TP53INP1 Downregulation Activates a p73- Dependent DUSP10 ... · Cancer Res; 77(17); 4602–12. 2017 AACR. Introduction Liver cancer remains one of the most prevalent and deadliest

Tumor and Stem Cell Biology

TP53INP1 Downregulation Activates a p73-Dependent DUSP10/ERK Signaling Pathway toPromote Metastasis of Hepatocellular CarcinomaKai-Yu Ng1, Lok-Hei Chan1, Stella Chai1, Man Tong1, Xin-Yuan Guan2,3, Nikki P Lee4,Yunfei Yuan5, Dan Xie5, Terence K Lee6, Nelson J Dusetti7, Alice Carrier7, andStephanie Ma1,3

Abstract

Identifying critical factors involved in the metastatic progres-sion of hepatocellular carcinoma (HCC) may offer importanttherapeutic opportunities. Here, we report that the proapoptoticstress response factor TP53INP1 is often selectively downregu-lated in advanced stage IV and metastatic human HCC tumors.Mechanistic investigations revealed that TP53INP1 downregula-tion in early-stage HCC cells promoted metastasis via DUSP10

phosphatase-mediated activation of the ERK pathway. TheDUSP10 promoter included putative binding sites for p73directly implicated in modulation by TP53INP1. Overall, ourfindings show how TP53INP1 plays a critical role in limitingthe progression of early-stage HCC, with implications fordeveloping new therapeutic strategies to attack metastatic HCC.Cancer Res; 77(17); 4602–12. �2017 AACR.

IntroductionLiver cancer remains one of the most prevalent and deadliest

cancer types worldwide. Hepatocellular carcinoma (HCC)accounts for over 75% of all liver cancer cases. Metastasis andpostsurgical recurrence are common and represent major obsta-cles to the improvement of patient survival. HCC patients areoften diagnosed at an advanced stage when curative therapy is nolonger available and even after surgery, the prognosis of HCCremains unsatisfactory, with a 5-year postrecurrence rate at >70%.Metastasis is a complex multistep process involving alterations inthe dissemination, invasion, survival, and growth of new cancercell colonies, which are regulated by a complex network of intra-and intercellular signal transduction cascades (1). However,metastasis remains the most poorly understood component ofcancer pathogenesis (2). Elucidation of the mechanisms under-lying metastasis is fundamental for the development of newtherapeutic treatments for advanced metastatic HCC.

Extracellular signal-regulated kinases (ERK) have been shownto play critical roles in malignant transformation and cancermetastasis (3). Oncogenic activation of ERKs can be induced byvarious mechanisms including transcriptional overexpression,mutations in upstream components of the MAP kinase pathway,such as RAS and BRAF, and downregulation of negative regulatordual-specificity MAP kinase phosphatases (DUSP; ref. 4). ERKplays a major role in invasion by inducing proteases that degradethe basement membrane, enhances cell migration, and increasescell survival. Activated ERK pathway has been shown to correlatewith the expression of epithelial–mesenchymal transition (EMT)markers, a hallmark of metastasis. These findings collectivelysuggest that ERK plays a major role in tumor progression andmetastasis. However, our knowledge of endogenous regulators ofDUSP/ERK remains limited and how they work to promote HCCmetastasis is also not known.

TP53INP1 is a stress-induced tumor suppressor gene withantiproliferative and proapoptotic activities (5, 6). It is an alter-natively spliced gene encoding two protein isoforms (a and b),and when overexpressed, both isoforms exert a tumor suppressorfunction, mainly by inducing the transcription of target genesinvolved in cell-cycle arrest and p53-mediated apoptosis as part ofthe cell responses to genotoxic stress. Significant reduction or lossof TP53INP1 expression has been shown in a number of cancertypes, including those of the stomach (7), breast (8), pancreas (9),esophagus (10), lung (11), melanocyte (12), colon (13), andblood (14). In relation to metastasis, TP53INP1 has only beenimplicated in a handful of studies including one reportwhere theyfound transcriptional levels of TP53INP1 to be downregulated inmetastatic lung of brain cancers (15). A more recent study led byour collaborator Dusetti and colleagues found TP53INP1 toreduce pancreatic cancer cell migration by regulating SPARCexpression (16). TP53INP1 is a target gene of the transcriptionfactor p53. Conversely, TP53INP1 has also been shown to playa role in cellular homeostasis through p53-dependent and

1School of Biomedical Sciences, The University of Hong Kong, Hong Kong.2Department of Clinical Oncology, The University of Hong Kong, Hong Kong.3State Key Laboratory for Liver Research, Li Ka Shing Faculty of Medicine, TheUniversity of Hong Kong, Hong Kong. 4Department of Surgery, The University ofHong Kong, Hong Kong. 5State Key Laboratory of Oncology in Southern China,Sun Yat-Sen University Cancer Center, Guangzhou, China. 6Department ofApplied Biology and Chemical Technology, The Hong Kong Polytechnic Uni-versity, Hong Kong. 7Aix Marseille University, CNRS, INSERM, Institut Paoli-Calmettes, CRCM, Marseille, France.

Note: Supplementary data for this article are available at Cancer ResearchOnline (http://cancerres.aacrjournals.org/).

CorrespondingAuthor:StephanieMa, TheUniversity ofHongKong, Room47, 1/F,Laboratory Block, Faculty of Medicine Building, 21 Sassoon Road, Pok Fu Lam,Hong Kong. Phone: 852-3917-9238; Fax: 852-2817-0857; E-mail: [email protected]

doi: 10.1158/0008-5472.CAN-16-3456

�2017 American Association for Cancer Research.

CancerResearch

Cancer Res; 77(17) September 1, 20174602

on August 17, 2020. © 2017 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Published OnlineFirst July 3, 2017; DOI: 10.1158/0008-5472.CAN-16-3456

http://crossmark.crossref.org/dialog/?doi=10.1158/0008-5472.CAN-16-3456&domain=pdf&date_stamp=2017-8-12

http://cancerres.aacrjournals.org/

p53-independent manners (5, 6). In addition to p53, TP53INP1,which is also a p73 target gene, can enhance transcriptionalactivity of p73 to induce cell-cycle arrest and cell death (17).Thus, TP53INP1 can exert its tumor suppressor function byinducing the transcription of both p53 and p73 target genes.

In our previous studies, we found that the initiation, growthand self-renewal of CD133þ liver tumors to be fine-tuned by abalance of miR-130b overexpression and TP53INP1 downre-gulation (18). This result suggests that TP53INP1 is a criticaleffector driving hepatocarcinogenesis. Nevertheless, to date, nostudies have determined the function of TP53INP1 in HCCmetastasis or the molecular mechanism by which TP53INP1regulates invasion and metastasis in HCC. Here, we demon-strate that TP53INP1 is frequently downregulated in advanced-stage and metastatic human HCC tumors and that downregu-lation of TP53INP1 in HCC functionally promotes metastasisthrough ERK activation via a p73-dependent DUSP10 regula-tion. Findings from our study not only provide new insightsinto how HCC metastasis is regulated but also provide a newlayer of mechanism by which DUSP10/ERK signaling is regu-lated by p73/TP53INP1 and also identify DUSP10 as a newtranscriptional effector of p73.

Materials and MethodsGene expression profiling and patient samples

Gene expression profiling studies involving multiple clinicalsamples were performed analyzing the expression of specifictranscripts in two datasets available through Gene ExpressionOmnibus (GSE25097 and GSE40367; refs. 19, 20). In addition,humanprimary andmatchedmetastatic HCC tissue sampleswereobtained from 37 patients undergoing hepatectomy at the SunYat-Sen University Cancer Centre in Guangzhou, China. Tissuesamples were collected from patients who had not received anyprevious local or systemic treatment prior to operation. Use ofhuman sampleswas approved by the committee for ethical reviewof research involving human subjects at the Sun Yat-Sen Univer-sity Cancer Centre.

Cell linesHuman HCC cell lines Hep3B, SNU182, SK-Hep-1, and

human hepatoblastoma cell line HepG2 were purchased fromAmerican Type Culture Collection. Human liver cell line LO2and HCC cell lines PLC8024, QSG-7701, and QGY-7703 wereobtained from the Institute of Virology, Chinese Academy ofMedical Sciences, Beijing, China. Human HCC cell line HLEwas obtained from Japanese Collection of Research Biore-sources Cell Bank. Immortalized normal liver cell line, MIHA,was provided by Dr. J. R. Chowdhury, Albert Einstein Collegeof Medicine, New York, New York (21). MHCC97L cells wereobtained from Liver Cancer Institute, Fudan University, China(22). 293FT cells were purchased from Invitrogen. All cell linesused in this study were obtained between 2013 and 2016,regularly authenticated by morphologic observation andAuthentiFiler STR (Invitrogen) and tested for absence of myco-plasma contamination (MycoAlert, Lonza). Cells were usedwithin 20 passages after thawing.

ReagentsU0126 was purchased from Cell Signaling Technologies. Mito-

mycin C was purchased from Calbiochem.

Phospho-kinase array profilingProteome Profiler Human Phospho-Kinase Array Kit was pur-

chased from R&D Systems (ARY003B).

Quantitative real-time PCRTotal RNAwas extracted using RNAisoPlus (Takara). For quan-

titative (q)RT-PCR of mRNA targets, cDNA was synthesized byPrimeScript RTMaster Mix (Takara) and amplified with EvaGreenqPCR MasterMix-R (Applied Biological Materials) and primerslisted in Supplementary Table S1. b-Actin was amplified as aninternal control. Reactions were performed on an ABI Prism 7900System (Applied Biosystems) with data analyzed using the ABISDS v2.3 software (Applied Biosystems). Relative expressiondifferences were calculated using the 2�DDCt method.

Western blot analysisProtein lysates were quantified and resolved on a SDS-PAGE

gel, transferred onto PVDFmembrane (Millipore), and immuno-blotted with a primary antibody, followed by incubation with asecondary antibody. Antibody signal was detected using anenhanced chemiluminescence system (GE Healthcare). The fol-lowing antibodies were used: TP53INP1 (1:250, Genway Biotech,GWB-61D856), p-ERK1/2 (1:1,000, Cell Signaling Technology,9101), total ERK (1:1,000, Cell Signaling Technology, 9102),DUSP10 (1:500, Cell Signaling Technology, 3483), p73(1:1,000, Novus Biologicals, NB100-56674), BAX (1:1,000, CellSignaling Technology, 2772), MDM2 (1:500, Santa Cruz Biotech-nology, sc-965), and b-actin (1:5,000, Sigma-Aldrich, A5316).

Expression plasmids and lentiviral transductionExpression plasmids for shRNAs were made in a pLKO.1-puro

vector (Sigma-Aldrich). The targeted sequences were: humanTP53INP1 (464, 50-CCGGCATAGATACTTGCACTGGTTTCTC-GAGAAACCAGTGCAAGTATCTATGTTTTTTG-30) and (3834, 50-CCGGGCGCCATGTTTCTCAAAGTTTCTCGAGAAACTTTGAGAA-ACATGGCGCTTTTTTG-30); human p73 (753, 50- CCGGATCC-GCGTGGAAGGCAATAATCTCGAGATTATTGCCTTCCACGCGG-ATTTTTTG-30) and (1643, 50- CCGGCCAAGGGTTACAGAGCAT-TTACTCGAGTAAATGCTCTGTAACCCTTGGTTTTTG-30); humanERK1 (50- CCGGCTATACCAAGTCCATCGACATCTCGAGATGT-CGATGGACTTGGTATAGTTTTTG-30) and ERK2 (50- CCGGGA-CATTATTCGAGCACCAACCCTCGAGGGTTGGTGCTCGAATAA-TGTCTTTTTG-30) and scrambled shRNA nontarget control (NTC;50-CCGGCAACAAGATGAAGAGCACAACTCGAGTTGGTGCTCT-TCATCTTGTTGTTTTT-30). Sequences were transfected into 293FTcells, packaged using MISSION lentiviral packaging mix (Sigma-Aldrich). The full-length complementaryDNAof humanDUSP10was amplified in cDNA of human adult normal liver tissue RNA(BioChain) as a template using the following primers (forward 50-GGGGACAAGTTTGTACAAAAAAGCAGGCTGCCACCATGCCT-CCGTCTCCTTTAGAC-30; reverse 50-GGGGACCACTTTGTAC-AAGAAAGCTGGGTCACACAACCGTCTCCACG-30); and thencloned into the Gateway entry vector pDONR201. DUSP10was then shuttled into the Gateway destination vector pEZ-Lv199 (GeneCopoeia). Sequences were transfected into 293FNcells, packaged using Lenti-Pac HIV Expression Packaging Mix(GeneCopoeia). Stable clones were selected with puromycin.The full-length complementary DNA of human TP53INP1 wasamplified in cDNA of human adult normal liver tissue RNA(BioChain) as a template using the following primers (forward

TP53INP1 in HCC Metastasis

www.aacrjournals.org Cancer Res; 77(17) September 1, 2017 4603




50- GGGGACAAGTTTGTACAAAAAAGCAGGCTGCCACCATGT-TCCAGAGGCTGAATAAAATGT -30; reverse 50-GGGGACCACT-TTGTACAAGAAAGCTGGGTTAGTAATTGTACTGACGCGGG -30);and then cloned into the Gateway entry vector pDONR201.TP53INP1 was then shuttled into the Gateway destination vectorpLenti CMV Blast DEST (706-1; Addgene plasmid #17451).Sequences were transfected into 293FN cells, packaged usingLentiPac HIV expression packaging mix (GeneCopoeia). Stableclones were selected with blasticidin.

Cell motility and invasion assaysMigration and invasion assays were conducted in 24well Milli-

cell hanging inserts (Millipore) and 24well BioCoat MatrigelInvasion Chambers (BD Biosciences), respectively. Cells resus-pended in serum-free DMEMwere added to the top chamber andthe medium supplemented with 10% FBS was added to thebottom chamber as a chemoattractant. After 48 hours of incuba-tion at 37�C, cells that migrated or invaded through the mem-brane (migration) or Matrigel (invasion) were fixed and stainedwith crystal violet (SigmaAldrich). The number of cells wascounted in 3 random fields under 20� objective lens and imagedusing SPOT imaging software (Nikon).

ImmunohistochemistryImmunohistochemical staining of paraffin sections was carried

out using a two-step protocol. After antigen retrieval, sectionswere incubatedwith the following antibodies against anti-humanTP53INP1 (clone A25-E12; 6 mg/mL; ref. 9), anti-humanp73 (1:500, Novus Biologicals, NB100-56674), anti-humanDUSP10 (1:50,Cell SignalingTechnology, 3483) andanti-humanp-ERK1/2 (1:500, abcam; ab50011). Anti-mouse, -rabbit and -ratHRP–labeledpolymer (DAKO)was used as secondary antibodies.Color detection was performed by liquid DABþ substrate chro-mogen system (DAKO). Slides were counterstained with Mayer'shematoxylin. According to the intensity and total area of thestaining, the expression of TP53INP1 was scored as either low(<30%), medium (30 to 60%), or high (>60%) expression.

Luciferase reporter assayBoth fragments of theDUSP10promoter regions S1 (�4,400 to

�2,201 bp, carrying predicted site sequences ATTAAGTTTCAA-CATGTA and ATCATGTTACAACATCCA) and S2 (�2,200 to �1bp, carrying predicted site sequences GGTATGTGCCTGCATGTAand GGCAAGGGGCGGCTTGCC) were amplified and clonedinto the XhoI and HindIII sites of a pGL3 basic vector (Promega)for luciferase reporter assay. All PCR products cloned into theplasmidwere verified byDNA sequencing to ensure that theywerefree of mutations and in the correct cloning direction. Primersequences used listed in Supplementary Table S2.

Chromatin immunoprecipitation assayChromatin immunoprecipitation (ChIP) assay was performed

using the MagnaChIP A Kit (Millipore). Briefly, cells were soni-cated and lysed after cross-link treatment by 1% formaldehyde for10 minutes. The crosslinked protein/DNA complex was immu-noprecipitated by anti-p73 antibody or normal IgG bound toprotein A magnetic beads. After overnight incubation at 4�C, thecomplex was eluted and DNA was purified. The immunopreci-pitated DNA was quantified by qPCR using primer sequencesdesigned to detect specific regulatory regions listed in Supple-mentary Table S3.

Animal studiesThe study protocol was approved by and performed in accor-

dance with the Committee of the Use of Live Animals in Teachingand Research at The University of Hong Kong. Metastasis wasassessed by orthotopically injecting into the liver to observe forextrahepatic metastasis to the lung. Luciferase-labeled cells wereinjected into the left lobes of the livers of 6-week-old BALB/c nudemice (n ¼ 6–10/group). Six to eight weeks after implantation,mice were administered with 100 mg/kg D-luciferin (Gold Bio-technology) via peritoneal injection 5 minutes before biolumi-nescent imaging (IVIS 100 Imaging System, Xenogen). Livers andlungs were harvested for ex vivo imaging and histologic analysis.Metastatic nodules in the lungs were counted.

Statistical analysisData were analyzed by SPSS 21.0 or GraphPad Prism 6.0 and

shown asmean� standard deviations, unless otherwise specified.Differences between groups were analyzed by an unpaired Stu-dent t test for continuous variables. Correlation between expres-sionswas analyzed by the c-square test. Statistical significancewasdefined as P � 0.05.

ResultsTP53INP1 is downregulated in advanced-stage and metastaticHCC tumors

As an initial attempt to explorewhether TP53INP1 expression isassociated with metastasis, we evaluated the expression ofTP53INP1 transcripts in two public gene expression databases.We found that in advanced-stage HCC samples (stage IV of AJCCand TNM) that are more likely associated with recurrence andmetastasis, the expression of TP53INP1 was significantly lowerthan that in early-stage samples (stages I, II, and III; GSE25097;ref. 19; Fig. 1A). In a second, independent data set (GSE40367;ref. 20) that compares metastatic free HCCs and HCCs withextrahepatic metastases, we also observed significantly lowerexpression of TP53INP1 inHCC sampleswith extrahepaticmetas-tases (Fig. 1B). To confirm these observations experimentally, wecarriedout immunohistochemical analyses in37pairs ofmatchedprimary and metastatic HCC tissue samples. Consistently,TP53INP1 was found to be downregulated in metastatic HCC.Only 28 of the 37 metastatic HCC samples were strong ormoderately positive for TP53INP1 and 9 were weak or negative.In contrast, moderate or strong immune positivity for TP53INP1was present in all 37 out of 37 primary HCC cases, suggesting thata downregulation of TP53INP1 expression is involved in HCCmetastasis (Fig. 1C). We then carried out Western blotting anal-yses in a panel of immortalized normal liver (MIHA and LO2),hepatoblastoma (HepG2) and HCC cell lines (SK-Hep1, HLE,SNU182, PLC8024, MHCC97L, Hep3B, QSG-7701, and QGY-7703). The expression of TP53INP1was high in the immortalizednormal liver and hepatoblastoma cells, while 7 of the 8 HCC celllines examined displayed significantly lower or undetectablelevels of TP53INP1 expression (Fig. 2A).

TP53INP1 knockdown promotes HCC metastasisTo assess the functional role of TP53INP1 in cancer cells, we

knocked down expression of TP53INP1 in immortalized normalliver cells MIHA and HCC cells MHCC97L using two TP53INP1-specific shRNA lentiviruses (sh-TP53INP1 464 and 3834). Ascontrols, we used lentiviruses expressing nonspecific shRNA

Ng et al.

Cancer Res; 77(17) September 1, 2017 Cancer Research4604




(nontarget control, NTC). Efficient TP53INP1 knockdown wasconfirmedbyWesternblotting (Fig. 2B).We found that TP53INP1shRNA-expressing cells had a significantly enhanced ability tomigrate and invade compared with control cells (Fig. 2C and D).Similar results were also obtained when the same experiment wasperformed in the presence of mitomycin C, where cells wereinhibited to proliferate, suggesting that TP53INP1-mediatedmigration and invasion are not a misinterpretation of the cells'altered ability to proliferate (Supplementary Fig. S1). To confirmthese findings, we further examined the effects of TP53INP1expression in an in vivo experimental metastasis model wherecells were orthotopically injected into the liver for observation ofmetastasis to the lung. TP53INP1 suppression induced a potentincrease in the ability of MHCC97L cells to not only form tumorsin the liver, but also metastasize to the lung (sh-464: 7 of 10tumors formed in the liver with 6 developing extrahepatic metas-tasis in the lung; sh-3834: 8 of 10 tumors formed in the liverwith 4developing extrahepatic metastasis in the lung). In contrast,MHCC97L control cells only resulted in tumor growth in theliver in 6of 10mice injected,with only 2mice going on todeveloplung metastasis (Fig. 2E; only 4 representative mice shown). Micewere sacrificed after 8 weeks and both livers and lungs wereremoved for histologic analyses. Hematoxylin and eosin (H&E)staining of the tumors confirmed the bioluminescence signalsobserved to indeed represent tumor cells and that there is alteredability of the cells to metastasize to the lung as evident byincreased number of tumor nodules present there (Fig. 2E andF). Immunohistochemical analysis also found TP53INP1 expres-

sion to be preferentially expressed in the livers and lungs of thenontarget control xenografts (Fig. 2F). In addition, to rule out anypotential off-target effects of our knockdown shRNAs, we per-formed experiments to rescue the effects of TP53INP1 shRNAs onmigration and invasion by overexpressing TP53INP1 in the samecells. Overexpression of TP53INP1 in MHCC97L cells withTP53INP1 stably repressed rescued the ability of the cells toattenuate migration and invasion in both knockdown clones,further demonstrating the importance of TP53INP1 in regulatingmetastasis in HCC (Supplementary Fig. S2).

Phopsho-kinase array profiling analysis identifies activation ofERK to be involved in TP53INP1-mediated HCC metastasis

To elucidate the molecular mechanism of TP53INP1 in regu-lating HCC metastasis, a Proteome Profiler Human Phospho-Kinase Array Kit was utilized to compare the relative levels of43 human protein kinase phosphorylation between HCC cellswithorwithout TP53INP1knockeddown. Intensity of the spotsonthe array was quantified by ImageJ analyses and those spots thatdisplayed >1.5-fold change between control and TP53INP1knocked down cells were selected for further validation byWesternblotting analyses. Altogether, 6 phospho-kinases were foundaltered, includingpERK1/2 (T202/Y204andT185/Y187), pGSK3b(S21/S9), pAMPK1a (T183), pAMPK2a (T172), p-p53 (S15), andp-WNK1(T60;Fig. 3A), ofwhichonlyp-ERK1/2couldbevalidatedtobe commonly increased inbothMIHAandMHCC97L cells (Fig.3B). To further validate the roleofpERK1/2signaling inTP53INP1-regulated metastasis, we analyzed the impact of introducing an

Figure 1.

TP53INP1 is downregulated in advanced-stage and metastatic HCC tumors. A, Gene expression levels of human TP53INP1 mRNA (NM_033285) in HCCtumors categorized by both AJCC (stages I, II, IIIA, IIIB, and IV; n ¼ 219) and TNM (stages I, II, III, IVA, and IVB; n ¼ 229) staging systems (GSE25097). Opencircles represent outliers. B, Box and whisker plot analysis of TP53INP1 mRNA levels in metastasis-free HCCs (n ¼ 10) and HCCs with extrahepatic metastasis(n ¼ 20; GSE40367). The horizontal lines indicate data within median � 1.5 interquartile range. Closed circles, outliers. C, TP53INP1 immunostaining of tissuemicroarray comprising of 37 paired human primary and metastatic HCC tissue samples. Shown are representative images of the immunostaining.Scale bar, 50 mm. P ¼ 0.0007. Graph indicates the percentage of cases displaying low, medium, and high staining intensity of TP53INP1.






ERK inhibitor (U0126) or stable shRNA against ERK1/2 intoHCC cells with TP53INP1 stably repressed on these alteredmetastatic phenotype. Introduction of U0126 or sh-ERK1/2 inTP53INP1-suppressed HCC cells attenuated in vitro cell migra-tion and invasion abilities (Figs. 3C and D, 4A; SupplementaryFig. S3), as well as lung metastasis in vivo (Fig. 4B–D), suggest-ing that ERK signaling is needed to drive metastasis inTP53INP1-deficient HCC. Immunohistochemical analysis alsofound p-ERK expression to be preferentially expressed in thelivers and lungs of the nontarget control of sh-TP53INP1xenografts (Fig. 4D). Note that 1 mmol/L and 10 mmol/L ofERK inhibitor U0126 was initially used to test which concen-tration was most appropriate for experimental use. At the end,10 mmol/L concentration was chosen as it resulted in completeabolishment of ERK expression as evident by Western blottinganalysis, with no sign of toxicity to the cells (data not shown).

TP53INP1 inhibits HCC metastasis through DUSP10-dependent modulation of ERK

Dual-specificity MAP kinase (MAPK) phosphatases (MKPs orDUSPs) are well-established negative regulators of MAPK/ERKsignaling in mammalian cells and tissues. By virtue of theirdifferential subcellular localization and ability to specificallyrecognize, dephosphorylate and inactivate different MAPK iso-forms, they are key spatiotemporal regulators of pathway activity.The MKPs constitute a distinct subgroup of 11 catalytically active

enzymes within the larger family of DUSPs, which all share aconserved cluster of basic amino acid residues involved in MAPKrecognition (23–25). A screen of these DUSP members at thegenomic level by qRT-PCR in HCC cells with or withoutTP53INP1 suppressed identified DUSP10/MKP-5 to be consis-tently downregulated in both MIHA and MHCC97L cells follow-ing TP53INP1 knockdown (Fig. 5A). This observation was furthervalidated at the proteomic level by Western blotting whereDUSP10 was found to be significantly downregulated (Fig.5B), concomitant with p-ERK1/2 activation in TP53INP1shRNA-expressing cells as compared with control cells (Fig.3B). To further validate the role of DUSP10-mediated pERK1/2signaling in TP53INP1 regulated metastasis, rescue experimentswhere DUSP10 was reintroduced into HCC cells with TP53INP1stably repressed was carried out (Fig. 5C). Introduction ofDUSP10 in TP53INP1-suppressed HCC cells resulted in amarkeddecrease in phosphorylated ERK (Fig. 5C) concomitant withattenuated abilities of HCC cells to migrate and invade in vitro(Fig. 5DandE), suggesting thatDUSP10-mediated alteration of p-ERK in TP53INP1 low/absent HCC cells can indeed promotemetastasis. Consistently, we also observed a significantly lowerexpression of DUSP10 in human HCC samples with extrahepaticmetastases as compared with metastatic free HCC samples in theGSE40367dataset (20). Apositive correlationbetween TP53INP1and DUSP10 expression was also found in the same samplecohort (R ¼ 0.4152; P ¼ 0.0001; Fig. 5F).

Figure 2.

TP53INP1 knockdown promotes HCC metastasis. A, Western blotting analysis of TP53INP1 expression in a panel of immortalized normal liver (MIHA andLO2), hepatoblastoma (HepG2), and HCC (SK-Hep1, HLE, SNU182, PLC8024, MHCC97L, Hep3B, QSG-7701, and QGY-7703) cell lines. B, Validation of TP53INP1knockdown inMIHA andMHCC97L cells byWestern blotting. NTC, nontarget control. sh-TP53INP1 clones 464 and 3834. Representative images and quantification ofnumber of cells that migrated (C) or invaded (D) in MIHA and MHCC97L cells with or without TP53INP1 suppressed. Scale bar, 50 mm. � , P < 0.05; �� , P < 0.01;and �� , P < 0.001 compared with NTC control. E, Bioluminescence imaging of four representative nude mice injected intrahepatically with luciferase-labeledMHCC97L cells with or without TP53INP1 suppressed. Ex vivo imaging of the livers and lungs harvested from nude mice that received orthotopic liver injections.n¼ 10mice per group. Bar chart summary of number of metastatic foci observed in lung. � , P < 0.05 and �� , P < 0.001 comparedwith NTC control. F, RepresentativeH&E and immunohistochemistry staining of TP53INP1 images of liver and lung tissues harvested. Scale bar, 50 mm. n ¼ 10. NTC, nontarget control.sh-TP53INP1 clones, 464 and 3834.

Ng et al.





p73,which transcriptional activity is known tobemodulatedbyTP53INP1, binds and regulates DUSP10 via promoter bindingand cooperatively drives ERK activation in HCC

To determine the link between TP53INP1- and DUSP10-medi-ated ERK signaling in regulating HCC metastasis, the upstreamregion of DUSP10 (�1 to �4,400) was analyzed using JASPAR(http://jaspar.genereg.net). Four predicted binding sites of p73,which activity is known to be modified by TP53INP1 (17), wasfound in the upstream region of DUSP10 [two sites in S1 (A andB); and two sites in S2 (C and D)], with a high relative score of>0.75 (Fig. 6A).ChIP assays showedhighphysical binding affinityof endogenous p73 to DUSP10 in MHCC97L cells in two of thefour predicted sites, namely site B (at�3716 to�3699) and site D(at�1337 to�1320; Fig. 6B, left). Todelineate the involvement ofTP53INP1 in the regulation of p73 activity and its subsequentbinding to the promoter of DUSP10, we knocked downTP53INP1 in MHCC97L and repeated the ChIP assay again.Silencing of TP53INP1 attenuated binding of p73 to DUSP10promoter in the same two binding sites (B and D; Fig. 6B, right),suggesting that TP53INP1 does indeed play a role in modulatingthe binding affinity of p73 to the DUSP10 promoter. Note that ithas previously been reported that TP53INP1 can also alter thetransactivation capacity of p73 on a number of genes, demon-strating a functional association between p73 and TP53INP1

(17). Notably, both MIHA liver and MHCC97L HCC cell linesthat were used for functional experiments in our current study areeither p53 absent (MIHA) ormutant (MHCC97L). Both cell typesare, however, p73 wild-type. Luciferase reporter assays showedhigh transcriptional activity of endogenous p73 to DUSP10 inMHCC97L cells in both sites 1 and 2, as knockdown of p73woulddecrease the activation of DUSP10 promoter by two folds (Fig.6C). Stable knockdown of p73 inMHCC97L cells led to amarkeddecrease inDUSP10and concomitant increase in pERK1/2 expres-sion; while overexpression of DUSP10 in cells with p73 stablysuppressed can cancel this effect (Fig. 6D). Further, we foundstable TP53INP1 knockdown in MHCC97L cell to also result in asimilar decrease inDUSP10 promoter activation (Fig. 6E). Immu-nohistochemical staining of xenograft tumors generated fromHCC cells with and without TP53INP1 knockdown further val-idated these observations as TP53INP1 repressed tumors dis-played elevated pERK1/2 concomitant with a decrease inDUSP10(Supplementary Fig. S4). Note p73 expression levels remainunchanged in TP53INP1-repressed HCC cells, as evidenced bybothWestern blotting and IHC analyses (Fig. 6F and Supplemen-tary Fig. S4). In addition, we also noted that in addition toDUSP10, knockdown of TP53INP1 would similarly lead to amarked downregulation of other known p73 targets, includingMDM2 and BAX2 (Fig. 6F; ref. 17). Taken together, TP53INP1 can

Figure 3.

Phopsho-kinase array profiling analysis identifies activation of ERK to be involved in TP53INP1-mediated HCC metastasis. A, Western blotting images ofderegulated phospho-kinases spotted on theProteomeProfiler HumanPhospho-KinaseArray, comparingMIHAcells transducedwithNTCor sh-TP53INP1 clone464.B, Western blotting analysis for levels of phosphorylated and total ERK1/2 in HCC cells expressing NTC or sh-TP53INP1 clones (464 and 3834).Representative images and quantification of number of cells that migrated (C) or invaded (D) in MIHA and MHCC97L cells expressing NTC or sh-TP53INP1 clones(464 and 3834) that were treated with DMSO vehicle control (V) or ERK inhibitor U0126 (10 mm). Scale bar, 50 mm. �� , P < 0.01 and ��, P < 0.001 compared withNTC/vehicle control. #, P < 0.05; ##, P < 0.01; and ###, P < 0.001 compared with vehicle.





http://jaspar.genereg.net


enhance p73 ability to drive DUSP10 transcription, thereby,altering downstream ERK signaling to drive HCC metastasis. InHCC tumors where p73mutations are rarely observed, TP53INP1downregulation promotes HCC metastasis through DUSP10inactivation via p73-dependent DUSP10 promoter binding andregulation, resulting in activation of the ERK signaling pathway(Fig. 6G).

DiscussionMetastasis is a major hallmark of cancer and yet remains the

most poorly understood component of cancer pathogenesis (2). Itis a complex multistep process involving alterations in the dis-semination, invasion, survival, and growth of new cancer cellcolonies, which are regulated by a complex network of intra- andintercellular signal transduction cascades (1). In this study, wedemonstrate that TP53INP1 is frequently downregulated inadvanced-stage and metastatic human HCC tumors and thatdownregulation of TP53INP1 in HCC promotes metastasisthrough DUSP10 inactivation via p73-dependent DUSP10 pro-moter binding and regulation, resulting in activation of the ERKsignaling pathway. Findings from our study not only provide newinsight into how HCC metastasis is regulated but also provide anew layer of mechanism by which DUSP10/ERK signaling isregulated by p73/TP53INP1. Note that because TP53INP1-medi-ated ERK1/2 activation can also lead to increased cell prolifera-tion, we must take caution when we interpret our metastasis

findings, such that we must ensure that the metastasis effect isnot a by-product of the cells' altered proliferation potential. Toaddress this, we repeated ourmigration and invasion assays again,in the presence of mitomycin C, a drug used to inhibit cellproliferation.

TP53INP1 is a stress-induced p53-target genewhose expressionis modulated by transcription factors such as p53, p73, and E2F1(6, 17, 26). It encodes two protein isoforms, TP53INP1a andTP53INP1b (5), which have similar functions and can induce cell-cycle arrest and apoptosis when overexpressed (6). In associationwith homeodomain-interacting protein kinase-2 (HIPK2),TP53INP1 phosphorylates p53 protein at serine 46, therebyenhancing p53 protein stability and its transcriptional activity,leading to transcriptional activation of p53-target genes, cellgrowth arrest and apoptosis upon DNA damage stress (27). Theantiproliferative andproapoptotic activities of TP53INP1 indicatethat TP53INP1 has an important role in cellular homeostasis andDNA damage response. TP53INP1 can be subcellularly localizedin the nucleus or cytoplasmdepending on the context. In additionto its role in the nucleus where it stimulates the transcriptionalactivity of p53 and p73 (17, 27), it also contributes to autophagyand regulation of energetic metabolism and reactive oxygenspecies (28–31).

Deficiency in TP53INP1 expression results in increased tumor-igenesis. A number of studies have demonstrated a significantreduction of TP53INP1 expression during cancer formation of thestomach (7), breast (8), pancreas (9), esophagus (10), lung (11),

Figure 4.

TP53IN1 inhibits HCC metastasis via modulation of ERK signaling. A, Western blotting analysis for levels of total ERK1/2 in MHCC97L cells coexpressingsh-TP53INP1 clones and NTC or sh-ERK1/2. B, Bioluminescence imaging of nude mice injected intrahepatically with luciferase-labeled MHCC97L cells coexpressingsh-TP53INP1 clones and NTC or sh-ERK1/2. Ex vivo imaging of the livers and lungs harvested from nude mice that received orthotopic liver injections.C, Bar chart summary of number of metastatic foci observed in lung. � , P < 0.05 compared with NTC control. D, Representative H&E and immunohistochemistrystaining of p-ERK images of liver and lung tissues harvested.

Ng et al.





melanocyte (12), colon (13), and T-cell leukemia (14); and thatdownregulation of TP53INP1 correlated with more aggressiveclinicopathologic behaviors in several human cancer types (7–9,11). TP53INP1-deficient mice exhibited exacerbated colitis-asso-ciated carcinogenesis (32),while TP53INP1 expressionwas foundto be lost in rat preneoplastic liver lesions (33). In contrast to this,two recent studies published by the same group in 2012 havefoundTP53INP1 tobe frequently overexpressed inprostate cancerand castration-resistant prostate cancer, and that its overexpres-sion correlated with poor prognostic factors and is predictive oftumor relapse (34, 35), suggesting that TP53INP1 appears to playa dual role as both a tumor-suppressing and tumor-promotinggene and that its expression trend is cancer type specific.

TP53INP1 downregulation in cancers is regulated at multiplelevels by DNA methylation (10), the transcription factors c-myc(10) and n-myc (36), histone deacetylase 2 (36) as well as aplethora of miRNAs including miR-569 (37), miR-155 (9, 38–40), miR-182 (41), miR-93, miR-130b (14, 18), miR-30a, miR-205 (42–43), and miR-125b (11). Studies have not only dem-onstrated a functional tumor suppressive role of TP53INP1 butalso a role in modulating cancer stem cell phenotypes (38),cisplatin and gemcitabine resistance (41, 44), as well as oxidativestress (45). In our previous studies, we found that the initiation,growth, and self-renewal of CD133þ liver tumors are regulated bya balance of miR-130b overexpression and TP53INP1 down-regulation (18), yet to date, the role of TP53INP1 in HCC

Figure 5.

TP53INP1 inhibits HCC metastasis through DUSP10-dependent modulation of ERK. A, Left, relative expression of selected DUSP/MKP family members andTP53INP1 in MIHA and MHCC97L cells expressing NTC or sh-TP53INP1 clones (464 and 3834) by qRT-PCR. Right, validation of downregulated DUSP10 expressionfollowing TP53INP1 knockdown in MIHA and MHCC97L cells by qRT-PCR. B, Western blotting analysis for levels of DUSP10 in HCC cells expressing NTC orsh-TP53INP1 clones (464 and 3834). C, Western blotting analysis for levels of DUSP10, phosphorylated and total ERK1/2 in HCC cells coexpressing NTC orsh-TP53INP1 clones and empty vector or DUSP10 overexpression. Representative images and quantification of number of cells that migrated (D) or invaded (E) inMIHA and MHCC97L cells coexpressing NTC or sh-TP53INP1 clones and empty vector or DUSP10 overexpression. Scale bar, 50 mm. � , P < 0.05; �� , P < 0.01;and �� , P < 0.001 compared with NTC/EV control. ##, P < 0.01 and ###, P < 0.001 compared with EV control. F, Left box and whisker plot analysis ofDUSP10mRNA levels inmetastasis-freeHCCs (n¼ 10) andHCCswith extrahepaticmetastasis (n¼ 20;GSE40367). The horizontal lines indicate datawithinmedian�1.5 interquartile range. Right, Pearson correlation analysis of TP53INP1 and DUSP10 mRNA levels in human HCC samples (n ¼ 30; GSE40367).






metastasis or the molecular mechanism by which TP53INP1regulates migration and invasion in HCC has not been explored.Prior to findings presented in this study, only three reports havelinked TP53INP1 to metastasis where they found TP53INP1 toreduce pancreatic cancer cell migration by regulating SPARCexpression (16); that TP53INP1 is downregulated in distant lungmetastasis of brain cancer (15); and TP53INP1 30UTR to functionas a competitive endogenous RNA (ceRNA) in repressing themetastasis of glioma cells by regulating miRNA activity (46).Specifically, using a mouse model of skin wound healing inTP53INP1 wild-type and deficient mice, our collaborators ele-gantly showed TP53INP1 to suppress cell migration in vivo.Similar observations were also noted in vitro in TP53INP1 wild-type and deficient mouse embryonic fibroblasts (MEF). Abovestudies collectively support a role of TP53INP1 in regulatingmetastasis.

As mentioned above, TP53INP1 encodes two protein isoforms(a and b; ref. 5). This current study did not examine these twoisoforms separately, but just looked at the role of both isoformscollectively in HCC. The antibody used for Western blottinganalysis binds to the N-terminus of TP53INP1, which detectsboth protein isoforms. However, it should be noted that apredominant 36-kDa band was observed in the Western blotting,

which according to our previous experience and studies wouldrepresent the a isoform. We did observe a much weaker band at55-kDa band, which in our experience would correspond to the bisoform of TP53INP1. However, this band was only detectedupon extensive exposure. RT-PCR analysis on HCC cell lines,clinical samples and sh-TP53INP1 HCC cells using primers spe-cific to just a isoform, b isoform or both a and b isoforms,revealed that expression levels were similarly expressed or unex-pressed (data not shown). Whether the two isoforms are differ-entially expressed at the mRNA and protein level or would exertdifferent functional roles in HCC would need to be furtherstudied.

There is ample evidence to show that TP53INP1 can alter thetransactivation capacity of a number of genes through both p53-and p73-dependent manners (17). P53 is mutated in approxi-mately 30% of all liver cancers (47). But unlike p53, mutation ofp73 is not a common event inHCCnor other human tumors. P73was also not found to be differentially expressed in nontumorversus HCC (GSE25097) nor metastatic-free HCC versus HCCwith extrahepatic metastasis (GSE40367; data not shown). Here,we have uncovered a novel mechanism by which TP53INP1downregulation contributes to HCC metastasis, through a p73-dependent DUSP10/ERK signaling pathway. The immortalized

Figure 6.

p73, which transcriptional activity is modulated by TP53INP1, binds and regulates DUSP10 via promoter binding and cooperatively drives ERK activation in HCC.A, Computational prediction of p73 binding sites (S1 at �4,400 to �2,201 bp and S2 at �2,200 to 1 bp) on DUSP10 promoter region by JASPAR matrix model.B, Confirmation of p73 binding to candidate DUSP10 sites by ChIP-qPCR analysis in MHCC97L cells with or without TP53INP1 suppressed. Chromatins wereimmunoprecipitated by anti-p73 antibody, and the enrichment of predicted p73 binding sites on DUSP10 (sites A, B, C, and D) relative to IgG control was confirmedby qPCR. C, Luciferase reporter assays in MHCC97L cells expressing NTC or sh-p73 clones (753 and 1643) to validate the interaction between p73 andDUSP10 at both predicted regions. pRL-TK Renilla luciferase plasmid cotransfected for normalization. �� , P < 0.01 and �� , P < 0.001 compared with NTC control.D, Western blotting analysis for levels of p73, DUSP10, phosphorylated and total ERK1/2 in HCC cells expressing NTC or sh-p73 clones (753 and 1643), withempty vector (EV) or DUSP10 overexpressed. E, Luciferase reporter assays in MIHA and MHCC97L cells expressing NTC or sh-TP53INP1 clones (464 and 3834) tovalidate the interaction between p73 and DUSP10 at both predicted regions. pRL-TK Renilla luciferase plasmid cotransfected for normalization. �� , P < 0.01 and�� , P < 0.001 compared with NTC control. F, Western blotting analysis for levels of p73, MDM2, and BAX in HCC cells expressing NTC or sh-TP53INP1 clones(464 and 3834).G, Proposed model illustrates how TP53INP1 downregulation promotes HCCmetastasis through a p73-dependent DUSP10/ERK signaling pathway.Dotted box with question mark indicates how TP53INP1 interacts with p73 is still unknown.

Ng et al.





normal liver and HCC cell lines that were used in this currentstudy, namelyMIHA andMHCC97L, respectively, were either p53deleted or mutated, but were both p73 intact. Whether down-regulation of TP53INP1 promotes HCC metastasis through asimilar DUSP10/ERK mechanism in a p53-dependent mannerneeds to be further studied using appropriate cell lines that harborwild-type p53. It is interesting to note that we were also able topredict five p53 putative binding sites on the DUSP10 promoterwith a relative score higher than 0.75 (which is the same settingused for prediction of p73 binding sites on DUSP10), suggestingthat TP53INP1 may also indeed control DUSP10/ERK pathwayvia a p53-dependent manner. If experimentally proven,TP53INP1 downregulation would be able to regulate DUSP10/ERK via both p53 and p73 means, uncovering a new mechanismfor all p53 wild-type, mutated/deleted HCC tumors.

p63 also exhibits significant structural homology to p53 andp73, has been reported to bind to the same responsive element asp73 and plays a role in cancer metastasis (48). It would also beintriguing to study the possible involvement of p63 andTP53INP1-mediated suppression of metastasis. Toward this end,wewent back to examine the p63 status inHCC tissues and foundthat p63 expression is largely absent in HCC (49, 50). With this,we cannot conclude that p63 has no role in TP53INP1-mediatedDUSP10/ERK signaling, but at least in the context of HCC, wherep63 expression is absent, chances are low.

Our study benefitted from the fast growing publicly availabletranscriptome datasets deposited in NCBI Gene ExpressionOmnibus. The two datasets used, namely GSE40367 (20) andGSE25097 (19), were chosen in particular as the clinical samplesprofiled are all representative of Asian ethnicity and are thusmorerelevant to the disease in our locality. In particular, the GSE40367dataset was sampled from laser capture microdissected tissue ofpure tumor cells of HCCs with extrahepatic metastases and

metastasis-free HCCs. Samples of these are rare and of particularimportance to studies like this that focuses specifically on HCCmetastasis.

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors' ContributionsConception and design: K.-Y. Ng, T.K. Lee, S. MaDevelopment of methodology: S. ChaiAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): K.-Y. Ng, L.-H. Chan, S. Chai, M. Tong, N.P. Lee,Y. Yuan, D. Xie, N.J. Dusetti, A. Carrier, S. MaAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): K.-Y. Ng, M. Tong, S. MaWriting, review, and/or revisionof themanuscript:K.-Y.Ng,N.J.Dusetti, S.MaAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): S. Chai, X.-Y. Guan, D. Xie, S. MaStudy supervision: S. Ma

AcknowledgmentsWe thank the Faculty Core Facility at the LKS Faculty of Medicine, The

University of Hong Kong for providing andmaintaining the equipment neededfor animal imaging.

Grant SupportThis work was supported in part by grants from Research Grants Council–

General Research Fund (HKU_773412M), Collaborative Research Fund(C7027-14G), and the Croucher Foundation Innovation Award to S. Ma.

The costs of publication of this articlewere defrayed inpart by the payment ofpage charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received December 19, 2016; revised May 26, 2017; accepted June 27, 2017;published OnlineFirst July 3, 2017.

References1. Chaffer CL, Weinberg RA. A perspective on cancer cell metastasis. Science

2011;331:1559–64.2. Nguyen DX, Bos PD, Massague J. Metastasis: from dissemination to organ-

specific colonization. Nat Rev Cancer 2009;9:274–84.3. Reddy KB, Nabha SM, Atanaskova N. Role of MAP kinase in tumor

progression and invasion. Cancer Metastasis Rev 2003;22:395–403.4. Caunt CJ, Keyse SM. Dual-specificity MAP kinase phosphatases (MKPs):

shaping the outcome of MAP kinase signalling. FEBS J 2013;280:489–504.5. TomasiniR, SamirAA,VaccaroMI, PebusqueMJ,Dagorn JC, Iovanna JL, et al.

Molecular and functional characterization of the stress-induced protein (SIP)gene and its two transcripts generated by alternative splicing. SIP induced bystress and promotes cell death. J Biol Chem 2001;276:44185–92.

6. Okamura S, Arakawa H, Tanaka T, Nakanishi H, Ng CC, Taya Y, et al.p53DINP1, a p53-inducible gene, regulates p53-dependent apoptosis.MolCell 2001;8:85–94.

7. Jiang PH, Motoo Y, Garcia S, Iovanna JL, Pebusque MJ, Sawabu N. Down-expression of tumor protein 53-induced nuclear protein 1 in human gastriccancer. World J Gastroenterol 2006;12:691–6.

8. Ito Y,Motoo Y, YoshidaH, Iovanna JL, Takamura Y,Miya A, et al. Decreasedexpression of tumor protein p53-induced nuclear protein 1 (TP53INP1) inbreast carcinoma. Anticancer Res 2006;26:4391–5.

9. Gironella M, Seux M, Xie MJ, Cano C, Tomasini R, Gommeaux J, et al.Tumor protein 53-induced nuclear protein 1 expression is repressed bymiR-155, and its restoration inhibits pancreatic tumor development. ProcNatl Acad Sci U S A 2007;104:16170–5.

10. Weng W, Yang Q, Huang M, Qiao Y, Xie Y, Yu Y, et al. c-Myc inhibitsTP53INP1 expression via promoter methylation in esophageal carcinoma.Biochem Biophys Res Commun 2011;405:278–84.

11. Li Q, Han Y, Wang C, Shan S, Wang Y, Zhang J, et al. MicroRNA-125bpromotes tumor metastasis through targeting tumor protein 53-inducednuclear protein 1 in patients with non-small-cell lung cancer. Cancer CellInt 2015;15:84.

12. Bonazzi VF, Irwin D, Hayward NK. Identification of candidate tumorsuppressor genes inactivated by promoter methylation in melanoma.Genes Chromosomes Cancer 2009;48:10–21.

13. Shibuya H, Iinuma H, Shimada R, Horiuchi A, Watanabe T. Clinicopatho-logical and prognostic value of microRNA-21 and microRNA-155 incolorectal cancer. Oncology 2010;79:313–20.

14. Yeung ML, Yasunaga J, Bennasser Y, Dusetti N, Harris D, Ahmad N, et al.Roles for microRNAs, miR-93 and miR-130b, and tumor protein 53-induced nuclear protein 1 tumor suppressor in cell growth dysregulationby human T-cell lymphotrophic virus 1. Cancer Res 2008;68:8976–85.

15. Zohrabian VM, Nandu H, Gulati N, Khitrov G, Zhao C, Mohan A, et al.Gene expression profiling of metastatic brain cancer. Oncol Rep 2007;18:321–8.

16. Seux M, Peuget S, Montero MP, Siret C, Rigot V, Clerc P, et al. TP53INP1decreases pancreatic cancer cell migration by regulating SPARC expression.Oncogene 2011;30:3049–61.

17. Tomasini R, Seux M, Nowak J, Bontemps C, Carrier A, Dagorn JC, et al.TP53INP1 is a novel p73 target gene that induces cell cycle arrest and celldeath by modulating p73 transcriptional activity. Oncogene 2005;24:8093–104.

18. Ma S, Tang KH, Chan YP, Lee TK, Kwan PS, Castilho A, et al. miR-130bpromotes CD133(þ) liver tumor-initiating cell growth and self-renewalvia tumor protein 53-induced nuclear protein 1. Cell Stem Cell 2010;7:694–707.






19. Lamb JR, Zhang C, Xie T, Wang K, Zhang B, Hao K, et al. Predictive genes inadjacent normal tissue are preferentially altered by sCNV during tumor-igenesis in liver cancer and may rate limiting. PLoS One 2011;6:e20090.

20. Ye QH, ZhuWW, Zhang JB, Qin Y, Lu M, Lin GL, et al. GOLM1modulatesEGFR/RTK cell-surface recycling to drive hepatocellular carcinoma metas-tasis. Cancer Cell 2016;30:444–58.

21. Brown JJ, Parashar B, Moshage H, Tanaka KE, Engelhardt D, Rabbani E,et al. A long-term hepatitis B viremia model generated by transplantingnontumorigenic immortalized human hepatocytes in Rag-2-deficientmice. Hepatology 2000;31:173–81.

22. Li Y, Tang ZY, Ye SL, Liu Y, Chen J, XueQ, et al. Establishment of cell cloneswith different metastatic potential from the metastatic hepatocellularcarcinoma cell line MHCC97. World J Gastroenterol 2001;6:630–6.

23. Kidger AM, Keyse SM. The regulation of oncogenic Ras/ERK signalling bydual-specificity mitogen activated protein kinase phosphatases (MKPs).Semin Cell Dev Biol 2016;50:125–32.

24. Keyse SM. Dual-specificity MAP kinase phosphatases (MKPs) and cancer.Cancer Metastasis Rev 2008;27:253–61.

25. Nomura M, Shiba K, Katagiri C, Kasugai I, Masuda K, Sato I, et al. Novelfunction of MKP-5/DUSP10, a phosphatase of stress-activated kinases, onERK-dependent gene expression, and upregulation of its gene expression incolon carcinomas. Oncol Rep 2012;28:931–6.

26. Tomasini R, Samir AA, Pebusque MJ, Calvo EJ, Totaro S, Dagorn JC, et al.P53-dependent expression of the stress-induced protein (SIP). Eur J CellBiol 2002;81:294–301.

27. Tomasini R, Samir AA, Carrier A, Isnardon D, Cecchinelli B, Soddu S, et al.TP53INP1s and homeodomain-interacting protein kinase-2 (HIPK2) arepartners in regulating p53 activity. J Biol Chem 2003;278:37722–9.

28. Seillier M, Pouyet L, N'Guessan P, Nollet M, Capo F, Guillaumond F, et al.Defects in mitophagy promotes redox-driven metabolic syndrome in theabsence of TP53INP1. EMBO Mol Med 2015;7:802–18.

29. Cano CE, Gommeaux J, Pietri S, Culcasi M, Garcia S, Seux M, et al. Tumorprotein 53-induced nuclear protein 1 is a major mediator of p53 antiox-idant function. Cancer Res 2009;69:219–26.

30. Seillier M, Peuget S, Gayet O, Gauthier C, N'Guessan P, Monte M, et al.TP53INP1, a tumor suppressor, interacts with LC3 and ATG8-familyproteins through the LC3-interacting region (LIR) and promotes autop-hagy-dependent cell death. Cell Death Differ 2012;19:1525–35.

31. Saadi H, Seillier M, Carrier A. The stress protein TP53INP1 plays a tumorsuppressive role by regulating metabolic homeostasis. Biochimie 2015;118:44–50.

32. Gommeaux J, CanoC, Garcia S, GironellaM, Pietri S, CulcasiM, et al. Colitisand colitis-associated cancer are exacerbated in mice deficient for tumorprotein 53-induced nuclear protein 1. Mol Cell Biol 2007;27:2215–28.

33. Ogawa K, Asamoto M, Suzuki S, Tsujimura K, Shirai T. Downregulation ofapoptosis revealed by laser microdissection and cDNAmicroarray analysisof related genes in rat liver preneoplastic lesions. MedMol Morphol 2005;38:23–9.

34. Giusiano S, Baylot V, Andrieu C, Fazli L, Gleave M, Iovanna JL, et al.TP53INP1 as new therapeutic target in castration-resistant prostate cancer.Prostate 2012;72:1286–94.

35. Giusiano S, Garcia S, Andrieu C, Dusetti NJ, Bastide C, Gleave M, et al.TP53INP1 overexpression in prostate cancer correlates with poor prog-

nostic factors and is predictive of biological cancer relapse. Prostate2012;72:117–28.

36. Shahbazi J, Scarlett CJ, Norris MD, Liu B, Haber M, Tee AE, et al. Histonedeacetylase 2 and N-Myc reduce p53 protein phosphorylation at serine 46by repressing gene transcription of tumor protein 53-induced nuclearprotein 1. Oncotarget 2014;5:4257–68.

37. Chaluvally-Raghavan P, Zhang F, Pradeep S, Hamilton MP, Zhao X,Rupaimoole R, et al. Copy number gain of hsa-miR-569 at 3q26.2 leadsto loss of TP53INP1 and aggressiveness of epithelial cells. Cancer Cell2014;26:863–79.

38. Liu F, Kong X, Lv L, Gao J. TGF-b1 acts through miR-155 to down-regulateTP53INP1 in promoting epithelial-mesenchymal transition and cancerstem cell phenotypes. Cancer Lett 2015;359:288–98

39. Zhang J, ChengC, YuanX,He JT, PanQH, Sun FY.microRNA-155 acts as anoncogene by targeting the tumor protein 53-induced nuclear protein 1 inesophageal squamous cell carcinoma. Int J Clin Exp Pathol 2014;7:602–10.

40. Zhang CM, Zhao J, Deng HY. MiR-155 promotes proliferation of humanbreast cancer MCF-7 cells through targeting tumor protein 53-inducednuclear protein 1. J Biomed Sci 2013;20:79.

41. Qin J, Luo M, Qian H, Chen W. Upregulated miR-182 increases drugresistance in cisplatin-treated HCC cell by regulating TP53INP1. Gene2014;538:342–7.

42. Xu CG, Yang MF, Fan JX, Wang W. MiR-30a and miR-205 are down-regulated in hypoxia andmodulate radiosensitivity of prostate cancer cellsby inhibiting autophagy via TP53INP1. Eur Rev Med Pharmacol Sci2016;20:1501–8.

43. Nie G, Duan H, Li X, Yu Z, Luo L, Lu R, et al. MicroRNA-205 promotesthe tumorigenesis of nasopharyngeal carcinoma through targetingtumor protein p53-inducible nuclear protein 1. Mol Med Rep 2015;12:5715–22.

44. Nakaya N, Ishigaki Y, Nakajima H, Murakami M, Shimasaki T, Takata T,et al. Meaning of tumor protein 53-induced nuclear protein 1 in themolecular mechanism of gemcitabine sensitivity. Mol Clin Oncol 2013;1:100–4.

45. Al Saati T, Clerc P, Hanoun N, Peuget S, Lulka H, Gigous V, et al. Oxidativestress induced by inactivation of TP53INP1 cooperates with KrasG12D toinitiate and promote pancreatic carcinogenesis in themurine pancreas. AmJ Pathol 2013;182:1996–2004.

46. Wang Y, Lin G. TP53INP1 30-UTR functions as a ceRNA in repressing themetastasis of glioma cells by regulating miRNA activity. Biotechnol Lett2016;38:1699–707.

47. Olivier M, Hollstein M, Hainaut P. TP53 mutations in human cancers:origins, consequences, and clinical use. Cold Spring Harb Perspect Biol2010;2:a001008.

48. DeYoung MP, Ellisen LW. p63 and p73 in human cancer: defining thenetwork. Oncogene 2007;26:5169–83.

49. Ramalho FS, Ramalho LN, Della Porta L, Zucoloto S. Comparative immu-nohistochemical expression of p63 in human cholangiocarcinoma andhepatocellular carcinoma. J Gastroenterol Hepatol 2006;21:1276–80.

50. Tannapfel A, Wittekind C. Genes involved in hepatocellular carcinoma:deregulation in cell cycling and apoptosis. Virchows Arch 2002;440:345–52.


Ng et al.




2017;77:4602-4612. Published OnlineFirst July 3, 2017.Cancer Res Kai-Yu Ng, Lok-Hei Chan, Stella Chai, et al. CarcinomaSignaling Pathway to Promote Metastasis of Hepatocellular TP53INP1 Downregulation Activates a p73-Dependent DUSP10/ERK

Updated version

10.1158/0008-5472.CAN-16-3456doi:

Access the most recent version of this article at:

Material

Supplementary

http://cancerres.aacrjournals.org/content/suppl/2017/07/01/0008-5472.CAN-16-3456.DC1

Access the most recent supplemental material at:

Cited articles

http://cancerres.aacrjournals.org/content/77/17/4602.full#ref-list-1

This article cites 50 articles, 10 of which you can access for free at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/77/17/4602To request permission to re-use all or part of this article, use this link



http://cancerres.aacrjournals.org/lookup/doi/10.1158/0008-5472.CAN-16-3456

http://cancerres.aacrjournals.org/content/suppl/2017/07/01/0008-5472.CAN-16-3456.DC1

http://cancerres.aacrjournals.org/content/77/17/4602.full#ref-list-1

http://cancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://cancerres.aacrjournals.org/content/77/17/4602


TP53INP1 Downregulation Activates a p73- Dependent DUSP10 ... · Cancer Res; 77(17); 4602–12. 2017 AACR. Introduction Liver cancer remains one of the most prevalent and deadliest

Documents