Ito, A., and Yao, T.P. (2003a). The
deacetylase HDAC6 regulates aggresome formation and cell viability in response to misfolded
protein stress. Cell 115, 727-738.
Kawaguchi, Y., Kovacs, J.J., McLaurin, A., Vance, J.M., Ito, A., and Yao, T.P. (2003b). The
deacetylase HDAC6 regulates aggresome formation and cell viability in response to misfolded
protein stress. Cell 115, 727-738.
Kawakami, T., Inagi, R., Wada, T., Tanaka, T., Fujita, T., and Nangaku, M. (2010). Indoxyl
sulfate inhibits proliferation of human proximal tubular cells via endoplasmic reticulum stress.
American Journal of Physiology-Renal Physiology 299, F568-F576.
Keith, D.S., Nichols, G.A., Gullion, C.M., Brown, J.B., and Smith, D.H. (2004). Longitudinal
follow-up and outcomes among a population with chronic kidney disease in a large managed care
organization. Archives of Internal Medicine 164, 659-663.
115
Khan, M.A.H., Liu, J., Kumar, G., Skapek, S.X., Falck, J.R., and Imig, J.D. (2013). Novel orally
active epoxyeicosatrienoic acid (EET) analogs attenuate cisplatin nephrotoxicity. Faseb Journal
27, 2946-2956.
Klarenbach, S.W., Tonelli, M., Chui, B., and Manns, B.J. (2014). Economic evaluation of dialysis
therapies. Nature Reviews Nephrology 10, 644-652.
Komatsu, M., and Ichimura, Y. (2010). Physiological significance of selective degradation of p62
by autophagy. Febs Letters 584, 1374-1378.
Komatsu, M., Waguri, S., Koike, M., Sou, Y.-s., Ueno, T., Hara, T., Mizushima, N., Iwata, J.-i.,
Ezaki, J., Murata, S., et al. (2007). Homeostatic levels of p62 control cytoplasmic inclusion body
formation in autophagy-deficient mice. Cell 131, 1149-1163.
Kopito, R.R. (2000). Aggresomes, inclusion bodies and protein aggregation. Trends in Cell
Biology 10, 524-530.
Kovacs, J.J., Murphy, P.J.M., Gaillard, S., Zhao, X.A., Wu, J.T., Nicchitta, C.V., Yoshida, M.,
Toft, D.O., Pratt, W.B., and Yao, T.P. (2005). HDAC6 regulates Hsp90 acetylation and
chaperone-dependent activation of glucocorticoid receptor. Molecular Cell 18, 601-607.
Kozikowski, A.P., Chen, Y., Gaysin, A., Chen, B., D'Annibale, M.A., Suto, C.M., and Langley,
B.C. (2007). Functional differences in epigenetic modulators-superiority of mercaptoacetamide-
based histone deacetylase inhibitors relative to hydroxamates in cortical neuron neuroprotection
studies. J Med Chem 50, 3054-3061.
Kozikowski, A.P., Tapadar, S., Luchini, D.N., Kim, K.H., and Billadeau, D.D. (2008). Use of the
nitrile oxide cycloaddition (NOC) reaction for molecular probe generation: a new class of enzyme
selective histone deacetylase inhibitors (HDACIs) showing picomolar activity at HDAC6. J Med
Chem 51, 4370-4373.
116
Lagger, G., O'Carroll, D., Rembold, M., Khier, H., Tischler, J., Weitzer, G., Schuettengruber, B.,
Hauser, C., Brunmeir, R., Jenuwein, T., et al. (2002). Essential function of histone deacetylase 1
in proliferation control and CDK inhibitor repression. Embo Journal 21, 2672-2681.
Lantinga-van Leeuwen, I.S., Leonhard, W.N., van der Wal, A., Breuning, M.H., de Heer, E., and
Peters, D.J.M. (2007). Kidney-specific inactivation of the Pkd1 gene induces rapid cyst formation
in developing kidneys and a slow onset of disease in adult mice. Human Molecular Genetics 16,
3188-3196.
Lee, J.Y., Koga, H., Kawaguchi, Y., Tang, W.X., Wong, E., Gao, Y.S., Pandey, U.B., Kaushik,
S., Tresse, E., Lu, J.R., et al. (2010). HDAC6 controls autophagosome maturation essential for
ubiquitin-selective quality-control autophagy. Embo Journal 29, 969-980.
Lee, J.Y., and Yao, T.P. (2010). Quality control autophagy: a joint effort of ubiquitin, protein
deacetylase and actin cytoskeleton. Autophagy 6, 555-557.
Lee, J.Y.C., Kuo, C.W., Tsai, S.L., Cheng, S.M., Chen, S.H., Chan, H.H., Lin, C.H., Lin, K.Y.,
Li, C.F., Kanwar, J.R., et al. (2016). Inhibition of HDAC3-and HDAC6-Promoted Survivin
Expression Plays an Important Role in SAHA-Induced Autophagy and Viability Reduction in
Breast Cancer Cells. Frontiers in Pharmacology 7.
Li, M.M., Tan, J., Miao, Y.Y., Lei, P., and Zhang, Q. (2015). The dual role of autophagy under
hypoxia-involvement of interaction between autophagy and apoptosis. Apoptosis 20, 769-777.
Li, Y., Shin, D., and Kwon, S.H. (2013). Histone deacetylase 6 plays a role as a distinct regulator
of diverse cellular processes. Febs Journal 280, 775-793.
Lindenmeyer, M.T., Rastaldi, M.P., Ikehata, M., Neusser, M.A., Kretzler, M., Cohen, C.D., and
Schlondorff, D. (2008). Proteinuria and Hyperglycemia Induce Endoplasmic Reticulum Stress.
Journal of the American Society of Nephrology 19, 2225-2236.
117
Liu, W., Fan, L.X., Zhou, X., Sweeney, W.E., Jr., Avner, E.D., and Li, X. (2012a). HDAC6
regulates epidermal growth factor receptor (EGFR) endocytic trafficking and degradation in renal
epithelial cells. PloS one 7, e49418.
Liu, Y.J., Peng, L.R., Seto, E., Huang, S.M., and Qiu, Y. (2012b). Modulation of Histone
Deacetylase 6 (HDAC6) Nuclear Import and Tubulin Deacetylase Activity through Acetylation.
Journal of Biological Chemistry 287, 29168-29174.
Martina, J.A., Diab, H.I., Lishu, L., Jeong-A, L., Patange, S., Raben, N., and Puertollano, R.
(2014). The Nutrient-Responsive Transcription Factor TFE3 Promotes Autophagy, Lysosomal
Biogenesis, and Clearance of Cellular Debris. Science Signaling 7.
Martini-Stoica, H., Xu, Y., Ballabio, A., and Zheng, H. (2016). The Autophagy-Lysosomal
Pathway in Neurodegeneration: A TFEB Perspective. Trends in Neurosciences 39, 221-234.
Matsuyama, A., Shimazu, T., Sumida, Y., Saito, A., Yoshimatsu, Y., Seigneurin-Berny, D.,
Osada, H., Komatsu, Y., Nishino, N., Khochbin, S., et al. (2002). In vivo destabilization of
dynamic microtubules by HDAC6-mediated deacetylation. Embo Journal 21, 6820-6831.
McLendon, P.M., Ferguson, B.S., Osinska, H., Bhuiyan, M.S., James, J., McKinsey, T.A., and
Robbins, J. (2014). Tubulin hyperacetylation is adaptive in cardiac proteotoxicity by promoting
autophagy. Proceedings of the National Academy of Sciences of the United States of America
111, E5178-5186.
Meadows, N.A., Sharma, S.M., Faulkner, G.J., Ostrowski, M.C., Hume, D.A., and Cassady, A.I.
(2007). The expression of Clcn7 and Ostm1 in osteoclasts is coregulated by microphthalmia
transcription factor. Journal of Biological Chemistry 282, 1891-1904.
Medina, D.L., Di Paola, S., Peluso, I., Armani, A., De Stefani, D., Venditti, R., Montefusco, S.,
Scotto-Rosato, A., Prezioso, C., Forrester, A., et al. (2015). Lysosomal calcium signalling
regulates autophagy through calcineurin and TFEB. Nature Cell Biology 17, 288-+.
118
Mergen, M., Engel, C., Muller, B., Follo, M., Schafer, T., Jung, M., and Walz, G. (2013). The
nephronophthisis gene product NPHP2/Inversin interacts with Aurora A and interferes with
HDAC6-mediated cilia disassembly. Nephrology, dialysis, transplantation : official publication
of the European Dialysis and Transplant Association - European Renal Association 28, 2744-
2753.
Mishima, Y., Santo, L., Eda, H., Cirstea, D., Nemani, N., Yee, A.J., O'Donnell, E., Selig, M.K.,
Quayle, S.N., Arastu-Kapur, S., et al. (2015). Ricolinostat (ACY-1215) induced inhibition of
aggresome formation accelerates carfilzomib-induced multiple myeloma cell death. Br J
Haematol 169, 423-434.
Mizushima, N. (2009). Regulation of autophagosome formation in mammalian cells. Autophagy
5, 898-899.
Mizushima, N., Yoshimori, T., and Levine, B. (2010). Methods in Mammalian Autophagy
Research. Cell 140, 313-326.
Montgomery, R.L., Davis, C.A., Potthoff, M.J., Haberland, M., Fielitz, J., Qi, X.X., Hill, J.A.,
Richardson, J.A., and Olson, E.N. (2007). Histone deacetylases 1 and 2 redundantly regulate
cardiac morphogenesis, growth, and contractility. Genes & Development 21, 1790-1802.
Montgomery, R.L., Potthoff, M.J., Haberland, M., Qi, X., Matsuzaki, S., Humphries, K.M.,
Richardson, J.A., Bassel-Duby, R., and Olson, E.N. (2008). Maintenance of cardiac energy by
histone deacetylase 3 metabolism in mice. Journal of Clinical Investigation 118, 3588-3597.
Mortenson, J.B., Heppler, L.N., Banks, C.J., Weerasekara, V.K., Whited, M.D., Piccolo, S.R.,
Johnson, W.E., Thompson, J.W., and Andersen, J.L. (2015). Histone deacetylase 6 (HDAC6)
promotes the pro-survival activity of 14-3-3zeta via deacetylation of lysines within the 14-3-3zeta
binding pocket. J Biol Chem 290, 12487-12496.
119
Motyckova, G., Weilbaecher, K.N., Horstmann, M., Rieman, D.J., Fisher, D.Z., and Fisher, D.E.
(2001). Linking osteopetrosis end pycnodysostosis: Regulation of cathepsin K expression by the
microphthalmia transcription factor family. Proceedings of the National Academy of Sciences of
the United States of America 98, 5798-5803.
Nezis, I.P., Simonsen, A., Sagona, A.P., Finley, K., Gaumer, S., Contamine, D., Rusten, T.E.,
Stenmark, H., and Brech, A. (2008). Ref(2) P, the Drosophila melanogaster homologue of
mammalian p62, is required for the formation of protein aggregates in adult brain. Journal of Cell
Biology 180, 1065-1071.
Nielsen, S. (1994). Endocytosis in renal proximal tubules. Experimental electron microscopical
studies of protein absorption and membrane traffic in isolated, in vitro perfused proximal tubules.
Dan Med Bull 41, 243-263.
Nielsen, T.K., Hildmann, C., Dickmanns, A., Schwienhorst, A., and Ficner, R. (2005). Crystal
structure of a bacterial class 2 histone deacetylase homologue. Journal of Molecular Biology 354,
107-120.
Oehme, I., Linke, J.P., Bock, B.C., Milde, T., Lodrini, M., Hartenstein, B., Wiegand, I., Eckert,
C., Roth, W., Kool, M., et al. (2013). Histone deacetylase 10 promotes autophagy-mediated cell
survival. Proceedings of the National Academy of Sciences of the United States of America 110,
E2592-E2601.
Ohse, T., Inagi, R., Tanaka, T., Ota, T., Miyata, T., Kojima, I., Ingelfinger, J.R., Ogawa, S., Fujita,
T., and Nangaku, M. (2006). Albumin induces endoplasmic reticulum stress and apoptosis in renal
proximal tubular cells. Kidney International 70, 1447-1455.
Olsen, C.A., and Ghadiri, M.R. (2009). Discovery of potent and selective histone deacetylase
inhibitors via focused combinatorial libraries of cyclic alpha3beta-tetrapeptides. J Med Chem 52,
7836-7846.
120
Olzmann, J.A., Li, L., and Chin, L.S. (2008). Aggresome formation and neurodegenerative
diseases: Therapeutic implications. Current Medicinal Chemistry 15, 47-60.
Oslowski, C.M., and Urano, F. (2011). MEASURING ER STRESS AND THE UNFOLDED
PROTEIN RESPONSE USING MAMMALIAN TISSUE CULTURE SYSTEM. Methods in
Enzymology: Unfolded Protein Response and Cellular Stress, Vol 490, Pt B 490, 71-92.
Palatini, P. (2012). Glomerular hyperfiltration: a marker of early renal damage in pre-diabetes and
pre-hypertension. Nephrology Dialysis Transplantation 27, 1708-1714.
Palijan, A., Fernandes, I., Bastien, Y., Tang, L.Q., Verway, M., Kourelis, M., Tavera-Mendoza,
L.E., Li, Z., Bourdeau, V., Mader, S., et al. (2009). Function of Histone Deacetylase 6 as a
Cofactor of Nuclear Receptor Coregulator LCoR. Journal of Biological Chemistry 284, 30264-
30274.
Pallet, N., and Legendre, C. (2013). Adverse events associated with mTOR inhibitors. Expert
Opinion on Drug Safety 12, 177-186.
Palmieri, M., Impey, S., Kang, H., di Ronza, A., Pelz, C., Sardiello, M., and Ballabio, A. (2011).
Characterization of the CLEAR network reveals an integrated control of cellular clearance
pathways. Human Molecular Genetics 20, 3852-3866.
Parmigiani, R.B., Xu, W.S., Venta-Perez, G., Erdjument-Bromage, H., Yaneva, M., Tempst, P.,
and Marks, P.A. (2008). HDAC6 is a specific deacetylase of peroxiredoxins and is involved in
redox regulation. Proceedings of the National Academy of Sciences of the United States of
America 105, 9633-9638.
Periyasamy-Thandavan, S., Jiang, M., Wei, Q., Smith, R., Yin, X.-M., and Dong, Z. (2008).
Autophagy is cytoprotective during cisplatin injury of renal proximal tubular cells. Kidney
International 74, 631-640.
Pinto, E. (2007). Blood pressure and ageing. Postgraduate Medical Journal 83, 109-114.
121
Polevoda, B., and Sherman, F. (2000). N alpha-terminal acetylation of eukaryotic proteins.
Journal of Biological Chemistry 275, 36479-36482.
Raben, N., and Puertollano, R. (2016). TFEB and TFE3: Linking Lysosomes to Cellular
Adaptation to Stress. In Annual Review of Cell and Developmental Biology, Vol 32, R.
Schekman, ed. (Palo Alto: Annual Reviews), pp. 255-278.
Ran, J., Yang, Y.F., Li, D.W., Liu, M., and Zhou, J. (2015). Deacetylation of alpha-tubulin and
cortactin is required for HDAC6 to trigger ciliary disassembly. Scientific Reports 5.
Regeniter, A., Freidank, H., Dickenmann, M., Boesken, W.H., and Siede, W.H. (2009).
Evaluation of proteinuria and GFR to diagnose and classify kidney disease: Systematic review
and proof of concept. European Journal of Internal Medicine 20, 556-561.
Remuzzi, G., Benigni, A., and Remuzzi, A. (2006). Mechanisms of progression and regression of
renal lesions of chronic nephropathies and diabetes. Journal of Clinical Investigation 116, 288-
296.
Richards, W.G., Sweeney, W.E., Yoder, B.K., Wilkinson, J.E., Woychik, R.P., and Avner, E.D.
(1998). Epidermal growth factor receptor activity mediates renal cyst formation in polycystic
kidney disease. The Journal of clinical investigation 101, 935-939.
Riolo, M.T., Cooper, Z.A., Holloway, M.P., Cheng, Y., Bianchi, C., Yakirevich, E., Ma, L., Chin,
Y.E., and Altura, R.A. (2012). Histone Deacetylase 6 (HDAC6) Deacetylates Survivin for Its
Nuclear Export in Breast Cancer. Journal of Biological Chemistry 287, 10885-10893.
Roczniak-Ferguson, A., Petit, C.S., Froehlich, F., Qian, S., Ky, J., Angarola, B., Walther, T.C.,
and Ferguson, S.M. (2012). The Transcription Factor TFEB Links mTORC1 Signaling to
Transcriptional Control of Lysosome Homeostasis. Science Signaling 5.
122
Rodriguez-Gonzalez, A., Lin, T., Ikeda, A.K., Simms-Waldrip, T., Fu, C., and Sakamoto, K.M.
(2008). Role of the aggresome pathway in cancer: targeting histone deacetylase 6-dependent
protein degradation. Cancer research 68, 2557-2560.
Roy, A., Kucukural, A., and Zhang, Y. (2010). I-TASSER: a unified platform for automated
protein structure and function prediction. Nat Protoc 5, 725-738.
Santo, L., Hideshima, T., Kung, A.L., Tseng, J.C., Tamang, D., Yang, M., Jarpe, M., van Duzer,
J.H., Mazitschek, R., Ogier, W.C., et al. (2012). Preclinical activity, pharmacodynamic, and
pharmacokinetic properties of a selective HDAC6 inhibitor, ACY-1215, in combination with
bortezomib in multiple myeloma. Blood 119, 2579-2589.
Saran, R., Li, Y., Robinson, B., Abbott, K.C., Agodoa, L.Y.C., Ayanian, J., Bragg-Gresham, J.,
Balkrishnan, R., Chen, J.L.T., Cope, E., et al. (2016). US Renal Data System 2015 Annual Data
Report: Epidemiology of Kidney Disease in the United States. American Journal of Kidney
Diseases 67, SVII-SVIII.
Sardiello, M., Palmieri, M., di Ronza, A., Medina, D.L., Valenza, M., Gennarino, V.A., Di Malta,
C., Donaudy, F., Embrione, V., Polishchuk, R.S., et al. (2009). A Gene Network Regulating
Lysosomal Biogenesis and Function. Science 325, 473-477.
Sarkar, S., Davies, J.E., Huang, Z., Tunnacliffe, A., and Rubinsztein, D.C. (2007). Trehalose, a
novel mTOR-independent autophagy enhancer, accelerates the clearance of mutant huntingtin and
alpha-synuclein. J Biol Chem 282, 5641-5652.
Schafer, S., Saunders, L., Eliseeva, E., Velena, A., Jung, M., Schwienhorst, A., Strasser, A.,
Dickmanns, A., Ficner, R., Schlimme, S., et al. (2008). Phenylalanine-containing hydroxamic
acids as selective inhibitors of class IIb histone deacetylases (HDACs). Bioorg Med Chem 16,
2011-2033.
123
Schafer, S., Saunders, L., Schlimme, S., Valkov, V., Wagner, J.M., Kratz, F., Sippl, W., Verdin,
E., and Jung, M. (2009). Pyridylalanine-containing hydroxamic acids as selective HDAC6
inhibitors. ChemMedChem 4, 283-290.
Schelling, J.R. (2016). Tubular atrophy in the pathogenesis of chronic kidney disease progression.
Pediatric Nephrology 31, 693-706.
Schindelin, J., Arganda-Carreras, I., Frise, E., Kaynig, V., Longair, M., Pietzsch, T., Preibisch,
S., Rueden, C., Saalfeld, S., Schmid, B., et al. (2012). Fiji: an open-source platform for biological-
image analysis. Nature Methods 9, 676-682.
Schmittgen, T.D., and Livak, K.J. (2008). Analyzing real-time PCR data by the comparative C-T
method. Nature Protocols 3, 1101-1108.
Schroeder, A., Mueller, O., Stocker, S., Salowsky, R., Leiber, M., Gassmann, M., Lightfoot, S.,
Menzel, W., Granzow, M., and Ragg, T. (2006). The RIN: an RNA integrity number for assigning
integrity values to RNA measurements. Bmc Molecular Biology 7.
Seigneurin-Berny, D., Verdel, A., Curtet, S., Lemercier, C., Garin, J., Rousseaux, S., and
Khochbin, S. (2001). Identification of components of the murine histone deacetylase 6 complex:
Link between acetylation and ubiquitination signaling pathways. Molecular and Cellular Biology
21, 8035-8044.
Selenica, M.L., Benner, L., Housley, S.B., Manchec, B., Lee, D.C., Nash, K.R., Kalin, J.,
Bergman, J.A., Kozikowski, A., Gordon, M.N., et al. (2014). Histone deacetylase 6 inhibition
improves memory and reduces total tau levels in a mouse model of tau deposition. Alzheimers
Res Ther 6, 12.
Settembre, C., Di Malta, C., Polito, V.A., Garcia-Arencibia, M., Vetrini, F., Erdin, S., Erdin, S.U.,
Huynh, T., Medina, D., Colella, P., et al. (2011). TFEB Links Autophagy to Lysosomal
Biogenesis. Science 332, 1429-1433.
124
Settembre, C., and Medina, D.L. (2015). TFEB and the CLEAR network. In Lysosomes and
Lysosomal Diseases, F. Platt, and N. Platt, eds. (San Diego: Elsevier Academic Press Inc), pp.
45-62.
Settembre, C., Zoncu, R., Medina, D.L., Vetrini, F., Erdin, S., Erdin, S., Tuong, H., Ferron, M.,
Karsenty, G., Vellard, M.C., et al. (2012). A lysosome-to-nucleus signalling mechanism senses
and regulates the lysosome via mTOR and TFEB. Embo Journal 31, 1095-1108.
Shan, B., Yao, T.P., Nguyen, H.T., Zhuo, Y., Levy, D.R., Klingsberg, R.C., Tao, H., Palmer,
M.L., Holder, K.N., and Lasky, J.A. (2008). Requirement of HDAC6 for transforming growth
factor-beta1-induced epithelial-mesenchymal transition. The Journal of biological chemistry 283,
21065-21073.
Shultz, M.D., Cao, X.Y., Chen, C.H., Cho, Y.S., Davis, N.R., Eckman, J., Fan, J.M., Fekete, A.,
Firestone, B., Flynn, J., et al. (2011). Optimization of the in Vitro Cardiac Safety of Hydroxamate-
Based Histone Deacetylase Inhibitors. Journal of Medicinal Chemistry 54, 4752-4772.
Singla, V., and Reiter, J.F. (2006). The primary cilium as the cell's antenna: signaling at a sensory
organelle. Science 313, 629-633.
Smil, D.V., Manku, S., Chantigny, Y.A., Leit, S., Wahhab, A., Yan, T.P., Fournel, M., Maroun,
C., Li, Z., Lemieux, A.M., et al. (2009). Novel HDAC6 isoform selective chiral small molecule
histone deacetylase inhibitors. Bioorg Med Chem Lett 19, 688-692.
Spampanato, C., Feeney, E., Li, L.S., Cardone, M., Lim, J.A., Annunziata, F., Zare, H.,
Polishchuk, R., Puertollano, R., Parenti, G., et al. (2013). Transcription factor EB (TFEB) is a
new therapeutic target for Pompe disease. Embo Molecular Medicine 5, 691-706.
Steingrimsson, E., Tessarollo, L., Reid, S.W., Jenkins, N.A., and Copeland, N.G. (1998). The
bHLH-Zip transcription factor Tfeb is essential for placental vascularization. Development 125,
4607-4616.
125
Stenvinkel, P. (2010). Chronic kidney disease: a public health priority and harbinger of premature
cardiovascular disease. Journal of Internal Medicine 268, 456-467.
Sun, H.Y., Sun, R., Hao, M., Wang, Y.Q., Zhang, X.W., Liu, Y., and Cong, X.L. (2016). Effect
of Duration of Ex Vivo Ischemia Time and Storage Period on RNA Quality in Biobanked Human
Renal Cell Carcinoma Tissue. Annals of Surgical Oncology 23, 297-304.
Tait, S.W.G., Ichim, G., and Green, D.R. (2014). Die another way - non-apoptotic mechanisms
of cell death. Journal of Cell Science 127, 2135-2144.
Tanaka, M., Machida, Y., Niu, S., Ikeda, T., Jana, N.R., Doi, H., Kurosawa, M., Nekooki, M., and
Nukina, N. (2004). Trehalose alleviates polyglutamine-mediated pathology in a mouse model of
Huntington disease. Nat Med 10, 148-154.
Taniguchi, M., and Yoshida, H. (2015). Endoplasmic reticulum stress in kidney function and
disease. Curr Opin Nephrol Hypertens 24, 345-350.
Uhlen, M., Fagerberg, L., Hallstrom, B.M., Lindskog, C., Oksvold, P., Mardinoglu, A.,
Sivertsson, A., Kampf, C., Sjostedt, E., Asplund, A., et al. (2015). Proteomics. Tissue-based map
of the human proteome. Science 347, 1260419.
Unuma, K., Aki, T., Funakoshi, T., Yoshida, K., and Uemura, K. (2013). Cobalt protoporphyrin
accelerates TFEB activation and lysosome reformation during LPS-induced septic insults in the
rat heart. PLoS One 8, e56526.
Valenzuela-Fernandez, A., Cabrero, J.R., Serrador, J.M., and Sanchez-Madrid, F. (2008).
HDAC6: a key regulator of cytoskeleton, cell migration and cell-cell interactions. Trends in Cell
Biology 18, 291-297.
Vega, R.B., Matsuda, K., Oh, J., Barbosa, A.C., Yang, X.L., Meadows, E., McAnally, J., Pomajzl,
C., Shelton, J.M., Richardson, J.A., et al. (2004). Histone deacetylase 4 controls chondrocyte
hypertrophy during skeletogenesis. Cell 119, 555-566.
126
Vellodi, A. (2005). Lysosomal storage disorders. British Journal of Haematology 128, 413-431.
Verdel, A., Curtet, S., Brocard, M.P., Rousseaux, S., Lemercier, C., Yoshida, M., and Khochbin,
S. (2000). Active maintenance of mHDA2/mHDAC6 histone-deacetylase in the cytoplasm.
Current Biology 10, 747-749.
Verdel, A., and Khochbin, S. (1999). Identification of a new family of higher eukaryotic histone
deacetylases - Coordinate expression of differentiation-dependent chromatin modifiers. Journal
of Biological Chemistry 274, 2440-2445.
Vitner, E.B., Platt, F.M., and Futerman, A.H. (2010). Common and Uncommon Pathogenic
Cascades in Lysosomal Storage Diseases. Journal of Biological Chemistry 285, 20423-20427.
Voelter-Mahlknecht, S., and Mahlknecht, U. (2003). Cloning and structural characterization of
the human histone deacetylase 6 gene. International Journal of Molecular Medicine 12, 87-93.
Westendorf, J.J., Zaidi, S.K., Cascino, J.E., Kahler, R., van Wijnen, A.J., Lian, J.B., Yoshida, M.,
Stein, G.S., and Li, X.D. (2002). Runx2 (Cbfa1, AML-3) interacts with histone deacetylase 6 and
represses the p21(CIP1/WAF1) promoter. Molecular and Cellular Biology 22, 7982-7992.
Wilson, P.D. (2004). Polycystic kidney disease. N Engl J Med 350, 151-164.
Xiao, Q.L., Yan, P., Ma, X.C., Liu, H.Y., Perez, R., Zhu, A., Gonzales, E., Tripoli, D.L.,
Czerniewski, L., Ballabio, A., et al. (2015). Neuronal-Targeted TFEB Accelerates Lysosomal
Degradation of APP, Reducing A beta Generation and Amyloid Plaque Pathogenesis. Journal of
Neuroscience 35, 12137-12151.
Yamagishi, S., and Matsui, T. (2010). Advanced glycation end products, oxidative stress and
diabetic nephropathy. Oxidative Medicine and Cellular Longevity 3, 101-108.
Yamahara, K., Kume, S., Koya, D., Tanaka, Y., Morita, Y., Chin-Kanasaki, M., Araki, H., Isshiki,
K., Araki, S., Haneda, M., et al. (2013). Obesity-Mediated Autophagy Insufficiency Exacerbates
127
Proteinuria-induced Tubulointerstitial Lesions. Journal of the American Society of Nephrology
24, 1769-1781.
Yan, J. (2014). Interplay between HDAC6 and its interacting partners: essential roles in the
aggresome-autophagy pathway and neurodegenerative diseases. DNA Cell Biol 33, 567-580.
Zhang, L., Liu, C., Wu, J., Tao, J.J., Sui, X.L., Yao, Z.G., Xu, Y.F., Huang, L., Zhu, H., Sheng,
S.L., et al. (2014). Tubastatin A/ACY-1215 improves cognition in Alzheimer's disease transgenic
mice. J Alzheimers Dis 41, 1193-1205.
Zhang, L., Sheng, S., and Qin, C. (2013). The role of HDAC6 in Alzheimer's disease. J
Alzheimers Dis 33, 283-295.
Zhang, W.Z., and Kone, B.C. (2002). NF-kappa B inhibits transcription of the H+-K+-ATPase
alpha(2)-subunit gene: role of histone deacetylases. American Journal of Physiology-Renal
Physiology 283, F904-F911.
Zhang, X., Yuan, Z., Zhang, Y., Yong, S., Salas-Burgos, A., Koomen, J., Olashaw, N., Parsons,
J.T., Yang, X.-J., Dent, S.R., et al. (2007). HDAC6 modulates cell motility by altering the
acetylation level of cortactin. Molecular Cell 27, 197-213.
Zhang, Y., Kwon, S., Yamaguchi, T., Cubizolles, F., Rousseaux, S., Kneissel, M., Cao, C., Li, N.,
Cheng, H.-L., Chua, K., et al. (2008). Mice lacking histone deacetylase 6 have hyperacetylated
tubulin but are viable and develop normally. Molecular and Cellular Biology 28, 1688-1701.
Zhang, Y., Li, N., Caron, C., Matthias, G., Hess, D., Khochbin, S., and Matthias, P. (2003).
HDAC-6 interacts with and deacetylates tubulin and microtubules in vivo. Embo Journal 22,
1168-1179.
Zoncu, R., Bar-Peled, L., Efeyan, A., Wang, S., Sancak, Y., and Sabatini, D.M. (2011). mTORC1
Senses Lysosomal Amino Acids Through an Inside-Out Mechanism That Requires the Vacuolar
H+-ATPase. Science 334, 678-683.
128
Appendix
10X Transfer Buffer
144 g glycine
30.3 g Tris
1 L distilled water
Dilute to 1X by adding 100 mL of 10X Transfer Buffer to 900 mL of water. Then add 200 mL
of methanol to make 20% v/v 1X Transfer Buffer.
10X Running Buffer
TG-SDS Buffer (Tris-Glycine-sodium dodecyl sulfate) 10X solution (BioBasics, Markham, ON,
Canada). Add 100 mL of the 10X Running Buffer stock solution to 900 mL of distilled water to
make 1X Running Buffer.
10X TBS Buffer
24.2 g Tris base
80 g NaCl
Adjust pH to 7.6 in 1 L of distilled water. Add 100 mL of 10X TBS stock solution to 900 mL of
distilled water to make a 1X working solution. At 1000 µL of Tween 20 (BioShop, Burlington,
ON, Canada) to the solution to make a 1X TBT-T working solution.
5% Blocking Solution (for Immunoblot)
1 g of skim milk powder (BioShop)
20 mL of TBS-T
129
Add reagents to a 50 mL conical tube. Vortex on high speed. Use 10 mL per nitrocellulose
membrane.
2% Blocking Solution (for Immunofluorescence)
2 mg of bovine albumin serum (BSA) (Sigma-Aldrich)
10 mL of 1X phosphate buffer saline (PBS)
Add reagents to a 15 mL conical tube. Vortex on high speed. Use 10 mL per nitrocellulose
membrane.
Citric Acid Buffer
41 mL (1M) sodium citrate
9 mL (1M) citric acid
500 µL (10N) NaOH
4950 mL of distilled water
Combine reagents and store at 4οC.
Scott’s Tap Water
Sodium bicarbonate 8.75 g
Magnesium sulphate 50.0 g
Distilled water 2500 mL
Homogenization Buffer
Sucrose 250mM 125 mL
TrisHCl 10mM 5 mL
EDTA 1mM 1 mL
130
Sodium orthovanadate 1mM 5 mL
Sodium fluoride 1mM 0.5 mL
Water 363 mL
Combine reagents and store at 4οC. Supplement with phosphatase inhibitor at a ratio of 1:1000
just prior to use.
5% FITC-inulin
100 mg FITC-inulin
2 mL 0.9% sodium chloride (NaCl) solution
1. Combine FITC-inulin and NaCl, slowly bring the solution to a boil.
2. Remove unbound FITC by filling solution into a cut-off dialysis membrane (1000 Da)
(Spectrum Laboratories Inc., Rancho Dominguez, CA).
3. Submerge the filled dialysis membrane in 1 L of NaCl, under constant rotation for 24
hours at room temperature.
4. Sterilize the solution prior to injection by filtering solution through a 0.22 µm filter.
Related Documents
