The role of class IA PI3Kδ in - digital.library.adelaide.edu.au · The role of class IA PI3Kδ in experimental autoimmune encephalomyelitis Sarah Haylock-Jacobs, B.Sc. (Biomed. Sci.)

The role of class IA PI3Kδ in

experimental autoimmune

encephalomyelitis

Sarah Haylock-Jacobs, B.Sc. (Biomed. Sci.) (Hons.)

Discipline of Microbiology & Immunology

School of Molecular & Biomedical Science

University of Adelaide

A thesis submitted to the University of Adelaide

in fulfilment of the requirements for the degree of

Doctor of Philosophy

July 2010

Preface

iii

Declaration

This work contains no material which has been accepted for the award of any other

degree or diploma in any university or other tertiary institution to Sarah Haylock-

Jacobs and, to the best of my knowledge and belief, contains no material previously

published or written by another person, except where due reference has been made in

the text.

I give consent to this copy of my thesis when deposited in the University Library,

being made available for loan and photocopying, subject to the provisions of the

Copyright Act 1968.

I also give permission for the digital version of my thesis to be made available on the

web, via the University’s digital research repository, the Library catalogue, the

Australasian Digital Thesis Program (ADTP) and also through web search engines,

unless permission has been granted by the University to restrict access for a period of

time.

Sarah Haylock-Jacobs, B.Sc. (Biomed. Sci.) (Hons.)

July 2010

Preface

iv

Acknowledgements First of all I must thank my supervisor Professor Shaun McColl for affording me the

opportunity to undertake such an interesting Ph.D. project. Your scientific advice,

expertise and guidance have been invaluable, as has been your trust in allowing me

some scientific independence. On a personal note, I am very thankful for the

patience, kindness, encouragement and understanding that you have always shown

me, particularly when I came to you two years into my Ph.D. and said ‘Guess what!

I’m having a baby’! I would also like to thank you for the time you have dedicated to

editing both my thesis and published material and for the patient way that you have

helped make my scientific writing much more betterer!

Next I must thank my wonderful colleagues: you have always made life in the lab

interesting! Iain, you truly have been an amazing help, both on the giant experiment

days and with your scientific advice; you’re an inspiring role model and good friend

to me, thanks. Adriana, your efforts to keep the lab going are no less than amazing,

and you are always great for a laugh too! Julie and Matt, thanks for the endless

laughs, entertainment and special lab coat dancing! Manuela and Marina, ever-

knowledgeable post-docs, thanks for all of your scientific input as well as all of the

great chats. Meizhi, all the best for finishing your Ph.D. with a newborn baby - you

are Supermum, you can do it! Mark, Yuka, Wendel and Michelle: thanks for all the

great chats and laughs and all the very best for the future. Lastly, the departed Jane

and Scott: you have both contributed so much towards me enjoying my Ph.D. years

and I feel very happy to have worked with you both and for having made such

enduring friendships.

Professionally, I must thank Dr. Kamal Puri and Calistoga Pharmaceuticals (Seattle,

USA) for providing the IC87114 compound used in this study and for performing all

of the GC-MS on plasma samples. Dr. Iain Comerford assisted me on many of the

busy days, performed some of the intracellular cytokine staining required for this

study, optimised conditions for the Th1- and Th17-skewing cultures, aided with the

optimisation of the DC antigen presentation experiment and helped with in vivo

inhibitor experiments. Mark Bunting contributed to the DC migration and CFA-

Preface

v

immunisation experiments, commonly maintained BMDC cultures, assisted with

optimising the DC antigen presentation assay and also helped with in vivo inhibitor

experiments. This assistance was invaluable, thank you to you all.

Now for my wonderful friends: Kate B, you are awesome, you have no idea how

much I will miss you! And thanks for your great advice when you told me that I

‘only need ONE Ph.D.’! Erin, you have significantly contributed to my sanity and

happiness throughout this Ph.D. thing, thanks. Good luck getting finished and getting

back to the ski slopes; I hope it happens very soon! Wendy, thanks for all of the great

chats over the years, lab life just isn’t the same without you. There are many

important people who aren’t specifically named here, but thank you everyone who

has supported me through both my Ph.D. and becoming a mum. You are all

irreplaceable and hopefully you know who you are.

Thanks to ‘Christine’ Mum, Dad (how did you get off that easily?), ‘idiot head’ Kate

(plus Jye Jye and Kobes) and ‘spacko’ Amy, I really would not be the person that I

am today without you guys. Thank you for always supporting me in what I do, I love

you all forever. Archie, Eva, Quinn, Lisa, Hayden, Carson and Hope, thanks for your

endless love, support and patience (well, actually, I wouldn’t really say that Lisa was

‘patient’ per se), I can’t wait to spend more time with all of you! Thanks also to the

rest of my wonderful family in Australia and Canada - I am so lucky to be

surrounded by such an amazing bunch of level-headed, caring and happy people.

Todd, thank you so much for your support during my Ph.D., it has been second to

none. I am the luckiest girl in the world to be married to you; you are my best friend

and having you in my life for the last 10 years has been an amazing blessing. I know

that you wanted to be acknowledged both first and last on this page - it didn’t

happen, but trust me, I agree that you deserve it! And last but most certainly never

the least, Lily. You are the brightest light in my life; you make me smile, laugh and

feel happy every single day. Always remember that, just like Mummy, you can grow

up to be whatever you want to be. I love you Todd and Lily - thanks.

Preface

vi

Preface

vii

Table of Contents

Declaration iii

Acknowledgements v

Table of Contents viii

Table of Figures xvi

List of Tables xix

Abbreviations xx

Publications arising from this work xxiv

Abstract xxvii

CHAPTER 1: INTRODUCTION .................................................................. 1

1.1 OVERVIEW ..................................................................................................... 3

1.2 FACTORS GOVERNING THE NORMAL IMMUNE RESPONSE ......... 4

1.2.1 Cells of the immune system ........................................................................ 4

1.2.1.1 T lymphocytes ...................................................................................... 4

1.2.1.2 B lymphocytes ...................................................................................... 6

1.2.1.3 Dendritic cells ...................................................................................... 7

1.2.1.4 Macrophages ........................................................................................ 7

1.2.1.5 Neutrophils ........................................................................................... 8

1.2.2 T helper cell differentiation ......................................................................... 8

1.2.2.1 Th1 and Th2 differentiation ................................................................. 8

1.2.2.2 Th17 and Treg differentiation .............................................................. 9

1.3 INFLAMMATION OF THE CENTRAL NERVOUS SYSTEM ................ 9

1.3.1 The healthy central nervous system .......................................................... 10

1.3.2 Multiple Sclerosis ..................................................................................... 10

1.3.3 Animal models of multiple sclerosis ......................................................... 12

1.3.3.1 Experimental autoimmune encephalomyelitis ................................... 12

1.3.3.2 Whole spinal cord homogenate-induced EAE ................................... 13

1.3.3.3 Induction of EAE using immunogenic peptides of myelin sheath

proteins ........................................................................................................... 13

1.3.3.4 Adoptive transfer ................................................................................ 14

Preface

viii

1.3.3.5 Transgenic mice ................................................................................. 14

1.3.3.6 Cuprizone-mediated demyelination ................................................... 14

1.3.3.7 Limitations of animal models for MS ................................................ 15

1.3.4 Immunopathology of MS .......................................................................... 15

1.3.4.1 CD4+ T cell-mediated pathology in MS/EAE .................................... 16

1.3.4.2 B cells and MS/EAE .......................................................................... 19

1.3.5 Current therapy for MS ............................................................................. 19

1.3.6 Summary ................................................................................................... 20

1.4 THE CLASS I PHOSPHOINOSITIDE 3-KINASE FAMILY .................. 20

1.4.1 Class I PI3Ks – Structure and expression ................................................. 21

1.4.2 Signalling events downstream of PI3Ks ................................................... 22

1.4.3 Negative regulation of PI3K activity ........................................................ 25

1.4.4 Methods of experimentally disrupting class I PI3K function ................... 26

1.4.4.1 Pan-PI3K inhibitors ............................................................................ 26

1.4.4.2 p110α, p110β and p110γ specific inhibitors ...................................... 27

1.4.4.3 P110δ-specific inhibitors .................................................................... 28

1.4.4.4 Knock-out and knock-out/knock-in mice ........................................... 28

1.5 P110α, P110β, P110γ AND THE PI3K REGULATORY SUBUNITS –

NORMAL FUNCTION AND INVOLVEMENT IN DISEASE ...................... 29

1.5.1 Studies targeting the PI3K regulatory subunits ......................................... 29

1.5.2 Class IA PI3Kα and PI3Kβ ....................................................................... 30

1.5.3 Class IB PI3Kγ .......................................................................................... 31

1.6 P110δ IN IMMUNOLOGY AND DISEASE ............................................... 32

1.6.1 p110δ and leukocyte migration ................................................................. 32

1.6.1.1 p110δ and migration of T and B cells ................................................ 32

1.6.1.2 p110δ and neutrophil migration ......................................................... 33

1.6.1.3 p110δ and migration of natural killer and mast cells ......................... 34

1.6.2 p110δ and cancer ....................................................................................... 34

1.6.3 The role of p110δ in Neutrophil function ................................................. 36

1.6.4 The role of p110δ in Mast cell-mediated allergic responses ..................... 36

1.6.5 The effect of p110δ on natural killer cell-mediated cytotoxicity .............. 37

1.6.6 The role of p110δ in dendritic cells ........................................................... 38

1.6.7 The role of p110δ in B cell activation and function .................................. 38

Preface

ix

1.6.8 The role of p110δ in T cell activation and function .................................. 40

1.6.9 Attenuating both p110δ and p110γ function ............................................. 41

1.7 HYPOTHESES AND AIMS OF THE STUDY ........................................... 43

CHAPTER 2: MATERIALS AND METHODS ......................................... 65

2.1 REAGENTS .................................................................................................... 67

2.1.1 General Solutions ...................................................................................... 67

2.1.1.1 Phosphate buffered saline (PBS) ........................................................ 67

2.1.1.2 PBS/Tween ......................................................................................... 67

2.1.1.3 ELISA coating buffer ......................................................................... 67

2.1.1.4 Mouse Red Cell Removal Buffer (MRCRB) ..................................... 67

2.1.1.5 Hank’s Balanced Salt Solution (HBSS) ............................................. 67

2.1.1.6 Standard isotonic Percoll (SIP) .......................................................... 68

2.1.1.7 Tail tip lysis buffer ............................................................................. 68

2.1.1.8 Tris Acetate-EDTA Buffer (TAE) ..................................................... 68

2.1.1.9 DNA loading buffer ........................................................................... 68

2.1.1.10 PBS/BSA/Azide for flow cytometery .............................................. 68

2.1.1.11 PBS/Azide for flow cytometery ....................................................... 68

2.1.1.12 1-4% Paraformaldehyde (PFA) ........................................................ 68

2.1.1.13 DNase solution for 5-Bromo-2'-Deoxyuridine (BrdU) labelling ..... 68

2.1.1.14 Annexin V staining buffer ................................................................ 69

2.1.1.15 1% acid alcohol ................................................................................ 69

2.1.1.16 Scott’s tapwater substitute................................................................ 69

2.1.1.17 Diethyl Pyrocarbonate (DEPC)-treated water .................................. 69

2.1.1.18 Gill’s haematoxylin .......................................................................... 69

2.1.1.19 Chemotaxis buffer ............................................................................ 69

2.1.2 Reagents used in vitro ............................................................................... 70

2.1.2.1 Antibodies .......................................................................................... 70

2.1.2.2 ELISA reagents .................................................................................. 70

2.1.2.3 Chemokines ........................................................................................ 70

2.1.2.4 Cytokines ........................................................................................... 70

2.1.3 Antigens and Adjuvants used in vivo ........................................................ 70

2.1.3.1 Myelin Oligodendrocyte Glycoprotein (MOG) peptide 35-55 .......... 70

Preface

x

2.1.3.2 Ovalbumin (OVA) 323-339 ............................................................... 71

2.1.3.3 Incomplete Freund’s Adjuvant (IFA) ................................................. 71

2.1.3.4 Complete Freund’s Adjuvant (CFA) .................................................. 71

2.1.3.5 Pertussis Toxin ................................................................................... 71

2.1.4 Inhibitors ................................................................................................... 71

2.1.4.1 LY294002 ........................................................................................... 71

2.1.4.2 IC87114 .............................................................................................. 72

2.1.4.3 Vehicle for IC87114 use in vivo ........................................................ 72

2.1.5 Cell culture media ..................................................................................... 72

2.1.5.1 Foetal calf serum ................................................................................ 72

2.1.5.2 Incomplete media ............................................................................... 73

2.1.5.3 Complete media .................................................................................. 73

2.1.5.4 BMDC media ..................................................................................... 73

2.2 ANIMAL MODELS ....................................................................................... 73

2.2.1 Mouse strains and conditions .................................................................... 73

2.2.2 Genotyping p110δ D910A/D910A mice ........................................................... 74

2.2.3 EAE Model ................................................................................................ 75

2.2.3.1 Active induction of EAE with MOG35-55 ........................................... 75

2.2.3.2 Clinical assessment of EAE ............................................................... 75

2.2.4 CFA immunisation .................................................................................... 75

2.2.5 In vivo administration of IC87114 ............................................................ 75

2.2.6 FITC paint assay ........................................................................................ 76

2.3 ANALYTICAL AND FUNCTIONAL ASSAYS ......................................... 76

2.3.1 Collection of tissues .................................................................................. 76

2.3.1.1 Collection of tail tips for genotyping ................................................. 76

2.3.1.2 Collection of mouse serum ................................................................. 76

2.3.1.3 Collection of mouse plasma ............................................................... 76

2.3.1.4 Preparation of single cell suspensions from lymphoid organs ........... 77

2.3.1.5 Collection of spinal cords for flow cytometry ................................... 77

2.3.1.6 Collection and storage of spinal cords for immunohistochemistry .... 78

2.3.1.7 Collection of bone marrow-derived dendritic cells ............................ 78

2.3.2 Flow cytometery ........................................................................................ 78

Preface

xi

2.3.2.1 Labelling cells with Carboxyfluorescin diacetate succinimidyl ester

(CFSE) ........................................................................................................... 78

2.3.2.2 Standard surface staining protocol ..................................................... 79

2.3.2.3 Intracellular cytokine staining ............................................................ 79

2.3.2.4 Intracellular BrdU staining ................................................................. 80

2.3.2.5 Intracellular FoxP3 staining ............................................................... 81

2.3.2.6 Annexin V and Propidium Iodide staining ........................................ 81

2.3.2.7 Flow cytometric analysis.................................................................... 82

2.3.3 Immunostaining of tissues ........................................................................ 82

2.3.3.1 Preparation of spinal cord sections .................................................... 82

2.3.3.2 Immunohistochemical staining of tissue sections .............................. 82

2.3.3.3 Haematoxylin staining ....................................................................... 83

2.3.4 Cell culture ................................................................................................ 83

2.3.4.1 Overnight culture of cells for chemotaxis assays ............................... 83

2.3.4.2 In vitro culture of immature dendritic cells from bone marrow......... 83

2.3.4.3 Maturation of BMDCs in vitro ........................................................... 84

2.3.4.4 Anti-CD3/anti-CD28 stimulated culture conditions .......................... 84

2.3.4.5 PHA stimulated culture conditions .................................................... 84

2.3.4.6 Th1-skewing culture conditions ......................................................... 85

2.3.4.7 Th17-skewing culture conditions ....................................................... 85

2.3.5 Proliferation assays ................................................................................... 86

2.3.5.1 Analysis of cell division ex vivo by CFSE dye dilution .................... 86

2.3.5.2 Detection of in vivo cellular proliferation by BrdU incorporation .... 86

2.3.6 ELISA ....................................................................................................... 87

2.3.6.1 Two-site (sandwich) ELISA for IgG detection .................................. 87

2.3.6.2 Two-site (sandwich) ELISA for cytokine detection .......................... 87

2.3.7 Transwell chemotaxis assays .................................................................... 88

2.3.7.1 Transwell chemotaxis assay with splenocytes ................................... 88

2.3.7.2 Transwell chemotaxis assay with dendritic cells ............................... 89

2.3.8 Dendritic cell antigen presentation assay .................................................. 89

2.3.9 GC/MS analysis of IC87114 in plasma ..................................................... 90

2.3.10 Statistical analysis ................................................................................... 90

Preface

xii

CHAPTER 3: CHARACTERISATION OF P110δD910A/D910A MICE AND

ANALYSIS OF EAE DISEASE PATHOGENESIS ................................... 99

3.1 OVERVIEW ................................................................................................. 101

3.2 CHARACTERISATION OF P110δD910A/D910A MICE ............................... 101

3.2.1 Genotyping of p110δD910A/D910A mice...................................................... 101

3.2.2 Surface marker expression on splenocytes from p110δD910A/D910A mice . 102

3.2.3 Chemotaxis of p110δD910A/D910A splenocytes towards homeostatic

chemokines ....................................................................................................... 102

3.3 DETERMINATION OF A FUNCTIONAL ROLE FOR P110δ IN

EAE ...................................................................................................................... 103

3.3.1 Effects of p110δ inactivation on EAE disease pathogenesis .................. 103

3.3.2 Heterozygous (p110δD910A/WT) mice develop EAE disease in the same

manner as wild-type C57BL/6 mice ................................................................. 104

3.4 ANALYSIS OF SPINAL CORD PATHOLOGY DURING EAE ........... 105

3.4.1 Immunohistochemical analysis of lesions in the spinal cords of

p110δD910A/D910A mice ....................................................................................... 105

3.4.2 Lesions in the spinal cords of p110δD910A/D910A mice .............................. 105

3.5 SUMMARY ................................................................................................... 105

CHAPTER 4: THE EFFECT OF P110δ INACTIVATION ON CELLS

OF THE IMMUNE SYSTEM DURING EAE .......................................... 125

4.1 OVERVIEW ................................................................................................. 127

4.2 PRIMING AND SURVIVAL OF CD4+ T LYMPHOCYTES IS

REDUCED IN P110δD910A/D910A MICE ............................................................. 127

4.2.1 CD4+ T lymphocytes in the draining lymph nodes of p110δD910A/D910A

mice display a more naïve phenotype than those from wild-type

counterparts ...................................................................................................... 127

4.2.2 There are fewer T effector memory cells in the draining lymph nodes of

p110δD910A/D910A mice throughout EAE ........................................................... 128

4.2.3 The ex vivo and in vivo proliferative response of p110δD910A/D910A CD4+ T

cells following stimulation with the neuroantigen MOG35-55 ........................... 128

4.2.4 Apoptosis is increased in CD4+ cells from p110δD910A/D910A mice ......... 130

Preface

xiii

4.3 B CELL ACTIVATION AND FUNCTION IS REDUCED IN

P110δD910A/D910A MICE DURING EAE ............................................................ 130

4.3.1 B220+ cells do not enter the central nervous system during EAE .......... 130

4.3.2 Antigen-specific antibody production does not occur in p110δD910A/D910A

mice throughout EAE ....................................................................................... 131

4.3.3 Apoptosis is increased in B220+ cells from p110δD910A/D910A mice at EAE

disease onset ..................................................................................................... 131

4.4 P110δ INACTIVATION DOES NOT AFFECT DENDRITIC CELL

MIGRATION OR ACTIVATION ................................................................... 132

4.4.1 Ex vivo migration of dendritic cells is not affected by p110δD910A/D910A

inactivation ....................................................................................................... 132

4.4.2 Migration of dendritic cells in vivo is not reliant on p110δ .................... 132

4.4.2 Dendritic cells from CFA-immunised p110δD910A/D910A mice display the

same phenotype as wild-type mice .................................................................. 133

4.5 T CELL DIFFERENTIATION TO T REGULATORY, TH1- AND TH17-

TYPES IS SIGNIFICANTLY REDUCED UPON P110δ

INACTIVATION ............................................................................................... 133

4.5.1 p110δD910A/D910A mice have fewer regulatory T cells in draining lymph

nodes at disease onset and peak disease time-points ....................................... 134

4.5.2 In vitro differentiation of CD4+ cells the Th1- and Th17- types is affected

by p110δ inactivation ....................................................................................... 134

4.5.3 Differentiation of CD4+ cells to the Th1-type throughout EAE is affected

by p110δ inactivation ....................................................................................... 135

4.5.4 p110δ is imperative for the development of Th17 cells in vivo during EAE

.......................................................................................................................... 135

4.5.5 There is a strong bias towards a Th1-type immune response in

p110δD910A/D910A mice ....................................................................................... 136

4.5.6 CNS infiltration of F4/80+ macrophages and Ly6G+ neutrophils is altered

in the absence of functional p110δ ................................................................... 136

4.6 SUMMARY .................................................................................................. 137

CHAPTER 5: INVESTIGATION INTO THE EFFICACY OF THE

P110δ INHIBITOR IC87114 AS A THERAPEUTIC FOR EAE ........... 175

Preface

xiv

5.1 OVERVIEW ................................................................................................. 177

5.2 CHARACTERISATION OF THE EFFECT OF IC87114 ON T CELL

DIFFERENTIATION IN VITRO ..................................................................... 177

5.2.1 The pan-PI3K inhibitor LY294002 reduces differentiation of naïve T cells

to the Th1-type ................................................................................................. 178

5.2.2 IC87114 treatment reduces differentiation of Th1 cells .......................... 178

5.2.3 LY294002 reduces Th17 cell differentiation .......................................... 179

5.2.4 CD4+ cell differentiation to a Th17-type is significantly impacted by

IC87114 ............................................................................................................ 179

5.3 IC87114 DOES NOT AFFECT DC FUNCTION ...................................... 180

5.3.1 IC87114 treatment does not affect DC migration ................................... 180

5.3.2 IC87114 treatment of DCs does not affect antigen processing and

presentation ...................................................................................................... 180

5.3.3 IC87114 treatment of responding OT-II cells inhibits proliferation in

response to antigen presentation by DCs ......................................................... 181

5.3.4 IC87114 is detectable in plasma following administration via oral

gavage ............................................................................................................... 181

5.3.5 IC87114 treatment does not affect DC activation following CFA

immunisation .................................................................................................... 182

5.4 IC87114 TREATMENT IN VIVO REDUCES CD4+ CELL

PROLIFERATION ............................................................................................ 182

5.4.1 IC87114 treatment in vivo reduces the ex vivo proliferative capacity of

naïve CD4+ cells ............................................................................................... 182

5.5 IC87114 ADMINISTRATION DURING EAE.......................................... 183

5.5.1 Preventative dosing of IC87114 to mice immunised with MOG35-55...... 184

5.5.2 Therapeutic dosing of IC87114 to mice immunised with MOG35-55 ...... 185

5.6 IC87114 TREATMENT IN VIVO DOES NOT AFFECT THE EX VIVO

PROLIFERATION OF CFA-ACTIVATED CD4+ T CELLS OR B220+ B

CELLS ................................................................................................................. 186

5.6.1 IC87114 treatment in vivo does not reduce ex vivo proliferation of CFA-

activated CD4+ T cells ...................................................................................... 186

5.6.2 In vivo IC87114 treatment does not reduce the ex vivo proliferative

capacity of CFA-activated B220+ cells ............................................................ 187

Preface

xv

5.7 SUMMARY .................................................................................................. 187

CHAPTER 6: DISCUSSION ...................................................................... 217

6.1 KEY FINDINGS .......................................................................................... 219

6.2 IMMUNE HOMEOSTASIS IN P110δD910A/D910A MICE .......................... 221

6.3 MIGRATION OF NAÏVE P110δ-INACTIVATED LYMPHOCYTES IN

RESPONSE TO HOMEOSTATIC CHEMOKINES ..................................... 222

6.4 THE ROLE OF P110δ IN EAE PATHOGENESIS .................................. 223

6.5 THE EFFECT OF P110δ INACTIVATION ON CD4+ T CELL

PRIMING, SURVIVAL AND DIFFERENTIATION .................................... 224

6.6 P110δ INACTIVATION AND B CELL FUNCTION .............................. 228

6.7 MACROPHAGES, NEUTROPHILS AND P110δ INACTIVATION .... 229

6.8 DENDRITIC CELL FUNCTION AND P110δ INACTIVATION .......... 230

6.9 FUTURE DIRECTIONS ............................................................................. 231

6.9.1 IC87114 dosing strategy ......................................................................... 232

6.9.2 Alternative EAE models ......................................................................... 233

6.9.3 p110δ attenuation and its impact on cells of the immune system ........... 236

6.10 CONCLUDING REMARKS .................................................................... 236

CHAPTER 7: REFERENCES .................................................................... 237

CHAPTER 8: APPENDIX 277

Preface

xvi

Table of Figures Figure 1.1: T cell differentiation. .............................................................................. 45

Figure 1.2: Proteins of the myelin sheath. ................................................................. 47

Figure 1.3: Immunopathology of multiple sclerosis. ................................................ 48

Figure 1.4: Chemical structure of membrane-anchored phosphatidylinositol. ......... 51

Figure 1.5: Class I PI3K catalytic and regulatory subunits. ...................................... 52

Figure 1.6: Class IA PI3K signalling. ....................................................................... 54

Figure 1.7: Class IB PI3K signalling. ....................................................................... 56

Figure 1.8: Negative regulation of PIP3. ................................................................... 58

Figure 1.9: Chemical structure of the PI3K inhibitors Wortmannin, LY294002 and IC87114. ..................................................................................................................... 59

Figure 3.1: Genetic characterisation of the p110δ knock-out/knock-in mutant mice .......................................................................................................................... 107

Figure 3.2: Surface phenotyping of lymphocytes from p110δD910A/D910A and wild-type mice .................................................................................................................. 108

Figure 3.3: Chemotaxis of p110δD910A/D910A splenocytes towards homeostatic chemokines ............................................................................................................... 113

Figure 3.4: Effects of p110δ inactivation on EAE pathogenesis ............................ 114

Figure 3.5: Mice heterozygous for the p110δ mutation develop EAE in the same manner as wild-type C57BL/6 mice ......................................................................... 119

Figure 3.6: Lesions in the spinal cord of mice immunised for EAE ....................... 120

Figure 4.1: Characterisation of CD4+ T lymphocytes in the draining lymph nodes of p110δD910A/D910A or wild-type mice throughout EAE. .............................................. 140

Figure 4.2: Effector memory T cells in the draining lymph nodes throughout EAE. ......................................................................................................................... 143

Figure 4.3: Ex vivo antigen-specific proliferation of encephalitogenic cells. ......... 144

Figure 4.4: Proliferation of CD4+ T cells in vivo following MOG35-55 immunisation. ........................................................................................................... 147

Figure 4.5: CD4+ T cells that lack p110δ undergo higher levels of apoptosis throughout EAE than wild-type cells. ...................................................................... 148

Figure 4.6: Reduced B cell infiltration of the CNS of p110δD910A/D910A mice. ....... 151

Figure 4.7: MOG35-55-specific IgG is not detectable in the serum of p110δD910A/D910A mice. ......................................................................................................................... 153

Figure 4.8: B220+ in the draining lymph nodes of mice without functional p110δ undergo higher levels of apoptosis than wild-type counterparts. ............................. 155

Preface

xvii

Figure 4.9: In vitro migration of BMDCs to CCL19 is not reliant on p110δ. ........ 156

Figure 4.10: Dendritic cell migration in vivo is not affected by genetic inactivation of p110δ.................................................................................................................... 158

Figure 4.11: Dendritic cell activation following CFA immunisation. .................... 161

Figure 4.12: Regulatory T cell generation is disrupted in p110δD910A/D910A mice at peak EAE disease. .................................................................................................... 162

Figure 4.13: Differentiation of cells from p110δD910A/D910A and wild-type mice ex vivo under Th1- and Th17-skewing culture conditions............................................ 164

Figure 4.14: Th17 responses are significantly reduced in p110δD910A/D910A mice. . 166

Figure 4.15: The autoimmune response in p110δD910A/D910A is skewed towards a Th1-type and away from the more pathogenic Th17-type. ...................................... 170

Figure 4.16: F4/80+ macrophage infiltration to the CNS is affected by p110δ inactivation. .............................................................................................................. 172

Figure 5.1: Inhibition of Th1-type cell differentiation and IFN-γ production and secretion by LY294002. ........................................................................................... 190

Figure 5.2: Inhibition of Th1-type cell differentiation and IFN-γ production and secretion by the p110δ inhibitor IC87114. ............................................................... 192

Figure 5.3: Inhibition of Th17-type cell differentiation and IL-17 production and secretion by LY294002. ........................................................................................... 194

Figure 5.4: Inhibition of Th17-type cell differentiation and IL-17 production and secretion by the p110δ inhibitor IC87114. ............................................................... 196

Figure 5.5: IC87114 does not affect BMDC migration towards CCL19 in vitro. .. 198

Figure 5.6: P110δ inhibition does not affect antigen uptake and presentation by dendritic cells. .......................................................................................................... 199

Figure 5.7: Functional p110δ is required for proliferation of OT-II CD4+ T cells in response to OVA-presentation by dendritic cells..................................................... 200

Figure 5.8: IC87114 is detectable in plasma following oral gavage. ...................... 201

Figure 5.9: IC87114 treatment in vivo does not affect DC activation .................... 202

Figure 5.10: IC87114 treatment results in reduced ex vivo proliferation of naïve T cells. ......................................................................................................................... 204

Figure 5.11: GC-MS analysis of IC87114 levels in the plasma of mice throughout the preventative EAE study. ..................................................................................... 207

Figure 5.12: IC87114 treatment of EAE-immunised mice with a ‘preventative’ dosing strategy. ........................................................................................................ 208

Figure 5.13: IC87114 treatment of EAE-immunised mice with a ‘therapeutic’ dosing strategy ..................................................................................................................... 210

Preface

xviii

Figure 5.14: IC87114 treatment in vivo does not result in reduced ex vivo proliferation of CFA-activated CD4+ T cells. .......................................................... 212

Figure 5.15: IC87114 treatment in vivo does not result in reduced ex vivo proliferation of CFA-activated B220+ B cells. ......................................................... 214

Figure 6.1: The role of p110δ in EAE 287

Preface

xix

List of Tables Table 1.1: Commonly used immunising antigens in EAE. ....................................... 60

Table 1.2: Spontaneous models of EAE ................................................................... 62

Table 2.1: Antibodies used in this study ................................................................... 92

Table 2.2: Chemokines used in this study ................................................................. 94

Table 2.3: Cytokines used in this study .................................................................... 95

Table 2.4: Inhibitors used in this study ..................................................................... 96

Table 2.5: Primers used in p110δD910A/D910A genotyping PCR .................................. 97

Preface

xx

Abbreviations ADP Adenosine di-phosphate

AML Acute myeloid leukaemia

APC Antigen presenting cell

APL Acute promyelocytic leukaemia

ARF ADP ribosylation factors

ARNO ARF nucleotide binding site opener

ATP Adenosine tri-phosphate

AV Annexin V

BBB Blood brain barrier

BCR B cell receptor

BD Becton Dickinson

BMDC Bone marrow-derived dendritic cell

BrdU 5-Bromo-2'-Deoxyuridine - Sigma

Btk Bruton’s tyrosine kinase

BSA Bovine serum albumin

CEF Chicken embryo fibroblast

CFA Complete Freund’s adjuvant

CFSE Carboxyfluorescin diacetate succinimidyl ester

CIA Collagen-induced arthritis

CNS Central nervous system

ConA Concanavalin A

CTL Cytotoxic T lymphocyte

DAG Diacyl glycerol

DC Dendritic cell

DEPC Diethyl Pyrocarbonate

DMSO Dimethyl sulfoxide

DNA-PK DNA-dependent protein kinase

DNP Dinitrophenyl

EAE Experimental Autoimmune Encephalomyelitis

Fab Fragment, antigen binding

Fc Fragment, crystalisable

Preface

xxi

FCS Foetal calf serum

fMLP N-formyl-methionyl-leucyl-phenylalanine

GAP GTPase-activating proteins

GDP Guanosine di-phosphate

GEF Guanine nucleotide exchange factors

GM-CSF Granulocyte macrophage – Colony stimulating factor

GPCR G protein-coupled receptor

GRP General receptor for phosphoinositides

GTP Guanosine tri-phosphate

HBSS Hank’s balanced salt solution

IFA Incomplete Freund’s adjuvant

IFN-γ Interferon gamma

IHC Immunohistochemistry

IKK IκB kinase

Ins(1,4,5)P3 Inositol(1,4,5)-trisphosphate

Itk Inducible T cell kinase

KO/KI Knock-out/knock-in

LPS Lipopolysaccharide

MBP Myelin basic protein

MHC Major histocombatability complex

MIP Macrophage inflammatory protein

MOG Myelin Oligodendrocyte Glycoprotein

MRCRB Mouse red cell removal buffer

mTOR Mammalian target of rapamycin

NK cell Natural killer cell

OVA Ovalbumin

PBS Phosphate buffered saline

PCR Polymerase chain reaction

PH Plekstrin homology

PI3K Phosphoinositide 3-kinase

PI Propidium iodide

PIPkins Proline-rich domain-containing inositol 5-phosphatase

kinases

Preface

xxii

PIP2 Phosphatidylinositol(4,5)-bisphosphate (PtdIns(4,5)P2)

PIP3 Phosphatidylinositol(3,4,5)-trisphosphate

(PtdIns(3,4,5)P3)

PKB Protein kinase B

PKC Protein kinase C

PLC Phospho-lipase C

PLCγ2 Phospholipase C gamma 2

PLP Proteolipid Protein

PMN Polymorphonucleocyte

PP-MS Primary progressive multiple sclerosis

PRR Proline rich region

PtdIns Phosphatidylinositol

PtdIns(4,5)P2 Phosphatidylinositol(4,5)-bisphosphate (PIP2)

PtdIns(3,4,5)P3 Phosphatidylinositol(3,4,5)-bisphosphate (PIP3)

PTEN Phosphatase and tensin homolog deleted on

chromosome ten

RA Rheumatoid arthritis

RR-MS Relapsing-remitting multiple sclerosis

RTK Receptor tyrosine kinase

SA Streptavidin

SHIP Src homology 2 domain containing inositol

polyphosphate phosphatase

SIP Standard isotonic Percoll

SP-MS Secondary progressive multiple sclerosis

TAE Tris Acetate-EDTA

TCR T cell receptor

Tc T cytotoxic cell

Tg Transgenic

Th T helper cell

TNF Tumour necrosis factor

Treg Regulatory T cells (CD4+/CD25+/FoxP3+)

Preface

xxiii

Preface

xxiv

Publications arising from this work

Manuscripts

Sarah Haylock-Jacobs*, Iain Comerford*, Scott Townley, Mark Bunting, & Shaun McColl. PI3Kδ is required for Th17 differentiation and the pathogenesis of experimental autoimmune encephalomyelitis. Manuscript submitted to The Journal of Immunology, January 2010. Adrian Liston, Rachel Kohler, Scott Townley, Sarah Haylock-Jacobs, Iain Comerford, Adriana Caon, Julie Webster, Jodie Harrison, Jeremy Swann, Iain Clark-Lewis, Heinrich Korner & Shaun McColl. Inhibition of Chemokine Receptor 6 (CCR6) function reduces the severity of experimental autoimmune encephalomyelitis via effects on the priming phase of the immune response, The Journal of Immunology, 2009, 182 (5), 1321-30. Rachel Kohler, Iain Comerford, Scott Townley, Sarah Haylock-Jacobs, Iain Clark-Lewis & Shaun McColl. Antagonism of the chemokine receptors CXCR3 and CXCR4 reduces the pathology of experimental autoimmune encephalomyelitis, Brain Pathology, 2008, 18(4), 504-16. Iain Comerford, Robert Nibbs, Wendell Litchfield, Mark Bunting, Yuka Harata-Lee, Sarah Haylock-Jacobs, Steve Forrow & Shaun McColl. The atypical chemokine receptor CCX-CKR scavenges CCL21 in vivo and suppresses experimental autoimmune encephalomyelitis by regulating T cell priming in the spleen. Manuscript submitted to Blood, January 2010. Iain Comerford*, Sarah Haylock-Jacobs*, Wendel Litchfield, Geoff Hill, Heinrich Korner & Shaun McColl. Uncoupled regulation of cell surface CCR6 expression and IL-17 production by type 17 CD4+ and CD8+ T cells. Manuscript in preparation. Manuela Klingler-Hoffmann, Julie Brazzatti, Erik Procko, Adriana Caon, Sarah Haylock-Jacobs, Angel Lopez, Mark Guthridge, Reinhard Wetzker & Shaun McColl. Essential roles of p101 in cell migration. Manuscript in preparation.

Preface

xxv

Conference proceedings

2009: Oral presentation at the Australasian Immunology Retreat (Adelaide, Australia). Title: PI3Kδ is important for Th17 generation and EAE

2009: Poster presentation at the Australasian Society for Medical Research

conference (Adelaide, Australia). Title: Activity of the catalytic subunit of PI3Kδ is required for the pathogenesis of experimental autoimmune encephalomyelitis

2008: Poster presentation at the Australasian Society for Immunology

Annual Scientific Meeting (Canberra, Australia). Title: Activity of the catalytic subunit of PI3Kδ is required for the pathogenesis of experimental autoimmune encephalomyelitis

2008: Oral presentation at the Australasian Immunology Retreat (Adelaide,

Australia). Title: Investigating the role of p110δ in EAE

2008: Poster presentation at the Canadian Society for Immunology

conference (Montreal, Canada). Title: The role of chemokine receptor CCR7 in experimental autoimmune encephalomyelitis

2007: Oral presentaion at the third Adelaide Immunology Retreat (Adelaide,

Australia). Title: Investigating the role of PI3Kδ in experimental autoimmune encephalomyelitis

2006: Oral presentaion at the second Adelaide Immunology Retreat

(Adelaide, Australia). Title: Investigating the role of p101/PI3Kγ in cell migration

2005: Poster presentation at the Australasian Society for Immunology

Scientific Meeting (Melbourne, Australia). Title: The role of chemokine receptor CCR7 in experimental autoimmune encephalomyelitis

Preface

xxvi

Preface

xxvii

Abstract Through its role in cells of haematopoietic origin, the class IA phosphoinositide 3-

kinase delta (PI3Kδ) has a significant impact on both the cell-mediated and innate

arms of the immune system. The catalytic protein subunit of PI3Kδ, p110δ, has been

implicated in leukocyte activation and survival, Th1 and Th2 differentiation as well

as the development of autoimmunity in a model of rheumatoid arthritis. While the

impact of p110δ inactivation in vitro is becoming clearer, the precise role that p110δ

plays in vivo remains poorly understood, particularly in regard to Th17

differentiation and models of autoimmunity. Here, using mice that express a

catalytically inactive form of p110δ (p110δD910A/D910A mice) it is shown that

functional p110δ is required for full expression of experimental autoimmune

encephalomyelitis (EAE), a Th17-dependent model of the human autoimmune

disease multiple sclerosis (MS). In p110δ-inactivated mice, T and B cell activation

and function during EAE were markedly reduced, and fewer T and B cells were

observed in the central nervous system (CNS) throughout disease. Th17 cell

generation was demonstrably more dependent on p110δ than was the Th1 response.

The decrease in T cell activation was not due to a defect in dendritic cell (DC)

function because p110�-inactivated DCs migrated, became activated and presented

antigen normally. However, there was a significant increase in the proportion of T

and B lymphocytes undergoing apoptosis at early stages of EAE. Due to the

promising findings observed in the p110δD910A/D910A mice, the ability of the p110δ

inhibitor, IC87114, to reduce EAE pathogenesis was investigated. While IC87114

was shown to be a potent inhibitor of Th1 and Th17 activation and differentiation in

vitro, administration of this compound failed to reduce EAE disease under the dosing

regimen used. Despite this, these findings indicate that p110δ plays an important role

in the development of IL-17-dependent inflammation and suggest that small

molecule inhibitors for p110δ may be useful therapeutics for the treatment of IL-17-

driven pathologies.

��

CHAPTER 1

Introduction

��

CHAPTER 1: Introduction

2

This page left blank intentionally.


3

1.1 OVERVIEW

The immune system serves to guard against pathogens and cancers whilst

maintaining tolerance to symbiotic flora and self-antigens. Efficient function of the

immune system involves a milieu of factors that cells require for processes such as

growth, metabolism, activation, proliferation, differentiation, adhesion, motility,

phagocytosis, effector function and survival. These include both extracellular stimuli

and intracellular signalling events. Failures in any of the processes involved in the

normal function of the immune system can result in opportunistic infections, chronic

inflammation, tumours or autoimmunity.

One autoimmune disease that arises following immune deregulation is multiple

sclerosis (MS). Intensive efforts have been devoted to further understanding the

mechanisms that govern immune activation and subsequent CNS damage in MS,

however there is much that is yet to be elucidated. Significant efforts are also

focussing on the development of new therapies for MS patients.

A group of proteins that is a potential target for MS therapy is the phosphoinositide

3-kinase (PI3K) family. These proteins become activated downstream of cognate

receptor ligation by peptides such as cytokines, growth factors and chemokines.

PI3Ks are also implicated in signalling through antigen receptors. PI3Ks have been

directly linked to processes such as insulin signalling and many facets of normal

immune system function, and have also been shown to play an important role in a

number of different pathologies including allergic inflammatory responses, cancer

and autoimmunity (1-10).

In this study, the function of a specific PI3K, PI3Kδ, is investigated using a murine

model for MS, experimental autoimmune encephalomyelitis (EAE). This research is

conducted with the aim of better understanding the intracellular signalling processes

that govern leukocyte activation in autoimmune disease, as well as to investigate

whether the PI3Kδ signalling pathway may be a useful therapeutic target in

autoimmune diseases.


4

1.2 FACTORS GOVERNING THE NORMAL IMMUNE RESPONSE

In as much as there are many different types of immune responses that are activated

following different immunological challenges, there are also many factors governing

these responses. Firstly, proper development of all of the immune cell types is

important to ensure availability of the full repertoire of cells involved in immunity.

Secondly, normal homeostasis within secondary lymphoid organs and basal

surveillance of peripheral tissues for pathogens is necessary. Lastly, efficient innate

and cell-mediated/humoral responses, which involve many different cell types, are

required for efficient clearance of antigens, tumours and pathogens such as bacteria

and viruses. Innate immunity describes the antigen-nonspecific, and often initial, host

defences which include physiological barriers as well as inflammatory cells. Cell-

mediated/humoral immunity, driven by T and B lymphocytes, is the antigen-specific

host immune response. These immune responses are complex and involve a wide

variety of cell stimuli and intracellular signalling events. Disruption or dysregulation

of any of these events can have profound effects on the overall efficiency of the

immune system. There are many different processes and cell types that underlie both

the humoral and cell-mediated immune responses, and several that are relevant to

this thesis are discussed further here.

1.2.1 Cells of the immune system

A number of different cell types make up the immune system. These include the B

and T lymphocytes, neutrophils, macrophages, monocytes, basophils, eosinophils

and mast cells. Lymphocytes are required for the generation of antigen-specific cell-

mediated/humoral immune responses and allow the development of immunologic

memory. Non-specific innate cellular immunity is performed by the other cell types

listed above. In addition to this, antigen-presenting cells (APCs) such as DCs are

required for efficient activation of the adaptive immune system.

1.2.1.1 T lymphocytes

T lymphocytes arise in the bone marrow and mature in the thymus. Each T cell

expresses a unique antigen-binding receptor, the T cell receptor (TCR), which

recognises antigenic peptides bound to major histocompatability complex (MHC)


5

molecules on the surface of APCs. Three major sub-populations of T cells have been

recognised; T helper (Th) cells, T cytotoxic (Tc) cells and T regulatory (Treg) cells

(11-15). T helper cells generally express the CD4 membrane glycoprotein and

recognise exogenous processed antigen presented by MHC class II, whereas T

cytotoxic cells generally express the CD8 membrane glycoprotein and recognise

endogenous antigen presented by MHC class I. Regulatory T cells, whose normal

function involves maintenance of tolerance, normally express CD4 membrane

glycoproteins. These CD4 or CD8 membrane glycoproteins act as co-receptors and

enhance TCR signalling. Efficient stimulation of T cells also requires co-stimulation

of another membrane-anchored glycoprotein, CD28, by CD80 or CD86 on the

surface of APCs (16).

When activated, T helper cells produce a variety of cytokines and chemokines which

assist in the activation of other immune cell types and their recruitment to sites of

infection. T helper cells, of which there are three well-defined types (Th1, Th2 and

Th17), also help drive specific types of immune responses according to the cytokines

they produce. Th1 cells produce high levels of the cytokines IL-2, IFN-γ and TNF-α

and are responsible for functions such as delayed-type hypersensitivity and activation

of CTLs (17-19). Th2 cells secrete high levels of IL-4, IL-5, IL-10 and IL-13 and are

responsible for allergic reactions and humoral immunity by providing help to B cells

(17, 18, 20-23). Th17 cells produce IL-17 and IL-23 and, while their function is less

well-defined than Th1 and Th2 cells, they are thought to be important for immunity

against bacteria and fungi (24-28). They are also believed to drive the severe

pathology observed in many autoimmune disorders (12, 29-34). T helper cell

differentiation is discussed in more detail in section 1.2.2.

Cytotoxic T lymphocytes (CTLs) do not produce as many cytokines as Th cells, but

instead function to induce cell-death in altered self-cells such as tumour cells, foreign

tissue grafts and virus-infected cells (35, 36).

Regulatory T cells, which produce the cytokine IL-10, are responsible for the

maintenance of peripheral tolerance to both self-antigens and symbiotic intestinal


6

flora and also aid in the regulation of T cell numbers during immune responses (37,

38). Breakdown of Treg function often results in autoimmunity (19). Treg cells are

generally defined as CD4+/CD25+ cells that express the forkhead transcription factor

FoxP3 (39-43).

T cell activation results in not only proliferation and differentiation of T cells to

effector Th or CTLs, but also to central memory T cells (44). Unlike the effector T

cells produced in response to infection, these cells survive long-term in the host. If

the host is re-exposed to the antigen then central memory T cells undergo rapid

expansion and differentiation resulting in the generation of a faster cell-mediated

immune response.

1.2.1.2 B lymphocytes

B cells mature in the bone marrow before moving to the peripheral secondary

lymphoid organs. Like T cells, B cells also express a unique antigen binding

receptor, the B cell receptor (BCR). The BCR is a membrane bound antibody

molecule which consists of an Fc (‘fragment, crystalisable’) fragment which is bound

by disulphide bonds to an antigen-specific Fab (‘fragment, antigen-binding’)

fragment. B cell activation occurs when the BCR comes into contact with cognate

antigen. It can be stimulated by T cell-dependent or T cell-independent antigens. T

cell-dependent antigen-mediated stimulation of B cells requires direct contact

between B and T cells and stimulation of B cells by T cell-produced cytokines and

relies on the ability of B cells to present antigen to T cells via MHC Class II (45, 46).

T cell-independent activation of B cells occurs when B cells encounter thymus-

independent antigens, particularly bacterial proteins such as lipopolysaccharide

(LPS) (45, 47).

Upon activation, B cells proliferate and differentiate into B memory cells (which,

like T memory cells, are long-lived cells which afford rapid secondary immune

responses) and Plasma cells which secrete high levels of antigen-specific antibody.

The humoral immune response, which is driven by B cells, is therefore characterised

by high levels of antibody in the plasma, lymph fluid and tissues. Antibodies then


7

bind cognate antigen, resulting in a number of outcomes including complement

activation, opsonisation and neutralisation. Different isoforms of antibody are

produced depending on the antigen and infection usually results in B cell isotype

class-switching from initial IgM responses to the production of isotypes with

different spatial characteristics and modes of action (48-50).

1.2.1.3 Dendritic cells

DCs are APCs which can be found in most areas of the body such as in the skin,

tissues, blood and secondary lymphoid organs. There are a number of different types

of DCs and their identification can be difficult. Most relevant to this study are

migratory DCs such as the Langerhans cells. These DCs reside in the epidermis and

mucous membranes and, upon exposure to antigen, mature and traffic to the

secondary lymphoid organs where they present antigen, most commonly in the

context of MHC II, to T helper cells (51, 52). They express MHC class II and up-

regulate co-stimulatory molecules upon activation, making them highly efficient

APCs. They also express high levels of CD11c. Langerhans cells are the most potent

of the ‘professional APCs’ and are crucial for priming the adaptive immune

response.

1.2.1.4 Macrophages

Macrophages are mononuclear cells whose primary function is to ingest and degrade

(phagocytose) both external (e.g. microorganisms) and internal (e.g. dead cell debris)

antigens. Opsonisation of antigens such as bacteria by B cell-produced antibodies

enhances this process as the Fc region of antibodies can be bound by Fc receptors on

the macrophage. In addition to their phagocytic function, macrophages can also

induce antimicrobial and cytotoxic mechanisms through oxygen-dependent and

oxygen-independent killing mechanisms as well as through complement (53, 54).

They are also one of the ‘professional APCs’ and can present antigen to T helper

cells via MHC II on their cell surface. Macrophages typically express high levels of

the cell marker F4/80.


8

1.2.1.5 Neutrophils

Neutrophils are granulocytes that are early mediators of the immune response to

pathogens such as bacteria. Due to their multi-lobed nucleus they are often referred

to as polymorphonuclear leukocytes (PMNs). Neutrophils, like macrophages, are

phagocytic cells that also use oxygen-dependent and -independent mechanisms to

perform their antimicrobial function (55-57). These cells typically express high

levels of the cell marker Ly6G. Due to the high number of circulating neutrophils in

the blood, and the ease of isolating these cell types, neutrophils have been commonly

used to investigate processes such as leukocyte trafficking.

1.2.2 T helper cell differentiation

T cell differentiation is complex and requires a milieu of stimulating factors and a

number of intrinsic processes. Upon ligation of the TCR, as well as co-stimulation of

CD28 (without which T cells generally become anergic (58)), T cells rapidly

proliferate and begin producing cytokines (59, 60). Cytokine stimulation of T cell

subsets results in up-regulation of disparate transcription factors (depending on the

stimulating cytokine) and subsequent production of a cytokine signature for that

subset. This is described in more detail below. A schematic diagram of T helper cell

differentiation is shown in Figure 1.1.

1.2.2.1 Th1 and Th2 differentiation

Th1 and Th2 cells drive cell-mediated and humoral immune responses respectively.

While Th1 and Th2 cells are both activated following stimulation of the TCR by

antigen presented on MHC II, different cytokines produced by the APC stimulate the

naïve T cell to up-regulate expression of different transcription factors, thus resulting

in directed differentiation. In the case of Th1 cells, TCR-induced activation along

with stimulation with the cytokine IL-12 ultimately results in upregulation of the

transcription factor T-bet (61). Th2 differentiation is regulated by stimulation with

the cytokine IL-4 and up-regulation of the transcription factor GATA-3 (20-23).

Expression of these transcription factors ultimately results in production of T helper

cell type-specific cytokines (i.e. IL-2, IFN-γ and TNF-α by Th1 cells and IL-4, IL-5,

IL-10 and IL-13 by Th2 cells) and differential effector function.


9

1.2.2.2 Th17 and Treg differentiation

Th17 cells typically produce high levels of the pro-inflammatory cytokine IL-17 and

require stimulation by the cytokines TGF-β, IL-6, and IL-1β, as well as expression of

the transcription factor RORγt, for their differentiation and activation (29, 31-34). Of

these cytokines, IL-6 seems to be the most important. Without IL-6, TGF-β-induced

differentiation results in the generation of Treg cells. While IL-23 is not required for

Th17 differentiation per se, it is necessary for sustained survival and expansion of

the Th17 cell type (32, 33).

Treg cells express CD4, CD25 and have high expression of the transcription factor

FoxP3 (39-43, 62). They are reliant on TGF-β stimulation and FoxP3 expression for

differentiation. However exposure to IL-6 in the presence of TGF-β drives cells away

from the Treg-type to the Th17 cell type (63).

Unlike Th1 and Th2 differentiation, which is thought to be relatively finite, it has

been demonstrated that there is plasticity in Th17 and Treg cell differentiation (15).

For example, Treg cells can be induced to produce cytokines typical of Th17 cells

(64-67) and both Treg and Th17 cells can be induced to express cytokines more

typical of Th1 and Th2 cells (68-71). This kind of plasticity has not been observed in

Th1 and Th2 cell types (15, 65). The consequences and prevalence of these

phenomena in vivo are not yet clear.

1.3 INFLAMMATION OF THE CENTRAL NERVOUS SYSTEM

The CNS includes the brain, optic nerves and spinal cord and provides the body with

the nervous signals vital for life. It is thought that the CNS may be an immuno-

privileged site and that trafficking of immune cells through the healthy CNS is

limited and therefore they are rarely exposed to CNS-specific antigens (72-74).

Despite this, autoimmunity of the CNS can occasionally occur. In these cases, a

CNS-specific, cell-mediated, immune response is initiated, such as that observed in

MS patients. The following sections provide an overview of the healthy CNS, the

possible causes of MS, the experimental animal models of MS employed in research

and the immunopathology and current treatments for the disease.


10

1.3.1 The healthy central nervous system

The CNS is separated from the periphery by a number of barriers, including the

blood brain barrier (BBB) which exists to provide a physical barrier and restrict the

passage of cells, pathogens and some chemical compounds to the CNS from the

periphery. Within the CNS are neurons, which conduct nervous impulses, and at least

four different types of glial cells. Oligodendrocytes are responsible for the

production of myelin which is a lipid and protein layer that surrounds neuronal axons

and affords rapid nervous conduction. The myelin sheath is made up of several

proteins (including myelin oligodendrocyte glycoprotein (MOG), myelin basic

protein (MBP) and proteolipid protein (PLP)) and is schematically shown in Figure

1.2. Microglia function in a similar way to macrophages and are responsible for

immune surveillance within the CNS. Astrocytes are responsible for synaptic

maintenance, the integrity of the BBB and the regulation of extracellular pH and K+

levels. The functions of the CNS-specific ependymal cells are not yet clear. In a

healthy CNS, these cell types all work in concert to protect, regenerate and maintain

the CNS environment and allow efficient neuron function.

1.3.2 Multiple Sclerosis

Multiple sclerosis is a debilitating disorder of the CNS that affects approximately 2.5

million people worldwide (National MS Society, USA). The clinical manifestation

usually begins in young adulthood (75). The symptoms of the neurological damage

that underlies MS vary widely between patients but generally include impairment of

motor, sensory and/or cognitive function. Episodes and physical symptoms are

unpredictable but often include fatigue, numbness and visual disruption and can

progress to more severe paralysis. A slow deterioration of each individual’s

capabilities is generally observed. Most cases (~85%) of MS begin with a relapsing-

remitting (RR-MS) disease course where patients suffer acute relapses, interspersed

with periods of little disease activity, before developing a more steady neurological

degeneration later in life (termed secondary progressive MS (SP-MS)) (76, 77).

While most patients present with the RR-MS type, 10-20% of patients initially

develop the primary progressive (PP-MS) chronic disease course which is normally


11

more typical of later stages of disease. PP-MS patients display continued and chronic

neurological damage and physiological symptoms.

The mechanism of MS pathology is still under investigation. However, it is clear that

there are several steps that result in disease. Symptoms arise because an

inappropriately activated immune system, particularly (although not exclusively) T

and B cells, results in destruction of the myelin sheath which insulates neuron axons

and affords rapid nervous conduction (77-79). Once the immune system is

inappropriately activated, antigen-specific and non-specific leukocytes infiltrate the

CNS in response to chemokines and cytokines and further contribute to the damage

(77, 80). The immunopathology of MS, and the cell types involved, are further

discussed in section 1.3.4.

While the aetiology of MS is yet to be elucidated, there are clear genetic elements to

the disease. MS is prevalent in Caucasians (affecting 0.05-0.15% of the Caucasian

population) and is more common in women than men. It is rarely observed in

individuals of African or Asian descent, even in areas of high MS prevalence (81,

82). Studies of family members of MS patients have revealed that blood relatives

have a higher incidence of the disease, whereas non-blood relatives have the same

MS prevalence as the general population, indicating that there is an element of

genetic predisposition (83). Several genes, such as IL7R, IL2RA, CLEC16A, CD226,

KIF1B and TYK2, have been identified as potentially being involved in MS

susceptibility and severity (84-93). However, the MHC class II encoding DR15 locus

is the most consistently associated with MS (84, 94-96), providing strong support not

only for the genetic basis of MS, but also for the autoimmune nature of the disease.

Future studies are expected to cast further light on the role that genetics plays in MS

development.

In addition to the genetic element in MS aetiology, environmental factors are thought

to play a role. MS is more prevalent in temperate climates (97) and viral infections

have been demonstrated to be associated with MS relapses (98). An ‘MS epidemic’

in the Faroe Islands, where MS was unknown before the 1940s, followed the arrival


12

of British troops at this time (99), indicating that that there may be some kind of

communicable element that contributes to MS (even though MS is not an infectious

disease). Viral proteins that are similar to self proteins found exclusively in the CNS

may be able to stimulate the immune system to generate a response against the self

proteins via a process known as molecular mimicry. Several studies have implicated

different pathogens that may contribute to virus-induced, CNS-specific immune cell

activation, however as yet there is little firm evidence to implicate any of these in

causing MS (100-102). It is known that almost all MS patients have had prior

exposure to Epstein-Barr virus (103) and this virus is consistently associated with

MS (104-107). However, the mechanism of any link between MS and Epstein-Barr

virus remains unclear.

1.3.3 Animal models of multiple sclerosis

While there are established links between genetic and environmental factors in MS, it

is still unknown how and why the cells of the immune system become activated and

attack the CNS. It is also possible that CNS damage plays a role by exposing CNS-

specific proteins to the immune system. While studies are ongoing, research into MS

pathology is currently limited as samples of diseased CNS are not easily accessible.

Tissues from deceased individuals usually show advanced clinical manifestations and

therefore do not give a detailed representation of all phases of the disease. While

modern imaging techniques, such as magnetic resonance imaging (MRI), allow

visualisation of the CNS, they do not afford differentiation of the cellular make-up of

MS lesions. Most cellular research in MS patients has therefore been performed

using blood or cerebrospinal fluid (CSF) samples. These studies also only provide a

limited ‘snapshot’ of MS pathology. Animal models have been developed to

circumvent these issues.

1.3.3.1 Experimental autoimmune encephalomyelitis

The most commonly used model for multiple sclerosis is EAE. Various EAE models

share clinical and histopathologic similarities to MS. EAE is induced in susceptible

strains of animals (most commonly mice and rats) by immunising with whole spinal

cord homogenate or a neuroantigen emulsified in adjuvant. The neuroantigens are


13

either immunogenic peptides or neuro-proteins that are part of the myelin sheath (see

Figure 1.2). The result of this immunisation is an ascending paralysis that displays

either a chronic or remitting-relapsing disease course (depending on the strain of

animal and immunogen used). There are several benefits of this experimental model.

EAE is a robust, inducible, affordable and time-efficient model that allows research

into the underlying causes of neuroinflammation. Details of antigenic

proteins/peptides used to induce EAE and susceptible animal strains are shown in

Table 1.1 and several are described further below.

1.3.3.2 Whole spinal cord homogenate-induced EAE

Initial development of an animal model that had similarities to MS in humans arose

following the observation that infection with CNS-infecting viruses (such as

smallpox and measles) or treatment with rabies vaccine (that was generated by

infecting rabbits before immunising humans with rabbit spinal cord emulsions) often

resulted in neurological complications. It was speculated that the exposure of the

peripheral immune system to CNS-specific antigens was resulting in the

development of a self-reactive immune system and consequent neurological damage

(108-112). Subsequent studies, where several strains of animals were injected with

CNS homogenate and were observed to develop neuroinflammation, lead to the

development of EAE as a model for MS (113-115). The addition of complete

Freund’s adjuvant (CFA) to the immunising emulsion enhanced the susceptibility of

immunised animals to neurodegeneration (116). This method of inducing EAE has

since been demonstrated to result in the activation of the immune system against a

variety of myelin sheath antigens (Table 1.1).

1.3.3.3 Induction of EAE using immunogenic peptides of myelin sheath proteins

Several animal strains have been demonstrated to be highly-susceptible to EAE

induced by a number of myelin sheath epitopes (Table 1.1). However, the

immunogenicity of each epitope varies greatly between animal strains. The myelin

proteins that are most commonly utilised to actively induce EAE are MOG, MBP

and PLP (117). Numerous peptides of each of these proteins have been demonstrated

to be immunogenic in rats and mice (Table 1.1). Immunisation of C57BL/6 mice


14

with MOG35-55 results in an ascending paralysis that follows a chronic disease course

which is similar to the later progressive phases of MS (118). Immunisation of SJL/J

or Biozzi ABH mice with PLP or MOG antigens induces a remitting-relapsing form

of EAE, thus allowing more specific research in to the remission and relapse phases

of the disease (119, 120). Different methods of EAE induction can therefore allow

research into disparate phases and mechanisms of MS/EAE.

1.3.3.4 Adoptive transfer

Adoptive transfer of EAE involves priming donor animals by immunising with

myelin antigens, isolating and re-stimulating lymphocytes prior to transferring them

to non-immune recipient animals (118-131). Recipient animals typically begin

showing signs of ascending paralysis within a week after transfer. This transfer

process allows the study of the effector, trafficking, demyelination and relapse

phases of the attack on the CNS independently of the priming phase of the immune

response.

1.3.3.5 Transgenic mice

A limited number of mice have been generated which have TCRs that are specific for

myelin epitopes (Table 1.2). These animals can develop EAE spontaneously

(incidence range of 20-100% of animals), depending on the strain and genetic

manipulation of the animal (117). These animals have proven useful for the study of

factors involved in the development of autoimmunity without exogenous

manipulation. Humanised transgenic animals carrying human myelin-specific TCRs

and multiple sclerosis-associated MHC class II molecules have also afforded

research into human immune mechanisms in an in vivo context (94, 95, 132).

1.3.3.6 Cuprizone-mediated demyelination

Another method of inducing an MS-like pathology is by oral administration of the

copper chelator cuprizone (bis-cyclohexanone-oxaldehydrazone). This results in

copper deficiency and demyelination, and is used as a model of the demyelination

that is observed in the white matter during MS (133). Following administration of

cuprizone to C57BL/6 mice, oligodendrocytes are ablated and microglia, along with


15

peripheral macrophages, phagocytose myelin in the CNS. The BBB remains intact

throughout the disease course. Removal of cuprizone from the diet results in

remyelination and recovery from the disease. This model therefore allows the study

of demyelination independently of antigen-specific immune cell responses and

affords investigation into the molecular mechanisms of remyelination in the CNS.

1.3.3.7 Limitations of animal models for MS

Despite the plethora of knowledge that in vivo animal experimentation has generated,

as with most disease models there are limitations in how this knowledge can be used

to advance treatment of the equivalent human disease (108, 134, 135). Several

successful MS therapies have been devised from animal studies. These include

Copaxone (galtiramer acetate) (136), Mitoxantrone (137) and Natalzumab (138).

Despite this, many have also failed. Interpretation of actively-induced EAE data

therefore requires consideration of the differences between animal and human

immune systems, particularly when proposing new human therapeutics.

1.3.4 Immunopathology of MS

A particular challenge for researchers studying and medical professionals treating

MS is that the disease rarely follows a predictable course. While patients can

generally be categorised with respect to whether they have RR-MS or PP-MS, it is

impossible to predict the neurological outcomes of their disease. As described above,

several models are available for MS research and each allows study into different

phases and types of MS-like disease. These models, as well as samples and imaging

from MS patients, have afforded a wider understanding of the immunopathology that

causes demyelination, prevents remyelination and underlies MS disease.

There are a number of steps required for the development of neuroinflammation. The

BBB, which normally protects the CNS from an influx of peripheral leukocytes,

must become permeable (139). Whether this occurs before or after the activation of

neuroantigen-specific lymphocytes remains unclear. However, once the BBB is more

permeable, an influx of antigen-specific and non-specific cells occurs, mediated by

the production of pro-inflammatory proteins such as cytokines and chemokines. In


16

fact, many different cytokines and chemokines have been implicated in EAE disease

progression (140-167). This cellular infiltration results in demyelination,

oligodendrocyte death and axon loss which are the processes that underlie the

neurological manifestations observed in MS.

Many different blood-derived cell types have been implicated in MS/EAE

pathogenesis. These include neutrophils (168, 169), macrophages (168-171), mast

cells (172-174), natural killer (NK) cells (175-179) and CD8+ T cells (123, 171, 180-

185). In addition, activation of microglia in the CNS further exacerbates CNS

damage (186). However, the most important cell types in MS/EAE pathology are

CD4+ T cells and B cells (29, 33, 115, 127, 150, 151, 155, 156, 158, 159, 162, 164,

187-191). A schematic diagram of MS/EAE immunopathology in shown in Figure

1.3. In addition, the role of T and B cells in MS/EAE pathology is further discussed

below.

1.3.4.1 CD4+ T cell-mediated pathology in MS/EAE

CD4+ T cells were first described as the driving force behind EAE pathology after

their isolation from MBP-immunised Lewis rats and adoptive transfer resulted in the

development of classical EAE in recipient animals (187). It has since been

demonstrated that rodents, primates and humans possess potentially autoagressive T-

cell clones, where the TCR is specific for myelin sheath proteins like MBP (192,

193). However, the method of activation of autoreactive T cells is currently unclear.

As mentioned, these T cells may be activated due to molecular mimicry by infecting

pathogens. Alternatively, damage to the CNS may result in exposure of peripheral

autoreactive T cells (which would not normally traffic through the CNS) to

neuroantigens, resulting in their subsequent activation. There is a plethora of

published research that describes the role of CD4+ T cells in MS/EAE (34, 150, 151,

155, 156, 158, 159, 162, 164, 175). Several specific subsets of CD4+ T cells have

been implicated in MS/EAE pathology. These include Th1, Th17 and Treg cells, all

of which can be derived from naïve T cells (Figure 1.1 and section 1.2.2).


17

Interferon gamma (IFN-γ)-producing, IL-12-driven, CD4+ Th1 cells have been

widely implicated in MS/EAE pathogenesis. In fact, until fairly recently Th1 cells

were the main cell type thought to be responsible for driving the autoimmune

response in these diseases. This was primarily due to the fact that high levels of IFN-

γ and TNF-α are expressed by encephalitogenic cells and these Th1-type cytokines

are also expressed in the CNS of mice with EAE (155, 162, 163). However, despite

the initial findings implicating Th1-type cells in EAE, it is now apparent that this cell

type is unlikely to be the main cause of the disease. Several studies have

demonstrated that knock-out of proteins or receptors thought to be classical

determinants of Th1 differentiation and function (such as IL-12, IL-18 and IFN-γ)

resulted in enhanced, not reduced, EAE pathogenesis (151, 157, 194-198).

The recent discovery of Th17 cells has resulted in a paradigm shift in regards to the

primary cell type that is responsible for the severe pathogenesis observed in

MS/EAE. Th17 cells have been implicated in autoimmune conditions including

rheumatoid arthritis (RA) (30, 159, 199, 200) and inflammatory bowel disease (201-

204) and Th17 cells have also been demonstrated to play an important role in the

mediation of autoimmune inflammation of the CNS during EAE (34, 150, 151, 156,

158, 159). Studies have demonstrated that Th17 cells, more than Th1 cells, are

necessary for the development of severe EAE pathology. Mice without a functional

IL-12 receptor develop EAE, whereas EAE pathogenesis is reduced when mice are

administered antibodies that neutralise IL-17 (154). Adoptively transferred Th17

cells are also more efficient at initiating severe EAE pathology in recipient mice than

Th1 cells (159), however it has also been demonstrated through adoptive transfer

EAE studies that while both Th1 and Th17 cells can drive EAE, neither can establish

the same neurological damage without some cooperation from the other cell type

(154, 156, 160). The ratio of Th17 to Th1 cells also appears to determine lesion

distribution in the CNS; a high Th17:Th1 ratio results in increased brain pathology

and severe EAE disease compared with a lower Th17:Th1 ratio (165). These data

indicate that, while both Th1 and Th17 cells are required for complete EAE

pathogenesis, it is Th17-driven autoimmunity that is responsible for the severe

disease phenotype observed in EAE.


18

While many aspects regarding the role of Th17 cells in MS are yet to be elucidated, it

has been demonstrated that MS patients have higher levels of IL-17 in lesions and

the CSF (168, 205, 206) and that IL-17-producing memory T cells infiltrate into MS

lesions (207). Human Th17 cells have been demonstrated to break down the BBB

with a higher efficiency than Th1 cells (207) and human BBB endothelial cells

express lower levels of tight junction proteins after culture with IL-17. IL-17

expression has also been shown to stimulate the expression of matrix

metalloproteinases in RA (208-210). Taken together, these studies suggest that Th17

cells may be responsible for not only CNS damage in MS but also for increased BBB

disruption, thus allowing the influx of other cell types to the CNS. Interfering with

Th17 function may prove to have significant therapeutic advantages for MS patients.

The function of Tregs is to control and down-regulate the immune system,

particularly to prevent autoimmunity. Deficiencies in Treg function have been

demonstrated to be at least partly responsible in several different autoimmune

diseases including RA (211-213) and diabetes (214-216). Adoptive transfer of

antigen-specific Treg cells has been associated with the prevention or reduction of

EAE (62, 217-220), and depletion of Tregs in EAE results in a more severe disease

phenotype and prevents remission (221, 222). Patients with MS have lower levels of

FoxP3 in their peripheral CD4+/CD25high cells which has been associated with a loss

of Treg function (223-225). Therefore, deficiencies in Treg function result in an

increased propensity to autoimmune diseases such as MS.

While all of these T cell types have been implicated in MS/EAE pathology, recent

evidence describing the plasticity of these lineages, particularly in the case of Th17

and Treg cells, must be taken in to account (15). It has been demonstrated that cells

expressing both IFN-γ and IL-17 are present in the CNS during EAE (68) and that

these may be Th17 cells that are undergoing differentiation to the Th1-type. While

there is clear evidence to suggest that Th17 cells drive the most severe MS/EAE

pathology, future research will further define the specific role of each of these T cell

subsets.


19

1.3.4.2 B cells and MS/EAE

While T cells have been critically linked to MS/EAE, it is clear that B cells are also

involved. Myelin-specific antibodies are often observed in blood samples from MS

patients as well as animals with EAE (226-229). It has since been demonstrated,

using a transgenic mouse model with a MOG-specific TCR, that T cell-dependent

activation of myelin-specific B cells occurs during EAE (127). In addition to

secreting myelin-specific autoantibodies, mature B cells act as APCs and present

local autoantigen within the CNS, which exacerbates disease (188, 190). They are

also capable of secreting inflammatory cytokines and activating complement, thereby

further contributing to the innate immune response (189, 191, 230, 231).

In addition to autoantibody-secreting plasma B cells, regulatory B cells have also

been implicated in MS/EAE. Mice deficient in functional B cells have been shown to

develop, but not recover from, the MBP-induced remitting EAE disease course

(115). Animals treated with antibodies that neutralise CD20 (a B cell-specific marker

involved in development) before EAE immunisation display increased disease

severity, whereas animals treated with this antibody only from peak disease show

declining EAE severity (191). This is attributed to a requirement for regulatory B

cells in preventing the early phases of EAE. Therefore, while it is clear that B cells

play a role in the pathogenesis of MS/EAE, therapies aimed at B cells for the

treatment of autoimmunity must take the function of regulatory B cells into account.

1.3.5 Current therapy for MS

Current therapy for MS patients generally involves treating both the inflammatory

and neurodegenerative aspects of the disease. Immunomodulatory drugs such as

glatiramer acetate (Copaxone) and β-interferons (Avonex, Betaferon and Rebif) can

successfully reduce the relapse rate of the disease (136, 232-235) and a limited

number of monoclonal antibodies are in preclinical development or, in the case of

Natalizumab, which blocks VLA-4 (α4β1 integrins), are newly approved for MS

treatment (138, 236). Intravenous or oral corticosteroids are useful for treating acute

exacerbations through their anti-inflammatory and immunosuppressive action. While

these methods of treatment have been variously successful, most of them need to be


20

taken regularly by MS patients. Furthermore, they currently only reduce MS severity

and relapses, and long-term neurodegeneration usually still occurs. It is therefore

important that a more focused approach to MS treatment/prevention is developed.

Several new therapies for relapsing MS, which either block T and B cell

activation/function or induce immune tolerance to neuroantigens, are currently in

phase 2 clinical trials (237).

1.3.6 Summary

MS/EAE pathology is a complex process that is not yet fully understood.

Pharmacologic intervention of any specific immune cell type is not likely to be

adequate to completely prevent pathology. However, there are several possibilities

for development of targeted intercession of the immune system. These include the

targeting of specific cytokines, chemokines and/or concurrent cell types. Intracellular

molecules specific for cells of the immune system are also an attractive target. One

family of proteins that includes isoforms that are largely immune-cell specific is the

PI3K family.

1.4 THE CLASS I PHOSPHOINOSITIDE 3-KINASE FAMILY

The PI3K family consists of 3 classes (I, II and III) defined by their sequence

homology (5). Because class II and III PI3Ks have not been implicated in immune

signalling they will not be discussed further here. Class I PI3Ks are further classified

into class IA and class IB, based on the method of activation. Class IA PI3Ks are

activated following receptor tyrosine phosphorylation which occurs after proteins

such as growth factors and cytokines, as well as peptides, bind to their cognate

receptor. They are also activated downstream of T-cell and B-cell antigen receptors

making them fundamental for processes such as cell growth, metabolism, survival,

activation and differentiation in many different cell types (238-252). The Class IB

PI3K is activated by serpentine transmembrane G protein-coupled receptors

(GPCRs), such as chemokine receptors and are primarily involved in cell migration

(3, 8, 253). Further details on each of the class I PI3K sub-groups are detailed in

sections 1.5 and 1.6.


21

Once activated, class I PI3Ks phosphorylate membrane-anchored

phosphatidylinositol(4,5)-bisphosphate (PtdIns(4,5)P2) at the 3’-OH position of the

inositol head group (254, 255). A structural diagram of membrane-anchored inositols

in shown in Figure 1.4. Phosphorylation of PtdIns(4,5)P2 (PIP2) results in the

generation of PtdIns(3,4,5)P3 (PIP3), which is a docking site for proteins with

plekstrin homology (PH) domains such as kinases, phosphatases and lipases that

reside in, or are recruited to, the cell membrane. A number of signal transduction

pathways resulting from PI3K activation are described in section 1.4.2.

The following sections provide a summary of PI3K structure, expression and

regulation, intracellular signal transduction regulated by PI3Ks and the function of

specific PI3K isoforms.

1.4.1 Class I PI3Ks – Structure and expression

Class I PI3Ks function primarily as heterodimers that consist of a catalytic p110

subunit coupled with a regulatory subunit. A schematic figure representing all of the

catalytic and adaptor subunits is shown in Figure 1.5. There are four different p110

catalytic subunits, p110α, p110β, p110δ and p110γ, which are encoded on the

PIK3CA, PIK3CB, PIK3CD and PIK3CG genes respectively. Of these catalytic

subunits, p110α, β and δ are responsible for class IA enzymatic function, and p110γ

is the sole catalytic subunit in class IB. The p110 isoforms are highly homologous

and have several hallmark domains. These include a Ras-binding domain (all p110

subunits bind Ras and it is thought that in many cases Ras is imperative for

stimulation of the p110 catalytic subunits) (256-259), a C2 domain (possibly

involved in membrane-recruitment), a structural helical backbone and the catalytic

domain (which is responsible for adenosine tri-phosphate (ATP) binding and

substrate specificity) (259). The expression of class I PI3K catalytic subunits is

varied (Table 1.3). Whilst p110α and β are expressed ubiquitously, expression of the

class IA p110δ and class IB p110γ is largely limited to cells of the immune system

(260). This is an important distinction for the rationale of this study.


22

Class IA PI3K p110 subunits constitutively bind to one of seven regulatory subunits

that are derived from three different genes; p85α (PI3KRI), p85β (PI3KR2), and p55γ

(PI3KR3). The p110α, β and δ catalytic subunits of class IA can form functional

complexes with each of these regulatory subunits (5). The p85 and p55 adaptor

proteins are expressed in many cell types (see Table 1.3) and share similar functional

domains in that they all contain proline-rich regions and SH2 domains (the region

between two of these is responsible for binding to the N terminus of class IA p110

proteins) (261). The p85 proteins also have N-terminal SH3 and RhoGAP regulatory

domains thereby allowing participation of other intra- and inter-molecular

interactions (262, 263). The regulatory proteins bind to receptor tyrosine kinases

(RTKs) via their SH2 domains following receptor dimerisation and tyrosine

autophosphorylation events induced by ligand binding. The role of the regulatory

subunits in PI3K signalling is thought to be three-fold: to stabilise the p110 catalytic

subunits, to inhibit basal activity of the p110 subunits and to recruit them to the

phosphorylated residues of RTKs where they are activated (9, 264).

The sole class IB PI3K catalytic subunit, p110γ, binds to one of two regulatory

subunits, p101 or p84 (also known as p87PIKAP) (265-267). Aside from demonstrated

p110γ and Gβγ binding-domains in p101 (268, 269), both p101 and p84 are still

relatively uncharacterised in regards to the presence of other functional domains. As

is the case with p110γ, it has been shown that p101 and p84 expression is largely

limited to cells of the immune system (266, 267), however both p84 and p110γ have

also been shown to be expressed in cardiac tissue (Table 1.3) (267, 270).

The functions of class IA and IB PI3Ks are discussed further in sections 1.5 and 1.6.

1.4.2 Signalling events downstream of PI3Ks

PI3Ks phosphorylate membrane-anchored PtdIns(4,5)P2 at the 3’-OH position of the

inositol head group to form PtdIns(3,4,5)P3, which results in the generation of a

docking site for proteins with PH domains (271). PH domains have been identified in

over 100 proteins (255) and consist of a C-terminal α-helix and short β-strands that

are connected by highly variable loops (272). Not all of these PH domain-containing


23

proteins can interact with 3-phosphoinositides. The most commonly studied proteins

involved in PIP3-induced activation following RTK or GPCR ligation and PI3K

signalling are Akt/PKB, the Tec family tyrosine kinases (e.g. Btk and Itk in B and T

lymphocytes) and the small GTPases of the Rho and Arf families. All of these

proteins initiate distinct signalling pathways. Signalling events that occur following

PI3K activation are complex and are still yet to be fully elucidated. Therefore, only

the most well researched elements are discussed briefly here. Figure 1.6 and Figure

1.7 show schematic representations of class IA and IB activation and signalling

respectively.

Due to difficulty in directly measuring 3-phosphoinositide levels within cells, one of

the most commonly used output readings for PI3K function in mammalian cells is

observing levels of phosphorylation of the serine/threonine kinase Akt/PKB (protein

kinase B), usually via western blot. Akt/PKB has a PH domain and binds directly to

PIP3 following both class IA and IB PI3K activation (255, 273), resulting in

Akt/PKB phosphorylation. There are several substrates for Akt/PKB that have been

identified and these studies have demonstrated how important Akt/PKB signalling

pathways are for processes such as cell survival and function (274-277). Suppression

of apoptosis is mediated in part via Akt/PKB phosphorylation and subsequent

deactivation of BAD, restricting its ability to bind to and inhibit the anti-apoptosis

proteins Bcl-2 and Bcl-XL (thereby indirectly inhibiting apoptosis) (278). Akt/PKB

can phosphorylate and inhibit caspase-9, a protease important for later stages of

apoptosis, thereby promoting cell survival (276, 278). Akt/PKB can also, in

cooperation with protein kinase C (PKC), bind to and activate IκB kinases (IKKs)

which are crucial for the regulation of the nuclear factor κB (NFκB) transcription

factor (279). This activation of IKKs leads to degradation of IκB which allows NFκB

to act as an integral transcription factor for anti-apoptotic proteins. Akt/PKB has also

been implicated in the function of forkhead (FH) transcription factors which, upon

phosphorylation by Akt/PKB, are retained in the cytosol and prevent expression of

proteins such as the Fas ligand, p27kip, Rb2/p130, Bim and TRAIL which are

involved in the initiation of apoptosis pathways and control of the cell-cycle (280-

284). Akt/PKB is also important for insulin signal transduction through its role in

phosphorylating and inhibiting glycogen synthase kinase 3 (GSK3) (285), resulting


24

in downstream effects on metabolic enzymes involved in augmenting glycogen

synthesis.

Another important PH-domain containing protein family that is activated by 3-

phosphoinositides are the Tec family of tyrosine kinases. This family of proteins

includes Btk (Bruton’s tyrosine kinase) and Itk (inducible T cell kinase) which are

vital for B and T cell antigen receptor function respectively (242, 246, 286, 287).

Following BCR activation, the main Btk substrate, phospholipase-C-gamma-2

(PLCγ2), hydrolyses PtdIns(1,4,5)P3 to form Ins(1,4,5)P3 and diacylglycerol (DAG),

which leads to intracellular Ca2+ mobilisation (287-289). This process also influences

activation of PKC and thus further impacts on IKK phosphorylation and downstream

effects on the control of apoptosis (290, 291). The role of Itk, which is activated

downstream of PI3K signalling induced by TCR stimulation, is less clear, however it

is thought to be involved in TCR-dependent actin polymerisation (242, 246).

PI3K-induced activation of the small GTPases of the Rho family is fundamental for

cell motility. The Rho family proteins (e.g. Rho, Rac and cdc42) are activated by

guanine nucleotide exchange factors (GEFs – which convert GDP to GTP) and

inactivated by GTPase-activating proteins (GAPs – which dephosphorylate GTP),

both of which contain PH domains (292-295). Rho GTPases are involved in adapting

actin reorganisation and in cytoskeletal rearrangements; i.e. processes which are

required for chemotaxis (294).

As well as the GTPases responsible for Rho family protein activation, GTPases

involved in Arf (ADP ribosylation factors) function are also regulated via PH

domains (296, 297). These include general receptor for phosphoinositides 1 (GRP1),

ARNO (ARF nucleotide binding site opener), centaurin-α1 and cytohesin-1 and 2.

These proteins are responsible for integrin-mediated adhesion of leukocytes as well

as regulating the leading edge during cell migration.


25

In summary, the proteins discussed here have been shown to require PI3K signalling

for their activation, however it is likely that future research will shed further light on

the complexity and significance of PI3Ks signalling.

1.4.3 Negative regulation of PI3K activity

Research has yielded significant insight into the negative regulation of PIP3. Once

PI3Ks have performed their function and have generated PIP3, negative regulation of

the PI3K-generated signal is predominantly performed via de-phosphorylation of

PIP3 by the phosphatases PTEN (phosphatase and tensin homolog deleted on

chromosome ten) or SHIP (Src homology 2 domain containing inositol

polyphosphate phosphatase). These lipid phosphatases de-phosphorylate PIP3 to form

PtdIns(4,5)P2 and PtdIns (3,4)P2 respectively (i.e. PTEN de-phosphorylates at the 3’-

OH position (298, 299) and SHIP at the 5’-OH position of PtdIns(3,4,5)P3 (300) (as

shown in Figure 1.8)). This not only controls basal activity of proteins with PH

domains, but also establishes localisation of PI3K signals (PIP3) to specific parts of

the cell, for example at the leading-edge following cell activation by chemotactic

stimuli. A brief summary of the most important findings of research targeting PTEN

and SHIP is discussed below.

PTEN is well-known as a tumour suppressor. PTEN knock-out is embryonic lethal,

and animals heterozygous for PTEN show a high incidence of cancer, defective Fas-

mediated cell death, lethal polyclonal autoimmunity and lethal lymphoproliferative

disease (301-305), mostly due to deregulated Akt/PKB activation (and therefore

deregulated apoptosis). PTEN has also been demonstrated to be important for cell

chemotaxis (306, 307). Further to its role in chemotaxis and cell survival, PTEN

function also impacts on process such as glycogen synthesis (through GSK3 which is

initiated by insulin receptor signalling) and can therefore influence the outcome of

Type 2 diabetes (308-311). PTEN has also been shown to be important for in vivo

neutrophil responses to both bacterial infection and during auto-antibody-induced

arthritis in mice. A lack of PTEN leads to diminished bacterial containment and

clearance and reduced neutrophil-induced arthritic inflammation respectively in these

models (307).


26

There are two closely related SHIP homologues: SHIP1 and SHIP2. SHIP2 proteins

have also been strongly implicated in the negative regulation of insulin signalling

(312), and genetic knock-out of SHIP2 confers resistance to obesity and diabetes

(313). Whilst the mechanism for this has not been delineated, it is likely that

deregulated signalling through Akt/PKB in Ship2-/- mice results in increased insulin

responsiveness and reduced obesity-related insulin resistance. It has also been shown

that SHIP2 can be up-regulated in some breast cancer cell lines (314), but that it does

not influence oncogenesis in a myeloma cell line (315) implying that a role for

SHIP2 in cancer progression is likely to be cell-type specific. SHIP1 is possibly more

relevant in immunology as its expression is limited to cells of haematopoietic lineage

(316). Similar to PTEN heterozygous mice, SHIP1-null mice suffer from a lethal

myeloproliferative disorder (which bears some similarity to chronic myelogenous

leukaemia) where myeloid cells infiltrate the lungs, most likely due to deregulated

apoptosis and cell motility (317, 318). Mutations in the SHIP1 gene have been

implicated in acute myeloid leukaemia as well as acute lymphoblastic leukaemia

(319, 320). SHIP1 has also been implicated in phagocytosis (321, 322), mast cell

activation and degranulation (323, 324), histamine-mediated allergic reactions (325-

327), macrophage function (328, 329) and T and B lymphocyte survival and function

(317, 330-338).

1.4.4 Methods of experimentally disrupting class I PI3K function

There are several methods of investigating PI3K function. These include pan-PI3K

inhibitors, isoform-specific small molecule inhibitors and genetic targeting strategies

in mice. All of these mechanisms of investigating PI3K function have led to

increased understanding of the roles that PI3Ks play.

1.4.4.1 Pan-PI3K inhibitors

Two low-molecular-weight, cell-permeable pan-PI3K inhibitors, Wortmannin and

LY294002, have been commercially available for a number of years and have

enabled many initial studies into the function of PI3Ks (7, 339-343). These reagents

have been important analytical tools for the development of the PI3K field and our

current understanding of PI3K signalling. The chemical structures of Wortmannin


27

and LY294002 are shown in Figures 1.9A and 1.9B respectively. Both compounds

potently inhibit class I PI3Ks at low inhibitory concentrations (IC50) by binding to

the ATP binding-pocket in the catalytic domain of the p110 subunits (344, 345).

Wortmannin has a lower IC50 whereas LY294002 has a longer half-life and both

have been used successfully, independently or in combination. It must be taken in to

account that both have off-site effects in that they both also inhibit the mammalian

target of rapamycin (mTOR) and DNA-dependent protein kinase (DNA-PK).

Wortmannin also inhibits ataxia telangiectasiamutated protein (ATM) and type II

Proline-rich domain-containing inositol 5-phosphatase kinases (PIPkins) α and β,

whilst LY294002 can also inhibit casein kinase-2 (CK-2) (255, 346-350). However,

if both Wortmannin and LY294002 are used at low concentrations (approximately

20-50nM and 10-100μM respectively) their specificity is greatly limited to PI3Ks.

In recent years cell-permeable, small-molecular-weight and isoform-specific

inhibitors for PI3Ks have been developed. These are discussed below.

1.4.4.2 p110α, p110β and p110γ specific inhibitors

Like the pan-PI3K inhibitors Wortmannin and LY294002, the isoform-specific

inhibitors of class I PI3Ks are targeted to the ATP-binding pocket of the catalytic

p110 subunits (351). Inhibitors for p110α (352-354), p110β (355, 356) and p110γ

(357, 358) have been developed, with mixed success. Current p110α inhibitors have

many off-target effects and inhibit other important kinases such as isoforms of

protein kinase C (354), and are therefore not considered to be a useful tool for

specifically studying p110α function. Similar issues are likely with p110β inhibitors.

This is attributed to the ubiquitous expression and function of both p110α and p110β

and indicates that widespread inhibition of these proteins may not prove to be useful

for studying their function or as therapeutics.

Due to their more limited expression, targeting of p110δ and p110γ is a more

attractive prospect. The most successful p110γ-specific inhibitor to date is AS604850

(357). This inhibitor shows high selectivity for p110γ with few off-target effects.

Inhibitors of p110δ are discussed below.


28

1.4.4.3 P110δ-specific inhibitors

Several small-molecule p110δ-specific inhibitors have been generated. These include

IC87048 (359), IC980033 (360) and IC486068 (361). The research using these

inhibitors is limited and they will not be further discussed here. The most potent

inhibitor with the least off-target effects is IC87114 (Figure 1.9C). IC87114 was first

described by Sadhu and colleagues in 2003 (359). The IC50 value for PI3Kδ

inhibition by IC87114 is 0.5μM, whereas the IC50 values for PI3Kα, PI3Kβ and

PI3Kγ are 100μM, 75μM and 29μM respectively, indicating that IC87114 is highly-

specific for PI3Kδ. In order to avoid inhibition of any of the other PI3K isoforms,

and to achieve optimal p110δ inhibition, IC87114 is optimally used at concentrations

between 1-10μM. Importantly, IC87114 was also shown to have no off-target effects

on several other protein kinases including Akt1 (PKBα), PKCα, PKCβII, p38

MAPK, DNA-PK, c-Src, casein kinase I and checkpoint kinase I (359). IC87114 is

highly effective at inhibiting PIP3 biosynthesis and significantly reduces PI3Kδ

function (238, 240, 359, 360, 362-372).

1.4.4.4 Knock-out and knock-out/knock-in mice

A list of mice with targeted regulatory and catalytic PI3K subunits is shown in Table

1.4. There have been a limited number of different genetic approaches to targeting

both PI3K catalytic and regulatory subunits in animal models. The most prevalent is

protein knock-out mice. While this is a useful way to measure PI3K function this

approach has been proven to have some serious limitations. Several knock-outs have

proven unsuccessful as the target protein is probably important for embryonic

development and the mice are either embryonic lethal (p110α (373) and p110β (374))

or do not survive for long post-birth (p85α+p55α+p50α (375)), thus highlighting the

ubiquitous importance of these PI3K subunits in mammalian biology. Despite this,

several successful PI3K subunit knock-out mice have been generated by targeting the

p110δ (239, 244), p110γ (376), p85α (305, 377), p55α (378), and p85β (379)

proteins. A double knock-out (p110δγ-/-) strain has also been produced (380, 381).

One of the problems with PI3K knock-out mice is that genetic deletion of one family

member has been shown to affect expression of others. For instance, up-regulation of


29

the PI3K p85 regulatory subunit has been observed in p110δ knock-out mice (373).

This has led to the development of PI3K ‘knock-out/knock-in’ (KO/KI) mice.

Indeed, p110δ (p110δD910A/D910A) and p110γ (p110γK833R/K833R) mice have not been

reported to show any differences in expression of any of the other PI3K subunits

(248, 270). In addition, the p110γ subunit has been confirmed to be expressed in

cardiac tissue and a hallmark study comparing cardiac function in p110γ-/- versus

p110γ KO/KI mice demonstrated that p110γ is important for scaffolding via

catalytic-activity-independent binding with phosphodiesterase 3B (PDE3B) in the

heart (270). This demonstrates that catalytically inactive KO/KI mice may be a more

relevant method of observing PI3K function without disrupting other, possibly

unknown, roles for these proteins.

1.5 P110α, P110β, P110γ AND THE PI3K REGULATORY SUBUNITS –

NORMAL FUNCTION AND INVOLVEMENT IN DISEASE

The focus of this thesis is on the functional role of the class IA catalytic subunit,

p110δ. However, it must be taken into account that p110δ functions in the cellular

environment in close relationship with not only class IA PI3K regulatory subunits,

but also often with other class IA and IB PI3K catalytic subunits. A brief summary of

class I PI3K regulatory and catalytic p110α, β and γ subunit biology is provided

below.

1.5.1 Studies targeting the PI3K regulatory subunits

Attenuation of the function of class I PI3K regulatory subunits has resulted in great

advancements in understanding of PI3K function. The most widely studied class I

PI3K regulatory subunits are those of the class IA sub-family, p85α, p85β, p55α and

p50α, all of which can bind to and mediate activation of the class IA PI3K catalytic

subunits (p110α/β/δ) (4). These subunits have been implicated in insulin

signalling/diabetes (4, 382-390), autoimmunity (391), cancer (387, 392-395) and

immune cell function (303, 305, 387, 396-402). Since genetic knock-out of the p85α

gene (PIK3R1; in which p55α and p50α are also encoded) results in embryonic or

perinatal lethality (303, 375) these proteins are thought to be important for


30

development, probably through their role in p110α and p110β function, as knock-out

mice for these proteins also die during gestation (373, 374).

While there has been a plethora of research focusing on the class IA PI3K regulatory

subunits, there has been less on the class IB regulatory subunits p101 and p84. The

expression of both is limited mostly to cells of the immune system, however p84 is

also expressed in cardiac tissue and has been demonstrated to be important for

kinase-independent p110γ/PDE3B-mediated scaffolding in the heart (267, 270, 403,

404). Both subunits have been implicated in p110γ activation, and p101 over-

expression has been demonstrated to enhance survival of T cells (405). However,

aside from this, very little is known about the specific function of p101 and p84.

It is undoubtable that the regulatory PI3K subunits all play an important role in

controlling catalytic function. However, research efforts have generally focussed on

further understanding the functional outcome of activation of the catalytic subunits.

This is further discussed below.

1.5.2 Class IA PI3Kα and PI3Kβ

Both p110α and p110β are expressed ubiquitously (4, 255, 406) and genetic deletion

of p110α or p110β is embryonic lethal (373, 374). This has restricted the study of

p110α and p110β function, however it is evident that p110α is primarily involved in

insulin-dependent signalling (407, 408) and p110β is responsible for platelet

aggregation and thrombosis and sustained insulin signalling (409-411). P110α has

also been implicated in phagocytosis and pinocytosis in macrophages (412), whereas

p110β is capable of acting downstream of GPCRs and in some cases is functionally

redundant with p110gamma (413). Both p110α and p110β are also involved in the

cell cycle and survival (411, 414, 415). Of relevance to this role, p110α has been

shown to be up-regulated in many different types of cancer, including ovarian, lung,

thyroid, cervical and gastric carcinomas as well as neuroblastoma (392, 394, 416-

422). While the involvement of p110β in cancer is not as well documented, it has

been implicated in ovarian, prostate and thyroid cancers as well as neuroblastoma

(392, 394, 416, 419, 423).


31

Despite the implication of both p110α and p110β in disease, it is unlikely that

specific therapeutic targeting of these proteins would be beneficial due to their

widespread expression and involvement in several critical cellular processes.

Without cell-specific methods of administration of p110α or p110β therapeutics,

targeting of the p110δ and p110γ catalytic PI3K subunits is more realistic.

1.5.3 Class IB PI3Kγ

As mentioned, expression of p110γ, p101 and p84 is largely limited to the immune

system (266, 267, 270). Upon binding of a ligand to its cognate GPCR, the PI3Kγ

complex (p110γ coupled to either p101 or p84) is activated. GPCRs are so-named

due to their coupling with G proteins consisting of α, β and γ subunits. Upon receptor

ligation, the Gα subunit is phosphorylated thus allowing dissociation of the Gβγ

subunits (which remain as a heterodimer). The Gα subunit then activates the

phospholipase C (PLC) pathways responsible for hydrolysis of membrane anchored

PtdIns(4,5)P2, ultimately resulting in increased intracellular Ca2+ levels (424, 425).

This drives processes such as actin polymerisation and cytoskeletal rearrangements,

which are critical processes for cell motility. Following release from Gα, the Gβγ

heterodimer directly activates PI3Kγ, resulting in PIP3 production (3, 255, 426).

There are several known isoforms of Gβγ which are all thought to activate the PI3Kγ

complex with equal efficiency, at least in vitro (265). As discussed earlier, activation

of PI3Kγ results in the generation of PH domains and intracellular processes

important for cell growth, survival and activation. However, since PI3Kγ is activated

following GPCR ligation with proteins such as chemokines, it is generally accepted

that the main function for this complex is in cell migration. In fact, it has been clearly

demonstrated that in normal cells PI3Kγ is the predominant PI3K isoform involved

in leukocyte motility both in vitro and in vivo, particularly at early time points (3, 8,

253, 307, 368, 369, 376, 427-434). Due to the role of PI3Kγ in cell migration it has

been directly implicated in inflammation (376, 429), cancer (394, 423, 433),

autoimmune disorders (357, 370, 433, 435-437) and heart disease (438, 439). PI3Kγ

has also been implicated in the activation of T cells (440), although its role in this

respect is less well-defined. It is clear that, through its role in cell movement and


32

activation, p110γ could be involved in a wide range of human pathologies such as

cancer metastasis, autoimmunity and chronic inflammation.

1.6 P110δ IN IMMUNOLOGY AND DISEASE

Through its role in cells of haematopoietic origin, p110δ has a significant impact on

both the innate and cell-mediated arms of the immune system. It has been

demonstrated that p110δ is imperative for efficient activation, migration and function

of many different leukocyte subsets. As a consequence, p110δ has also been

implicated in numerous immune pathologies. Deregulated p110δ-mediated signalling

has also been shown to specifically play a role in several different types of cancer.

These findings are further discussed below.

As outlined above, p110δ inactivation has been achieved in several different ways

(most commonly through genetic means such as p110δ-/- or p110δD910A/D910A mice or

with the p110δ inhibitor IC87114 as discussed in section 1.4.4). Therefore, for the

purpose of this discussion the term ‘p110δ inactivation’ is used to imply inhibition

by any of these methods.

1.6.1 p110δ and leukocyte migration

Current research suggests that the class IB PI3Kγ (which binds to GPCRs like

chemokine receptors) is the predominant PI3K responsible for driving directed cell

migration (3, 8, 253, 307, 368, 369, 376, 427-434). However there have been several

recent reports that also implicate p110δ in trafficking of cells. These studies have

primarily highlighted a role for p110δ in the migration of B cells, NK cells and

neutrophils. While T cell migration in vivo has also been shown to involve p110δ

signalling, this may be indirect.

1.6.1.1 p110δ and migration of T and B cells

Despite a lack of evidence to implicate p110δ in T cell migration in vitro (241, 432,

441), it has been demonstrated that without p110δ, T cells are not capable of

efficiently migrating towards antigenic tissue in vivo (441). This reduction in

trafficking is TCR-dependent and is supported by findings which show that


33

chemokine-induced T cell migration, at least in the case of CXCR4-mediated

migration, requires cross-talk between TCR- (mediated by ZAP-70) and chemokine-

mediated signals (245). The class IA PI3K regulatory subunit p85 has also been

implicated in T cell trafficking in the lymph nodes, but this is more likely to be due

to disrupted cell-cell interactions as opposed to direct effects on migratory pathways

(442). These findings demonstrate that, while p110δ may not play a role in direct

migration of T cells, its activation may be indirect, affecting other activities such as

T cell activation, adhesion to endothelium and the expression of endothelial adhesion

molecules, which are required for efficient extravasation and trafficking of T cells in

vivo.

The p110δ protein has however been clearly implicated in B cell trafficking both in

vitro (241, 432) and in vivo (241, 244, 248, 432). B cells lacking functional p110δ

cannot migrate effectively towards CXCL13 in vitro (432) and a lack of p110δ in

transferred B cells affects their ability to home to Peyer’s patches and splenic white

pulp in vivo (a process generally governed by the B cell response to CXCL13) (432).

Mice lacking functional p110δ are incapable of forming germinal centres, a

phenomenon that may be at least in part attributable to defects in B cell homing (241,

244, 248, 432). Aside from this, further effects of p110δ inactivation on B cell

homing in vivo (such as to sites of autoimmunity) are yet to be elucidated.

1.6.1.2 p110δ and neutrophil migration

Neutrophils are commonly used to study cell trafficking and p110δ has been

implicated in migration of this cell type. It has been reported that p110δ-inactivation

in neutrophils can result in reduced cell trafficking in vitro, however this is

dependent on the chemotactic stimulus driving neutrophil migration (307, 359, 365).

Neutrophil migration in vivo (which is reliant on a range of different chemotactic

cues) also requires p110δ (368-370). Expression of functional p110δ in endothelial

cells helps govern their adhesive state (369). OT-II mice without functional p110δ

express lower levels of ICAM-1 and VCAM-1 in the lung following ovalbumin

(OVA) challenge, further supporting a role for p110δ in endothelial adhesion

molecule expression (367). In addition to the importance of functional p110δ in the


34

endothelium, neutrophils with inactive p110δ are not capable of efficiently migrating

across leukotreine (LTB)4- or TNF-α-treated inflamed microvessels in vivo (369,

370) and functional p110δ is required for efficient infiltration of neutrophils to joints

of mice with autoantibody-induced arthritis (370). Furthermore, it was shown that

p110δ plays a more important role in later stages (4+ hours) of migration whereas the

class IB p110γ is more important for initial stages of neutrophil motility in vivo

(368).

1.6.1.3 p110δ and migration of natural killer and mast cells

Through its role in SCF-dependent adhesion to fibronectin and transwell chemotaxis

in vitro, p110δ has been implicated in the migration of mast cells (362, 363). NK

cells also utilise p110δ-dependent pathways for chemotaxis. P110δ-inactivated NK

cells cannot migrate efficiently towards CXCL12 or CCL3, however p110γ has also

been demonstrated to be important for NK migration towards these chemokines

(434). In addition, p110δ is required for NK migration towards CXCL10 and

sphingosine-1-phosphate (S1P) whereas p110γ is not (434). Interestingly, even when

chemotaxis is dependent on p110δ but not p110γ it is still sensitive to pertussis toxin

(434). This indicates that the signalling is occurring through, and p110δ may be

directly activated by, GPCRs. NK cells from mice lacking active p110δ cannot

efficiently migrate to the peritoneum in response to LPS-induced inflammation, nor

to the uterus in response to normal chemotactic signals that occur during pregnancy

(434), indicating that the p110δ isoform is necessary for efficient recruitment of NK

cells in vivo.

1.6.2 p110δ and cancer

Cells require several ‘hallmarks’ to become cancerous. These include self-

sufficiency in growth signals and insensitivity to anti-growth signals, limitless

replicative potential, the ability to drive angiogenesis, tissue invasion and metastasis

(443). As previously discussed, PI3Ks are involved in regulation of the cell-cycle,

apoptosis and cell activation. Mutations in PI3K subunits have been strongly

implicated in several different types of cancers (444-446). In addition to this, several

studies have indirectly implicated PI3Ks by demonstrating unregulated Akt/PKB


35

signalling or reduced PTEN-mediated de-phosphorylation of PIP3 in cancer cells

(444-446). As p110δ is highly expressed in leukocytes and is the predominant class

IA PI3K in leukocyte signalling it is reasonable to speculate that deregulation of

p110δ may be a primary cause of increased survival (by loss of apoptosis) in

leukocyte tumours. Analysis of samples from human patients with acute myeloid

leukaemia (AML) delineated that p110δ, but not p110α, β or γ, is consistently

expressed at high levels in blast cells from AML (371), however this is not due to a

mutation in p110δ (447). The p110δ inhibitor, IC87114, can suppress AML

proliferation and Akt/PKB activation in blasts to the same extent as the pan-PI3K

inhibitor LY294002 (371). Inhibition of p110δ also results in reduced proliferation

and increased cell death in acute promyelocytic leukaemia (APL) cells (448) and is

capable of reducing the proliferation of the WEHI-231 B cell lymphoma cell line, as

well as impairing Akt/PKB phosphorylation in these cells (238).

P110δ deregulation has also been specifically implicated in several different types of

non-myeloid cancers. In addition to high p110δ expression in cells of haematopoietic

origin, p110δ has also been shown to be expressed in endothelial cells. Mice with

Lewis lung carcinoma (a cancer of the endothelial cells of the lung) or GL261 hind

limb endothelial tumours display reduced tumour growth when treated with a

selective p110δ inhibitor (IC486068) in conjunction with radiation when compared

to either treatment alone (361). It has also been demonstrated that, through a role

downstream of the epidermal growth factor receptor, breast cancer cells require

p110δ for migration (449). P110δ is up-regulated in some neuroblastoma tumours

and contributes to survival and uncontrolled growth in these cells (416). Studies

observing the role of p110δ in the induction of oncogenic transformation of chicken

embryo fibroblasts (CEFs) have demonstrated that this isoform can confer Ras-

independent oncogenic potential to these cells (423, 450).

These studies reveal that the development of p110δ-specific inhibitors for treatment

of cancers of both myeloid and non-myeloid types may provide therapeutic

intervention of PI3Ks in a manner that would not disrupt off-target cellular functions

(which may occur with pan-PI3K inhibition).


36

1.6.3 The role of p110δ in Neutrophil function

Neutrophils are critical for the innate immune response, and, as discussed above,

p110δ has been demonstrated to be integral for efficient migration of these cells.

However, p110δ is not only important for neutrophil migration, but also for their

activation and function. Initial reports showed that, without active p110δ, neutrophils

are not capable of superoxide generation in response to TNF-α and N-formyl-

methionyl-leucyl-phenylalanine (fMLP) in vitro (360), and they produce less PIP3

following fMLP stimulation (369). In vivo, p110δ inactivation can reduce LPS-

mediated neutrophil accumulation in a model of acute pulmonary inflammation (369)

and neutrophil accumulation in the lungs of mice challenged with OVA is reduced

when p110δ is inhibited by IC87114 treatment (367). Without functional p110δ,

mice do not develop autoantibody-induced arthritis to the same extent as wild-type

counterparts (370), a phenomenon which was attributed, at least in part, to reduced

neutrophil accumulation in joints of p110δ-deficient animals. Future research may

further elucidate the role of p110δ in the specific function of neutrophils, however

these findings indicate that therapeutic inactivation of p110δ may prove a useful

strategy in disorders where infiltration by neutrophils is an underlying cause, such as

asthma and RA (451-457).

1.6.4 The role of p110δ in Mast cell-mediated allergic responses

Mast cells are important for inflammatory responses to invading pathogens and

parasites. Importantly, they also contribute to atypical inflammatory responses such

as asthma, autoimmunity and other allergic disorders. As discussed in section 1.6.1.3,

p110δ is involved in adhesion and migration of mast cells. However, it has also been

implicated in mast cell development and function.

P110δ-inactivation has been shown to result in reduced phosphorylation of Akt/PKB

in mast cells following SCF- and IL-3-stimulation in vitro (362, 363). Signalling

through the mast cell FcεRI receptor with IgE-antigen is also reduced when p110δ is

genetically or pharmacologically inactivated (362, 363). Furthermore, p110δ

inactivation results in reduced FcεRI-mediated mast cell-dependent cutaneous


37

anaphylaxis in vivo following intradermal administration with dinitrophenyl (DNP)-

directed IgE and systemic DNP challenge (362).

These findings are particularly important for the interpretation of a number of studies

implicating p110δ in airway hyperresponsiveness (367, 458, 459). Although those

studies did not specifically concentrate on mast cells, this cell type has been

independently implicated in asthma and airway inflammation (460). It is clear that

without efficient p110δ-driven signals mast cells are not capable of participating in

the immune response, which could partially explain why reduced airway

inflammation was observed in these studies following p110δ inactivation (367, 458,

459). However, mice lacking functional p110δ (p110δD910A/D910A mice) have fewer

mast cells in the dermis of the ear as well as the submucosa and muscularis of the

stomach (362, 363). Therefore, the impact of p110δ on mast cell development and

differentiation must be taken in to account when considering the effects that this

protein has on mast cell function.

1.6.5 The effect of p110δ on natural killer cell-mediated cytotoxicity

Aside from the role that p110δ plays in NK cell migration (discussed in section

1.6.1.3), this protein is also integral for efficient NK function. NK cells are key

mediators of innate immunity, playing a significant role in mediating cytotoxicity

towards virus-infected and tumour cells. Without p110δ, NK cells do not efficiently

develop and mature (380, 461, 462). NK cells with inactive p110δ fail to efficiently

clear transplanted lymphoma cells due to reduced CXCR3-mediated chemotaxis of

NK cells in vivo (434). NK cells from mice lacking active p110δ were not capable of

mediating cytotoxicity against influenza virus infection (461). This indicates that

p110δ may be more important for NK mediated antiviral responses than in tumour

clearance. In addition to this, inactivation of p110δ results in profound defects in

secretion of the cytokines and chemokines IFN-γ, GM-CSF, MIP-1α (CCL3), MIP-

1β (CCL4) and RANTES (CCL5) by NK cells (461, 462). This lack of p110δ-

mediated cytokine and chemokine secretion by NK cells is likely to have significant

detrimental effects on the immune response.


38

1.6.6 The role of p110δ in dendritic cells

At this stage, the only published evidence implicating p110δ in DC function showed

that bone marrow-derived DCs (BMDCs) from p110δD910A/D910A mice produce less

IL-6 compared to BMDCs from wild-type animals following stimulation in vitro

with cholera toxin (463). While this was not further investigated in the published

study, it is possible that reduced IL-6 production by DCs due to targeted p110δ

inactivation may affect the differentiation of T cells upon antigen presentation by

these APCs. Because pathogenic Th17 cells require IL-6 for efficient differentiation

it is possible that reduced IL-6 production by DCs could affect the activation of this

specific T cell subset. However, there is no further published evidence to either

support or disprove a role for p110δ in DC function as yet.

1.6.7 The role of p110δ in B cell activation and function

In addition to the requirement for p110δ in B cell trafficking, the involvement of

p110δ in B cell activation and function has been widely studied. Inhibition of p110δ

function has arguably the most profound negative impact on B cells when compared

with any other cell type.

Several studies have elucidated an important role for p110δ in B cell specific

processes, particularly those downstream of the BCR, and p110δ has been implicated

in both T-dependent and T–independent B cell responses. Without p110δ function

downstream of the BCR, B cells have lower levels of phosphorylated Akt/PKB and

Btk, reduced PLCγ2-mediated Ca2+ flux following anti-IgM exposure and also show

an impaired ability to proliferate in response to B cell stimuli such as anti-IgM, anti-

CD40, IL-4, CpG and LPS in vitro (238-241, 243, 244, 248). B cells lacking

functional p110δ show reduced activation of cell-cycle regulators such as cyclins D2,

A and E, retinoblastoma protein (Rb), p107 and E2F1 after anti-IgM stimulation

(238, 398, 401) and fail to successfully progress through the cell-cycle (398, 401).

Other downstream effectors of BCR signalling that are not effectively activated

following anti-IgM stimulation include the forkhead transcription factor FOXO3a

and GSK3α (238). In vivo, p110δ-inactivated B cells generate lower levels of serum

immunoglobulin in response to T-dependent and T-independent antigens (239, 241,


39

244, 248) and fail to generate germinal centres in the spleen, mesenteric lymph nodes

and Peyer’s patches upon adoptive transfer or in T-dependent and T-independent

models of inflammatory bowel disease (244, 248, 432). These studies identified the

critical importance of p110δ in B cell function and activation.

Without functional p110δ, it has been reported that B cells show uncontrolled class-

switching to IgE and IgG1 after anti-CD40/IL-4, LPS/IL-4 and CpG/IL-4 treatment

in vitro (240, 372). This occurs despite reductions in the production of other

immunoglobulin isoforms and type 2 cytokines (IL-4, IL-6, IL-10 and IL-13) (240,

372, 459). Therefore, if lacking p110δ, B cell signalling through CD40/IL-4

receptors as well as toll-like receptors appears to result in faulty regulation of IgG1

and IgE B cell responses. These findings demonstrate that inactivation of p110δ may

have further implications that must be taken into account when considering

attenuation of p110δ function in disease.

Defects in B cell development have also been reported and the most significant

outcomes of this are a reduction in peritoneal B1 B cell and CD23-CD21+ marginal

zone B cell numbers in mice lacking functional p110δ (239, 241, 248). There are also

fewer cells in secondary lymphoid organs of mice lacking functional p110δ (244,

248). The down-regulation of RAG gene expression, which is necessary for light

chain allelic/isotype exclusion during maturation, is also p110δ-dependent (247).

Without this regulation of RAG, unique BCR production does not occur. Therefore

p110δ is not only important for the development and differentiation of B cells but

also for the development of the BCR repertoire.

In response to IL-4-stimulation, p110δ-/- B cells do not display increased levels of

phosphorylated Akt/PKB thereby rendering them incapable of preventing apoptosis

through downstream phosphorylation of proteins such as IκBα and Bcl-XL (238,

239). Despite this, B cell survival has not yet been addressed in an in vivo setting;

without proper p110δ-mediated survival signals, efficient B cell generation and

immune responses are unlikely to occur.


40

In summary, p110δ has been implicated in the control of B cell development,

antibody production, BCR specificity and survival. As p110δ has been shown to play

an important role in B cell function both in vitro and in disease models in vivo, it is

likely that autoimmune diseases which have a B cell component (such as MS/EAE

and RA/collagen-induced arthritis (CIA)) would benefit from inhibition of p110δ

function.

1.6.8 The role of p110δ in T cell activation and function

T cells are integral for the cell-mediated immune response and inactivation of p110δ

in T cells results in profound defects in TCR signalling (248). T cells lacking

functional p110δ are not capable of effectively undergoing processes such as

phosphorylation of Akt/PKB, Ca2+ flux and proliferation following TCR stimulation

with anti-CD3 antibodies (248, 249).

T cells from p110δ KO/KI mice that have been crossed with OT-II TCR transgenic

mice (resulting in p110δ-inactivated T cells with a TCR that is specific for OVA)

show a reduced capacity to proliferate in response to OVA antigen (249) and are

incapable of sustained production of IFN-γ or IL-4 under Th1- or Th2-skewing

culture conditions respectively (249), indicating that both Th1- and Th2-type

immune responses are reduced without functional p110δ. In vivo, these T cells fail to

undergo clonal expansion or to produce IFN-γ in response to immunisation with

OVA/LPS (249). As discussed in section 1.6.7, T-dependent B cell responses are

also attenuated in mice lacking functional p110δ (239, 244, 248) which may be due

to defects in T cell function, B cell function or, most likely, both.

While T cell development appears to be normal in mice without functional p110δ,

there are significantly fewer T cells in the secondary lymphoid organs of these

animals (248, 381). Despite the smaller secondary lymphoid organs, normal ratios

CD4+ and CD8+ are observed (248, 381).

In addition to the well-documented role for p110δ in Th1 and Th2 cell differentiation

and function, it has also been reported that p110δD910A/D910A mice have impaired


41

development and function of CD4+/CD25+/FoxP3+ Treg cells (464). Development of

Tregs is impaired as evidenced by fewer regulatory T cells in the periphery when

compared with wild-type mice (464). The ability of these Tregs to suppress

proliferation of CD4+CD25+ cells in response to anti-CD3/CD28 (with exogenous

IL-2) is reduced, as are the levels of the cytokine IL-10 that are produced by p110δ-

inactivated Tregs (464). Adoptively transferred Tregs without functional p110δ

cannot protect recipient mice from disease in a model of experimental colitis (464).

These findings further support the importance of p110δ in TCR-mediated activation

of T cells.

Unlike that observed in p110δ-inactivated B cells, no link has been made between

p110δ inactivation and increases in T cell apoptosis (249) (although mice lacking

both p110δ and p110γ show increased thymocyte apoptosis - see section 1.6.9).

Despite the clear influence that p110δ exerts on activation and differentiation of

Tregs and Th1- and Th2-type T cells, the influence of p110δ on the differentiation of

IL-17-producing Th17 cells is as yet undetermined. It is also unclear as to whether

the reduction in T cell differentiation is purely a result of defective T cell function, or

whether a lack of p110δ signalling also affects the presentation of antigen to T cells

by APCs such as DCs.

1.6.9 Attenuating both p110δ and p110γ function

As discussed in previous sections, the expression of both p110δ and p110γ is largely

limited to cells of the immune system and they perform different yet often

complementary functions within leukocytes. There is also some evidence that they

can function through receptors normally not thought to be involved in activation of

each of these specific enzymes, such as p110δ activation by GPCRs and p110γ

activation through RTKs (252, 434), however the prevalence and implications of

these findings are not yet clear. It is rarely shown that inactivation of either p110δ or

p110γ results in a complete inhibition of the output reading, such as chemotaxis or

cell activation, indicating that there may be some redundancy between these systems.

It is however important to note that when p110δ (and maybe p110γ) is inactivated

that p110α/β may also be able to execute some of the functions normally performed


42

by these proteins. Despite this, it is an attractive option to cooperatively target both

the p110δ and p110γ isoforms to further reduce cell function (465). To address this,

two approaches have been used. Firstly, mice in which both p110δ and p110γ have

been genetically inactivated have been generated (p110γ/δ-/- mice (380, 381) and

p110γ-/-/δD910A/D910A mice (428)). Secondly, a combination of genetically-altered

mice and small molecule p110 subunit inhibitors is commonly used to investigate the

effects of inhibition of both of these PI3K catalytic subunits (366, 368, 370).

However these approaches have not always shown that concurrent inhibition results

in any functional differences when compared to inhibition of one of the subunits

alone (364, 365).

Several studies have focussed on the effect of attenuating p110δ/γ function in

different cell types, the most widely studied being neutrophils. In vivo, the migration

of neutrophils to TNF-α is additionally reduced when compared with only p110γ-

inactivation (368). This has been attributed to differential roles for p110γ and p110δ

in early and late phases of the neutrophil emigration response respectively.

Furthermore, mice lacking both p110δ and p110γ function display significantly

reduced mean ankle thickness, altered histology, bone and cartilage erosion, and

neutrophil infiltration in a model of autoantibody-induced arthritis (370). The

attenuation of both p110δ and p110γ in this model showed further reductions in all of

these outputs when compared to the inhibition of only one catalytic subunit alone.

Therefore both p110γ and p110δ are important for movement of neutrophils into

inflamed joint tissue.

While no major defects in T cell development have been described in p110δ-

inactivated animals, p110γ inactivation has been shown to lead to reduced thymus

size, cellularity and defects in thymocyte selection (433). Mice lacking both p110δ

and p110γ function have further defects in thymocyte differentiation as well as

increased apoptosis in double-positive thymocytes (251, 381). Extrathymic T cells

from these animals are less capable of mobilising intracellular Ca2+ in response to

TCR cross-linking than was observed in both p110δ-/- and p110γ-/- mice, indicating


43

that both of these proteins work in concert to mediate TCR signalling in mature T

cells (251).

Mice with deleted p110γ and inactive p110δ (p110γ-/-/δD910A/D910A mice) have

reduced B and T cell numbers and lower levels of serum immunoglobulin compared

with wild-type animals (428). In addition, function of Th1 and Th2 cells from these

animals is altered; lower levels of IFN-γ and TNF-α, but higher levels of IL-5 and

IL-4 are observed following anti-CD3 or anti-CD3/anti-CD28 stimulation in vitro.

Perhaps the most striking phenotype of these mice however is that they

spontaneously develop eosinophil- and T cell-dominated inflammation in the

stomach and salivary glands which may be attributable to reduced Treg function and

increased Th2 development (428).

As demonstrated by the aforementioned studies which co-ordinately inactivated both

p110δ and p110γ function, there may be benefits to reducing the function of these

proteins concurrently. However serious side-effects, in particular the high incidence

of spontaneous inflammation in multiple organs, must be taken into account when

considering this approach.

1.7 HYPOTHESES AND AIMS OF THE STUDY

As discussed above, the p110δ protein has been shown to be integral for many

immunological processes, including those required for migration, activation,

differentiation and/or function in neutrophils, mast cells, NK cells, B and T cells. All

of these cell types have been implicated in either MS or EAE, and it is postulated that

reduction in their function may result in reduced disease. In particular, CD4+ T cells

have been demonstrated to be highly pathogenic and are generally accepted to be the

major initiating cell type in both EAE and MS. Research has shown that p110δ-

inactivation reduces the capacity for efficient T cell differentiation to the Th1-, Th2-

and Treg-types. However, to date, little is known about the role that p110δ plays in

Th17-cell differentiation, nor has p110δ been specifically implicated in the

generation of the autoimmune response in MS or EAE. The published findings, and

speculation that arises from them, have led to the following hypotheses:


44

1) That inactivation of p110δ results in reduced differentiation of naïve CD4+ T

cells to the IL-17-producing Th17-type.

2) That genetically-inactivating p110δ function influences EAE disease

pathogenesis through reducing immune cell activation and function.

3) That treatment of murine cells with the p110δ inhibitor IC87114 reduces their

activation and differentiation.

To address the above hypotheses, the experimental aims were as follows:

1) To further characterise the KO/KI p110δD910A/D910A (kinase-dead) mice and

assess their ability to generate an autoimmune response in the model for

multiple sclerosis, EAE.

2) To characterise the autoimmune response in p110δD910A/D910A mice with

particular regard to the leukocyte infiltration to the CNS, DC activation and B

and T cell activation and survival.

3) To assess the role of p110δ in the generation of IL-17-producing Th17 cells.

4) To investigate the ability of the p110δ inhibitor, IC87114, to reduce

differentiation of T cells and influence EAE outcome.

The results of the experimental investigation of the aforementioned hypotheses are

presented and discussed in the subsequent chapters of this thesis.


45

Figure 1.1: T cell differentiation. Following antigen-specific activation, naïve T

cells may undergo differentiation to several different types depending on the stimuli

received. When activated in the presence of TGF-β alone they up-regulate the FoxP3

transcription factor and differentiate into regulatory T cells. When activated in the

presence of TGF-β and IL-6 they up-regulate the RORγt transcription factor and

become IL-17-producing Th17 cells. Th1 cells are driven by IL-12 and expression of

the transcription factor T-bet. Th2 cells differentiate following IL-4 stimulation and

GATA3 up-regulation. IFN-γ and IL-4, produced by Th1 and Th2 cells respectively,

negatively regulate Th17 differentiation. IFN-γ also suppresses Th2 differentiation,

and IL-4 suppresses Th1 differentiation. (Adapted from (150))

IL-4

IL-17, IL-21

IL-22

IL-12

IL-10

TGF-β

IL-4 IFN-γ

TGF-β

IL-6

Treg cell (FoxP3)

Naïve T cell

Th1 cell (T-bet)

Th2 cell (GATA3)

Th17 cell (RORγt)


46



47

Figure 1.2: Proteins of the myelin sheath. The myelin sheath, which surrounds and

protects axons and affords rapid nervous conduction, is comprised of lipids (80%)

and protein (20%) and is formed by oligodendrocytes. Proteins that make up the

myelin sheath include PLP (proteolipid protein), MOG (myelin oligodendrocyte

protein) and MBP (myelin basic protein). (Adapted from (466))

Phospholipid Glycolipid Cholesterol

Myelin oligodendrocyte glycoprotein (MOG)

Proteolipid protein (PLP)

Myelin basic protein (MBP)

MBP

MOG

PLP

Extracellular domain

Cytoplasmic domain


48

Figure 1.3: Immunopathology of multiple sclerosis. There are many facets to CNS

inflammation. Upon presentation of neuro-antigen to naïve T cells by APCs and

exposure to cytokines, naïve CD4+ T cells differentiate to the Th1- and Th17-types,

before entering the CNS where they are restimulated by CNS resident cells and

secrete cytokines such as IL-17, IFN-γ and TNF-α. These cytokines also further

disrupt the BBB, exacerbating the influx of antigen-specific and non-specific cells.

CD8+ T cells and B cells also become activated in an antigen-specific manner.

Mature cytotoxic T cells and plasma cells then cause further CNS damage, including

oligodendrocyte cell death and local antibody-production and complement induction

respectively. CNS-resident microglia are also activated. Cytokines and chemokines

produced within the CNS by T cells, plasma cells and microglia further exacerbate

disease by recruiting more of these cell types, as well as macrophages, neutrophils

and NK cells to the CNS. The ultimate result of this immune response is myelin

destruction, neuron death and inefficient nervous conduction. (Adapted from (230))

Naïve T cell Activated Th1 cell

Activated Th17 cell Activated CD8+ T cell

Naïve B cell Plasma cell

Dendritic cell Neuron

Oligodendrocyte

Microglia

Myelin sheath (CNS-specific) antigen

Cytokines/chemokines Macrophage

Neutrophil NK cell


49

NOTE: This figure is included on page 49 of the print copy of the thesis held in the University of Adelaide Library.


50



51

Figure 1.4: Chemical structure of membrane-anchored phosphatidylinositol.

The inositol head group is attached to the membrane-anchored diacylglycerol fatty

acid tails by a phosphodiester link. (Adapted from (6, 255))

Inositol head group

Phosphodiester link

OH 3

4 OH

OH 5

OH

2 6

1

O

O H

O O O O

O- P

O

OH

Diacylglycerol

(fatty acid tails that

anchor the inositols to

the cell membrane)


52

Figure 1.5: Class I PI3K catalytic and regulatory subunits. The class IA PI3Ks

consist of three p110 catalytic subunits (α, β and δ) that couple to p85 or p55

regulatory subunits. The class IB catalytic subunit p110γ binds to either p101 or p84

regulatory subunits to efficiently function. All p110 subunits have a C2, Ras binding

and catalytic domains as well as a helical backbone. The class IA regulatory subunits

all have p110α/β/δ binding and SH2 domains as well as proline rich regions (PRR).

The p85 proteins also have GAP and SH3 domains. The class IB regulatory subunit

p101 binds p110γ at the N terminus and Gβγ at the C terminus. The p84 protein is

currently uncharacterised. (Adapted from (1))


53

p101

p110γ

p55γ

p85α/β

p110α/β/δ

p110γ B

IND

ING

p110α/β/γ B

IND

ING

SH

2 G

AP

PRR

SH

3

RB

D

KIN

ASE

/CA

TA

LY

TIC

H

EL

ICA

L

C2

RB

D

KIN

ASE

/CA

TA

LY

TIC

H

EL

ICA

L

C2

PRR

SH

2

p110α/β/γ B

IND

ING

SH

2 PR

R

SH2

Gβγ

BIN

DIN

G

Class IB

PI3K

Class IA

PI3K

p84


54

Figure 1.6: Class IA PI3K signalling. Following ligand binding to RTKs, receptor

homodimerisation and autophosphorylation, class IA PI3Ks are activated. This

activation results in phorphorylation of PIP2 to PIP3 which provides a docking site

for proteins with PH domains. Activation of class IA PI3Ks contributes to diverse

cell processes such as activation, migration, metabolism, differentiation, survival,

growth and phagocytosis. (Adapted from (3))


55

P

P

P

RTK

Growth factor/cytokine etc.

P

P P Class IA

PI3K

p110α/β/δ

Ras

p85/p55 /p50

Cytosol PIP

3 containing PH

domain-

protein

Phagocytosis Growth

Survival Differentiation

Metabolism

Cell migration

Activation


56

Figure 1.7: Class IB PI3K signalling. The binding of GPCR agonists (such as

chemokines) to their cognate GPCR results in activation of G proteins and

subsequent class IB PI3K activation. PI3Kγ then phosphorylates PIP2 to PIP3 which

generates a docking site for proteins with PH domains. Activation of class IB PI3K

contributes to cell processes such as migration and survival. (Adapted from (3))


57

Cell migration

Survival

Cytosol PIP

3 containing PH

domain-

protein

Chemokine

GPCR (e.g. chemokine receptor)

Gα/β/γ Gβγ

PI3Kγ

p110γ

Ras

p101


58

Figure 1.8: Negative regulation of PIP3. Following PtdIns(3,4,5)P3 generation by

class I PI3Ks, PTEN and SHIP de-phosphorylate PIP3 at the 3’ or 5’ position of the

inositol head group to form PtdIns(4,5)P2 and PtdIns(3,4)P2 respectively. (Adapted

from (255)).

a1172507

Text Box



59

Figure 1.9: Chemical structure of the PI3K inhibitors Wortmannin, LY294002

and IC87114. The pan-PI3K inhibitors (A) Wortmannin and (B) LY294002 (7). (C)

The p110δ-specific small molecule inhibitor IC87114 (359).

a1172507

Text Box



60

Table 1.1: Commonly used immunising antigens in EAE. The CNS antigens most

commonly used to immunise animals to develop EAE are listed. Shown are the

antigenic peptide, animal strain that is commonly used and the induction protocol

used to generate EAE disease (Induced = actively immunised. Transferred =

adoptively transferred encephalitogenic cells). (Adapted from (117))

Legend:

M = Mice, R = Rat, P = Primate.

* Most commonly used models of EAE.


61

Immunising antigen

Autoantigen Animal strain Induction References

Myelin basic protein (MBP)

MBP MBP MBP MBP Ac1-11 MBP21-35 MBP29-84 MBP61-82 MBP79-87 MBP80-105 MBP89-101 MBP170-186

SJL/J (M) Lewis (R) Rhesus monkey (P) B10.PL and PL/J (M) Biozzi ABH (M) Lewis (R) Lewis (R) C3H/HeJLewis (R) SJL/J (M) Lewis (R)

Induced Induced/Transferred Induced Induced/Transferred Induced Induced Induced Transferred Induced Induced Induced

(467) (125, 129) (468) (121, 130) (469) (125, 129) (125, 129) (123) (125, 129) (469) (125, 129)

Myelin oligodendrocyte glycoprotein (MOG)

MOG MOG MOG MOG MOG1-22 MOG14-36 MOG34-56 MOG35-55* MOG35-55 MOG35-55 MOG43-57 MOG74-90 MOG92-106 MOG93-107 MOG134-148

SJL/J (M) Biozzi ABH (M) DA, BN (R) Common Marmoset (P) Biozzi ABH (M) Common Marmoset (P) Rhesus Monkey (P) C57BL/6 (M) C57BL/6 (M) B10.PL and PL/J (M) Biozzi ABH (M) DA, BN (R) SJL/J (M) DA, BN Biozzi ABH (M)

Induced/Transferred Induced Induced Induced Induced Induced Induced Induced Transferred Induced/Transferred Induced Transferred Induced Transferred Induced

(119, 127) (119) (470) (471) (119) (471) (468) (118) (118) (124) (119) (128) (119) (128) (119)

Proteolipid Protein (PLP)

PLP PLP56-70 PLP104-117 PLP139-151* PLP178-191 PLP215-232

C3H/HeJ (M) Biozzi ABH (M) SJL/J (M) SJL/J (M) SJL/J (M) C3H/HeJ (M)

Induced Induced Induced Induced/Transferred Induced/Transferred Induced

(122) (472) (473) (120) (122) (122)

Oligodendrocyte-specific Glycoprotein (OSP)

OSP OSP OSP57-72 OSP179-207

C57BL/6 (M) SJL/J (M) SJL/J (M) C57BL/6 (M)

Induced Induced/Transferred Induced Induced

(474) (126, 131) (126) (474)

Nogo-A rNogo-66 C57BL/6 / SJL/J (M)

Induced (475)


62

Table 1.2: Spontaneous models of EAE. These models of EAE involve the use of

transgenic mice to study the mechanisms of autoimmunity independently of

exogenous manipulation (e.g. immunisation with CNS antigenic epitopes). (Adapted

from (117))

Mouse strain Epitope Model Characteristics References C57BL/6 MOG35-55

MOG35-55 and MOG Neo-self antigen OVA

CD4+ TCR Tg CD4+ TCR Tg x BCR Tg ODC-OVA Tg x OT01 (CD8+) TCR Tg

Paralytic EAE and optic neuritis. Paralytic EAE and optic neuritis. Paralytic EAE and locomotor defects.

(476) (190) (477)

SJL/J PLP139-151

MOG92-106

CD4+ TCR Tg CD4+ TCR Tg

Paralytic EAE. Paralytic and ataxic EAE, relapsing-remitting.

(478) (127)

B10.PL MBP Ac1-9 MBP Ac1-11

CD4+ TCR Tg CD4+ TCRTg

Paralytic EAE. Paralytic EAE.

(479) (480)


63

Table 1.3: Tissue distribution of the mammalian class I PI3K protein subunits.

(Adapted from (387))

PI3K class Subunit Expression References Class IA (catalytic)

p110α p110β p110δ

Ubiquitous. Ubiquitous. Highly expressed in leukocytes. Moderate expression in neurons and cancer cell lines from various origin (melanoma, breast, colon). Moderate expression in endothelium.

(260, 373, 481) (260, 374, 481, 482) (260, 369, 449, 481, 483, 484)

Class IA (regulatory)

p85α p55α p50α p85β p55γ

Ubiquitous. Lowest in skeletal muscle. Brain and muscle. Undetectable in other tissues. High in liver, low in kidney and brain. Ubiquitous. Lowest in skeletal muscle. Low protein expression in liver, muscle, fat, spleen. High mRNA in brain and testis.

(481, 485, 486) (485, 487) (485, 488) (481, 485, 486) (263, 481, 485)

Class IB (catalytic)

p110γ Highly expressed in leukocytes. Low expression in most other tissues.

(270, 376, 489-491)

Class IB (regulatory)

p101 p84

Highly expressed in leukocytes. Highly expressed in leukocytes and heart.

(266, 267) (266, 267)


64

Table 1.4: Genetic manipulation of PI3K subunits. (Adapted from (4))

PI3K class Targeted subunit Viability References Class IA (catalytic)

p110α p110β p110δ KO p110δ KO/KI

Embryonic lethal Embryonic lethal Viable Viable

(373) (374) (239, 244, 369) (248, 362)

Class IA (regulatory)

p85α + p55α + p50α (PIK3RI) p85α p55α + p50α p85β p55γ

Perinatal lethality (homozygous) Viable (heterozygous) Viable Viable Viable Viable

(303, 375, 492-494) (305, 377) (378) (379) (379)

Class IB (catalytic)

p110γ KO p110γ KO/KI

Viable Viable

(376, 429, 430, 433, 437, 495) (270)

��

CHAPTER 2

MATERIALS AND

METHODS

��

CHAPTER 2: Materials & Methods

66



67

2.1 REAGENTS

2.1.1 General Solutions

2.1.1.1 Phosphate buffered saline (PBS)

PBS was obtained from the Central Services Unit at the Department of Molecular

and Biomedical Sciences (The University of Adelaide). Endotoxin free PBS was

obtained from the Media Production Unit at the Institute of Medical and Veterinary

Sciences (IMVS) (Adelaide, SA).

2.1.1.2 PBS/Tween

Polyoxyethylene-sorbitan monolaurate (Tween 20) (Sigma Australia, Castle Hill,

NSW, Australia) was added to PBS to a final concentration of 0.05 % (w/v) and the

solution mixed thoroughly.

2.1.1.3 ELISA coating buffer

NaCHO3 was dissolved in Milli-Q water to a concentration of 0.1M, the pH was

adjusted to 9.6 and the solution filter sterilised.

2.1.1.4 Mouse Red Cell Removal Buffer (MRCRB)

MRCRB was prepared by mixing 9 parts Solution A (8.3g NH4Cl made up to 1L

with Milli-Q water) with 1 part Solution B (20.594g TRIS base made up to 1L with

Milli-Q water and adjusted to pH 7.65 with HCl). MRCRB was adjusted to pH 7.2,

filter sterilised and stored at 4°C.

2.1.1.5 Hank’s Balanced Salt Solution (HBSS)

The following reagents were dissolved in Milli-Q water to generate 10X stocks:= and

sterilised by autoclaving: 80g/L NaCl, 4g/L KCl, 0.32g/L NaHPO4 and 10g/L D-

glucose. When required for use, the solution was diluted to 1X in Milli-Q water, and

HEPES buffer (pH 7.4) and CaCl2 were added to a final concentration of 0.01M and

1.6mM respectively.


68

2.1.1.6 Standard isotonic Percoll (SIP)

SIP was prepared by mixing one part 1X HBSS with 9 parts Percoll (Amersham

Pharmacia Biotech Australia, Castle Hill, NSW).

2.1.1.7 Tail tip lysis buffer

Tail tip lysis buffer was made by adding the following ingredients to Milli-Q water:

100mM Tris-HCl pH 8.5, 5mM EDTA, 0.2% SDS and 200mM sodium chloride.

2.1.1.8 Tris Acetate-EDTA Buffer (TAE)

1 x TAE consisted of 0.04M Tris-acetate, 0.02M Na acetate and 1mM EDTA (pH

7.4).

2.1.1.9 DNA loading buffer

1ml of DNA loading buffer consisted of 50μl 1M Tris, 10μl 0.5M EDTA, 100μl

Bromophenol Blue 0.15%, 100μl Xylene cynole 0.5% and 750μl 80% Glycerol.

DNA loading buffer was stored at 4°C.

2.1.1.10 PBS/BSA/Azide for flow cytometery

PBS was mixed with 1% bovine serum albumin (BSA, Sigma) and 0.04% NaN3

(both w/v) and stored at 4°C.

2.1.1.11 PBS/Azide for flow cytometery

PBS was mixed with 0.04% NaN3 (w/v) and stored at 4°C.

2.1.1.12 1-4% Paraformaldehyde (PFA)

PFA (w/v) was prepared by dissolving paraformaldehyde in PBS pH 7.4 at 55°C

with stirring for at least 30 minutes. PFA was stored at 4°C for up to one month or at

-20°C until required.

2.1.1.13 DNase solution for 5-Bromo-2'-Deoxyuridine (BrdU) labelling

Stock solutions of DNase were prepared by dissolving DNaseI (Sigma) to 5,000

U/ml in a solution of 4.2mM MgCl2 + 0.15mM NaCl in Milli-Q water (pH 5.0).


69

Aliquots of the stock solution were stored at -20ºC. When required, an aliquot of

stock solution was thawed and diluted to 50 U/ml in 4.2mM MgCl2 + 0.15mM NaCl.

2.1.1.14 Annexin V staining buffer

Annexin V staining buffer was made up of Milli-Q water with the following

additives: 10mM HEPES (pH 7.4), 140mM NaCl and 5mM CaCl2.

2.1.1.15 1% acid alcohol

10ml of concentrated hydrochloric acid was added to 300ml of distilled water. Seven

hundred ml of commercial grade ethanol was added to the acid/water solution and

mixed thoroughly.

2.1.1.16 Scott’s tapwater substitute

The following reagents were dissolved in Milli-Q water: 2g sodium bicarbonate and

20g magnesium sulphate, then made up to 1L with additional Milli-Q water. The

solution was filter-sterilised and stored at room temperature.

2.1.1.17 Diethyl Pyrocarbonate (DEPC)-treated water

DEPC was diluted to 0.1% (v/v) in Milli-Q water, incubated overnight at room

temperature and then autoclaved.

2.1.1.18 Gill’s haematoxylin

250ml ethylene glycol, 2g Haematoxylin 75290, 0.2g sodium periodate (NaIO4),

17.6g aluminium sulphate (AI2(SO4)3.18H2O) and 20ml glacial acetic acid were

added in that order to 730ml distilled H2O while stirring. The solution was stirred for

1 hour at room temperature until dissolved.

2.1.1.19 Chemotaxis buffer

Chemotaxis buffer was made up by dissolving 0.25g of BSA in 50ml of RPMI-1640

media with 1.25ml of 1M HEPES (IMVS, South Australia).


70

2.1.2 Reagents used in vitro

2.1.2.1 Antibodies

Antibodies used for flow cytometry, ELISA, immunohistochemistry (IHC) and cell

culture are listed in Table 2.1.

2.1.2.2 ELISA reagents

ELISA peroxidase reactions were developed using o-Phenylenediamine

dihydrochloride (OPD) (Sigma, St Louis, MO, USA).

2.1.2.3 Chemokines

A list of chemokines used in chemotaxis experiments in this study is provided in

Table 2.2. The chemokines used in this study were provided by Professor Ian Clark-

Lewis (UBC, Vancouver). All chemokines were functionally tested in this laboratory

using either chemotaxis and/or calcium mobilisation assays.

2.1.2.4 Cytokines

A list of the commercial cytokines used in this study is provided in Table 2.3.

2.1.3 Antigens and Adjuvants used in vivo

2.1.3.1 Myelin Oligodendrocyte Glycoprotein (MOG) peptide 35-55

MOG35-55 is an encephalitogenic peptide of myelin oligodendrocyte glycoprotein.

This was obtained as a kind gift from Professor Iain Clark-Lewis (Biomedical

Research Centre, University of British Colombia, Vancouver, Canada) and was also

purchased from the Biomolecular Research Facility, John Curtain School of Medical

Research, Australian National University, Canberra, Australia as well as GL

Biochem (Shanghai) Ltd. (Shanghai, China). The sequence (N→C terminus) is as

follows: MEVGWYRSPFSRVVHLYRNGK. MOG35-55 was received in desiccated

form and stored at 4°C. For use, 16mg of MOG35-55 was dissolved in 1ml of mQ

water before 9ml of sterile endotoxin-free PBS was added. Suspended MOG35-55 was

stored at -20°C.


71

2.1.3.2 Ovalbumin (OVA) 323-339

OVA323-339 is an antigenic peptide which is recognised by the transgenic TCR of OT-

II (H-2b) mice (section 2.2.1). OVA323-339 was obtained from the Biomolecular

Resource Facility, John Curtin School of Medical Research, Australian National

University, Australia. The sequence (N→C terminus) is as follows:

ISQAVHAAHAEINEAGR. OVA323-33 was received in desiccated form and stored at

4°C.

2.1.3.3 Incomplete Freund’s Adjuvant (IFA)

IFA was made by combining mineral oil (85%; Sigma) and mannide manooleate

(15%; Sigma) and stored at 4°C.

2.1.3.4 Complete Freund’s Adjuvant (CFA)

CFA was prepared by supplementing IFA with 8.33mg/ml Mycobacterium

tuberculosis H37RA (Difco Laboratories, Detroit, MI, USA) and stored at 4°C. The

bacteria were ground using a mortar and pestle in IFA.

2.1.3.5 Pertussis Toxin

Lyophilised, salt free toxin from Bordatella pertussis (List Biological Laboratories)

was reconstituted to 50μg/ml in endotoxin-free PBS. Reconstituted Pertussis toxin

was stored at 4°C and diluted to the required concentration in endotoxin-free PBS

immediately before use.

2.1.4 Inhibitors

All inhibitors are listed in Table 2.4 and are described in further detail below.

2.1.4.1 LY294002

LY294002 was purchased from Calbiochem (Catalogue number 440202) and was re-

suspended in Dimethyl sulfoxide (DMSO) (Sigma Australia # D8418) for use.


72

2.1.4.2 IC87114

The small molecule p110δ inhibitor, IC87114, was synthesised and purified as

described (Patent reference number WO0181346 (359)) and provided for this study

by Kamal Puri at Calistoga Pharmaceuticals (Seattle, USA). IC87114 is a highly

selective inhibitor of p110δ. Its IC50 values for p110α, p110β and p110γ are at least

200-, 150- and 60-fold higher than that for p110δ (359). IC87114 has no inhibitory

activity in vitro toward a number of other kinases, including Akt1, PKCα, PKCβII, c-

Src, p38 MAPK, casein kinase I, checkpoint kinase 1 and DNA-PK (359). For in

vitro studies, IC87114 was re-suspended in DMSO (Sigma Australia # D8418). For

in vivo studies IC87114 was re-suspended in the vehicle described below (section

2.1.4.3).

2.1.4.3 Vehicle for IC87114 use in vivo

IC87114 was administered in vivo in a solution containing 0.5% (w/v)

methylcellulose (supplied by Calistoga Pharmaceuticals)/0.1% (v/v) Tween 80

(Sigma) (Kamal Puri, personal communication). The solution was prepared in the

following manner: 100ml of Milli-Q water was heated to 70-90ºC on a heated stir

plate. Methylcellulose (0.5g per 100ml) and Tween 80 (0.1ml per 100ml) was added

to the water and left on the heated stir plate for 15 minutes. The solution was then

covered with aluminium foil and placed in the dark to stir overnight on a stir plate at

4ºC. The vehicle solution was stored at 4º in the dark for up to 30 days.

IC87114 was suspended in vehicle at a concentration of 7.5mg/ml and thoroughly

vortexed. Mice were administered approximately 30mg/kg of this suspension (i.e.

approximately 80μl per 20g mouse). To stop IC87114 from settling out of the

viscous vehicle the solution was shaken vigorously throughout the dosing procedure.

2.1.5 Cell culture media

2.1.5.1 Foetal calf serum

Foetal calf serum (FCS) was obtained from JRH Biosciences (Lenexa, KS, USA) and

was heat-inactivated by incubation at 55°C for one hour.


73

2.1.5.2 Incomplete media

RPMI 1640 medium (Gibco BRL Life Technologies, Grand Island, NY, USA)

supplemented with 0.1% heat-inactivated FCS and 1% penicillin/gentamycin stock

solution (IMVS, South Australia).

2.1.5.3 Complete media

RPMI 1640 medium supplemented with 10% heat-inactivated FCS and 1%

penicillin/gentamycin stock solution.

2.1.5.4 BMDC media

RPMI 1640 medium supplemented with 10% heat-inactivated FCS, 1%

penicillin/gentamycin stock solution, 2mM L-glutamine (IMVS, South Australia),

55μM 2 beta Mercaptoethanol (IMVS, South Australia).

2.2 ANIMAL MODELS

2.2.1 Mouse strains and conditions

All animals were housed at the University of Adelaide Animal House (Adelaide, SA,

Australia), under standard light and temperature conditions, with food and water ad

libitum. All mice were aged 6-10 weeks at the initiation of experiments. Severely

paralysed mice were afforded easier access to food and water. The p110δD910A/D910A

mice (on the C57Bl6 background) (248) used in this study were obtained from Dr.

Margaret Hibbs, Ludwig Institute for Cancer Research, Melbourne, Australia and

bred at the University of Adelaide Animal House. The OT-II mice used in this study

were obtained from Dr. Christian Engwerda, Queensland Institute for Medical

Research, Queensland, Australia. Age and sex-matched C57BL/6 mice were

purchased from The University of Adelaide Animal House, South Australia or the

Australian Research Council and housed at the University of Adelaide Animal

House. All animals were housed in specific pathogen-free (SPF) barrier rooms.

Animal experiments were performed as approved by The University of Adelaide

Animal Ethics Committee.


74

2.2.2 Genotyping p110δ D910A/D910A mice

Approximately 5mm of the tail tips of p110δD910A/D910A were taken at the time of

weaning (section 2.3.1.1). Tail tips were digested overnight at 55ºC in 100μl of tail

tip lysis buffer (section 2.1.1.7) containing 0.1mg/ml of Proteinase K (Roche # 1-

373-196). The following morning, tubes were placed at 95ºC for 5 minutes before

400μl of Milli-Q water was added. Tails were then centrifuged for 15 minutes at

13,000 RPM and the supernatant used as template for polymerase chain reactions

(PCR). All genotyping PCR was carried out in 0.2ml thin walled PCR tubes

(Scientific Specialities Inc., Lodi, CA, USA) in a Bio-Rad MyCycler

thermocytometer. Primers used for PCR amplification are listed in Table 2.5. All

primers were purchased from GeneWorks (Adelaide, SA) and were of PCR purity.

Primers were received in a lyophilised form, diluted in sterile Milli-Q water and

stored at -20°C. Reactions were carried out with the Immolase enzyme (Bioline #

Bio 21047) with supplied PCR buffer supplemented with MgCl2 at a final

concentration of 2.5μM and dNTPs (Sigma) at a final concentration of 1μM/base per

reaction. Enzyme was added at 2.5U/20μl reaction and 0.5μl of tail tip DNA was

added to each tube. Cycling conditions were as follows: Initial denaturation at 95°C

for 7 minutes, then 35 cycles of 94°C for 20 seconds, 69°C for 20 seconds and 72°C

for 30 seconds. Reactions were incubated for an additional 10 minutes at 72°C to

ensure efficient A-tailing, then maintained at 4°C. Genotypes were determined by

running PCR products on a 1.5% agarose gel before being stained with GelRed

(Jomar # 41003-S) and measured with a Molecular Imager FX (Bio-Rad

Laboratories, Hercules, CA, USA) using Quantity OneTM software. Lanes with bands

at 500bp and 300bp were considered to be heterozygous (p110δD910A/WT) mice and

lanes with bands only at 500bp were considered to be homozygous p110δD910A/D910A

mice.


75

2.2.3 EAE Model

2.2.3.1 Active induction of EAE with MOG35-55

Female C57BL/6 mice received an intravenous dose of 300ng of pertussis toxin

(Sapphire Biosciences # 181) in endotoxin-free PBS on the day of induction. One

hour later mice were immunised with 100μg MOG35-55 (Biomolecular Resource

Facility, John Curtin School of Medical Research, Australian National University

and GL Biochem) in CFA (section 2.1.3.4). The emulsion contained equal volumes

of MOG35-55 (1.6mg/ml in endotoxin-free PBS) and CFA. Fifty microlitres was

injected subcutaneously (s.c.) into each hind flank and 20μl was injected s.c. into the

scruff of the neck. Two days later mice were again injected intravenously with 300ng

of pertussis toxin.

2.2.3.2 Clinical assessment of EAE

Mice were observed daily until day 30 for clinical signs of EAE. Disease severity

was scored on a scale from 0 (asymptomatic) to 5 (moribund). Clinical scores were

assigned as follows: 0 = no clinically detectable signs of EAE were observed; 1 =

partial tail and/or hind limb paralysis; 2 = complete tail paralysis; 2.5 fully flaccid

tail and some visible hind limb paralysis; 3 = hind limb and tail paralysis; 4 = hind

limb and forelimb paralysis; 5 = moribund. Animals that reached a score of 4 were

euthanased after 24 hours if no partial recovery was made.

2.2.4 CFA immunisation

CFA emulsions were prepared by thoroughly mixing one part CFA (section 2.1.3.4)

with one part endotoxin-free PBS (IMVS, South Australia). Fifty microlitres of CFA

emulsion was injected subcutaneously in both of the hind flanks of mice and 20μl

was injected subcutaneously into the scruff of the neck.

2.2.5 In vivo administration of IC87114

Mice were administered IC87114 via oral gavage. A 20 gauge needle (Popper #

7902) was used to inject 30mg/kg of IC87114 in vehicle (sections 2.1.4.2 and


76

2.1.4.3) twice daily (at approximately 9am and 5pm). Mice used were between 16-

22grams each and were between 6-11 weeks of age.

2.2.6 FITC paint assay

The abdomen of naïve mice was shaved and painted with 150μl of a 1:1 solution of

acetone and di-butylphthalate containing 1% FITC powder. Forty-eight hours later

single cell suspensions were generated from the inguinal and brachial lymph nodes

as described in section 2.3.1.4. Cells were then stained with anti-CD11c antibody

(Table 2.1) and were analysed by flow cytometry (sections 2.3.2.2 and 2.3.2.7).

2.3 ANALYTICAL AND FUNCTIONAL ASSAYS

2.3.1 Collection of tissues

2.3.1.1 Collection of tail tips for genotyping

Mice were weaned from their mothers at three weeks of age by staff members of the

University of Adelaide Animal House. During the weaning process, mice were

anaesthetised with Isoflourane (VCA, NSW, Australia) and approximately 0.5cm of

the tip of their tails was removed with scissors and stored in an eppendorf tube. Tail

tips were frozen at -20ºC until use.

2.3.1.2 Collection of mouse serum

Mice were sacrificed by carbon dioxide asphyxiation. The rib cage was then

immediately reflected back to expose the heart, which was perforated at the left

ventricle with surgical scissors. Blood was collected from the chest cavity into

eppendorf tubes and allowed to clot overnight at 4°C. Tubes were then centrifuged at

1,000 x g for 10 minutes at 4°C. Serum was collected and stored at -20°C.

2.3.1.3 Collection of mouse plasma

Mice were sacrificed by carbon dioxide asphyxiation. The rib cage was then reflected

back to expose the heart, which was perforated at the left ventricle with surgical

scissors. Blood was collected from the chest cavity and immediately placed in


77

Lithium Heparin coated tubes (IMVS, South Australia) and centrifuged at 2,500 x g

for 15 minutes at 4ºC. Plasma was collected and stored at -80°C. Shipments of

plasma were sent on dry ice.

2.3.1.4 Preparation of single cell suspensions from lymphoid organs

Mice were sacrificed by carbon dioxide asphyxiation and lymph nodes and/or

spleens were removed by blunt dissection. Organs were individually gently

homogenised using two microscope slides with frosted ends (VWR Scientific #

48312-002) in 5ml of complete media (section 2.1.5.3). When lymph node cells were

being stained with anti-DC markers they were also treated for 30 minutes with

collagenase (Sigma # C2674) at 37ºC and with 5% CO2 before being homogenised.

The resulting suspensions were filtered through cell strainers (BD Biosciences

Labware) and suspended in a further 5ml of complete medium. Following 5 minutes

of centrifugation, lymph node cells were counted and re-suspended in the appropriate

solution for the subsequent experiment. Before cell counting, splenocytes were

suspended in 7ml MRCRB (section 2.1.1.4) and incubated at 37°C for 5 minutes.

Following centrifugation splenocytes were re-suspended appropriately for

subsequent experiments.

2.3.1.5 Collection of spinal cords for flow cytometry

To remove spinal cords, mice were sacrificed by carbon dioxide asphyxiation and

perfused through the left ventricle with PBS to remove circulating leukocytes. The

spinal cord was extracted from the spinal column using scissors to cut the vertebrae

and a scalpel to remove the cord. Spinal cords were then gently crushed through a

cell strainer. The resultant cell suspension was collected in 30ml of RPMI 1640 plus

10% FCS, and 20ml of 90% Percoll (Amersham Pharmacia Biotech, Little Chalfont,

UK) was added, before centrifuging at 1000 x g for 25 minutes at 4°C, with no

brake. Following centrifugation, the myelin cake was discarded, the cells were

washed twice then re-suspended in PBS/BSA/Azide for antibody labeling (section

2.1.1.10).


78

2.3.1.6 Collection and storage of spinal cords for immunohistochemistry

To remove spinal cords, mice were sacrificed by carbon dioxide asphyxiation and

perfused through the left ventricle with PBS to remove any circulating lymphocytes.

The spinal cord was extracted from the spinal column using scissors to cut the

vertebrae and a scalpel to remove the cord. Spinal cords were embedded in Tissue-

Tek® OCT embedding medium (Sakura Finetek, Torrance, CA, USA) and frozen

using the Gentle Jane snap-freezing system (Instrumedics Inc. Hackensack, NJ,

USA). Blocks were stored at -80°C until sectioning for IHC (section 2.3.3).

2.3.1.7 Collection of bone marrow-derived dendritic cells

Mice were euthanased and femurs were removed, rinsed with 70% ethanol and

placed into warm PBS. Bone marrow was flushed out by cutting either end of the

bone with dissecting scissors into a 10cm2 tissue culture dish (Falcon) with a 1mL

syringe and 27G needle using warm BMDC medium (section 2.1.5.4). The cells were

then centrifuged at 300 x g for 5 minutes at room temperature before being

suspended in 6mL of MRCRB (section 2.1.1.4) and incubated for 5 minutes at 37ºC.

Cells were then centrifuged and washed with 10ml of PBS, re-centrifuged and re-

suspended in PBS while cell counts were performed.

2.3.2 Flow cytometery

2.3.2.1 Labelling cells with Carboxyfluorescin diacetate succinimidyl ester (CFSE)

Single cell suspensions were generated as described in section 2.3.1.4 and cells were

suspended in incomplete media (section 2.1.5.2) at a concentration of 2 x 107/ml to

be labelled with CFSE (Molecular Probes, Eugene, OR, USA # C1157). CFSE,

which was stored at a stock concentration of 5mM in DMSO, was diluted 1:40 in

incomplete media. Two microlitres of diluted CFSE was added per 100μl of cells and

immediately shaken vigorously to ensure even staining of CFSE. After incubation at

37°C for 10 minutes, the reaction was quenched by the addition of 15ml of complete

media and incubated at room temperature for 5 minutes, followed by two washes in

the same medium. Cells were then re-suspended at the required concentration for

subsequent assays.


79

2.3.2.2 Standard surface staining protocol

Cells were isolated as described (section 2.3.1.4 and 2.3.1.5) before being

resuspended to 4 x 106 viable cells/ml in PBS. Fc receptors were blocked by

incubating for 20 minutes at room temperature with 50μg of murine gamma-globulin

(Rockland D609-0100) per million cells, then 50μl of cells was aliquoted into wells

of 96 well round-bottom plates (BD FalconTM #353077). For experiments where an

un-conjugated primary antibody was used, cells were incubated for 30 minutes at

room temperature with 10μl of antibody at concentrations indicated in Table 2.1.

Following this incubation, cells were washed with 180μl of PBS/BSA/Azide (section

2.1.1.10), centrifuged at 400 x g for 1 minute, after which the supernatant was flicked

off. Fifty microlitres of fluorophore-conjugated secondary antibody was then added

to relevant wells at concentrations indicated in Table 2.1. Following a 30 minute

incubation at 4°C in the dark, cells were once again washed with 180μl of

PBS/BSA/Azide. If conjugated secondary antibodies were then being used, any

potential cross reactivity of the anti-rat secondary for rat and mouse

immunoglobulins was prevented by pre-blocking the secondary antibody with 10μl

of 2mg/ml rat gamma-globulin (Rockland D611-0050) for 20 minutes at 4°C.

Fluorochrome-conjugated antibodies were then added and incubated for 30 minutes

on ice in the dark (Table 2.1). Cells were washed with PBS/Azide (section 2.1.1.11)

then re-suspended in 200μl of PBS/Azide. Cells were then immediately acquired on a

flow cytometer (section 2.3.2.7). If flow cytometric acquisition was not performed

immediately cells were instead re-suspended in 200μl of PFA (1% in PBS) and

stored in the dark at 4°C.

2.3.2.3 Intracellular cytokine staining

Single cell suspensions were generated as described in sections 2.3.1.4 and 2.3.1.5.

In experiments where intracellular cytokines were detected, cells were activated for

four hours at 37ºC in RPMI 1640 media containing 20ng/ml PMA (Sigma), 1μM

ionomycin (Invitrogen) and GolgistopTM (BD Biosciences). Cells were then washed

with PBS/BSA/Azide (section 2.1.1.10), blocked with 1.25μl murine gamma-

globulin (10mg/ml - Rockland D609-0100) for 20 minutes at room temperature and

incubated with the anti-CD4:PECy7 antibody (Table 2.1) for 30 minutes at 4ºC. Cells


80

were then washed with PBS/BSA/Azide and fixed and permeabilised using a

Cytofix/Cytoperm kit (BD Biosciences # 554715) according to the manufacturer’s

instructions. Intracellular IFN-γ and IL-17 was then stained for using the anti-IFN-

γ:FITC and anti-IL-17:PE antibodies as described in Table 2.1. Cells were then

washed in PBS/Azide and re-suspended in PBS/1% PFA and analysed on a BD LSR

II flow cytometer (section 2.3.2.7). If flow cytometric acquisition was not performed

immediately cells were stored in the dark at 4°C and acquired within 4 days of

staining.

2.3.2.4 Intracellular BrdU staining

Mice were fed BrdU (Sigma) in their drinking water as described in section 2.3.5.2

before single cell suspensions were generated (sections 2.3.1.4). Cells were then re-

suspended in PBS/BSA/Azide (section 2.1.1.10) at 4 x 106/ml and 50μl was added to

wells of 96-well trays (Falcon # 353077). Fc receptors on cells were blocked by

adding 1.25μl of murine gamma-globulin (10mg/ml - Rockland D609-0100) to each

well and incubating at room temperature for 20 minutes. Ten microlitres of primary

anti-CD4:PECy7 antibody (Table 2.1) was then added to each well and incubated at

4ºC for 30 minutes. Following washing with PBS cells were transferred to tubes

(Falcon # 352008), centrifuged and re-suspended in 500μl NaCl (0.15M) before

1.2ml of ice-cold 95% ethanol was added in a drop-wise manner whilst vortexing.

Tubes were then incubated on ice for 30 minutes in the dark before cells were

washed in 2ml of cold PBS. Cells were then re-suspended in 1ml of DNase solution

(section 2.1.1.13), incubated for 30 minutes at 37ºC with 5% CO2. Following this

incubation, cells were washed in 2ml of PBS then incubated for 30 minutes at 4ºC

with 10μl of anti-BrdU:FITC antibody (Table 2.1). Cells were then suspended in

200μl of PBS and transferred to a 96-well tray which was centrifuged. Cells were

then resuspended in 200μl of PBS/1% PFA and acquired on a BD LSR II flow

cytometer (section 2.3.2.7). If flow cytometric acquisition was not performed

immediately cells were stored in the dark at 4°C and acquired within 4 days of

staining.


81

2.3.2.5 Intracellular FoxP3 staining

Single cell suspensions were generated as described in section 2.3.1.4. Cells were

then re-suspended in PBS/BSA/Azide (section 2.1.1.10) at 4 x 106/ml and 50μl was

added to wells of 96-well trays (Falcon # 353077). Fc receptors on cells were

blocked by adding 1.25μl of murine gamma-globulin (10mg/ml - Rockland D609-

0100) to each well and incubating at room temperature for 20 minutes. Ten

microlitres of both anti-CD4:PECy7 and anti-CD25:FITC antibodies (Table 2.1)

were then added to each well and incubated at 4ºC for 30 minutes. Cells were then

washed with PBS/BSA/Azide before being suspended in 200μl of Fix/Perm solution

(eBioscience # 00-5121-00) and incubated overnight at 4ºC. In the morning, cells

were washed once with 200μl Permeabilisation buffer (eBioscience # 00-8333-56)

then incubated with 10μl of anti-FoxP3:PE antibody (Table 2.1) for 30 minutes on

ice in the dark. Cells were then washed once in Permeabilisation buffer before being

suspended in 200μl of PBS/1% PFA for acquisition on a BD LSR II flow cytometer

(section 2.3.2.7). If flow cytometric acquisition was not performed immediately cells

were stored in the dark at 4°C and acquired within 4 days of staining.

2.3.2.6 Annexin V and Propidium Iodide staining

Single cell suspensions were generated as described in section 2.3.1.4. Cells were

then re-suspended in PBS/BSA/Azide (section 2.1.1.10) at 4 x 106/ml and 50μl was

added to wells of 96-well trays (Falcon # 353077). Fc receptors on cells were

blocked by adding 1.25μl of murine gamma-globulin (10mg/ml - Rockland D609-

0100) to each well and incubating at room temperature for 20 minutes. Ten

microlitres of either anti-CD4:PECy7 or anti-B220:PECy7 antibodies (Table 2.1)

was then added to wells and incubated at 4ºC for 30 minutes. Cells were then washed

with Annexin V staining buffer (section 2.1.1.14) and 100μl of Annexin V staining

buffer, containing 2μl of Annexin V:FITC (MBL # BV-1001-5) and 1μl of

propidium iodide (Sigma # P4864), was added to each well. Cells were incubated at

room temperature in the dark for 10-15 minutes before being centrifuged at 400 x g

for 1 minute and re-suspended in 200μl of Annexin V staining buffer. Cells were

immediately acquired on a BD LSR II flow cytometer (section 2.3.2.7).


82

2.3.2.7 Flow cytometric analysis

Cell fluorescence data was acquired on a Becton Dickinson LSRII or FACSCanto

flow cytometer and data were analysed using either BD FACSDiva or FlowJo

software. Lymphocytes were gated using forward- and side-scatter characteristics

and isotype controls were used to determine gating for cell surface and intracellular

antibodies.

2.3.3 Immunostaining of tissues

2.3.3.1 Preparation of spinal cord sections

Spinal cords were collected and frozen in Tissue-Tek® OCT as described in section

2.3.1.6. Before sectioning, blocks were allowed to equilibrate to a temperature of -

20°C. Ten micron cryostat sections were cut from embedded tissue, air dried on

microscope slides, then stored at -20°C until they were used for immunostaining

(section 2.3.3.2).

2.3.3.2 Immunohistochemical staining of tissue sections

Frozen sections were prepared as described in section 2.3.3.1 and stored at -20ºC.

Before use, slides were equilibrated to room temperature for 1 hour prior to use.

Slides were then fixed in 100% ice-cold acetone for 10 minutes before being

rehydrated in PBS. Endogenous peroxidise activity was blocked with 0.3% hydrogen

peroxide for 10 minutes before slides were washed through 3 changes of PBS.

Sections were then blocked with 100μg/ml murine gamma globulin (Rockland D609-

0100) for 30 minutes in a humid chamber at room temperature. After 3 washes in

PBS, slides were incubated with primary antibody (Table 2.1) for 1 hour in a humid

chamber at 4ºC. After 3 washes in PBS, slides were incubated with HRP-conjugated

anti-Rat secondary antibody for 1 hour in a humid chamber at 4ºC. Slides were then

washed 3 times with PBS and binding of antibodies was revealed by incubation with

3,3’-diaminobenzidine (DAB) substrate (DAKO, NSW, Australia). Sections were

counterstained with haematoxylin (section 2.3.3.3), mounted and examined by

routine light microscopy.


83

2.3.3.3 Haematoxylin staining

Slides were stained with antibodies as described in section 2.3.3.2. Slides were then

immersed in Gill’s haematoxylin (section 2.1.1.18) for approximately 4 minutes

(depending on the strength and age of the haematoxylin). Slides were then immersed

in Scott’s tapwater substitute (section 2.1.1.16) for 1 minute then distilled water for 1

minute. Slides were then subjected to ethanol (70% ethanol for 2 minutes, 95%

ethanol for 2 minutes, 100% ethanol for 2 minutes, followed by immersion in clean

100% ethanol for another 2 minutes) before being immersed in two batches of

Safsolvent (Ajax Finechem # A2537) for 5 minutes each. Slides were then allowed to

briefly air-dry before being mounted with DePeX (BDH # 361254D) and examined

by routine light microscopy.

2.3.4 Cell culture

2.3.4.1 Overnight culture of cells for chemotaxis assays

Mice were euthanased and primary cells were isolated as described in section 2.3.1.4.

Cells were cultured overnight in 4ml of complete media (section 2.1.5.3) at a

concentration of 2 x 107 cells per well in a 6 well tissue culture tray.

2.3.4.2 In vitro culture of immature dendritic cells from bone marrow

Dendritic cells were removed from the bone marrow and single cell suspensions

were generated as described in section 2.3.1.7. Bone marrow cells were then

suspended to 2 x 105 cells/ml in 2ml of warm BMDC media (section 2.1.5.4) with

20ng/ml of recombinant GM-CSF (rmGM-CSF) (Biosource # PMC 2015) and added

to a single well of a six well tissue culture dish (Falcon # 353046). Cells were

cultured at 37ºC in 5% CO2 for 10 days. On day 3 another 2ml of BMDC media with

20ng/ml rmGM-CSF was added. On day 6 and 8, 2ml of cell suspension was

removed and centrifuged at 300 x g for 4 minutes before the supernatant was

removed and cells re-suspended in 2ml of fresh BMDC media with 20ng/ml rmGM-

CSF and added back to the plate. On day 10, immature BMDCs were used for DC

antigen presentation assays (section 2.3.8) or subjected to maturation culture

conditions (section 2.3.4.3).


84

2.3.4.3 Maturation of BMDCs in vitro

To produce a mature phenotype in BMDCs, cells were cultured for 10 days in

conditions described in section 2.3.4.2 to generate immature BMDCs. On day 10, the

2ml cell suspension was removed, cells were centrifuged at 300 x g for 5 minutes

and resuspended in 2ml of fresh BMDC media with 10ng/ml rmGM-CSF (Biosource

# PMC 2015), 1μg/ml LPS (made in-house) and 8.5ng/ml TNF-α (Biosource # PMC

3014). Cells were then added back to the well and cultured overnight. On day 11,

cells which had adhered to the plastic were gently loosened using a cell scraper

before supernatant was removed from the wells. Cells were then washed and re-

suspended at the required concentration for in vitro chemotaxis assays (section

2.3.7.2).

2.3.4.4 Anti-CD3/anti-CD28 stimulated culture conditions

Cells were isolated from the spleens of mice as described in section 2.3.1.4. In some

cases cells were also stained with CFSE (section 2.3.2.1). During the process of

isolating the cells, 96 well plates (Falcon # 353077) were coated with 50μl of anti-

CD3 antibody (clone #2C11, produced in-house and affinity purified) at 10μg/ml in

PBS for 1 ½ hours at 37ºC. Following this incubation, plates were washed twice with

PBS before 100μl of complete media containing 1μg/ml anti-CD28 was added (Table

2.1) (antibody value indicates final concentration). Cells were re-suspended at a

concentration of 2.5 x 106 cells/ml before 100μl of cells were placed into each well.

Plates were cultured for 4 days at 37ºC in 5% CO2 before cells were subjected to

flow cytometric analysis as described in section 2.3.2.7. In cases where cells were

inhibited with IC87114, cells were pre-incubated with the inhibitor or controls

(section 2.1.4) for at least 15 minutes prior to being added to the well.

2.3.4.5 PHA stimulated culture conditions

Cells were isolated from the spleens of mice as described in section 2.3.1.4. In some

cases cells were also stained with CFSE (section 2.3.2.1). 100μl of complete media

containing 100μg/ml PHA (Sigma # L9132) as well as 100μl of cells suspended to a

concentration of 2.5 x 106 cells/ml were added to relevant wells (therefore PHA was

at a final concentration of 50μg/ml). Plates were cultured for 4 days at 37ºC in 5%


85

CO2 before cells were subjected to flow cytometric analysis as described in section

2.3.2.7. In cases where cells were inhibited with IC87114, cells were pre-incubated

with the inhibitor or controls (section 2.1.4) for at least 15 minutes prior to being

added to the well.

2.3.4.6 Th1-skewing culture conditions

Cells were isolated from the spleens of mice as described in section 2.3.1.4. During

the process of isolating the cells, 96 well plates (Falcon # 353077) were coated with

50μl of anti-CD3 (clone #2C11, produced in-house and affinity purified) antibody at

10μg/ml in PBS for 2 hours at 37ºC. Following this incubation, plates were washed

twice with PBS before 100μl of complete media containing the following additives:

1μg/ml anti-CD28 and 10ng/ml IL-12 (cytokine and antibody values indicate final

concentration) (Table 2.3). Cells were re-suspended at a concentration of 2.5 x 106

cells/ml before 100μl of cells were placed into each well. In cases where cells were

inhibited with IC87114, cells were pre-incubated with the inhibitor or controls

(section 2.1.4) for at least 15 minutes prior to being added to the well. Plates were

cultured for 4 days at 37ºC in 5% CO2 before cells were stained for flow cytometric

analysis with anti-CD4, anti-IFN-γ and anti-IL-17 antibodies as described in sections

2.3.2.2 and 2.3.2.3.

2.3.4.7 Th17-skewing culture conditions

Cells were isolated from the spleens of mice as described in section 2.3.1.4. During

the process of isolating the cells, 96 well plates (Falcon # 353077) were coated with

50μl of anti-CD3 (clone #2C11, produced in-house and affinity purified) antibody at

10μg/ml in PBS for 2 hours at 37ºC. Following this incubation, plates were washed

twice with PBS before 100μl of complete media containing the following additives

was added: 1μg/ml anti-CD28 and 10μg/ml anti-IFN-γ, 10μg/ml anti-IL-4, 10ng/ml

IL-1β, 5ng/ml TGF-β, 20ng/ml IL-6 and 10ng/ml IL-23 (cytokine and antibody

values indicate final concentration) (Table 2.3). Cells were re-suspended at a

concentration of 2.5 x 106 cells/ml before 100μl of cells were placed into each well.

In cases where cells were inhibited with IC87114, cells were pre-incubated with the

inhibitor or controls (section 2.1.4) for at least 15 minutes prior to being added to the


86

well. Plates were cultured for 4 days at 37ºC in 5% CO2 before cells were stained for

flow cytometric analysis with anti-CD4, anti-IFN-γ and anti-IL-17 antibodies as

described in sections 2.3.2.2 and 2.3.2.3.

2.3.5 Proliferation assays

2.3.5.1 Analysis of cell division ex vivo by CFSE dye dilution

Mice immunised with MOG35-55 in CFA (section 2.2.3.1) were euthanased 9 days

post-immunisation and the draining inguinal and brachial lymph nodes were taken

for proliferation assays (section 2.3.1.4). Cells were labelled with CFSE as described

in section 2.3.2.1 before being suspended at a final concentration of 2.5 x 106

cells/ml. In a 200μl volume, 2.5 x 105 cells were cultured in 96-well round-bottom

trays with added MOG35-55 at a concentration of 25 or 50μg/ml, or with 1.5μg/ml

Concanavalin A (ConA; Amersham Pharmica Biotech, Australia). Wells that

contained no stimulating antigen were included as a negative control. After 3 days of

culture at 37°C in a humidified atmosphere containing 5% CO2, 50μl of complete

media was added to each well to replenish nutrients. On the fourth day of culture

cells were harvested and analysed by flow cytometry (section 2.3.2.7). Cell division

(proliferation) was determined as a progressive halving of CFSE fluorescence

intensity.

2.3.5.2 Detection of in vivo cellular proliferation by BrdU incorporation

BrdU was dissolved to 0.8mg/ml in the drinking water of the animals starting at day

6 post-immunisation. The drinking bottles were covered in aluminium foil to prevent

light-induced degradation of BrdU. Mice were culled at day 9 post-immunisation,

single cell suspensions of lymphocytes from draining inguinal and brachial lymph

nodes were generated (section 2.3.1.4) and flow cytometric analysis was performed

to analyse BrdU incorporation to DNA (section 2.3.2.4).


87

2.3.6 ELISA

2.3.6.1 Two-site (sandwich) ELISA for IgG detection

Neuro-antigen (MOG35-55) specific IgG was measured through two-site (sandwich)

peroxidise ELISA assays. High-protein-binding ELISA plates (Corning) were

incubated overnight at 4°C with 200ng/well MOG35-55 in 200μl of ELISA coating

buffer (section 2.1.1.3). Plates were then washed three times with 200μl PBS/Tween

per well (section 2.1.1.2) before being blocked for 2 hours with 3% BSA (Sigma) in

PBS at room temperature. Following three more washes with PBS/Tween, 100μl of

serum at a 1:5 dilution in PBS/BSA 1% was added and incubated for 90 minutes at

room temperature. Plates were washed four more times with PBS/Tween before

100μl of 1:5,000 anti-mouse IgG:HRP (Table 2.1) in PBS/BSA 1% was added. After

incubation for 45 minutes at room temperature plates were washed five times with

PBS/Tween. All detection plates were then developed using 200μl/well o-

Phenlenediamine dihydrochloride (Sigma FastTM OPD; Sigma) as per the

manufacturer’s specifications. Reactions were stopped with 50μl 3M HCl and the

intensity was read at 490nm with a Bio-Rad plate reader. Serum from naïve mice was

used as a negative control.

2.3.6.2 Two-site (sandwich) ELISA for cytokine detection

High protein-binding ELISA plates (Costar # 3590, Corning International, NY, USA)

were coated with either anti-IFN-γ or anti-IL-17 capture antibodies in ELISA coating

buffer (section 2.1.1.3) overnight at 4ºC. Plates were washed three times in

PBS/Tween (section 2.1.1.2) before being blocked with 3% BSA (Sigma) in PBS and

incubated at room temperature for 2 hours. Following this incubation, plates were

washed three times and samples (culture supernatants at a 1:15 dilution in 1%

BSA/PBS solution) were added and incubated for 1 ½ hours at room temperature. A

standard curve was generated by using known concentrations of either recombinant

IFN-γ (R&D # 485 MI-100) or IL-17 (R&D # 421 ML-025). Plates were then

washed three times and biotinylated secondary antibodies were added for 45 minutes.

Plates were then re-washed four times and SA:HRP (Rockland # S00-03) was added

for 30 minutes at room temperature before washing five times. Detection was


88

performed by adding 200μl of Sigma FastTM OPD (Sigma # P9187) to each well for

up to 15 minutes. Reactions were stopped with 50μl of 3M HCl and read on a

Biotrack II plate reader at 490nm. ELISA assays were analysed using the GraphPad

Prism program. A standard curve, and all experimental samples, were analysed using

several equations. First, data was transformed using the following equation:

X=Log[X]. Then, the standard curve was determined by performing a sigmoidal

dose-response (variable slope) where the goodness of fit for the standard curve was

deemed sufficient if it was over R2= 0.98. Unknown X values were then transformed

using the following equation: Y=10Y, to obtain a final concentration of pg/ml. Data

were then normalised depending on the initial sample dilution during incubation in

the ELISA assay.

2.3.7 Transwell chemotaxis assays

2.3.7.1 Transwell chemotaxis assay with splenocytes

Following isolation of splenocytes from mice (section 2.3.1.4) and overnight

incubation (section 2.3.4.1), cells were washed in PBS before being resuspended to 1

x 107 cells/ml and subjected to transwell chemotaxis assays. Chemokines, in 600μl of

chemotaxis buffer, were added to the lower chambers of a transwell plate (6.5mm

diameter filter, 5μm pore size; Corning, NY, USA). After adding 100μl of cells to the

upper chambers, the assay was incubated for 3 hours at 37º and 5% CO2. Controls

included media only in the lower transwell (to assess spontaneous migration of cells

through the filter) and wells which included 100% of input cells were used as a

control to enumerate migrated cells. Following the 3 hour incubation, cells were

collected from the lower chamber after extensive washing of the filter underside with

the chemotaxis buffer from the lower chamber. Collected cells were centrifuged at

8,000 rpm for 4 minutes. Cells were then subjected to staining with anti-CD4 and

anti-B220 antibodies (Table 2.1) and flow cytometric analysis (section 2.3.2.7).

Unlabelled Calibrite beads (BD # 349502) were used to enumerate the number of

cells per 5,000 beads and this was compared to the standard curve values to

determine the total number of migrated cells.


89

2.3.7.2 Transwell chemotaxis assay with dendritic cells

Mature BMDCs were generated as described in section 2.3.4.3. Following the 11 day

culture, BMDCs were washed in PBS before being labelled with CFSE (section

2.3.2.1), re-washed and resuspended to 5 x 106 cells/ml and subjected to transwell

chemotaxis assays. The chemokine CCL19, in 600μl of chemotaxis buffer, was

added to the lower chambers of a transwell plate (6.5mm diameter filter, 5μm pore

size; Corning, NY, USA) at final concentrations of 0.3μg/ml or 10μg/ml. After

adding 100μl of cells to the upper chambers, the assay was incubated for 3 hours at

37º and 5% CO2. In cases where cells were inhibited with IC87114, cells were pre-

incubated with the inhibitor or controls (section 2.1.4) for at least 30 minutes prior to

being added to the well. Controls included media only in the lower transwell (to

assess spontaneous migration of cells through the filter) and wells which included

100% of input cells were used to enumerate migrated cells. Following the 3 hour

incubation, cells were collected from the lower chamber after extensive washing of

the filter underside with the chemotaxis buffer from the lower chamber. Collected

cells were centrifuged at 8,000 rpm for 4 minutes before being suspended in 100μl of

PBS and placed into wells of a black 96 well tray (Costar # 3631). Migration was

measured using a Molecular Imager FX (BioRad) with excitation at 488nm and

emission at 494nm. The migration index was determined by dividing the value

obtained for the experimental sample by the value of the no-chemokine negative

control.

2.3.8 Dendritic cell antigen presentation assay

Immature BMDCs were generated from naïve C57BL/6 mice as described in section

2.3.4.2. To pulse BMDCs with antigen, 104 immature BMDCs per well of 96 well

trays were incubated for a period of 2 hours in the presence of OVA323-339

(Biomolecular Resource Facility, John Curtin School of Medical Research,

Australian National University) in complete media. During this incubation, spleens

were isolated from OT-II mice (section 2.3.1.4) and were labelled with CFSE

(section 2.3.2.1). Following the 2 hour DC antigen-pulsing incubation, cells were

washed twice with PBS before 2.5 x 105 CFSE-labelled OT-II lymphocytes were

added to each well. Cells were cultured for 4 days at 37ºC and 5% CO2. On the third


90

day of the culture, 50μl of complete media was added to each well to replenish

nutrients. Following the culture period, cells were labelled with anti-CD4 antibodies

(Table 2.1) before cell division (proliferation) was determined as a progressive

halving of CFSE fluorescence intensity by flow cytometry (section 2.3.2.7). In cases

where DCs were treated with IC87114 or DMSO, the inhibitor (10μM IC87114) or

an equal volume of DMSO control were added for the 2 hour DC pulsing step before

being washed away during the PBS washes. When responding OT-II cells were

treated with IC87114 or DMSO the inhibitor or equal volumes of DMSO were added

to cells at least 15 minutes prior to cells being added to wells containing DCs.

2.3.9 GC/MS analysis of IC87114 in plasma

All GC/MS analysis of IC87114 in plasma was carried out at Calistoga

Pharmaceuticals (Seattle, USA). Plasma from animals that had not received IC87114

was used as a negative control.

2.3.10 Statistical analysis

All statistical analysis was performed in GraphPad Prism 3 or GraphPad Prism 5

software using students t tests where *P<0.05, **P<0.01 and ***P<0.001.


91


Table 2.1: Antibodies used in this study

Antigen Conjugation Isotype Vendor Catalogue # Concentration Use PRIMARY ANTIBODIES

BrdU FITC RatIgG1 BD 347587 50μg/ml Flow cytometry CCR6 None RatIgG2a R & D MAB 590 50μg/ml Flow cytometry CCR6 PE RatIgG2a R & D FAB 590P 20μg/ml Flow cytometry CCR7 None RatIgG2a In-house Clone 4B12 50μg/ml Flow cytometry CD3 None RatIgG2a In-house Clone 2C11 10μg/ml Cell culture CD4 Alexa647 RatIgG2a BD 557681 20μg/ml Flow cytometry CD4 FITC RatIgG2a BD 553729 50μg/ml Flow cytometry CD4 PE RatIgG2a BD 553652 20μg/ml Flow cytometry CD4 PE Cy7 RatIgG2a BD 552784 20μg/ml Flow cytometry CD11c PE Arm.Ham.IgG1 BD 557401 20μg/ml Flow cytometry CD25 FITC RatIgM BD 553071 50μg/ml Flow cytometry CD28 None RatIgG2a BD 553294 1μg/ml Cell culture CD44 FITC RatIgG2b BD 553133 50μg/ml Flow cytometry CD45 None RatIgG2b BD 553077 100μg/ml IHC CD45R (B220) None RatIgG2a BD 550286 3.125μg/ml IHC CD45R (B220) PECy7 RatIgG2a BD 552772 20μg/ml Flow cytometry CD45R (B220) PerCP Cy5.5 RatIgG2a BD 552771 20μg/ml Flow cytometry CD62L PE RatIgG2a BD 553151 20μg/ml Flow cytometry CD86 None RatIgG2a BD 553691 50μg/ml Flow cytometry CXCR3 None RatIgG2a R & D MAB 1685 50μg/ml Flow cytometry FoxP3 PE RatIgG2a eBioscience 11-5773 20μg/ml Flow cytometry IFN-γ FITC RatIgG1 BD 554411 50μg/ml Flow cytometry IFN-γ None RatIgG1 BD 551216 1μg/ml ELISA - capture IFN-γ Biotin RatIgG1 BD 554410 0.5μg/ml ELISA - detection IFN-γ None RatIgG1 BD 551216 10μg/ml Cell culture

IL-4 None RatIgG1 BD 555434 10μg/ml Cell culture IL-17 PE RatIgG1 BD 559502 20μg/ml Flow cytometry IL-17 None RatIgG1 BD 555068 1μg/ml ELISA - capture IL-17 Biotin RatIgG2a BD 555069 0.5μg/ml ELISA - detection MHC II (I-A/I-B) None RatIgG2a BD 553622 50μg/ml Flow cytometry

SECONDARY ANTIBODIES/REAGENTS Biotin SA:HRP Rockland S000-03 1:20,000 ELISA MouseIgG HRP Rockland 210-1307 1:5,000 ELISA RatIgG Alexa647 Molecular probes A21247 1:250 Flow cytometry RatIgG FITC Jackson 712-095-453 1:100 Flow cytometry RatIgG PE BD 554685 1:100 Flow cytometry RatIgG HRP Jackson 712-036-150 1:50 IHC

CONTROL ANTIBODIES Arm.Ham.IgG1 PE BD 559954 20μg/ml Flow cytometry MouseIgG FITC In-house Clone XC3 50μg/ml Flow cytometry RatIgG2a None R & D MAB 006 100μg/ml or

3.125μg/ml IHC

RatIgG2a None R & D MAB 006 50μg/ml Flow cytometry RatIgG2a Alexa647 BD 557690 20μg/ml Flow cytometry RatIgG1 FITC In-house Clone TP9 50μg/ml Flow cytometry RatIgG2a PE BD 553930 20μg/ml Flow cytometry RatIgG2a PE Cy7 BD 552775 20μg/ml Flow cytometry RatIgM FITC BD 553942 50μg/ml Flow cytometry


94

Table 2.2: Chemokines used in this study

Chemokine Description Concentration Source Application

CCL19 Synthetic protein 0.5μg/ml * Chemotaxis CCL21 Synthetic protein 4μg/ml * Chemotaxis CXCL13 Synthetic protein 1μg/ml * Chemotaxis * From Ian Clark-Lewis (Biomedical Research Centre, University of British

Colombia, Vancouver, Canada)


95

Table 2.3: Cytokines used in this study

Description Source Catalogue # Application

muIFN-γ Recombinant R&D 485-MI ELISA muIL-17 Recombinant R&D 421-ML-025 ELISA muIL-6 Recombinant R&D 406-ML-005 Cell culture ratIL-1β Recombinant PeproTech 400-01B Cell culture muIL-12 Recombinant R&D 419-ML-010 Cell culture muIL-23 Recombinant R&D 1887-ML-010 Cell culture huTGF-β Recombinant eBioscience 8348 Cell culture muGM-CSF Recombinant Biosource PMC 2015 Cell culture


96

Table 2.4: Inhibitors used in this study

Inhibitor Source Catalogue

number

Use Concentration Diluent

LY294002 Calbiochem 440202 In vitro

2.5-100μM DMSO

IC87114 Calistoga Pharmaceuticals

N/A In vitro

1-10μM DMSO

IC87114 Calistoga Pharmaceuticals

N/A In vivo

30mg/kg/dose Section 2.1.4.3


97

Table 2.5: Primers used in p110δD910A/D910A genotyping PCR

Sequence (5ʹ-3ʹ) μl/reaction Final conc.

D149 AACGAAGCTCTCAGAGAAAGCTGG 1 100ng D73 CCTGCACAGAAATGCACTTCC 2 200ng NeoF1 CGCCTTCTATCGCCTTCTTGAC 1 100ng


98

��

CHAPTER 3

Characterisation of

p110δD910A/D910A mice and

analysis of EAE disease

pathogenesis

��

CHAPTER 3: Characterisation of p110δD910A/D910A mice and analysis of EAE pathogenesis

100



101

3.1 OVERVIEW

In normal biology, the p110δ protein binds to one of several regulatory proteins to

form the heterodimeric PI3Kδ, ultimately regulating the activation of many different

proteins that are involved in a wide range of cellular processes. However, many of

the precise functions of PI3Kδ are still elusive. The ultimate aim of this project is to

further understand the role that p110δ plays within the immune system in order to

indicate whether p110δ may be useful as a therapeutic target in autoimmune disease.

This was addressed using both p110δD910A/D910A mice and by using the highly

selective p110δ inhibitor, IC87114. These initial experiments both generally

characterise the p110δD910A/D910A mice and address the ability of these animals to

develop autoimmune responses in EAE, a model of the human disease multiple

sclerosis.

3.2 CHARACTERISATION OF p110δD910A/D910A MICE

The p110δD910A/D910A mice have been previously described (248). They were

generated by gene targeting the p110δ gene, Pik3cd, with a knock-in vector that

ultimately changed an aspartate residue at amino acid position 910 to an alanine,

rendering the protein catalytically inactive. Mice were then back-crossed on to a

C57BL/6 background. To begin this study, the p110δD910A/D910A mice were

characterised in regards to their genotype, lymphocyte marker expression and the

potential of their lymphocytes to migrate towards homeostatic chemokines.

3.2.1 Genotyping of p110δD910A/D910A mice

Breeding pairs of p110δD910A/D910A mice were obtained from the Ludwig Institute

(section 2.2.1). As breeding of homozygous animals was unsuccessful (Hibbs,

personal communication), p110δD910A/D910A mice were instead bred with

p110δD910A/WT mice (heterozygous) to generate offspring. Genotyping was routinely

carried out as described in the materials and methods (section 2.2.2) (Figure 3.1A).

Analysis of the percentage of each genotype of mouse (i.e. p110δD910A/WT or

p110δD910A/D910A, male or female) per 100 mice born was analysed for over 400 mice.

These data show that normal Mendelian breeding ratios were observed in these


102

animals and there were no significant differences between the sex or genotype of the

mice born (Figure 3.1B).

3.2.2 Surface marker expression on splenocytes from p110δD910A/D910A mice

An in-depth study of surface marker expression on naïve lymphocytes from

p110δD910A/D910A mice has not yet been performed. Therefore the expression of

several different leukocyte markers, including homeostatic chemokine receptors and

adhesion molecules on the surface of splenocytes from p110δD910A/D910A mice and

wild-type C57BL/6 animals, was investigated. Lymphocytes were isolated from the

spleen of p110δD910A/D910A and wild-type mice, single cell suspensions were

generated and several cell surface markers were probed with antibodies and analysed

by flow cytometry. It was found that there was no significant difference between the

proportions of CD4+ and CD8+ T cells, nor B220+ B cells, in the spleen of

p110δD910A/D910A mice when compared with wild-type animals (Figure 3.2A). Cells

that were CD4+ did not show any difference in the levels of expression of the

homeostatic chemokine receptors CCR7 or CXCR4 (Figure 3.2B). Furthermore,

there was no difference in the proportion of lymphocytes isolated from the spleens of

wild-type versus p110δD910A/D910A mice that expressed either the integrin α4 or β1

chains (CD49d and CD29 respectively) (Figure 3.2C). Previous reports have

however demonstrated that the p110δD910A/D910A mice have fewer cells in the

secondary lymphoid organs when compared with wild-type mice (248, 462). This

phenomenon (in the spleen and inguinal and brachial lymph nodes) was also

routinely observed throughout this study.

3.2.3 Chemotaxis of p110δD910A/D910A splenocytes towards homeostatic

chemokines

It has been previously reported that p110δ inactivation does not affect T cell

migration in vitro, however it does reduce the capacity for B cells to migrate towards

CXCL13, albeit in p110δ-/-, not p110δD910A/D910A mice (432). Migration of B and T

cells from p110δD910A/D910A mice was assessed by performing Transwell chemotaxis

assays as described in section 2.3.7.1. The concentrations of stimulating chemokines

that were used were previously optimised (432, 496). B cell migration towards


103

CXCL13 was reduced when p110δ catalytic function was abrogated (Figure 3.3A).

However, the capacity of CD4+ T cells to migrate towards the homeostatic

chemokines CCL19 and CCL21 was reduced by approximately 50% in splenocytes

from p110δD910A/D910A mice when compared with those from wild-type animals

(Figures 3.3B and 3.3C respectively).

3.3 DETERMINATION OF A FUNCTIONAL ROLE FOR p110δ IN EAE

As discussed at length in the introduction, it has been previously demonstrated that

the efficient function of the p110δ protein is important for the activation,

differentiation, survival and general function of a number of different cell types both

in vitro and, whilst it has been studied to a lesser extent, in vivo. Considering the

important role that p110δ plays in leukocytes, it was considered that p110δD910A/D910A

mice may display differences in their ability to mount autoimmune responses in

disease models. EAE was chosen as a model as it is an inducible autoimmune disease

whose pathogenesis can be measured visually by observing the extent and severity of

paralysis, as well as by a range of well-documented common analytical

immunological methods.

3.3.1 Effects of p110δ inactivation on EAE disease pathogenesis

To determine whether p110δ plays a role in EAE, both p110δD910A/D910A mice and

wild-type C57BL/6 mice were immunised with MOG35-55 emulsified in CFA and

pertussis toxin (as described in 2.2.3.1). Mice were evaluated for clinical disease

signs from day 9 post-immunisation (section 2.2.3.2). Three independent

experiments were performed and are shown here separately (Figure 3.4A-C) as well

as pooled (Figure 3.4D). In both experiment 1 and 3 (figures 3.4A and 3.4C

respectively) it was observed that p110δD910A/D910A mice initially developed EAE

almost to the same extent as their wild-type counterparts (with clinical disease scores

of approximately 2-2.5 representing a flaccid tail and partial hind limb paralysis),

before their clinical disease scores dropped to around 1-1.5 (indicating that they had

a partially flaccid tail). Disease scores were significantly different from day 19 and

day 16 post-immunisation respectively. Mice that were immunised in experiment

number 2 (Figure 3.4B) did not develop EAE disease as severely as wild-type


104

C57BL/6 animals and there was a significant difference between the two groups

from day 13 post-immunisation. When these experiments were pooled (Figure 3.4D)

it was clear that, on average, EAE was reduced in p110δD910A/D910A mice when

compared with wild-type mice. This difference was statistically-significant from day

15 post-immunisation. Cumulated EAE disease scores where all three experiments

are pooled and accumulated daily are also shown (Figure 3.4E) and there is a

statistically-significant difference between the two groups from day 16 post-

immunisation.

There was no difference between animal cohorts with respect to either disease

incidence, the day of disease onset, or the day of peak EAE disease when the data

were pooled (Figures 3.4F-H). However, the pooled peak EAE clinical disease score

of the p110δD910A/D910A mice was significantly lower when compared with that of

wild type mice (Figure 3.4I). The mean peak disease score of p110δD910A/D910A mice

was 2.152 (± 0.231), indicating a paralysed tail only, whereas the mean peak disease

score of wild type mice was 2.988 (± 0.062), which correlated with complete hind-

limb paralysis (P <0.01).

3.3.2 Heterozygous (p110δD910A/WT) mice develop EAE disease in the same

manner as wild-type C57BL/6 mice

To determine whether the severity of EAE that develops in heterozygous

(p110δD910A/WT) mice is reduced when compared to wild-type C57BL/6 animals, both

groups were immunised with MOG35-55 emulsified in CFA and pertussis toxin as

described in 2.2.3.1. Mice were evaluated for clinical disease signs from day 9 post-

immunisation (section 2.2.3.2). Data shown are pooled from two independent

experiments (Figure 3.5A) and cumulative disease scores are also shown (Figure

3.5B). There was no significant difference in the disease incidence, day of onset, day

of peak disease or peak disease score between the two cohorts (Figures 3.5C-F

respectively). Therefore there is no difference in the EAE disease that develops in

wild-type animals when compared with p110δD910A/WT mice.


105

3.4 ANALYSIS OF SPINAL CORD PATHOLOGY DURING EAE

To begin the analysis of the mechanism behind the reduction of EAE disease in the

p110δD910A/D910A mice, signs of pathology within the CNS of these animals and wild-

type animals were compared. This was done by generating frozen sections of spinal

cords at different time-points through the disease course and analysing them by IHC.

3.4.1 Immunohistochemical analysis of lesions in the spinal cords of

p110δD910A/D910A mice

Cross-sections from the spinal cord of p110δD910A/D910A and wild-type mice at day 15

and 28 post-immunisation for EAE were cut and immunohistochemical staining was

performed with an anti-CD45 antibody (section 2.3.3). CD45, otherwise known as

‘leukocyte common antigen’, is expressed at high levels on the surface of all cells of

haematopoietic origin, except erythrocytes (497). Probing spinal cord sections for

CD45+ cells was therefore used as a method of determining leukocyte influx to the

CNS during EAE. Spinal cords from mice displaying representative EAE disease

scores were used. Immunohistochemical staining on spinal cord sections clearly

showed fewer CD45+ leukocytes in the CNS of p110δD910A/D910A mice on day 28

post-immunisation (Figure 3.6A). The reduced disease scores by the later phases of

EAE in p110δD910A/D910A mice correlated with a reduction in the number of CD45+

leukocytes in lesions in the spinal cords of these animals. These results were

commonly observed in both lumbar and thoracic regions of the spinal cord.

3.4.2 Lesions in the spinal cords of p110δD910A/D910A mice

Areas containing at least ten CD45+ cells (‘lesions’) were enumerated on both day 15

and day 28 post-immunisation (Figure 3.6B). It was observed that at day 15 there

was a strong trend towards fewer lesions in the CNS of p110δD910A/D910A mice.

However, by day 28 post-immunisation there was a statistically significant difference

between the two groups.

3.5 SUMMARY

In summary, p110δD910A/D910A mice were successfully bred and births occurred at

expected Mendelian ratios. As far as homeostasis of the immune system is


106

concerned, there was no difference in the proportion of CD4+ or CD8+ T cells, nor

B220+ B cells, in the spleens of p110δD910A/D910A mice when compared to wild-type

animals. Similar levels of the homeostatic chemokine receptors CCR7 and CXCR4,

as well as the α4 and β1 integrins (CD49d and CD29 respectively), were also

observed on the surface of p110δD910A/D910A mice when compared with wild-type

mice. Taking all of these data into account, it appears that inactivation of p110δ does

not overtly affect homeostasis of the immune system, at least with respect to the

parameters investigated. Despite this, migration of both B cells towards CXCL13 and

T cells towards CCL19 and CCL21 was reduced in cells in which p110δ had been

catalytically inactivated. While it has previously been demonstrated that B cells

require functional p110δ to effectively migrate towards CXCL13 in vitro (432), it

had not previously been shown that p110δ plays a role in T cell migration in vitro.

This is discussed further in chapter 6 of this thesis. In a novel finding, it was

observed that complete genetic inactivation of the p110δ protein clearly resulted in

reduced EAE pathogenesis. This was further supported by the finding that there were

fewer lesions consisting of CD45+ leukocytes in the spinal cord of p110δD910A/D910A

mice when compared with wild-type animals. No differences in EAE pathogenesis

were observed when comparing wild-type C57BL/6 and heterozygous p110δD910A/WT

mice. These findings define a clear role for p110δ in EAE pathogenesis, but

demonstrate that complete inactivation of p110δ is required for this to occur. A

complete picture of the mechanism behind this reduction in CNS leukocytes and

EAE pathology remains to be addressed. The following chapter describes

experiments that characterise the reduced autoimmune response in p110δD910A/D910A

mice.


107

0

10

20

30

40

Mal

e p1

10�D

910A

/D91

0A

Mal

e p1

10�D

910A

/WT

Fem

ale

p110�D

910A

/D91

0A

Fem

ale

p110�D

910A

/WT

% g

enot

ype/

gend

er

A

B

Figure 3.1: Genetic characterisation of the p110δ knock-out/knock-in mutant

mice

(A) Genomic DNA was extracted from the tail tips of mice overnight as described in

section 2.2.2. The resulting DNA was subjected to 35 cycles of PCR with previously

genotyped heterozygous (p110δD190A/WT) and homozygous (p110δD910A/D910A) mouse

DNA as controls. Homozygous and heterozygous mice were characterised by the

visualisation of either a single band at 500bp or one band at 500bp and another at

300bp respectively. Representative genotyping results for over 400 mice are shown.

(B) Following genotyping of animals, typical breeding ratios were determined by

observing the percentage of each possible genotype (i.e. heterozygous male,

heterozygous female, homozygous male or homozygous female) per 100 mice

counted (400 mice represented in total). Data are expressed as mean ± SEM.

p110

δD91

0A/D

910A

p110

δD91

0A/W

T 500bp

300bp


108

Figure 3.2: Surface phenotyping of lymphocytes from p110δD910A/D910A and wild-

type mice

Spleens were isolated from naïve p110δD910A/D910A and wild-type mice and single cell

suspensions were prepared and analysed by flow cytometry (section 2.3.2.2).

Representative flow cytometric histograms are shown in each figure. In each case the

lines representing samples are as follows: isotype control (green), wild-type (blue)

and p110δD910A/D910A (red). (A) Lymphocytes were stained with anti-CD4, anti-CD8

and anti-B220 antibodies. (B) Lymphocytes were stained with anti-CD4, anti-CCR7

and anti-CXCR4 antibodies. CD4+ cells were gated upon (shown in the histogram on

the left) and CCR7 or CXCR4 expression on their cell surface was determined. (C)

CD29 (β1 integrin chain) and CD49d (α4 integrin) expression on the surface of

lymphocytes. Data points represent the mean percentage of positive lymphocytes ±

SEM (n = 3 mice per group) and represent two independent experiments.


109

CD4+ CD8+ B220+0

10

20

30

40

50

60 Wild-typep110�D910A/D910A

Cell surface marker

% c

ells

pos

itive

A

CD4 CD8

B220


110

CCR7+ CXCR4+0

2

4

6

8

10

80

90

100

Chemokine receptor

% C

D4+

cells

pos

itive

B

CCR7

CXCR4

CD4


111

CD29+ (�1) CD49d+ (�4)0

5

10

15

20

25

Wild-typep110�D910A/D910A

80

90

100

Integrin chain

% c

ells

pos

itive

C

CD29

CD49d


112

Wild-ty

pe

p110�

D910A

/D91

0A

0

20000

40000

60000

80000 *

# B

220+

cells

mig

rate

d to

1 �g/

ml C

XCL1

3

Wild-ty

pe

p110�

D910A

/D91

0A

0

25000

50000

75000

100000

125000

150000

**

# C

D4+

cells

mig

rate

d to

0.5 �

g/m

l CCL

19

A

B


113

Wild-ty

pe

p110�

D910A

/D91

0A

0

25000

50000

75000

100000

125000***

# C

D4+

cells

mig

rate

d to

4 �g/

ml C

CL21

C

Figure 3.3: Chemotaxis of p110δD910A/D910A splenocytes towards homeostatic

chemokines

Lymphocytes were isolated from the spleen of naive wild-type C57BL/6 mice and

p110δD910A/D910A animals, stained with Calcein and subjected to Transwell

chemotaxis assays as described in section 2.3.7.1. Following a three hour incubation,

cells were isolated from the lower chamber of the chemotaxis tray and subjected to

staining with anti-CD4 and anti-B220 antibodies and analysed by flow cytometry.

Total numbers of migrated cells were calculated as described (section 2.3.7.1). (A)

B220+ cell migration in response to 1μg/ml CXCL13. Data represent the mean

number of migrated cells ± SEM (n = 2). *P <0.05. (B) CD4+ cell migration in

response to 0.5μg/ml CCL19. Data represent the mean number of migrated cells ±

SEM (n = 2). **P <0.01. (C) CD4+ cell migration in response to 4μg/ml CCL21.

Data represent the mean number of migrated cells ± SEM (n = 2). ***P <0.001.


114

Figure 3.4: Effects of p110δ inactivation on EAE pathogenesis

Mice were immunised with MOG35-55 and pertussis toxin as described in section

2.2.3.1. Animals were monitored for clinical disease from day 9 post-immunisation.

EAE disease scores were evaluated as described in section 2.2.3.2. Wild-type

C57BL/6 (blue squares) and age-matched p110δD910A/D910A (red squares) mice were

immunised to induce EAE. (A-C) Data from three independent experiments are

shown. Data points represent the mean EAE disease score ± SEM (*P <0.05). (D)

Pooled disease scores from the three independent experiments shown in Figure 3.4

A-C. (Wild-type C57BL/6 n = 22, p110δD910A/D910A n = 23. *P <0.05). (E)

Cumulative EAE disease scores of pooled EAE experiments with p110δD910A/D910A

(red squares) and age-matched C57BL/6 (blue squares) mice throughout the disease

course. Data are mean pooled EAE disease score ± SEM. *P <0.05. (F) EAE disease

incidence was 100% in both experimental groups. (G) Day of EAE onset. Data

represent the mean day of EAE onset ± SEM. (H) Day of peak EAE disease. Data

represent the mean day of peak EAE disease ± SEM. (I) Peak EAE disease score.

Data represent the mean peak EAE disease score ± SEM. **P <0.01.


115

EAE study #1

0 10 20 300.0

0.5

1.0

1.5

2.0

2.5

3.0

3.5 Wild-typep110�D910A/D910A

* * * * ** * *

Day post-immunisation

EAE

dise

ase

scor

e

EAE study #2

0 10 20 300.0

0.5

1.0

1.5

2.0

2.5

3.0


* * *

* * * * **

**

**

* *


EAE

dise

ase

scor

e

EAE study #3

0 5 10 15 20 25 300.0

0.5

1.0

1.5

2.0

2.5

3.0


* * ** * ** * * * *

*


EAE

dise

ase

scor

e

C

B

A


116

0 10 20 300.0

0.5

1.0

1.5

2.0

2.5

3.0


** * *

* * * **

* **

* * *


EAE

dise

ase

scor

e

0 10 20 300

10

20

30


* ** * * * * * * * * * * *


Cum

ulat

ive

dise

ase

scor

eD

E


117

Wild-type p110�D910A/D910A0

20

40

60

80

100

EAE

inci

denc

e

Day of onset


2

4

6

8

10

12

14

Day

post

-imm

unis

atio

n

Day of peak disease


5

10

15

20

Day

post

-imm

unis

atio

n

Peak disease score

Wild-type p110�D910A/D910A0.0

0.5

1.0

1.5

2.0

2.5

3.0

3.5

EAE

dise

ase

scor

e

**

IH

F G


118

0 10 20 300.0

0.5

1.0

1.5

2.0

2.5

3.0

3.5 Wild-typep110�D910A/WT

* *


EAE

dise

ase

scor

e

0 10 20 300

10

20

30

40 Wild-typep110�D910A/WT


Cum

ulat

ive

dise

ase

scor

eA

B


119

Wild-type p110�D910A/WT0

25

50

75

100EA

E in

cide

nce

Day of onset

Wild-type p110�D910A/WT0

2

4

6

8

10

12

14

Day

post

-imm

unis

atio

n

Day of peak disease

Wild-type p110�D910A/W T0

5

10

15

20

25

Day

post

-imm

unis

atio

n

Peak disease score

Wild-type p110�D910A/W T0

1

2

3

4

EAE

dise

ase

scor

e

C

FE

D

Figure 3.5: Mice heterozygous for the p110δ mutation develop EAE in the same

manner as wild-type C57BL/6 mice

Mice were immunised with MOG35-55 emulsified in complete Freund’s adjuvant as

described in section 2.2.3.1. Pertussis toxin was also administered at the time of

immunisation and on the second day post-immunisation. Mice were evaluated for

clinical disease symptoms from day 9 post immunisation. (A) EAE disease scores

observed in wild-type and p110δD910A/WT mice were evaluated as described in section

2.2.3.2. Data points represent the mean EAE disease score ± SEM (Wild-type n = 15

mice, p110δD910A/WT n = 14 mice). (B) Cumulative EAE disease scores (where each

day’s score is added to that from the previous day) throughout the disease course. (C)

Disease incidence. (D) Day of EAE disease onset. (E) Day of peak EAE disease. (F)

Peak EAE disease score. All statistics are mean ± SEM (wild-type n = 15,

p110δD910A/WT n = 14 mice).


120

Figure 3.6: Lesions in the spinal cord of mice immunised for EAE

Spinal cords were removed from mice (as described in section 2.3.1.6) at day 15 and

day 28 post-immunisation for EAE. Sections were cut and stained with rat anti-

mouse CD45 antibody and haematoxylin (section 2.3.3). (A) CD45+ cells in sections

of spinal cords from p110δD910A/D910A and age-matched C57BL/6 mice at day 15 and

28 post-immunisation for EAE. Top panels show lumbar sections from spinal cords

obtained at day 15 post-immunisation; bottom panels are thoracic sections of spinal

cords extracted at day 28 post-immunisation for EAE. Sections are representative of

several sections from at least 3-5 mice per group. (B) The number of lesions on day

15 and 28 post-immunisation in cross sections of thoracic and lumbar spinal cords

from p110δD910A/D910A and age-matched C57BL/6 mice. Lesions in 12-18 sections

from 3-5 mice per group were counted. Data are representative of the mean lesion

number ± SEM. **P <0.01.


121

Wild-type p110�D910A/D910A

Day

15

Day

28

A


122



123

Day 15 Day 280

2

4

6

8


n.s.

**


# of

lesi

ons

cont

aini

ng>1

0 C

D45

+ ce

lls

B


124

��

CHAPTER 4

The effect of p110δ

inactivation on cells of the

immune system during EAE

�

��

CHAPTER 4: The effect of p110δ inactivation on cells of the immune system during EAE

126


127

4.1 OVERVIEW

In the previous chapter it was demonstrated that p110δD910A/D910A mice do not

develop EAE to the same extent as wild-type animals. It is possible that p110δ is

playing a variety of roles in different cell types that govern EAE pathogenesis. This

chapter focuses on investigating the mechanisms behind the reduced EAE pathology

observed in the p110δD910A/D910A mice.

4.2 PRIMING AND SURVIVAL OF CD4+ T LYMPHOCYTES IS REDUCED

IN p110δD910A/D910A MICE

As discussed in the introduction, CD4+ T cells have been widely implicated in MS

and EAE. Furthermore, it has been demonstrated that p110δ function influences

effector T cell trafficking to antigenic tissue in vivo as well as the differentiation and

sustained activation of both Th1- and Th2-type CD4+ T cells. To this end, the effect

of p110δ inactivation on the CD4+ T cell compartment in EAE was investigated, with

initial studies focussing on the priming of CD4+ T cells during EAE. Furthermore,

p110δ has been implicated in cell survival of a number of other cell types,

particularly B cells (238, 239, 416, 448). Since T cells share the same signalling

pathways that govern this process (in particular the Akt/PKB initiated survival

pathways) the impact of p110δ inactivation on T cell survival during the immune

priming phase of EAE was also investigated.

4.2.1 CD4+ T lymphocytes in the draining lymph nodes of p110δD910A/D910A mice

display a more naïve phenotype than those from wild-type counterparts

To determine whether CD4+ T cells from p110δD910A/D910A mice were being activated

as efficiently as those from wild-type counterparts, a detailed study of the expression

of classical activation markers on the surface of cells from the draining inguinal and

brachial lymph nodes throughout the EAE disease course was performed. These

activation markers included CD62L (L-selectin) and the chemokine receptors CCR7,

CXCR3 and CCR6. CD62L and CCR7 are both highly expressed on naïve T

lymphocytes (44, 498-500), whereas CXCR3 and CCR6 are up-regulated on the

surface of T cells following activation, and are therefore indicative of activated T

lymphocytes (501-504). Lymphocytes were isolated from the inguinal and brachial


128

lymph nodes of p110δD910A/D910A and wild-type mice at days 9 and 15 post-

immunisation, single cell suspensions were generated and the expression of the

aforementioned surface markers was assessed by flow cytometry (section 2.3.2.2). It

was found that, when compared with wild-type mice, there was a higher proportion

of CD4+ cells from p110δD910A/D910A mice that express the naïve cell markers CD62L

and CCR7 at both days 9 and 15 post-immunisation (Figures 4.1A and 4.1B

respectively). Complementary to this, CD4+ T cells from the draining lymph nodes

of p110δD910A/D910A mice expressed lower levels of the activation markers CXCR3

and CCR6 at both time-points compared to that observed on the surface of CD4+

cells from wild-type animals (Figures 4.1C and 4.1D respectively). These data

indicate that the CD4+ T cells in the draining inguinal and brachial lymph nodes of

p110δD910A/D910A mice are not activated as efficiently as T cells in wild-type animals.

4.2.2 There are fewer T effector memory cells in the draining lymph nodes of

p110δD910A/D910A mice throughout EAE

The proportion of effector memory T cells in the draining inguinal and brachial

lymph nodes of p110δD910A/D910A and wild-type mice was assessed by flow

cytometry. It was observed that at both day 9 and day 15 post-immunisation the

p110δD910A/D910A mice had a lower proportion of CD4+ T cells that were

CD62Llo/CD44hi, indicating that there were fewer effector memory T cells in the

draining lymph nodes of these animals compared with wild-type mice (Figure 4.2).

4.2.3 The ex vivo and in vivo proliferative response of p110δD910A/D910A CD4+ T

cells following stimulation with the neuroantigen MOG35-55

Once T cells become activated following antigen presentation they undergo a rapid

proliferation. It was observed that fewer T cells from p110δD910A/D910A mice express

markers of activation following immunisation with MOG35-55 in CFA, suggesting

that there was less priming of the autoimmune response in these animals. Therefore,

the ability of lymphocytes to proliferate ex vivo and in vivo was assessed.

To determine whether p110δ is important for proliferation of primed T cells ex vivo,

animals were immunised with MOG35-55 in CFA before the draining inguinal and


129

brachial lymph nodes were extracted on day 9 post-immunisation (sections 2.2.3.1).

Single cell suspensions were generated and cells were labelled with CFSE before

being incubated for four days in the presence of MOG, as described in section

2.3.5.1. Concanavalin A (ConA) was used as a positive control to induce high levels

of cell proliferation, while cells that were incubated with media only were used as a

negative control for non-antigen-specific proliferation that may occur during the

incubation period. It was observed that lymphocytes from p110δD910A/D910A mice

underwent significantly less proliferation in response to MOG35-55-stimulation than

cells from wild-type animals (Figure 4.3). There was no difference in background

proliferation observed between the two cohorts (i.e. media only-treated cells). In

addition, it was observed that cells from p110δD910A/D910A mice did not proliferate in

response to ConA stimulation as efficiently as wild-type cells. Together, these data

indicate that lymphocytes which lack functional p110δ are less capable of

undergoing proliferation, and are less activated in response to MOG35-55. However,

the observed reduction in cell division following stimulation with ConA indicates

that this reduction in proliferation was not antigen-specific.

While assessment of proliferation of MOG35-55-stimulated cells ex vivo is useful to

indicate the level of activation of the stimulated cells, immune priming in vivo is a

much more complex process which requires a number of cellular and molecular

interactions not attainable in vitro. These include the provision of growth factors,

cytokines and chemokines that are required for efficient activation of cells in vivo, as

well as co-stimulation by APCs. Therefore, to investigate whether p110δ is important

for cell activation/proliferation in vivo, priming of immune cells was further

investigated using BrdU proliferation assays as described in section 2.3.5.2. Briefly,

animals were fed BrdU in their drinking water from day six post-immunisation

before draining inguinal and brachial lymph nodes were removed at day nine post-

immunisation. BrdU incorporation into the DNA of CD4+ cells was assessed by flow

cytometry after lymphocytes were labelled with anti-CD4 and anti-BrdU antibodies.

Consistent with the results of the surface marker staining and ex vivo proliferation

assay it was observed that CD4+ cells from p110δD910A/D910A mice had incorporated


130

less BrdU into their DNA compared with wild-type mice, indicating less immune

priming was occurring in these animals (Figure 4.4).

4.2.4 Apoptosis is increased in CD4+ cells from p110δD910A/D910A mice

Previous reports have demonstrated that several different types of cells which lack

p110δ undergo increased levels of apoptosis (238, 239, 416, 448). However, the

impact of p110δ inactivation on antigen-activated T cell survival has yet to be

reported. Propidium iodide and annexin V staining was performed to assess the level

of cell death in lymphocytes from p110δD910A/D910A and wild-type mice throughout

the EAE disease course (section 2.3.2.6). It was observed that at day 6 and 9 post-

immunisation there was a lower proportion of apoptotic cells in the draining lymph

nodes of wild-type mice than in p110δD910A/D910A mice (Figure 4.5A). When this was

analysed in more detail, focusing on the CD4+ T cell population, it was observed that

CD4+ cells in the draining lymph nodes of p110δD910A/D910A mice were undergoing

more apoptosis at day 9 post-immunisation (Figure 4.5B). These data indicate that

p110δ function is imperative for CD4+ T cell survival during EAE immune priming.

4.3 B CELL ACTIVATION AND FUNCTION IS REDUCED IN

p110δD910A/D910A MICE DURING EAE

While T cells are critical for the induction of disease in MS/EAE, it has been

demonstrated that B cells also play an important role in the pathology and clinical

outcomes of these diseases. Furthermore, the development, survival, activation and

function of B cells are demonstrably reliant on p110δ (238, 239). Therefore, the

presence of B cells in the CNS, antibody production and B cell survival in

p110δD910A/D910A mice during EAE was investigated.

4.3.1 B220+ cells do not enter the central nervous system during EAE

To examine the extent of B220+ B cell infiltration to the CNS of p110δD910A/D910A and

wild-type mice during EAE, spinal cords were extracted from both cohorts at day 15

post-immunisation and cross-sections of these spinal cords were cut and stained with

anti-B220 antibodies (section 2.3.3). Spinal cords from mice displaying

representative EAE disease scores were used. Immunohistochemical staining on


131

spinal cords showed that, while wild-type mice had B220+ cells in the spinal cord at

day 15 post-immunisation, there were no detectable B220+ cells in the spinal cord of

p110δD910A/D910A mice (Figure 4.6). These results were commonly observed in both

the lumbar and thoracic regions of the spinal cord.

4.3.2 Antigen-specific antibody production does not occur in p110δD910A/D910A

mice throughout EAE

MOG35-55-specific antibody production by p110δD910A/D910A and wild-type mice was

subsequently investigated. Serum was isolated from the mice at days 9, 15 and 28

post-immunisation for EAE and ELISA assays were performed as described in

section 2.3.6.1. Regardless of the severity of the clinical disease scores throughout

the experiments there was no increase in the levels of MOG35-55-specific IgG in the

serum of p110δD910A/D910A mice at days 9, 15 and 28 post-immunisation (Figure 4.7).

Wild-type mice, however, displayed significantly increasing levels of MOG35-55-

specific IgG in the serum throughout the disease course, indicating that B cells were

maturing, undergoing isotype-switching and increasing their IgG output. There were

particularly high levels of MOG35-55-specific antibodies in the serum of wild-type

mice at day 28 post-immunisation, which correlates with a typical time-course for

IgG production in immune challenges (505, 506).

4.3.3 Apoptosis is increased in B220+ cells from p110δD910A/D910A mice at EAE

disease onset

It has been widely reported that p110δ plays an important role in B cell survival in

vitro (238, 239). The defects observed in B cell antibody production and trafficking

to the CNS of p110δD910A/D910A mice during EAE may not only be due to defects in

these particular processes, but also due to B cells lacking functional p110δ

undergoing higher levels of apoptosis. To test this, the levels of apoptotic B cells in

the draining lymph nodes at EAE onset were investigated. Lymphocytes were

extracted from draining brachial and inguinal lymph nodes at day 9 post-

immunisation and stained with anti-B220 antibodies as well as Annexin V and

propidium iodide before being analysed by flow cytometry (section 2.3.2.6). It was

observed that while approximately 10% of B220+ cells extracted from wild-type


132

lymph nodes were AV+/PI+, more than 30% of B220+ cells from p110δD910A/D910A

mice were undergoing apoptosis (Figure 4.8). Therefore, without p110δ, a

significantly higher proportion of B220+ cells from p110δD910A/D910A mice are

apoptotic during early stages of EAE.

4.4 p110δ INACTIVATION DOES NOT AFFECT DENDRITIC CELL

MIGRATION OR ACTIVATION

Cell-mediated immunity relies on efficient antigen processing and presentation by

APCs such as dendritic cells. Without functional p110δ, T cell responses have been

shown to be reduced (present study and others (248, 249, 381, 464)). However, the

observed reduction in T cell activation in the p110δD910A/D910A mouse could be due to

a T cell intrinsic defect, or a defect in DC function, or both. In spite of this, the role

of p110δ in the function of DCs has not yet been reported.

4.4.1 Ex vivo migration of dendritic cells is not affected by p110δD910A/D910A

inactivation

The capacity of BMDCs to migrate towards chemokines in vitro was assessed. DCs

were isolated from the bone marrow of p110δD910A/D910A and wild-type mice (section

2.3.1.7) before being cultured in the presence of GM-CSF for 10 days. Following this

incubation, medium containing GM-CSF, LPS and TNFα was added to the DCs in

order to produce a mature phenotype (section 2.3.4.3). There was no difference

between the numbers of DCs that were isolated from the bone marrow of wild-type

and p110δD910A/D910A mice (Figure 4.9A), nor was there a difference between the

numbers of mature DCs generated in culture (Figure 4.9B). Transwell chemotaxis

assays were then performed to assess the ability of mature DCs to migrate in vitro

towards the homeostatic chemokine CCL19. It was observed that mature BMDCs

lacking functional p110δ migrated in vitro towards the chemokine CCL19 as

effectively as mature BMDCs from wild-type mice (Figure 4.9C).

4.4.2 Migration of dendritic cells in vivo is not reliant on p110δ

Migration of DCs from the site of immunisation to the draining lymph nodes is

imperative for efficient antigen-presentation to T cells and subsequent disease


133

induction during EAE. Therefore, in vivo DC migration was assessed. The abdomens

of both p110δD910A/D910A and wild-type mice were shaved and painted with a 1%

FITC solution (section 2.2.6). Forty-eight hours later the inguinal and brachial lymph

nodes were removed, and single cell suspensions were generated and co-stained with

anti-CD11c antibodies before being analysed by flow cytometry. There was no

difference in the proportion of CD11c+ cells that were isolated from the draining

lymph nodes of p110δD910A/D910A mice when compared with wild-type mice (Figure

4.10A), nor was there a difference in the proportion of CD11c+ cells that were FITC+

in the draining lymph nodes of the two groups (Figure 4.10B). Therefore, p110δ does

not play a role in the migration of activated DCs from the skin to the draining lymph

nodes.

4.4.2 Dendritic cells from CFA-immunised p110δD910A/D910A mice display the

same phenotype as wild-type mice

To assess the maturation of DCs, both p110δD910A/D910A and wild-type mice were

immunised in the hind flank with CFA and draining inguinal lymph nodes were

extracted 48 hours later and stained with DC markers. It was observed that CD11c+

DCs had similar levels of the activation markers CD86 and MHC class II on the cell

surface (Figure 4.11). Therefore p110δ inactivation does not affect the activation of

DCs following CFA immunisation in vivo.

4.5 T CELL DIFFERENTIATION TO T REGULATORY, Th1- AND Th17-

TYPES IS SIGNIFICANTLY REDUCED UPON p110δ INACTIVATION

It has been demonstrated both in the present study and in the published literature

(248, 249, 381, 464) that inactivation of p110δ results in inefficient T cell activation.

As discussed in the introduction to this thesis (section 1.3.4.1), Th17 cells have been

recently implicated as the driving force behind the severe pathogenesis observed in

both EAE and MS. While p110δ has been shown to be important for the function and

development of Th1, Th2 and Treg cells (381, 464), the role of p110δ in Th17 cell

differentiation has not yet been reported. Due to the importance of Th17 cells in

EAE/MS pathogenesis, the role of p110δ in Th17 cell biology was investigated. As

there has been a strong link between p110δ and Th1 and Treg cell differentiation


134

(both of which have been implicated in MS/EAE pathogenesis), the effect of genetic

p110δ inactivation in these cell types was also further examined throughout the EAE

disease course.

4.5.1 p110δD910A/D910A mice have fewer regulatory T cells in draining lymph

nodes at disease onset and peak disease time-points

Treg cells are important for the regulation of the immune response. Inefficient Treg

function often results in autoimmunity and Treg function has been shown to be

compromised in p110δD910A/D910A mice in a colitis model (464). Therefore, the

presence of Treg cells in the draining lymph nodes of p110δD910A/D910A mice

throughout EAE was investigated. Draining inguinal and brachial lymph nodes were

extracted at days 6 and 15 post-immunisation and cells were stained with anti-CD4,

anti-CD25 and anti-FoxP3 antibodies and analysed by flow cytometry. It was

observed that on day 6 post-immunisation there was a significantly higher proportion

of CD4+/CD25+/FoxP3+ Treg cells in the draining lymph nodes of p110δD910A/D910A

mice when compared with wild-type animals (Figure 4.12). Despite this, by day 15

post-immunisation a significantly lower proportion of cells in the draining lymph

nodes were Tregs. This indicates that p110δ is involved in the differentiation and

development of Treg cells during EAE.

4.5.2 In vitro differentiation of CD4+ cells the Th1- and Th17- types is affected

by p110δ inactivation

To determine the role of p110δ in the differentiation of Th1 and Th17 cells in vitro

naïve splenocytes were isolated from p110δD910A/D910A and wild-type mice and

cultured for four days in the presence of anti-CD3 and anti-CD28 under either Th1-

skewing or Th17-skewing culture conditions (sections 2.3.4.6 and 2.3.4.7

respectively). Briefly, cells were exposed to IL-12 to induce differentiation to the

Th1-type or TGF-β, IL-6, IL-1β and IL-23 in the presence of neutralising anti-IFN-γ

and IL-4 antibodies to induce differentiation to the Th17-type. Following the four

day culture, cells were stained for the expression of surface CD4 and intracellular

IFN-γ and IL-17 before flow cytometric analysis. It was observed that cells from

p110δD910A/D910A mice were less capable of differentiating to either IFN-γ-producing


135

Th1 cells (Figure 4.13A) or IL-17-producing Th17 cells (Figure 4.13B). Therefore,

p110δ inactivation results in a reduction in differentiation of both Th1 and Th17 cells

in vitro.

4.5.3 Differentiation of CD4+ cells to the Th1-type throughout EAE is affected

by p110δ inactivation

Th1 cells have been shown to be involved in EAE pathogenesis (155, 162, 163) and

to require p110δ for efficient differentiation (present study and (381)). Therefore, the

presence of Th1 cells in the draining lymph nodes and CNS of p110δD910A/D910A and

wild-type mice throughout EAE was assessed. To do this, cells were isolated from

the spinal cords and draining inguinal and brachial lymph nodes of p110δD910A/D910A

and wild-type animals at days 15 and 28 post-immunisation, as described in section

2.3.4.6. Following this, lymphocytes were stained for expression of surface CD4 and

intracellular IFN-γ and IL-17 and analysed by flow cytometry. On day 15 post-

immunisation, the p110δD910A/D910A mice had a higher proportion of Th1 cells in their

draining lymph nodes than did wild-type mice (Figure 4.14A). The proportion of

IFN-γ-producing CD4+ cells in the lymph nodes was greatly reduced by day 28 post-

immunisation, particularly in the p110δD910A/D910A mice. On both days 15 and 28

post-immunisation there was no statistically significant difference in the proportion

of Th1 cells in the spinal cords of the two cohorts (Figure 4.14B). Representative

flow cytometric plots are shown in Figure 4.14E. Taken together, the data observed

from both the lymph nodes and spinal cord indicate that p110δD910A/D910A mice are

capable of mounting a Th1 response during EAE and that the proportion of Th1 cells

in the draining lymph nodes is increased at peak disease.

4.5.4 p110δ is imperative for the development of Th17 cells in vivo during EAE

In contrast to the results observed when investigating the ability of p110δD910A/D910A

mice to mount a Th1 response during EAE, mice lacking functional p110δ were not

as capable of mounting a Th17 response. At the later time-point investigated (day 28

post-immunisation), the proportion of CD4+/IL-17+/IFN�- Th17 cells in the draining

lymph nodes of p110δD910A/D910A mice was significantly lower than that observed in

wild-type mice (Figure 4.14C). This phenomenon was also observed in the spinal


136

cord of p110δD910A/D910A mice at day 28 post-immunisation, with a strong trend

towards proportionally less Th17 cells in the spinal cord of these animals at day 15

post-immunisation also (Figure 4.14D). Representative flow cytometric plots are

shown in Figure 4.14E. Mice lacking functional p110δ therefore mount a less

efficient Th17 response in EAE.

4.5.5 There is a strong bias towards a Th1-type immune response in

p110δD910A/D910A mice

When the data shown in Figure 4.14 are expressed as a ratio (i.e. the number of Th1

cells per Th17 cell), p110δD910A/D910A mice had a higher Th1:Th17 ratio in the

draining lymph nodes at all disease stages examined (Figure 4.15A). Whereas wild-

type mice typically had a Th1:Th17 ratio of between 1:1 and 2:1, p110δD910A/D910A

mice had a Th1:Th17 ratio of around 5:1 and 6:1 at both day 15 and 28 post-

immunisation. This difference was also observed in the spinal cord of

p110δD910A/D910A mice at the day 28 post-immunisation time point, with a trend

towards the same phenomena at peak disease (day 15 post-immunisation) (Figure

4.15B). This indicates that while wild-type C57BL/6 mice mount both Th1 and Th17

immune responses, p110δD910A/D910A mice produce an autoimmune response that is

strongly skewed towards Th1.

4.5.6 CNS infiltration of F4/80+ macrophages and Ly6G+ neutrophils is altered

in the absence of functional p110δ

It has been previously reported that adoptive transfer of encephalitogenic cells,

which have been skewed ex vivo to the IL-12-driven Th1-type, results in an

autoimmune response characterised by macrophage-rich CNS infiltrates. Conversely,

when IL-23-driven Th17-type cells are transferred, a neutrophil-rich CNS infiltrate

occurs (169). In those previous reports, in spite of a difference in the cells that made

up the CNS infiltrates, the resulting paralysis was clinically indistinguishable

between the two groups. However those data demonstrate that Th1- and Th17-type

autoimmune responses can drive the activation and recruitment of different cell-types

to the CNS.


137

To investigate the effect of reduced Th17-type responses on the cellular infiltrates in

the CNS of p110δD910A/D910A mice, the proportion and number of F4/80+

macrophages and Ly6G+ neutrophils in the CNS of p110δD910A/D910A and wild-type

mice at days 6 and 15 post-immunisation for EAE were determined by flow

cytometry (section 2.3.2.2). There was no significant difference in the number of

cells isolated from the CNS of p110δD910A/D910A mice when compared with wild-type

mice at day 6 and day 15 post-immunisation (Figure 4.16A). At day 6 post-

immunisation wild-type mice had a significantly higher proportion of F4/80+

macrophages in the CNS when compared with p110δD910A/D910A mice (Figure 4.16B).

At both time points there were significantly fewer F4/80+ cells in the CNS of

p110δD910A/D910A mice (Figure 4.16C). While there was a significantly higher

proportion of Ly6G+ cells in the CNS of p110δD910A/D910A mice at day 6 post-

immunisation when compared with wild-type counterparts (Figure 4.16D), there was

no difference in the proportion of Ly6G+ cells between the two cohorts at day 15

post-immunisation, nor was there a difference between the numbers of Ly6G+ cells

isolated from the CNS at either time-point investigated (Figure 4.16E). When

expressed as a ratio of the number of F4/80+ macrophages to Ly6G+ neutrophils in

the CNS, wild-type mice had a higher macrophage to neutrophil ratio at day 6 post-

immunisation (approximately 2.5:1) and an equal number of macrophages and

neutrophils in the CNS at day 15 post-immunisation (Figure 4.16F). In contrast,

p110δD910A/D910A mice had equal numbers of macrophages and neutrophils in the

CNS six days post-immunisation and a macrophage to neutrophil ratio of

approximately 0.5:1 at day 15 post-immunisation. These data together indicate that

while Ly6G+ neutrophils from p110δD910A/D910A mice seem capable of migrating to

the CNS, there appears to be a defect in recruitment of F4/80+ macrophages to the

CNS during EAE in these animals.

4.6 SUMMARY

As described in chapter 3 of this thesis, p110δ function is imperative for the

development of an efficient autoimmune response in EAE. This chapter has further

examined the cellular basis for this. Firstly, the work presented here demonstrates

that p110δ is required for efficient T cell priming in EAE. CD4+ T cells from p110δ-


138

inactivated mice have a more naïve phenotype when compared with wild-type T cells

and they do not undergo as much proliferation ex vivo or in vivo as do wild-type T

cells. In addition, p110δD910A/D910A mice have fewer effector memory T cells at EAE

onset and at peak disease. Despite a reduction in Th1 cell generation in vitro, the

proportion of Th1 cells in the CNS of p110δD910A/D910A mice was observed to be

similar to that observed in wild-type animals. In a novel finding, the differentiation

of CD4+ T cells to the highly-pathogenic Th17-type was demonstrated to be

significantly reduced both in vitro and in vivo when p110δ is inactive. The reduction

in T cell activation and differentiation observed in p110δ-deficient animals was not

due to a disruption in DC migration or activation (the ability of DCs to effectively

process and present antigen is addressed in chapter 5 of this thesis). While the

proportion of Tregs in draining lymph nodes in p110δD910A/D910A mice was shown to

be elevated at day 6 post-immunisation when compared with wild-type animals, by

peak disease there was a lower proportion of Tregs in p110δ-deficient mice. Previous

reports have shown that p110δD910A/D910A mice have reduced Treg function which

correlated with a lack of protection from experimental colitis (464). However, in the

present study it appears that the reduced T cell activation and differentiation may be

sufficient to reduce EAE disease in these animals, despite the lower proportion of

Tregs. Alternatively, the increased proportion of Tregs in the p110δD910A/D910A mice

prior to disease onset may be sufficient to confer some protection against the

development of severe EAE. In addition to the reduced T cell function observed in

this study, the capacity of B cells to enter the CNS and produce MOG35-55-specific

IgG was inhibited. Because anti-MOG antibodies have been implicated in EAE

pathogenesis these data indicate that B cells are reliant on p110δ function to be

pathogenic in EAE. Levels of apoptosis in lymphocytes from the two experimental

cohorts were also tested and it was observed that a higher proportion of both B and T

cells lacking functional p110δ were undergoing apoptosis at day 9 post-

immunisation. Together these data indicate that not only is the activation of p110δ-

deficient antigen-specific B and T cells reduced but that these cell types are

incapable of maintaining efficient survival signals. Both of these phenomena are

likely to be contributing to the reduced EAE pathogenesis observed in the

p110δD910A/D910A mice. Finally, while equal proportions of Ly6G+ neutrophils were


139

observed in the CNS of both cohorts during EAE, proportionally fewer F4/80+

macrophages were observed in the CNS of p110δD910A/D910A mice when compared

with wild-type animals, indicating that p110δ may play an important role in

macrophage biology. In summary, this chapter shows that, primarily through its role

in T and B cell activation and survival, p110δ is unequivocally linked to the

development of EAE.


140

Figure 4.1: Characterisation of CD4+ T lymphocytes in the draining lymph

nodes of p110δD910A/D910A or wild-type mice throughout EAE.

Draining lymph nodes from wild-type and p110δD910A/D910A mice on either day 9 or

15 post-immunisation for EAE were analysed for expression of CD4, CD62L (A),

CCR7 (B), CXCR3 (C) and CCR6 (D). Representative flow cytometry plots are

shown. Data are representative of at least 3 independent experiments. *P <0.05, **P

<0.01, ***P <0.005. All data are mean ± SEM (n = 6-8 mice per group).


141

Day 9 Day 150

10

20

30

40

50

60 Wild-typep110�D910A/D910A***

*


% C

D4+

cells

that

are

CD

62L

+

Day 9 Day 150

10

20

30

40

50

60

70

80

90 ******


% C

D4+

cells

that

are

CC

R7+

CD

4

CD62L

Wild-type p110�D910A/D910A Wild-type p110�D910A/D910A

11.72 6.05 25.54 25.0527.0 31.48 11.18 17.82

CD

4

CCR7


7.85 4.74 9.76 5.7418.45 22.57 29.85 34.02

A

B

Day 9 Day 15

Day 9 Day 15


142

Day 9 Day 150

5

10

15

20

25


**


% C

D4+

cells

that

are

CXC

R3+

Day 9 Day 150

5

10

15

20

25

30

***

***


% C

D4+

cells

that

are

CC

R6+

CD

4

CXCR3


21.48 28.5230.68 29.09

9.02 5.752.21 1.52

CD

4

CCR6


21.59 23.21 34.2 37.816.74 4.12 4.57 5.4

C

D

Day 9 Day 15

Day 9 Day 15


143

Day 9 Day 150

10

20

30

40


***


% C

D4+

cells

that

are

CD

44hi

CD

62Llo

CD

62L

CD44


42.06 28.37 21.13 9.28

Day 9 Day 15

Figure 4.2: Effector memory T cells in the draining lymph nodes throughout

EAE.

CD4+ cells from the draining lymph nodes of p110δD910A/D910A mice at both day 9 and

day 15 post-immunisation were analysed for expression of CD44 and CD62L to

identify memory CD4+ T cells. Representative flow cytometry plots gating on CD4+

cells are shown. Data are representative of at least 3 independent experiments. *P

<0.05, **P <0.01, ***P <0.005. All data are mean ± SEM (n = 6-8 mice per group).


144

Figure 4.3: Ex vivo antigen-specific proliferation of encephalitogenic cells.

Proliferation of encephalitogenic cells ex vivo was determined by immunising wild-

type and p110δD910A/D910A mice with MOG35-55 emulsified in CFA as described in

section 2.2.3. At day 9 post-immunisation draining inguinal and brachial lymph

nodes were extracted and single cell suspensions were generated (section 2.3.1.4)

and stained with CFSE (section 2.3.2.1). Cells were then cultured for 4 days in the

presence of 25μg/ml MOG35-55, 50μg/ml MOG35-55 or 1.5μg/ml ConA (section

2.3.5.1). Cultures that contained media and cells alone were used as negative

controls. Following the 4 day culture, cells were washed, resuspended in PBS/Azide

and proliferation of wild-type (blue bar) and p110δD910A/D910A (red bar) cells was

analysed by assessing the progressive halving of CFSE fluorescence. A

representative flow cytometery histogram overlay is shown for cell division in

response to ConA (wild-type = blue line, p110δD910A/D910A = red line). *P <0.05,

***P <0.005. All data are mean ± SEM (n = 8-9 mice per group).


145

Cells O

nly

25�g

/ml M

OG

50�g

/ml M

OG

1.5�g

/ml C

onA0

2

4

6


1020304050

* *

***%

cel

ls d

ivid

ed

CFSE

Cell

#


146



147


10

20

30

40

50 **

% C

D4+

cells

that

are

Brd

U+

CD

4

BrdU


10.46 19.9111.38 7.63

Figure 4.4: Proliferation of CD4+ T cells in vivo following MOG35-55

immunisation.

Mice were immunised with MOG35-55 emulsified in CFA as described in section

2.2.3. From day 6 post-immunisation mice were fed BrdU in their drinking water

(section 2.3.5.2). At day 9 post-immunisation, mice were euthanased and draining

inguinal and brachial lymph nodes were extracted (section 2.3.1.4). Single cell

suspensions were generated and stained with antibodies specific for surface CD4 and

intracellular BrdU (section 2.3.2.4). Representative flow cytometry plots are shown.

Data are representative of at least 3 independent experiments. **P <0.01. All data are

mean ± SEM (n = 5).


148

Figure 4.5: CD4+ T cells that lack p110δ undergo higher levels of apoptosis

throughout EAE than wild-type cells.

Mice were immunised to develop EAE as described in section 2.2.3. At days 6 and 9

post-immunisation, animals were euthanased and draining inguinal and brachial

lymph nodes were extracted (section 2.3.1.4). Single cell suspensions were

generated, stained with Annexin V and propidium iodide and analysed by flow

cytometry (section 2.3.2.6). (A) The proportion of apoptotic (Annexin V+/Propidium

iodide+) cells in the draining lymph nodes of p110δD910A/D910A mice (red bars)

compared with wild-type mice (blue bars). Representative FACS plots are also

shown. (B) Cells were labelled with anti-CD4 antibodies before Annexin V and

propidium iodide staining and the proportion of apoptotic (AnnexinV+/Propidium

iodide+) CD4+ cells in the draining lymph nodes of p110δD910A/D910A (red bar) and

wild-type (blue bar) mice at day 9 post-immunisation for EAE was calculated.

Representative flow cytometry plots are also shown. Results are representative of at

least two independent experiments. ***P <0.005. All data are mean ± SEM (n = 6-8

mice per group).


149

Day 6 Day 90

1

2

3

4

5

6

7

8


******


% c

ells

AV

+ /PI

+


5

10

15

20

***

% C

D4+

cells

that

are

AV

+ /PI

+

Ann

exin

V

Propidium Iodide


4.26 6.77

Day 6 Day 9

Ann

exin

V

Propidium Iodide


5.13 16.68

A

B

6.04 4.53


150



151

Wild-type p110δD910A/D910A Isotype control

Figure 4.6: Reduced B cell infiltration of the CNS of p110δD910A/D910A mice.

Spinal cords were removed from mice (section 2.3.1.6) at day 15 post-immunisation

for EAE. Cross sections were cut and stained with rat anti-mouse B220 antibody and

haematoxylin (section 2.3.3). B220+ cells in representative thoracic sections of spinal

cords from p110δD910A/D910A and age-matched C57BL/6 mice at day 15 post-

immunisation for EAE are shown. Isotype control antibody used was a RatIgG2a

monoclonal. Arrow indicates B220+ cells. Sections are representative of several

sections from at least 3-5 mice per group.


152



153

Naive Day 9 Day 15 Day 280.0

0.2

0.4

0.6

0.8

1.0



***

**

**

OD

492n

m

Figure 4.7: MOG35-55-specific IgG is not detectable in the serum of

p110δD910A/D910A mice.

Direct ELISAs were performed to determine the levels of MOG35-55-specific IgG in

the serum of mice throughout the EAE disease course. Serum was isolated from

wild-type or p110δD910A/D910A mice at days 9, 15 and 28 post-immunisation. Serum

from naïve (non-immunised) animals was used as a negative control. ELISAs were

performed as described in section 2.3.6.1. Data are mean ± SEM and are

representative of at least 2 independent experiments (n = 6-8).


154



155


10

20

30

40


% B

220+

cells

that

are

AV

+ /PI

+

**

Ann

exin

V

Propidium Iodide


13.55 42.93

Figure 4.8: B220+ in the draining lymph nodes of mice without functional p110δ

undergo higher levels of apoptosis than wild-type counterparts.

Mice were immunised for EAE as described in section 2.2.3. At day 9 post-

immunisation draining inguinal and brachial lymph nodes were extracted and single

cell suspensions generated (section 2.3.1.4). Cells were stained with B220 antibodies

(section 2.3.2.2) before being stained with Annexin V and propidium iodide (section

2.3.2.6) and analysed by flow cytometry (section 2.3.2.7). The proportion of

apoptotic (Annexin V+/Propidium iodide+) B220+ B cells in the draining lymph

nodes of p110δD910A/D910A mice (red bars) and wild-type mice (blue bars) is shown.

Representative flow cytometry dot plots are also shown. Data are representative of

two independent experiments. ***P <0.005. All data are mean ± SEM (n = 5).


156

Figure 4.9: In vitro migration of BMDCs to CCL19 is not reliant on p110δ.

Bone-marrow was isolated from the femurs of naïve wild-type C57BL/6 (blue bar)

and p110δD910A/D910A (red bar) mice (section 2.3.1.7). (A) Cell numbers extracted

from the bone marrow of the two cohorts were calculated. Data are representative of

at least five independent experiments and shown is the mean cell number ± SEM (n =

4). (B) Bone marrow-derived cells were cultured to generate mature DCs (section

2.3.4.3). The number of mature DCs generated in cultures was determined by trypan

blue staining and counting cells with a typical DC phenotype. Data are representative

of five independent experiments (n = 4). (C) Mature DCs were subjected to in vitro

transwell chemotaxis assays as described in section 2.3.7.2. Data are pooled from

three independent experiments (n = 10). All data are mean ± SEM.


157

0.3�g/ml 10�g/ml0

1

2

3

4

5

6

7

8

No ChemokineWild�typep110�D910A/D910A

CCL19 concentration

Mig

ratio

n in

dex


1

2

3

# de

ndrit

ic c

ells

isol

ated

from

cultu

re (x

106 )

Wild-type p110�D910A/D910A0.0

0.2

0.4

0.6

0.8

1.0

1.2

# ce

lls is

olat

ed fr

om o

ne fe

mur

(x10

7 )

A B

C


158

Figure 4.10: Dendritic cell migration in vivo is not affected by genetic

inactivation of p110δ.

DC migration in vivo was assessed by painting the abdomen of mice with FITC two

days prior to removal of the draining lymph nodes (section 2.2.6). Single cell

suspensions were then stained with anti-CD11c antibodies and analysed by flow

cytometry. (A) The proportion of CD11c+ DCs isolated from p110δD910A/D910A (red

bar) or wild-type (blue bar) mice. (B) The proportion of CD11c+ cells that were

FITC+ in the draining lymph nodes of p110δD910A/D910A (red bar) and wild-type (blue

bar) mice. Figures show pooled data from two independent experiments (n = 12). All

data are mean ± SEM.


159


1

2

3

4

5%

CD

11c+

cells


10

20

30

40

50

60

70

80

90

% C

D11

c+ ce

lls th

at a

re F

ITC

+

A

B


160



161

CD86 MHC II0

10

20

30

40

50

60

70

80


% C

D11

c+ ce

lls p

ositi

ve

Figure 4.11: Dendritic cell activation following CFA immunisation.

To assess the activation status of DCs in p110δD910A/D910A versus wild-type mice,

animals were immunised with CFA in the hind flank 7 days before inguinal lymph

nodes were removed, and the proportion of active DCs was also assessed by

comparing the proportion of CD11c+ cells that were also positive for CD86 or MHC

class II. The levels of CD11c+ cells that were either CD86+ or MHC II+ in

p110δD910A/D910A (red bars) and wild-type (blue bars) mice are shown. Data are

representative of two independent experiments (n = 8). All data are mean ± SEM.


162

Figure 4.12: Regulatory T cell generation is disrupted in p110δD910A/D910A mice at

peak EAE disease.

P110δD910A/D910A and wild-type animals were immunised as described in section 2.2.3

and draining lymph nodes were extracted at day 6 and 15 post-immunisation (section

2.3.1.4). Single cell suspensions were stained with antibodies against surface CD4,

CD25 and intracellular FoxP3 (sections 2.3.2.2 and 2.3.2.5). The proportion of CD4+

cells that were CD25+/FoxP3+ in the lymph nodes of p110δD910A/D910A (red bars) and

wild-type (blue bars) was then analysed by flow cytometry. Representative flow

cytometry plots are shown. Figures are representative of two independent

experiments (n = 8). Data are mean ± SEM.


163

Day 6 Day 150

2

4

6

8

10

12

14

16

18 Wild-typep110�D910A/D910A**

*


% C

D4+ c

ells

that

are

CD25

+ /Fox

P3+

CD25

FoxP3


7.11 4.13

Day 15

11.17 14.57

Day 6


164

Figure 4.13: Differentiation of cells from p110δD910A/D910A and wild-type mice ex

vivo under Th1- and Th17-skewing culture conditions.

Lymphocytes from p110δD910A/D910A (red bars) and wild-type (blue bars) mice were

incubated under Th1- or Th17-skewing culture conditions (sections 2.3.4.6 and

2.3.4.7) for 4 days before being assessed for (A) Th1 (CD4+/IFN-γ+/IL-17-) or (B)

Th17 (CD4+/IFN-γ-/IL-17+) cell production. To assess Th1 and Th17 cell production,

cells were stained for surface CD4 and intracellular IFN-γ (Th1 cells) or IL-17 (Th17

cells) and analysed by flow cytometry (sections 2.3.2.2 and 2.3.2.3). Representative

flow cytometric dot plots are also shown. Data are representative of two independent

experiments (n = 9). ***P <0.005. All data are shown as mean ± SEM.


165


1

2

3

4

5

6

7

***

% T

h1 c

ells


2

4

6

8

10***

% T

h17

cells

IL-1

7

IFN�


5.99 3.18

IL-1

7

IFN�


8.28 3.24

A

B


166

Figure 4.14: Th17 responses are significantly reduced in p110δD910A/D910A mice.

The proportion of Th1 (IFN-γ+/IL-17-/CD4+ cells) cells in (A) the draining lymph

nodes and (B) spinal cords of p110δD910A/D910A (red bars) and wild-type (blue bars)

mice throughout the EAE disease course was assessed by isolating lymphocytes at

days 15 and 28 post-immunisation for EAE and staining for surface CD4 and

intracellular IFN-γ (sections 2.3.2.2 and 2.3.2.3). Proportions of Th17 (IFN-γ-/IL-

17+/CD4+ cells) cells were also assessed in (C) the draining lymph nodes and (D)

spinal cords by staining for surface CD4 and intracellular IL-17 (sections 2.3.2.2 and

2.3.2.3). (E) Representative flow cytometric dot plots of lymph node and spinal cord

cells are also shown. *P <0.05, **P <0.01, ***P <0.005. Data are expressed as mean

± SEM and are representative of at least two independent experiments per time-point.

Lymph node n = 5-8, spinal cord n = 4-6.


167

Day 15 Day 280

1

2

3

4

5

6

7

8


**

**


% T

h1 c

ells

in th

e dr

aini

ng ly

mph

node

s

Day 15 Day 280

10

20

30


% T

h1 c

ells

in th

e sp

inal

cor

dA

B


168

Day 15 Day 280.0

0.2

0.4

0.6

0.8

1.0


***

*


% T

h17

cells

in th

e dr

aini

ng ly

mph

node

s

Day 15 Day 280

1

2

3

4

*

*


% T

h17

cells

in th

e sp

inal

cor

dC

D


169

Wild

-typ

ep1

10�D

910A

/D91

0A

0.70

1.26

0.56

1.10

0.79

3.36

0.11

0.44

Wild

-typ

e

Lym

ph n

ode

IL-1

7p1

10�D

910A

/D91

0A

IFN�

12.84

39.08

2.68

19.01

4.42

41.90

0.91

16.15

Spin

al c

ord

E Day 15 Day 28


170

Figure 4.15: The autoimmune response in p110δD910A/D910A is skewed towards a

Th1-type and away from the more pathogenic Th17-type.

Flow cytometric data from Figure 4.14 was also used to determine the relative ratio

of Th1 (CD4+/IFN-γ+/IL-17-) to Th17 (CD4+/IFN-γ-/IL-17+) cells in the draining

lymph nodes and spinal cords of p110δD910A/D910A (red bars) and wild-type (blue bars)

mice throughout the EAE. These data represent the number of Th1 cells per Th17

cells in (A) the draining lymph nodes or (B) the spinal cord throughout the disease

course. *P <0.05, **P <0.01. Data are expressed as mean ± SEM and are

representative of at least two independent experiments per time-point. Lymph node n

= 5-8, spinal cord n = 4-6.


171

Day 15 Day 280

2

4

6

8

10

12

14

16

18 Wild-typep110�D910A/D910A**

*


# Th

1 ce

lls p

er T

h17

cell

in th

edr

aini

ng ly

mph

nod

es

Day 15 Day 280

10

20

30

40*


# Th

1 ce

lls p

er T

h17

cell

in th

esp

inal

cor

d

A

B


172

Figure 4.16: F4/80+ macrophage infiltration to the CNS is affected by p110δ

inactivation.

Infiltration of macrophages and neutrophils to the CNS was assessed by extracting

leukocytes from spinal cords from p110δD910A/D910A (red bars) and wild-type (blue

bars) mice at day 6 and 15 post-immunisation for EAE and staining cells for

expression of surface F4/80 and Ly6G before flow cytometric analysis (section

2.3.2.2). (A) Total cell numbers recovered from spinal cords is shown. The

proportion and number of F4/80+ cells (B and C respectively) and Ly6G+ cells (D

and E respectively) in the CNS of p110δD910A/D910A and wild-type was assessed by

flow cytometry. (F) Flow cytometric data was also used to determine the relative

ratio of F4/80+ macrophages to Ly6G+ neutrophils in the spinal cords of

p110δD910A/D910A (red bars) and wild-type (blue bars) mice at days 6 and 15 post-

immunisation for EAE. These data represent the number of F4/80+ cells per Ly6G+

cell in the spinal cord throughout the disease course. *P <0.05, **P <0.01, ***P

<0.005. Data are expressed as mean ± SEM (n = 7-8 mice per group).


173

Day 6 Day 150

100000

200000

300000



Num

ber o

f cel

ls is

olat

ed fr

om th

esp

inal

cor

d

Day 6 Day 150

10

20

30

40

50

60

*


% F

4/80

+ ce

lls

Day 6 Day 150

10000

20000

30000

40000

50000

60000

70000

80000 *

*


# F4

/80+ c

ells

Day 6 Day 150

10

20

30

40

*


% L

y6G

+ ce

lls

Day 6 Day 150

10000

20000

30000

40000

50000


# Ly

6G+ c

ells

A

B C

D E


174

Day 6 Day 150

1

2



# F4

80+

cells

per

Ly6

G+

cell

**

**F

��

CHAPTER 5

Investigation into the efficacy

of the p110δ inhibitor

IC87114 as a therapeutic for

EAE

��

CHAPTER 5: The efficacy of the p110δ inhibitor IC87114 as a therapeutic for EAE

176



177

5.1 OVERVIEW

In the past, studies into PI3K function were performed using pan-PI3K inhibitors

such as Wortmannin and LY294002. However in recent years small molecule,

isoform-specific inhibitors for PI3K catalytic subunits have been developed (352-

361). One of these inhibitors, IC87114, is highly specific for the class IA p110δ

catalytic isoform (359). IC87114 has no known off-target effects on other protein

kinases such as Akt1 (PKBα), PKCα, PKCβII, p38 MAPK, DNA-PK, c-Src, casein

kinase I and checkpoint kinase I and significantly inhibits p110δ catalytic function

and the generation of PIP3 (359). Published studies using IC87114 have

demonstrated that this compound is capable of reducing in vitro activation, function

and/or trafficking in a number of different cell types including neutrophils, mast

cells, NK cells and B and T cells (238, 240, 359, 360, 362-372). IC87114 treatment

has also been shown to reduce pathology in a model of rheumatoid arthritis (370).

Isoform-specific PI3K inhibitors are currently undergoing clinical development for

cancer treatment and in the near future they may also be adapted to treat autoimmune

diseases. Therefore, due to the high specificity of IC87114 towards p110δ, and in

view of the data presented in the previous two chapters implicating p110δ in the

immune response occurring in EAE, an initial investigation into the potential of this

compound to reduce clinical disease during EAE was conducted and is reported in

this chapter.

5.2 CHARACTERISATION OF THE EFFECT OF IC87114 ON T CELL

DIFFERENTIATION IN VITRO

The p110δ-specific inhibitor IC87114 has been demonstrated to reduce the activation

and function of several different cell types (238, 240, 359, 360, 362-372). While

genetic inactivation of p110δ reduces IFN-γ-production by Th1-skewed cells in vitro

(249), pharmacological inhibition of p110δ function has not yet been demonstrated to

reduce the differentiation of Th1 or Th17 cells. As both Th1 and Th17 cells are

important for EAE pathogenesis, initial studies were undertaken to compare the

effects of the pan-PI3K inhibitor LY294002 and the p110δ-specific inhibitor

IC87114 on T cell differentiation in vitro.


178

5.2.1 The pan-PI3K inhibitor LY294002 reduces differentiation of naïve T cells

to the Th1-type

PI3Ks have been shown to be important for Th1 differentiation (present study and

(249)). To examine the effect of the pan-PI3K inhibitor LY294002 on Th1 cell

differentiation spleens were extracted from wild-type C57BL/6 mice and single cell

suspensions were generated (section 2.3.1.4). Cells were then cultured for four days

under Th1-skewing culture conditions (media containing IL-12 - section 2.3.4.6) in

the presence of LY294002 or a diluent control (section 2.1.4.1) before being

analysed by flow cytometry. Concentrations of LY294002 used in the present study

have been used previously and have been shown to inhibit PI3K activation (440).

Th1 cells were defined as CD4+ cells that were IFN-γ+/IL-17-. CD4+ cells that were

cultured with the highest concentration of LY294002 (100μM) had very little

intracellular IFN-γ when compared to diluent controls (Figure 5.1A). Culturing cells

with lower concentrations of LY294002 (2.5μM and 5μM) did not affect the

proportion of cells that were CD4+/IFN-γ+/IL-17- when compared with the negative

controls. Despite this, when culture supernatants were analysed by ELISA, there

were lower levels of IFN-γ detectable in the supernatants of all of the LY294002-

treated samples when compared to the diluent control (Figure 5.1B). This indicates

that, even at the lower concentrations, LY294002 inhibits secretion of IFN-γ by IL-

12-driven cells in vitro. Therefore PI3Ks may not only be important for Th1

differentiation but also for cytokine secretion in vitro.

5.2.2 IC87114 treatment reduces differentiation of Th1 cells

It is clear that pan-PI3K inhibition results in reduced Th1 differentiation under the

culture conditions used for this study. The efficacy of the p110δ inhibitor IC87114 to

inhibit this process was then assessed as described above. It was observed that cells

which were cultured with 5μM or 10μM of IC87114 showed a marked reduction in

their capacity to differentiate to IFN-γ-producing Th1 cells (Figure 5.2A).

Furthermore, levels of IFN-γ in the culture supernatant of IC87114-treated cells were

significantly lower than that observed in the supernatant of diluent controls (Figure

5.2B). These findings demonstrate that IC87114 inhibits the process of Th1

differentiation and IFN-γ production/secretion in vitro. As observed with LY294002,


179

cytokine secretion was more sensitive to inhibition of p110δ than was Th1

differentiation.

5.2.3 LY294002 reduces Th17 cell differentiation

The results of experiments using p110δD910A/D910A mice indicate a role for p110δ in

Th17 generation (see chapter 4). To determine whether pharmacological inhibition of

p110δ similarly inhibits Th17 production, lymphocytes were cultured for four days

under Th17-skewing culture conditions (media containing IL-6, TGF-β, IL-1β, IL-

23, anti-IFN-γ and anti-IL-4 - section 2.3.4.7), in the presence of LY294002 or

diluent (as a negative control). It was observed that at all concentrations of

LY294002 tested (2.5μM, 5μM and 100μM) there was a significant reduction in the

proportion of CD4+ cells that were IL-17+/IFN-γ- (Th17 cells) when compared with

the samples cultured in the presence of the diluent negative control (Figure 5.3A).

When analysed by ELISA, it was observed that cells which were exposed to

LY294002 also secreted lower levels of IL-17 into the culture supernatant; IL-17 was

undetectable in the wells where cells were exposed to 100μM LY294002 (Figure

5.3B). These findings show that PI3Ks are important for Th17 cell differentiation

and possibly for IL-17 production/secretion.

5.2.4 CD4+ cell differentiation to a Th17-type is significantly impacted by

IC87114

To assess whether IC87114 inhibits Th17 differentiation in vitro, lymphocytes were

cultured in Th17-skewing culture conditions in the presence or absence of IC87114

suspended in DMSO (section 2.1.4.2). CD4+ cells were examined for intracellular

IL-17 by flow cytometry (sections 2.3.2.2 and 2.3.2.3). It was observed that CD4+

cells which were exposed to optimal concentrations of IC87114 (5μM and 10μM)

failed to effectively differentiate to the IL-17-producing Th17-type (Figure 5.4A).

There was very little IL-17 detectable by ELISA in the supernatant of these cultures

(Figure 5.4B). Therefore the p110δ-specific inhibitor IC87114 can significantly

reduce Th17 cell differentiation when administered at concentrations of 5μM and

10μM in vitro, verifying an important role for p110δ in Th17 differentiation.


180

5.3 IC87114 DOES NOT AFFECT DC FUNCTION

In chapter 4 of this thesis the role of p110δ in DC migration and activation was

addressed. Here, the ability of the p110δ inhibitor IC87114 to affect DC migration

and activation is also tested. Antigen processing and presentation by DCs is integral

for efficient immune responses. Therefore IC87114 was also used to inhibit p110δ in

either DCs or responding T cells to determine whether pharmacological inhibition of

p110δ affects DC antigen processing and presentation, as well as T cell proliferation

in response to presentation of antigen by DCs.

5.3.1 IC87114 treatment does not affect DC migration

To test whether IC87114 affects DC migration, BMDCs were isolated from wild-

type C57BL/6 mice (section 2.3.1.7) before being cultured in the presence of GM-

CSF for 10 days. Following this incubation, media containing GM-CSF, LPS and

TNFα was added to the DC cultures in order to produce a mature phenotype (section

2.3.4.3). DCs were then labelled with CFSE, pre-treated with IC87114 or diluent,

and subjected to Transwell chemotaxis assays to assess the ability of mature DCs to

migrate towards the chemokine CCL19 in vitro (section 2.3.7.2). Consistent with that

observed in p110δD910A/D910A mice (Figure 4.9B), pharmacological inhibition of

p110δ with IC87114 did not affect the capacity of DCs to migrate towards CCL19 in

vitro (Figure 5.5).

5.3.2 IC87114 treatment of DCs does not affect antigen processing and

presentation

Antigen presentation by DCs to cells within the lymph nodes is important for the

efficient activation of the immune response. The ability of OVA-pulsed, IC87114-

treated, DCs to present antigen to CFSE-labeled OT-II lymphocytes was examined to

determine if p110δ plays a role in DC antigen processing and presentation. Immature

wild-type DCs were pulsed with OVA for a period of two hours, during which time

they were treated with IC87114 or diluent (section 2.1.4.2). Following this, DCs

were washed and subsequently incubated with CFSE-labelled OT-II splenocytes, and

CD4+ OT-II cell proliferation was assessed by flow cytometry 4 days later (section

2.3.8). There was no difference in the ability of IC87114 treated DCs to induce


181

proliferation in OT-II CD4+ T cells when compared with diluent control-treated DCs

(Figure 5.6).

5.3.3 IC87114 treatment of responding OT-II cells inhibits proliferation in

response to antigen presentation by DCs

To further examine the role of p110δ in the dynamic T cell/DC interaction, the DC

cell antigen presentation assay described above was performed without p110δ

inhibition of DCs but with IC87114-treatment of responding OT-II T cells. When

responding OT-II cells were treated with IC87114 for the 4-day incubation period

there was a significant reduction in their ability to proliferate in response to OVA

presented by DCs (Figure 5.7). This indicates that p110δ inhibition induces an

intrinsic defect in T cell activation, thereby reducing the proliferative response.

5.3.4 IC87114 is detectable in plasma following administration via oral gavage

Before any in vivo experiments using IC87114 were commenced, initial tests were

performed to ensure that administration of IC87114 resulted in the compound being

effectively delivered to the blood stream. The most effective in vivo dosing strategy

of IC87114 has been previously devised (Kamal Puri, Calistoga Pharmaceuticals,

personal communication). This involves a twice daily administration of 30mg/kg of

IC87114 (suspended in vehicle) (sections 2.1.4.2 and 2.1.4.3) to mice via oral gavage

(section 2.2.5). To test the levels of IC87114 in the bloodstream of mice, blood was

collected one, two or four hours following administration of IC87114 (section

2.3.1.3). Plasma samples were then analysed by gas chromatography – mass

spectrometry (GC-MS) to examine IC87114 levels (section 2.3.9). It was observed

that at one, two and four hours post-administration of IC87114 there were

appropriate levels of IC87114 for pharmacological activity detectable in the plasma

of animals (Figure 5.8) (Kamal Puri, Calistoga Pharmaceuticals, personal

communication).


182

5.3.5 IC87114 treatment does not affect DC activation following CFA

immunisation

To examine whether IC87114 treatment in vivo affects the proportion of active DCs

in the draining lymph nodes, mice were treated with IC87114 or vehicle alone for 48

hours following immunisation with CFA (section 2.2.4). Draining inguinal and

brachial lymph nodes were then extracted and treated with collagenase (section

2.3.1.4) before cells were stained with antibodies against CD11c, CD86 and MHC

class II and analysed by flow cytometry (section 2.3.2.2). It was observed that there

was an equal proportion of CD11c+ cells in the draining lymph nodes of mice treated

with IC87114 when compared with animals treated with the vehicle only (Figure

5.9A). The CD11c+ DCs from mice treated with IC87114 in vivo expressed levels of

the activation markers CD86 and MHC II that were comparable to that observed

from vehicle-treated mice (Figure 5.9B). Therefore, IC87114 treatment in vivo does

not affect the proportion of active DCs in draining lymph nodes following CFA

immunisation, thereby confirming the observed lack of effect of genetic inactivation

of p110δ on these DC functions.

5.4 IC87114 TREATMENT IN VIVO REDUCES CD4+ CELL

PROLIFERATION

Before considering IC87114 treatment in vivo it was important to investigate whether

the inhibitor is capable of inhibiting T cell responses after in vivo administration.

Therefore, preliminary experiments were performed to examine this.

5.4.1 IC87114 treatment in vivo reduces the ex vivo proliferative capacity of

naïve CD4+ cells

In a first series of experiments, the proliferative capacity of T cells with ex vivo

inhibition of p110δ was assessed. Cells taken from the spleen of mice with no prior

treatment in vivo were labelled with CFSE (section 2.3.2.1) before being incubated

for four days in the presence of anti-CD3/anti-CD28 antibodies (section 2.3.4.4) with

the addition of IC87114 or diluent (section 2.1.4.2). At the end of the four day

culture, cells were harvested and analysed by flow cytometry. Cell proliferation was

assessed by comparing experimental samples with cells that were incubated in the


183

presence of culture media alone (cells only negative controls); a progressive halving

of CFSE fluorescence intensity was considered a marker of cell proliferation. It was

observed that 5% of CD4+ T cells treated in vitro with the diluent control divided in

response to the anti-CD3/anti-CD28 stimulation whereas only 2.5% of CD4+ T cells

treated in vitro with IC87114 were capable of proliferating in response to anti-

CD3/anti-CD28 (Figure 5.10A).

To assess whether IC87114 treatment in vivo can reduce the proliferative capacity of

naïve CD4+ T cells, wild-type C57BL/6 mice were administered either IC87114 or

the vehicle control via oral gavage in the morning and evening (section 2.2.5). The

following morning, mice were again administered IC87114 or vehicle before the

spleen of the mice was removed one hour later and single cell suspensions were

generated and set up with the same culture conditions described above (without

inhibitor or diluent). It was observed that approximately 8% of the CD4+ T cells

taken from the spleen of vehicle control-treated mice proliferated in response to anti-

CD3/anti-CD28 stimulation during the culture period. However only 5% of CD4+ T

cells from mice treated with IC87114 underwent cell division during this time

(Figure 5.10B). Therefore, these data show that in vivo treatment with the p110δ

inhibitor IC87114 reduces the ex vivo proliferative capacity of naïve T cells. These

data indicate that the IC87114 treatment in vivo can reduce the ex vivo proliferative

capacity of naïve T cells.

5.5 IC87114 ADMINISTRATION DURING EAE

IC87114 is a potent inhibitor of p110δ and initial published experiments show that

this compound may prove to be a useful therapeutic in diseases such as cancer

(particularly leukaemia) and rheumatoid arthritis (370, 371). The autoimmune

disease MS is characterised by an influx of both antigen-specific and non-specific

cells to the CNS where they cause local inflammation and myelin and axon

destruction. This damage results in the progressive neurological defects observed in

MS patients. Due to the role that cells of the immune system play in MS, it was

thought that administration of IC87114 may aid in down-regulating the autoimmune

response in MS patients by inhibiting the activation and effector function of key


184

disease mediators such as T and B cells. IC87114 may therefore provide some

therapeutic relief to RR-MS patients by limiting the frequency and severity of

relapses, and it may also prove useful for slowing the degeneration observed in PP-

MS patients.

The experiments already shown in this chapter show that IC87114 is capable of

almost completely inhibiting Th17 differentiation in vitro, reducing Th1

differentiation in vitro and reducing the proliferative capacity of CD4+ T cells

following in vivo treatment. IC87114 does not affect DC migration, activation or

antigen processing and presentation. Therefore, due to the capacity of IC87114 to

limit T cell function, and the proven importance of T cells in EAE, IC87114 was

administered to wild-type C57BL/6 throughout EAE with two different dosing

strategies. The first was a ‘preventative’ strategy where animals were administered

IC87114 via oral gavage (section 2.2.5) from the day prior to EAE immunisation

until the experimental end-point (section 5.5.1). The second dosing strategy was a

‘therapeutic’ approach where animals were only administered the compound from

the time that they were showing symptoms of established clinical disease (section

5.5.2).

5.5.1 Preventative dosing of IC87114 to mice immunised with MOG35-55

To determine the efficacy of IC87114 to prevent EAE, mice were administered

IC87114 twice daily via oral gavage from one day prior to EAE immunisation. This

represents the ‘preventative’ dosing strategy. As an added control, plasma samples

taken throughout this experimental procedure were analysed by GC-MS to determine

the levels of IC87114 in the blood of mice. This was done at various time-points

post-IC87114 dosing. It was observed that the animals being treated with IC87114

had high levels of the compound in their bloodstream at most of the time-points

tested throughout the disease course. However, by 12 hours post-IC87114

administration there were only low levels of IC87114 detectable in the bloodstream

(Figure 5.11). Animals receiving 30mg/kg of IC87114 twice daily throughout the

course of EAE exhibited a similar EAE disease course when compared with mice

receiving the vehicle control (Figure 5.12A). There was no significant difference


185

between the average day of disease onset and the average day of peak disease

between the two cohorts (Figures 5.12B and 5.12C respectively). The average peak

disease score was however significantly higher in animals treated with IC87114

when compared with the vehicle control-treated animals (Figure 5.12D). In addition,

there were high levels of animal morbidity in both the IC87114 and vehicle control-

treated groups; this is has not been previously observed in other EAE experiments

performed in the laboratory in which this work was conducted. Kapplan-Meyer

survival charts show that the rate of death in the IC87114-treated group was much

higher than that observed in the vehicle control-treated animals (Figure 5.12E). The

reason for this is as yet unclear. However, these data indicate that IC87114 treatment

from the time of EAE immunisation (under these conditions) does not reduce EAE

pathogenesis.

5.5.2 Therapeutic dosing of IC87114 to mice immunised with MOG35-55

In addition to preventative dosing experiments, IC87114 treatment following EAE

disease onset was also performed to assess the potential of this inhibitor to reduce

disease in animals showing physical disease symptoms. Mice were immunised and

EAE was allowed to develop. Two days following EAE disease onset (where animals

had a clinical disease score of 2 or higher) twice-daily oral gavage administration of

IC87114 or the vehicle control was commenced. It was observed that there was no

difference between the EAE disease scores observed in IC87114 treated mice when

compared with vehicle control-treated mice (Figure 5.13A). In addition, there was no

difference in the peak disease scores observed in the two cohorts (Figure 5.13B).

While there was some morbidity observed in animals in both treatment groups it was

not as distinct as that observed with the preventative dosing strategy (Figure 5.13C).

These data show that, at least under the conditions tested and with this dosing

strategy, therapeutic dosing of mice with IC87114 does not reduce EAE

pathogenesis.


186

5.6 IC87114 TREATMENT IN VIVO DOES NOT AFFECT THE EX VIVO

PROLIFERATION OF CFA-ACTIVATED CD4+ T CELLS OR B220+ B

CELLS

The initial studies described in section 5.4 demonstrate that IC87114 treatment in

vivo results in reduced ex vivo proliferative capacity of naïve CD4+ T cells (section

5.4.1). However, during EAE, the immune system is activated by MOG35-55

emulsified in CFA. Due to the lack of reduction in EAE pathogenesis following

IC87114 administration in both preventative and therapeutic dosing strategies, the

ability of IC87114 treatment to inhibit ex vivo proliferation of both CFA-activated

CD4+ T cells and B220+ B cells was examined.

5.6.1 IC87114 treatment in vivo does not reduce ex vivo proliferation of CFA-

activated CD4+ T cells

To assess whether IC87114 treatment in vivo can reduce the proliferation of activated

CD4+ T cells ex vivo, mice were immunised with CFA in the hind flanks and scruff

of the neck (section 2.2.4) and treated with either IC87114 or the vehicle control for

4 days in the mornings and evenings. On the final day, IC87114 or vehicle control

were administered in the morning 30 minutes before draining inguinal and brachial

lymph nodes were extracted, and cells were stained with CFSE and cultured with

anti-CD3/anti-CD28 as described in section 2.3.4.4. Following the four day culture

period, cell proliferation was assessed by comparing experimental samples with cells

that were incubated in the presence of culture media alone (cells only negative

controls). There was no difference in the levels of proliferation observed in cells

isolated from mice that had received IC87114 in vivo when compared with cells

isolated from vehicle control-treated animals (Figure 5.14A). As a control, cells from

un-treated animals were cultured in the presence of IC87114 or a diluent control. As

observed previously with naïve T cells (Figure 5.10A), in vitro treatment of CFA-

activated CD4+ T cells with IC87114 reduced their proliferative capacity when

compared with diluent controls (Figure 5.14B). Therefore, IC87114 treatment in vivo

does not reduce the proliferative capacity of CD4+ T cells that have been previously

activated as a result of CFA immunisation.


187

5.6.2 In vivo IC87114 treatment does not reduce the ex vivo proliferative

capacity of CFA-activated B220+ cells

B cells are also important for EAE pathogenesis (115, 127, 188-191, 226-231) and it

has been clearly shown that p110δ is integral for efficient B cell function (238-241,

243, 244, 247, 372, 398, 401, 432, 459, 507). Therefore, the ability of p110δ-

inhibited B220+ B cells to proliferate in response to stimulation with PHA following

CFA-activation in vivo was assessed. Mice were treated with IC87114 or the vehicle

control for 4 days following CFA immunisation and then single cell suspensions

were generated as described in section 2.3.1.4. Cells were labelled with CFSE and

cultured for 4 days in the presence of PHA (section 2.3.4.5). At the end of the culture

period, division of B220+ cells was assessed by flow cytometery (section 2.3.2.2). It

was observed that there was no difference in levels of proliferation of B220+ cells

from mice treated with IC87114 in vivo when compared to cells from vehicle control

treated animals (Figure 5.15A). When cells from CFA-immunised mice were

cultured in the presence of IC87114 in vitro there was a significant reduction in the

ability of B220+ cells to proliferate in response to PHA stimulation when compared

with diluent-treated controls (Figure 5.15B). These data demonstrate that in vivo

treatment of CFA-immunised mice with the p110δ inhibitor IC87114 does not lead to

a reduction in the ability of B cells to proliferate when stimulated with PHA ex vivo.

5.7 SUMMARY

In chapter 4 of this thesis it was demonstrated that genetic inactivation of p110δ

results in reduced EAE pathogenesis. IC87114 is a highly specific inhibitor of p110δ

that has no known off-target effects on other protein kinases and has been

demonstrated to significantly inhibit p110δ function in vitro (238, 240, 359, 360,

362-366, 368-372, 458). It has also been shown to reduce pathology in a model of

RA (370). Due to this, the ability of IC87114 to reduce activation and differentiation

of Th1 and Th17 cells in vitro, as well as to influence EAE pathogenesis in vivo, was

examined. The results presented in this chapter demonstrate that IC87114 is a potent

inhibitor of Th1 and Th17 differentiation in vitro. However Th17, more so than Th1,

cells appear to be highly reliant on p110δ for efficient differentiation and cytokine

production. IC87114 was also observed to inhibit CD4+ T cell and B220+ B cell


188

proliferation in vitro. Even though T cell activation in vivo is reduced when p110δ is

genetically inactivated (chapter 4), IC87114 has no effect on DC migration,

activation and antigen processing and presentation. This is consistent with that

observed in the p110δD910A/D910A mice. Despite the finding that IC87114 reduces Th1

and Th17 differentiation in vitro, and despite that observed in the p110δD910A/D910A

mice, IC87114 administration to mice did not affect EAE pathogenesis. There are a

number of potential reasons for this observation. IC87114 is known to have a short

half-life in vivo and the adopted IC87114 dosing strategy may have been inefficient,

or the doses of MOG35-55 and CFA used to induce EAE may have activated the

immune system with such potency that inhibition of p110δ did not affect the disease

pathogenesis. Also, the inhibitor may be blocking function of cells such as regulatory

T and B cells, both of which play an important role in negatively regulating

autoimmunity. As the effects of IC87114 in vivo are only beginning to be

investigated, it is possible that there are as yet unknown effects on many different

cell types which are responsible for EAE pathology. This is discussed further in

chapter 6 of this thesis and future studies will endeavour to address these issues.


189



190

Figure 5.1: Inhibition of Th1-type cell differentiation and IFN-γ production and

secretion by LY294002.

Lymphocytes were isolated from the spleen of naïve wild-type C57BL/6 mice

(section 2.3.1.4) and cultured for four days in Th1-skewing culture conditions

(section 2.3.4.6) in the presence of 2.5μM, 5μM or 100μM LY294002 or a diluent

control (section 2.1.4.1). Cells were then stained with antibodies against surface CD4

and intracellular IFN-γ and IL-17. (A) The proportion of Th1 (CD4+ cells that are

IFN-γ+/IL-17-) cells that were isolated from the cultures was determined by flow

cytometric analysis (sections 2.3.2.2 and 2.3.2.3). (B) Levels of IFN-γ in the

supernatant of cultures were also analysed by ELISA (section 2.3.6.2).

Representative flow cytometry plots are also shown. Data are mean ± SEM and are

representative of three independent experiments (n = 3).


191

DMSO 2.5�M 5�M 100�M0

2

4

6

8

10

LY294002 concentration

**

% T

h1 c

ells

DMSO 2.5�M 5�M 100�M0

100

200

300

400

500


**

IFN�

(pg/

ml)

A

B

IL-1

7

IFN�

7.47 6.01 7.30 0.90

DMSO 2.5�M 5�M 100�MLY294002 concentration


192

Figure 5.2: Inhibition of Th1-type cell differentiation and IFN-γ production and

secretion by the p110δ inhibitor IC87114.



(section 2.3.4.6) in the presence of 1μM, 5μM or 10μM IC87114 or a diluent control

(section 2.1.4.2). Cells were then stained with antibodies against surface CD4 and

intracellular IFN-γ and IL-17. (A) The proportion of Th1 (CD4+ cells that are IFN-

γ+/IL-17-) cells that were isolated from the cultures was determined by flow

cytometric analysis (sections 2.3.2.2 and 2.3.2.3). (B) Levels of IFN-γ in the





193

DMSO 1�M 5�M 10�M0

2

4

6

8

10

IC87114 concentration

**

% T

h1 c

ells

DMSO 1�M 5�M 10�M0

100

200

300

400

500

600

700


****

IFN�

(pg/

ml)

IL-1

7

IFN�

7.47 6.57 4.37 4.16

DMSO 1�M 5�M 10�MIC87114 concentration

A

B


194

Figure 5.3: Inhibition of Th17-type cell differentiation and IL-17 production

and secretion by LY294002.



(section 2.3.4.7) in the presence of 2.5μM, 5μM or 100μM LY294002 or a diluent

control (section 2.1.4.1). Cells were then stained with antibodies against surface CD4

and intracellular IFN-γ and IL-17. (A) The proportion of Th17 (CD4+ cells that are

IFN-γ-/IL-17+) cells that were isolated from the cultures was determined by flow

cytometric analysis (sections 2.3.2.2 and 2.3.2.3). (B) Levels of IL-17 in the





195

DMSO 2.5�M 5�M 100�M0

2

4

6

8

10

12


*****

**

% T

h17

cells

DMSO 2.5�M 5�M 100�M0

10

20

30

40

50

60


**

IL-1

7A (p

g/m

l)

IL-1

7

IFN�

8.06 3.85 1.57 0.49DMSO 2.5�M 5�M 100�M


A

B


196

Figure 5.4: Inhibition of Th17-type cell differentiation and IL-17 production

and secretion by the p110δ inhibitor IC87114.



(section 2.3.4.7) in the presence of 1μM, 5μM or 10μM IC87114 or a diluent control

(section 2.1.4.2). Cells were then stained with antibodies against surface CD4 and

intracellular IFN-γ and IL-17. (A) The proportion of Th17 (CD4+ cells that are IFN-

γ-/IL-17+) cells that were isolated from the cultures was determined by flow

cytometric analysis (sections 2.3.2.2 and 2.3.2.3). (B) Levels of IL-17 in the





197

DMSO 1�M 5�M 10�M0

2

4

6

8

10


******

% T

h17

cells

DMSO 1�M 5�M 10�M0

10

20

30

40

50

60


**

IL-1

7 (p

g/m

l)

A

B

IL-1

7

IFN�

8.06 6.36 0.51 0.67DMSO 1�M 5�M 10�M



198

0.3mg/ml 10mg/ml0

1

2

3

4

5

6

7No ChemokineDMSOIC87114

CCL19 concentration

Mig

ratio

n In

dex

Figure 5.5: IC87114 does not affect BMDC migration towards CCL19 in vitro.

In vitro transwell chemotaxis assays were used to investigate the capacity of p110δ-

inactivated mature BMDCs to migrate towards the chemokine CCL19. Bone-marrow

cells were isolated from the femurs of naïve wild-type C57BL/6 mice (section

2.3.1.7) and were cultured for 11 days to generate mature DCs (section 2.3.4.3).

Mature DCs, which were pre-treated with either IC87114 or diluent, were subjected

to in vitro transwell chemotaxis assays as described in section 2.3.7.2. Data are mean

± SEM (n = 4).


199

100�g/ml 10�g/ml 00

2

4

6

8

10 DMSOIC87114

OVA concentration

% C

D4+

cells

div

ided

Figure 5.6: P110δ inhibition does not affect antigen uptake and presentation by

dendritic cells.

The ability of DCs lacking p110δ function was examined by pulsing BMDCs with

OVA in the presence of the p110δ inhibitor, IC87114 (10μM - purple bars), or

diluent (DMSO) control (pale green bars) before washing and incubating with CFSE-

labelled OT-II lymphocytes (section 2.3.8). Four days later proliferation of CD4+

OT-II T cells was determined by flow cytometry (sections 2.3.2.2 and 2.3.2.7). Data

are mean ± SEM and are representative of three independent experiments (n = 4).


200

100�g/ml 10�g/ml 00

1

2

3

4

5

6 DMSOIC87114

**

**

OVA concentration

% C

D4+

cells

div

ided

Figure 5.7: Functional p110δ is required for proliferation of OT-II CD4+ T cells

in response to OVA-presentation by dendritic cells.

Immature BMDCs were pulsed with OVA, washed and then incubated with OT-II

cells that had been pre-treated with IC87114 (purple bars) or diluent (DMSO) control

(pale green bars) (section 2.3.8). Four days later cell division of CD4+ OT-II cells

was assessed by flow cytometry (sections 2.3.2.2 and 2.3.2.7). Data are mean ± SEM

and are representative of three independent experiments (n = 4).


201

1 hour 2 hours 4 hours0

1000

2000

3000

4000

5000

6000

7000

8000

Time post-administration

IC87

114

conc

entr

atio

n in

pla

sma

(ng/

ml)

Figure 5.8: IC87114 is detectable in plasma following oral gavage.

Mice were administered IC87114 at a concentration of 30mg/kg via oral gavage

(section 2.2.5). One, two and four hours later mice were euthanased and plasma was

collected as described in section 2.3.1.3. Samples were sent to Calistoga

Pharmaceuticals where GC-MS analysis was carried out to determine levels of

IC87114 in the plasma. Data are mean ± SEM (n = 4).


202

Figure 5.9: IC87114 treatment in vivo does not affect DC activation

Mice were immunised at the scruff of the neck and in the hind flank with CFA and

treated morning and evening with IC87114 or the vehicle control (section 2.2.5).

Forty-eight hours after CFA immunisation mice were euthanased and draining lymph

nodes were removed and treated with collagenase (section 2.3.1.4) before single cell

suspensions were stained with anti-CD11c, anti-MHC II and anti-CD86 antibodies

and analysed by flow cytometry (section 2.3.2.2). (A) Proportions of CD11c+ cells

isolated from the lymph nodes of IC87114 treated mice (purple bar) and vehicle

control-treated animals (green bar) are shown. (B) The proportion of CD11c+ cells

from IC87114 treated (purple bars) and vehicle control-treated (dark green bars)

mice that were either MHC II+ or CD86+ in is shown. Data are mean ± SEM (n = 6).


203

Vehicle control IC871140

1

2

3

4

5%

cel

ls C

D11

c+

CD86 MHC II0

10

20

30

40 Vehicle controlIC87114

% C

D11

c+ ce

lls p

ositi

ve fo

r CD

86or

MHC

IIA

B


204

Figure 5.10: IC87114 treatment results in reduced ex vivo proliferation of naïve

T cells.

(A) Splenocytes from naïve wild-type C57BL/6 mice were stained with CFSE,

treated with IC87114 (purple bar) or diluent control (pale green bar) and subjected to

stimulation with anti-CD3 and anti-CD28 for four days (section 2.3.4.4).

Proliferation was determined by a progressive halving of CFSE fluorescence

intensity by flow cytometry. (B) Mice were administered 30mg/kg of IC87114

(purple bar) or vehicle alone (dark green bar) via oral gavage in the morning and

evening for one day and the morning of the next day before being euthanased one

hour later (section 2.2.5). CD4+ T cell proliferation in response to anti-CD3/anti-

CD28 stimulation was then assessed. Data are mean ± SEM and are representative of

three independent experiments (n = 6).


205

Cells only �CD3/�CD280

2

4

6 DMSOIC87114 *

% C

D4+

cells

div

ided


2

4

6

8

10*Vehicle control

IC87114

% C

D4+

cells

div

ided

A

B


206



207

2 3 5 120

2

4

6

8

10

26

28

30

Hours post-dosing

IC87

114

( �M

)

Figure 5.11: GC-MS analysis of IC87114 levels in the plasma of mice

throughout the preventative EAE study.

Mice were treated twice daily (approximately 9am and 5pm) with 30mg/kg of

IC87114 or the vehicle control from the day before EAE immunisation (section

2.2.5). Throughout this study plasma samples were obtained from animals (section

2.3.1.3) and analysed using GC-MS by Calistoga Pharmaceuticals (section 2.3.9).

The samples shown in this graph represent the μM concentration of IC87114 in the

bloodstream at the indicated time-points. (Data represent the mean μM concentration

± SEM, n = 3-4 samples per point). In addition to the different post-dose time-points,

the samples were taken on different days post-immunisation for EAE. These days

were as follows: the 2 hours post-dose sample was taken on day 1 post-immunisation

(n = 3), the 3 hours post-dose sample was taken on day 31 post-immunisation (n = 4),

the 5 hours post-dose sample was taken on day 4 post-immunisation (n = 3) and the

12 hours post-dose sample was taken on day 31 post-immunisation (n = 3).


208

Figure 5.12: IC87114 treatment of EAE-immunised mice with a ‘preventative’

dosing strategy.

Mice were immunised with MOG35-55 and CFA as described in section 2.2.3. One

day prior to immunisation, treatment with either the p110δ inhibitor IC87114 or

vehicle control was begun and mice were administered with either treatment daily as

described in section 2.2.5. (A) The mean clinical disease scores over time-course of

disease. (B) Day of onset, (C) day of peak disease and (D) peak disease score. All

data are representative of mean ± SEM (n = 14 vehicle control-treated mice, 16

IC87114 treated mice, except at time points where animals had died). (E) Kaplin-

Meyer plots showing the percent survival of mice in each group following

immunisation.


209

0 5 10 15 20 25 30 350.0

0.5

1.0

1.5

2.0

2.5

3.0

3.5Vehicle ControlIC87114


EAE

dise

ase

scor

e

Day of onset


5

10

15

20

Day

post

-imm

unis

atio

n

Peak disease day


5

10

15

20

25

30

Day

post

-imm

unis

atio

n

Peak disease score


1

2

3

4*

EAE

dise

ase

scor

e

0 5 10 15 20 25 30 350

25

50

75

100

Vehicle controlIC87114


% s

urvi

val

A

B C

D E


210

Figure 5.13: IC87114 treatment of EAE-immunised mice with a ‘therapeutic’

dosing strategy

Mice were immunised with MOG35-55 and CFA as described in section 2.2.3. On the

second day after individual animals began showing signs of clinical disease (scores

of 1.5-2.5), animals were treated with either IC87114 or vehicle control as described

in section 2.2.5. (A) The mean clinical disease scores over time post-disease onset.

The arrow indicates the day on which IC87114 or vehicle treatment was begun. (B)

Peak disease score. All data are representative of mean ± SEM (n = 14 vehicle

control-treated mice, 16 IC87114 treated mice, except at time-points where animals

had died). (C) Kaplin-Meyer plots showing the percent survival of mice in each

group following disease onset.


211

0 2 4 6 8 10 120.0

0.5

1.0

1.5

2.0

2.5

3.0

3.5 Vehicle ControlIC87114

Day post-disease onset

EAE

dise

ase

scor

e

Peak disease score

Vehicle control IC871140.0

0.5

1.0

1.5

2.0

2.5

3.0

3.5

EAE

dise

ase

scor

e

A

B

C

0 2 4 6 8 10 120

25

50

75

100

Vehicle controlIC87114

Day post-disease onset

% s

urvi

val


212

Figure 5.14: IC87114 treatment in vivo does not result in reduced ex vivo

proliferation of CFA-activated CD4+ T cells.

(A) Mice were immunised with CFA and administered 30mg/kg of IC87114 or

vehicle for four days as described in section 2.2.5. On the last morning mice were

administered IC87114 or vehicle 30 minutes before being euthanased. Cells from the

draining inguinal and brachial lymph nodes were then stained with CFSE and

subjected to stimulation with anti-CD3 and anti-CD28 for four days (section 2.3.4.4).

Proliferation of CD4+ cells was determined by a progressive halving of CFSE

fluorescence intensity by flow cytometry. (B) Proliferation of CD4+ T cells that were

treated with IC87114 or diluent control in vitro. Data are mean ± SEM (n = 6).


213


2

4

6

8

10 DMSOIC87114

***

% C

D4+

cells

div

ided


2

4

6

8

10

12

14


% C

D4+

cells

div

ided

A

B


214

Figure 5.15: IC87114 treatment in vivo does not result in reduced ex vivo

proliferation of CFA-activated B220+ B cells.

(A) Mice were immunised with CFA and administered 30mg/kg of IC87114 or

vehicle for four days as described in section 2.2.5. On the last morning mice were

administered IC87114 or vehicle 30 minutes before being euthanased. Cells from the

draining inguinal and brachial lymph nodes were then stained with CFSE and

subjected to stimulation with anti-CD3 and anti-CD28 for four days (section 2.3.4.4).

Proliferation of B220+ cells was determined by a progressive halving of CFSE

fluorescence intensity by flow cytometry. (B) Proliferation of B220+ T cells that

were treated with IC87114 or diluent control in vitro. Data are mean ± SEM (n = 6).


215

Cells only PHA0

1

2

3

4

5

6

7

8 DMSOIC87114

***

% B

220+

cells

div

ided

Cells only PHA0

2

4

6

8

10


% B

220+

cells

div

ided

A

B


216

��

CHAPTER 6

Discussion

��

CHAPTER 6: Discussion

218



219

The importance of the class IA PI3K catalytic subunit p110δ in the activation,

differentiation and function of many different cell types has become increasingly

apparent in recent years. Not only has p110δ been implicated in the activation,

development and/or function of B cells (238-241, 243, 244, 248, 372, 398, 401, 432,

459), T cells (248, 249, 381, 464), mast cells (362, 363), NK cells (380, 434, 461,

462) and neutrophils (359, 360, 367-370), but inactivation of p110δ has also been

demonstrated to be directly linked with a reduction in pathogenesis in a model for

RA (370). However, while p110δ has been directly implicated in the function of

these cell types, apart from one study in autoantibody-induced arthritis the effects of

p110δ inactivation in models of autoimmune disease in vivo are unexplored. Due to

the specific role that p110δ plays in cells of haematopoietic origin (260), and the role

that these cells play in autoimmune diseases such as MS and RA (29, 33, 115, 123,

127, 150, 151, 155, 156, 158, 159, 162, 164, 168-180, 182-185, 187-191, 404), it is

possible that pharmacological inactivation of this protein may provide relief for

people suffering from autoimmune pathologies.

6.1 KEY FINDINGS

The main aim of this study was to determine whether p110δ plays a role in

experimental autoimmune encephalomyelitis, a model for the human autoimmune

disease MS. This has been addressed by investigating the effect of genetic

inactivation of p110δ on EAE. In addition, the ability of the highly selective p110δ

inhibitor IC87114 to inhibit EAE was also investigated. The key findings of this

study are:

� There were no gross differences between naïve p110δD910A/D910A mice and wild-

type C57BL/6 animals in regards to the proportion of T and B cells in the lymph

nodes, nor was there a difference in levels of adhesion molecules and

homeostatic chemokine receptors on the surface of T cells from p110δD910A/D910A

mice. However, T and B cells from p110δD910A/D910A mice were less capable of

migrating towards homeostatic chemokines in vitro.


220

� The p110δD910A/D910A mice showed significantly reduced EAE disease when

compared with wild-type mice and this was characterised by fewer infiltrating

leukocytes and lesions in the CNS of those animals.

� p110δD910A/D910A mice had lower levels of activated CD4+ T cells in their

draining lymph nodes and reduced proliferation of CD4+ T cells ex vivo and in

vivo following EAE immunisation, indicating that p110δ inactivation

significantly reduces T cell priming.

� B cell function was also reduced in p110δD910A/D910A mice as demonstrated by a

lack of detectable MOG-specific IgG in the serum, and an absence of B cells in

the CNS of these animals.

� Survival of both T and B cells was reduced at early EAE time-points when

p110δ was genetically inactivated.

� The differentiation of CD4+ T cells into the Th1- and Th17-type was

significantly reduced when p110δ was inactivated (either genetically or

pharmacologically) in vitro.

� Genetic inactivation of p110δ resulted in an EAE disease course that is biased

towards the Th1-type due to a defect in Th17 cell generation.

� p110δ inactivation did not affect dendritic cell migration, activation or antigen

processing and presentation.

� While the p110δ inhibitor IC87114 significantly reduced Th1 and Th17

differentiation in vitro, as well as proliferation of naïve T cells ex vivo, in vivo

administration of IC87114 did not reduce EAE pathogenesis with the dosing

strategy that was performed in this study.


221

The following discussion will further address the major findings of this study, with a

particular focus on how this study adds new insights to current paradigms in the

field. Possible future directions for this study will also be discussed.

6.2 IMMUNE HOMEOSTASIS IN p110δD910A/D910A MICE

An initial characterisation of the p110δD910A/D910A mouse was undertaken for several

reasons. Those included that they were a strain of mice that hadn’t previously been

used in this laboratory and were being bred in a new animal house with potentially

different microflora, and little documented information existed regarding basic

immune homeostasis in these animals. The p110δD910A/D910A mice were successfully

bred and births occur at expected Mendelian ratios. The proportion of CD4+ T cells,

CD8+ T cells and B220+ B cells in the spleen was determined using flow cytometry.

There was no difference in the proportion of CD4+ or CD8+ T cells, nor of B220+ B

cells, in the spleens of p110δD910A/D910A mice when compared with wild-type animals.

Further characterisation of surface markers on splenic lymphocytes was carried out

using flow cytometry. Homeostatic chemokine receptors CCR7 and CXCR4 are

important for lymphocyte homing to designated microenvironments of secondary

lymphoid organs (508). CCR7 and CXCR4 expression on the surface of CD4+ T

cells was the same in p110δD910A/D910A mice and wild-type C57BL/6 mice. Cells were

also screened for surface expression of α4 and β1 integrins (CD49d and CD29

respectively) as these molecules are involved in the adhesion of cells to various cell

adhesion molecules such as VCAM-1 and MadCAM as well as fibronectin (509).

Splenic lymphocytes from naïve p110δD910A/D910A mice had the same level of both α4

and β1 integrins on their cell surface as did wild-type mice. These results are

expected as it has been previously demonstrated that there is no reduction in the

ability of anti-CD3-induced binding of p110δD910A/D910A cells to fibronectin via β1

integrins (248). However, they also further demonstrate that there are not likely to be

major defects in cell adhesion processes mediated by these molecules in the

p110δD910A/D910A mouse. It should be noted that there are other adhesion molecules

that govern cell trafficking and several studies have reported reduced trafficking of

p110δ-inactivated cells in vivo (241, 244, 248, 369, 370, 432, 434, 441). However,

taking all of these data into account, it appears that genetic inactivation of p110δ


222

does not overtly affect homeostasis of the immune system, at least with respect to the

parameters assessed.

6.3 MIGRATION OF NAÏVE p110δ-INACTIVATED LYMPHOCYTES IN

RESPONSE TO HOMEOSTATIC CHEMOKINES

In vitro migration of both B cells towards CXCL13 and T cells towards CCL19 and

CCL21 was reduced in cells that had catalytically inactive p110δ. Chemotaxis is

generally thought to be induced via chemokines binding to G-protein-coupled

receptors, thereby inducing signalling through the class IB PI3Kγ (3, 8, 253).

However, increasing evidence is emerging to suggest that chemotaxis of B cells, T

cells, NK cells and neutrophils may require p110δ for efficient activation of

signalling events required for this response (241, 244, 248, 362, 363, 367-370, 432,

434, 441). It has previously been demonstrated that B cells require functional p110δ

to effectively migrate towards CXCL13 in vitro (432) and CXCL13 has also been

demonstrated to be important for EAE progression (140). However, it had not

previously been shown that p110δ plays a role in T cell migration in vitro. In fact, the

data presented in the present study contradicts previous reports in which T cell

migration in response to the chemokines CXCL10, CXCL12, CCL5, CCL19 and

CCL21 was not affected by loss of p110δ (432, 441). Although reasons for the

differing outcomes are not clear, the studies were not performed in an identical

manner; Reif and colleagues used cells from p110δ-/- mice (432), so differences

between the p110δ-inactivation systems may account for the disparate results

observed in this study, particularly since an up-regulation of other catalytic and

regulatory subunits has been observed in animals in which other class IA subunits

have been genetically deleted (373) and it is possible that this also occurs in p110δ-/-

mice. Such compensation may rescue some of the lost p110δ function. Also, Jarmin

and colleagues performed T cell migration assays towards CXCL10, CXCL12 and

CCL5, which were not tested in the present study (441). However, it has been

demonstrated that T cell receptor-induced p110δ activity is important for the efficient

trafficking of activated T cells to antigenic tissue in vivo (441). Therefore, the results

observed in the present work, whilst being converse to previous reports, could


223

indicate that p110δ plays a more important role in T cell migration than previously

thought.

6.4 THE ROLE OF p110δ IN EAE PATHOGENESIS

In the present study, EAE was induced in gene targeted mice which express a kinase-

dead form of p110δ (p110δD910A/D910A mice) and it was observed that these animals

developed significantly less severe disease pathologies compared with wild-type

counterparts. While the three independent experiments presented show slightly

different disease kinetics, it is clear that the physical symptoms of EAE are reduced

in p110δD910A/D910A mice, particularly at later disease time-points. This difference was

dramatic; the wild-type animals displayed average disease scores of around 2.5-3,

indicating at least partial, if not complete, hind-limb paralysis, whereas the

p110δD910A/D910A mice developed average disease scores between 1-1.5, indicating

only a partially flaccid tail. Therefore, the reduction in EAE pathogenesis observed

in p110δD910A/D910A mice represents a significant inhibition of clinical manifestations

of the disease. No significant differences in the day of onset or day of peak disease

were observed. However, the average peak disease scores were significantly lower in

p110δD910A/D910A mice. Further investigation into CNS pathology by immunostaining

of spinal cord cross-sections showed that p110δD910A/D910A mice had a reduced

number of lesions and fewer infiltrating CD45+ leukocytes at late stages of EAE

when compared with wild-type animals. The reasons for this were investigated in

chapter 4 and are discussed in more detail below.

IC87114 is a highly specific inhibitor of p110δ that has no known off-target effects

on other protein kinases and has been demonstrated to significantly inhibit p110δ

function in vitro (238, 240, 359, 360, 362, 363, 365-370). It has also been shown to

reduce pathology in a model of RA (370). Due to this, and the promising findings in

the p110δD910A/D910A mice, the ability of IC87114 to reduce EAE pathogenesis was

examined. Unlike when p110δ was genetically inactivated, IC87114 treatment did

not reduce EAE pathogenesis despite proving highly effective in inhibiting a number

of relevant parameters in vitro and ex vivo. There are a number of possible

explanations for this. In the p110δD910A/D910A mice, p110δ has been genetically


224

inactivated in every cell, whereas the extent of the overall coverage of IC87114 in

vivo, and the level of inhibition of p110δ, has not yet been quantified. Furthermore,

p110δD910A/WT mice, which express both wild-type and catalytically inactive forms of

p110δ, do not display reduced EAE pathology, indicating that greater than 50%

inhibition of p110δ is required to reduce EAE pathogenesis. The most likely

explanation for the lack of efficacy of IC87114 is that the IC76114 dosing strategy

used in this study was not optimal. For future research directions in regards to these

issues, see section 6.9.1.

The present study has provided valuable and novel insight into the role of the p110δ

protein in EAE by demonstrating that when p110δ is completely (genetically)

inactivated, immune system activation and EAE pathology is reduced. It is therefore

likely that therapeutically reducing p110δ function in MS patients could result in

improved quality of life and reduced severity of relapses. However, further research,

using different models of EAE, will be required to determine the efficacy of p110δ

inhibition on different stages of MS pathology, such as during relapses and chronic

stages of MS. The methods that may be undertaken to address this are discussed

further in section 6.9.2.

To delineate the mechanism for the reduction in EAE pathogenesis observed in this

study, the activation, survival and function of different cell types was investigated by

observing the cellular consequences of p110δ inactivation, both in vitro and in vivo.

These findings are discussed in the sections below.

6.5 THE EFFECT OF p110δ INACTIVATION ON CD4+ T CELL PRIMING,

SURVIVAL AND DIFFERENTIATION

CD4+ T cells have long been accepted to be the main cell-type responsible for

driving MS/EAE pathology (29, 33, 115, 127, 150, 151, 155, 156, 158, 159, 162,

164, 175, 188-190). Following the observation that EAE was reduced in

p110δD910A/D910A mice, the activation, differentiation and survival of CD4+ T cells in

EAE-immunised, p110δ-inactive, animals was examined. It was observed that not

only are there proportionally fewer T cells displaying markers of activation isolated


225

from the draining lymph nodes of p110δD910A/D910A mice when compared with wild-

type mice, but these T cells are also less capable of proliferating in response to

antigen both ex vivo and in vivo. These findings indicate that immune priming of T

cells is not occurring efficiently in the p110δD910A/D910A mice, an outcome that may

be due to inherent T cell defects or a disruption in antigen-presentation and

subsequent T cell activation.

In the past, EAE was considered to be driven by Th1 cells secreting IFN�. However,

the recent discovery of a third major helper cell subclass that produce IL-17, called

Th17 cells, has significantly added to the complexity of EAE (154, 159). It has now

been shown that both Th1 and Th17 cells can drive EAE, but neither cell type can

exclusively drive the pathogenic autoimmune response to the same extent without

some participation from the other (154, 159). While it has been previously

demonstrated that p110δ plays a role in Th1 differentiation in vitro (249), the present

study is the first to demonstrate that genetic or pharmacological inactivation of p110δ

results in a reduction in both Th1 and Th17 differentiation in vitro and that Th17-

type cell production is reduced in p110δD910A/D910A mice throughout EAE. Moreover,

it appears from these data that the generation of Th17 cells may be more reliant on

p110δ than Th1 cells, as reflected by the more profound effect of p110δ inactivation

on Th17 cell generation in the in vitro skewing culture experiments. The reduction in

EAE disease observed in p110δD910A/D910A mice can be attributed to ablated Th17

differentiation due to the autoimmune response being strongly skewed towards the

less pathogenic Th1-type and away from the Th17-type when p110δ is inactive,

whereas wild-type animals show an autoimmune response that is skewed towards the

more pathogenic Th17-type. Functional p110δ was also necessary for cytokine

secretion under both Th1- and Th17-skewing culture conditions. Cytokine

production/secretion relies on processes such as up-regulation of transcription

factors, protein synthesis and vesicle transport. PI3Ks have previously been directly

and indirectly implicated in up-regulation of transcription factors as well as vesicle

transport (510-514). As p110δ-inactivation resulted in reduced levels of IFN-γ and

IL-17 in the supernatant of Th1- and Th17-skewed cultures respectively, it is

possible that p110δ is also involved in this process in T cells. Together, this data


226

indicates that therapeutic intervention of p110δ signalling may prove to be beneficial

in diseases where deregulation of Th17 immune responses is the underlying cause for

pathology, such as in MS (34, 150, 151, 154, 156, 158, 159) and RA (30, 159, 199,

200). Despite this, Th17 differentiation appears to be governed by a number of

different parameters in human versus mouse cells (29, 31-34, 63, 515-518).

Therefore research on human samples will be necessary to further understand the

role of this cell type in MS.

In addition to the reduced differentiation of Th1 and Th17 cells observed in the

present study, p110δ was also shown to be important for the differentiation of

regulatory T cells during EAE. While there was a higher proportion of Tregs in the

draining lymph nodes of p110δD910A/D910A mice at day 6 post-immunisation, by day

15 post-immunisation there was a significantly lower proportion of Tregs in the

lymph nodes of p110δD910A/D910A mice when compared with wild-type counterparts.

Normally, Treg cells are responsible for the maintenance of peripheral tolerance and

down-regulating the immune response, and therefore play an important role in

preventing autoimmunity. The increased proportion of Tregs at day 6 post-

immunisation may be contributing to regulation of the early autoimmune events in

the p110δD910A/D910A mice. However, a previous report has shown that Tregs from

p110δD910A/D910A mice are not capable of performing their suppressive function (464).

Therefore it is likely that, in this model, Tregs may not be performing their effector

function efficiently. Future work will need to be performed to confirm this. In

addition, the reduction in T cell activation and differentiation may be sufficient to

reduce EAE disease, despite the lower proportion of Tregs at peak disease, or the

increased proportion of Tregs in the p110δD910A/D910A mice prior to disease onset may

be enough to confer some protection against the development of severe EAE. As it is

probable that since a reduction in Treg function would result in the removal of one of

the most important regulatory mechanisms in the immune system, therapies aimed at

inhibiting p110δ would need to balance the importance of Treg function against the

benefits of reducing Th17 function.


227

While it is clear that p110δ plays an important role in T cell differentiation and

cytokine secretion, the mechanism remains to be elucidated. Previous reports

indicate that p110δ has a significant role in TCR signalling (248, 249) therefore

reduced signalling through the TCR is likely to be responsible at least in part for the

reduction in T cell priming, survival and differentiation observed in this study.

However, T cell differentiation is reliant on a number of different factors. In

particular, inefficient signalling through cytokine receptors that initiate PI3Kδ

intracellular signalling may be, at least in part, responsible for the reduced T cell

differentiation observed. Future investigations into this theory may involve

examining the TGF-β signalling pathway, as this cytokine has been demonstrated to

drive differentiation of both Th17 and Treg cells (29, 519). In addition, intrinsic T

cell pathways that involve p110δ may not only be responsible for reduced T cell

differentiation. While the present study has not shown any differences in antigen

processing and presentation by DCs, it has been previously reported that activated

DCs lacking functional p110δ produce lower levels of IL-6 compared to wild-type

DCs (463). Therefore, inactivation of p110δ may not only affect intrinsic T cell

processes, but may reduce production of cytokines by APCs that are important for

efficient T cell activation and differentiation. This is discussed further below (section

6.8).

In addition to the reductions in T cell activation and differentiation, p110δ-deficient

CD4+ T cells undergo significantly higher levels of apoptosis during the priming

phase of EAE. Primarily through its role in the activation of the pro-survival proteins

Akt/PKB, p110δ has previously been demonstrated to be important for the survival

of several different cell types (238, 239, 251, 416, 448). However, prior to the

present study p110δ had not yet been implicated in the survival of primary, antigen-

activated, T lymphocytes. As the immune system is controlled at many different

levels (antigen processing and presentation, lymphocyte activation, differentiation

and proliferation and a negative regulation of lymphocytes via apoptosis), the finding

that p110δ is important for mature T cell survival has implications for our

understanding of why the CD4+ T cell-driven autoimmune response is reduced in

p110δD910A/D910A mice. That is, not only is CD4+ T cell activation and differentiation


228

reduced, but these cells are also undergoing increased apoptosis. At this stage it is

not possible to determine whether apoptosis is occurring due to inefficient T cell

activation or if intrinsic defects in survival signals are resulting in higher levels of

apoptosis, or both.

6.6 p110δ INACTIVATION AND B CELL FUNCTION

While T cells are generally accepted to be the predominant mediator of pathogenesis

in EAE, B cells have also been unequivocally linked to MS/EAE pathology. This has

primarily been through the observation of myelin-specific antibodies in the blood of

MS patients (226-229), but also through studies in EAE models (127, 188-191, 230,

231). The role of p110δ in B cell function is also unambiguous; p110δ has been

clearly shown to be required for efficient B cell development (239, 241, 244, 247,

248), trafficking (241, 244, 248, 432), BCR signalling (238-241, 243, 244, 248), cell-

cycle regulation (398, 401), isotype class-switching (240, 372, 459), survival (238,

239) and T-dependent and -independent activation (239, 241, 244, 248) (see section

1.6). It was therefore hypothesised in the present study that B cell function would be

reduced in EAE when p110δ was inactivated.

This study has shown that B cell function in EAE appears to be completely inhibited

without p110δ. There were no detectable B cells in the CNS of p110δD910A/D910A mice

and there was no detectable MOG35-55-specific IgG in the serum of p110δD910A/D910A

mice. This may be due to inefficient B cell activation, reduced B cell survival,

inefficient trafficking of B cells to the CNS, or most likely a combination of all three.

The complete lack of detectable MOG35-55-specific IgG in the serum of the

p110δD910A/D910A mice indicates that B cells are not being activated and/or class-

switching after EAE immunisation. It has previously been demonstrated that B cells

from p110δD910A/D910A mice show uncontrolled class-switching to IgE and IgG1

under certain stimulatory conditions (240, 372, 507). The predominant

immunoglobulin isoform usually observed in EAE is IgG1, so in view of the

previous findings it is perhaps surprising that no antigen-specific IgG was detected in

this study at all. However, B cells from p110δD910A/D910A mice underwent higher

levels of apoptosis than was observed in wild-type animals. Therefore, these results


229

indicate that B cells may not be generating IgG because they are either not being

activated efficiently (and therefore do not reach a point where they undergo class-

switching) or are undergoing apoptosis before they reach this point. Another reason

for the lack of B cell activation may be the lack of observable T cell activation. An

efficient B cell response to thymus-dependent antigens (such as that occuring in

EAE) requires direct contact with Th cells and exposure to Th cell produced

cytokines. Without this T cell help, B cell activation is reduced and isotype switching

cannot occur. The reduction in T cell activation and cytokine production observed

when p110δ is inactivated in the present study is therefore likely to also affect the

activation of B cells. Therefore, together these findings indicate that, without

functional p110δ, B cell responses are inefficient following EAE immunisation, not

only due to reductions in p110δ-mediated BCR signalling (as has been previously

reported (238-241, 243, 244, 248)) and increased B cell apoptosis (shown here and in

previous studies (238, 239)) but possibly also due to reduced T cell help during B

cell activation.

6.7 MACROPHAGES, NEUTROPHILS AND p110δ INACTIVATION

It has been reported previously that Th1- and Th17-driven EAE autoimmune

responses result in a preferential recruitment of macrophages or neutrophils the CNS

respectively (169). However, while it was clear that there was a reduction in the

number of F4/80+ macrophages in the CNS of the p110δD910A/D910A animals, on

comparison to wild-type mice, there was no significant difference in the numbers of

Ly6G+ neutrophils infiltrating the CNS of the p110δD910A/D910A mice. Taking the

previously published data into account, it could be assumed that p110δD910A/D910A

mice, which have a reduced Th17 response, would exhibit higher numbers of

macrophages in the CNS, and that wild-type mice would have more neutrophils.

However, the data described above indicate that p110δ may be more important for

macrophage activation and/or migration than it was for neutrophil activation and

entry to the CNS. Future work may involve focusing on the role of p110δ in this cell

type.


230

6.8 DENDRITIC CELL FUNCTION AND p110δ INACTIVATION

CD4+ T cell activation requires presentation of antigen in the context of MHC class

II by APCs such as DCs. As CD4+ T cell activation is so profoundly reduced in the

p110δD910A/D910A mice throughout EAE, the role of p110δ in DC trafficking,

activation and function was investigated. Firstly, the capacity of DCs lacking

functional p110δ to migrate to the chemokine CCL19 in vitro was assessed using

DCs in which p110δ had been inactivated. CCL19 is expressed by interdigitating

DCs and stromal cells in the T cell zones and assists in directing cells that express

the chemokine receptor CCR7, such as naïve T cells and mature DCs, to these

specific regions of lymph nodes (520). DC migration in vitro in response to CCL19

was not affected by either genetic or pharmacological inactivation of p110δ. In

addition, DC migration from the skin to the draining lymph nodes in vivo was also

not affected by p110δ-inactivation. Therefore, in contrast to p110γ (427), p110δ does

not appear to play a role in DC trafficking.

DC activation and antigen processing and presentation were also shown to not be

dependent on p110δ. The draining lymph nodes of CFA-immunised mice in which

p110δ had been genetically or pharmacologically inactivated had the same

proportions of CD11c+ DCs expressing the activation marker molecules CD86 or

MHC II on their surface when compared with those isolated from control animals.

As DC-mediated activation of T lymphocytes is integral for initiation of the

autoimmune response in EAE, the ability of IC87114 to inhibit the DC-dependent

activation and proliferation of T cells was investigated. It was observed that OVA-

pulsed DCs that had been treated with IC87114 initiated equal levels of proliferation

in OVA-specific T cells as did DCs from control-treated animals, indicating that

p110δ inhibition in DCs does not affect their ability to process and present antigen.

However, when non-treated, OVA-pulsed, DCs were cultured with IC87114 treated

OT-II T cells there was a significant reduction in the ability of these T cells to

proliferate, indicating that it is an intrinsic defect in T cell activation and

proliferation caused by p110δ-inhibition that is responsible for reduced CD4+ OT-II

T cell division. Taken together, these results indicate that p110δ-inhibition with

IC87114 does not affect antigen processing and presentation by DCs, and that the


231

reduction in T cell activation in the p110δD910A/D910A mice during EAE (which relies

on antigen presentation by APCs) is probably due to intrinsic T cell defects as

opposed to reduced DC function.

While it is clear that p110δ inactivation in DCs does not affect their ability to migrate

in response to CCL19, to express activation markers or to process and present

antigen, it has previously been reported that upon stimulation with cholera toxin in

vitro, DCs from p110δD910A/D910A mice do not secrete as much of the cytokine IL-6 as

do wild-type mice (463). Lower levels of IL-6 secretion by mast cells with inactive

p110δ has also been reported (362). Therefore, while it is unlikely that defects in the

DC functions discussed above are responsible for the reduced T cell activation

observed when p110δ was inactivated both genetically and pharmacologically in this

study, reduced expression of IL-6 by these cells, as well as other cell types, may

contribute to the impaired differentiation of cells when p110δ is inhibited in vivo. In

particular, Th17 cells require stimulation with IL-6. Therefore, a reduction in IL-6

secretion by APCs and other leukocytes could play a role in the reduced levels of

Th17 cells in the p110δD910A/D910A mice. As the immune environment in vivo is

highly complex and requires interaction between a variety of different cell types,

future studies will need to delineate the effects of wide-spread p110δ inhibition so

that any influence of p110δ-targeted therapy on immune biology can be fully

understood.

6.9 FUTURE DIRECTIONS

This study has highlighted an important role for p110δ in the development of the

autoimmune response in EAE. However, while the importance of p110δ in the

efficient activation, function and survival of T and B cells was highlighted, only

when p110δ was completely genetically inactivated was there a difference in EAE

pathogenesis. While this study has firmly established a basis for investigating the use

of p110δ inhibitors for therapeutic intervention of EAE and perhaps MS, future

research must be undertaken to further delineate the role of p110δ in cells of the

immune system and the efficacy of targeting p110δ as a therapeutic for

autoimmunity. Initial studies should focus on three separate goals. While the p110δ


232

inhibitor IC87114 was demonstrated to be a potent inhibitor of T cell activation and

differentiation in vitro, it failed to reduce EAE pathogenesis in vivo. It is possible

that this may be improved with better coverage of the compound in mice, which will

require that the dosing strategies used to administer the inhibitor are optimised. The

present study was undertaken using a model of EAE that was induced with MOG35-55

in mice on a C57BL/6 background, which results in a chronic disease course. It may

be advantageous for future research to focus on the role of p110δ in different EAE

models. Lastly, before pharmacological targeting of p110δ can be considered for

humans, a thorough understanding of the effect of IC87114 on cells of the immune

system must be achieved. All of these future directions are discussed further below.

6.9.1 IC87114 dosing strategy

Initial studies shown in chapter 5 of this thesis indicate that IC87114 treatment in

vivo reduces ex vivo activation and proliferation of naïve CD4+ T cells. Inefficient

activation of this cell type was demonstrated to be integral for the reduced EAE

disease observed in p110δD910A/D910A mice (chapter 4). Given the promising findings

that IC87114 could reduce activation, proliferation and differentiation of CD4+ T

cells, in vivo administration of IC87114 to mice with EAE was undertaken. Both

‘preventative’ (where mice were administered IC87114 before EAE immunisation

and throughout the disease course) and ‘therapeutic’ (where mice were administered

IC87114 once they were showing clinical signs of disease and throughout the disease

course) dosing strategies were trialled. However, there was no reduction in EAE

pathogenesis observed with either dosing strategy. In fact, EAE pathogenesis

appeared to be slightly enhanced in mice receiving IC87114 treatment when

administered from the time of immunisation (i.e. ‘preventative’ dose). Despite these

disappointing results, there are several avenues for future research that may be

pursued to further investigate whether IC87114 may prove to have some therapeutic

potential to reduce EAE.

To begin with, the in vivo dosing regimen used in this study for IC87114 involved

oral gavage of animals in the morning (9am) and afternoon (5pm) with 30mg/kg of

IC87114 in vehicle. This regimen was suggested by Calistoga Pharmaceuticals, the


233

company which provided the compound for this study. From the in vitro studies

presented in this chapter, it is evident that IC87114 can act as a potent inhibitor of

p110δ function over four day culture periods. However, while GC-MS analysis of

IC87114 levels in plasma throughout the preventative dosing EAE study generally

displayed good coverage of the compound in the plasma of mice, at the 12 hour post-

dose time-point it was evident that there was very little active compound in the

plasma of these animals. This indicated that IC87114 is cleared quickly from the

bloodstream of mice, in keeping with its known short half-life in vivo (Kamal Puri,

Calistoga Pharmaceuticals, personal communication). As animals were administered

IC87114 in the morning and evening of each day, the longest period between the

dosing of the compound was typically 16-17 hours. It may be that during this time

frame IC87114 was effectively cleared from the system of experimental animals and

cell activation/function was allowed to progress. Randis and colleagues have used

IC87114 during an in vivo model of rheumatoid arthritis and observed reduced

disease pathology (370). In that study, IC87114 was used at 20mg/kg and

administered three times daily at eight hour intervals. Therefore, while the same total

daily amount of IC87114 was administered, it was done so at three different time-

points as opposed to the two which were chosen for this study. It is therefore possible

that altering the dosing regimen of IC87114 so that animals receive the compound

three times daily may improve the overall coverage of the compound in the

bloodstream and thereby have more of an effect on EAE disease.

6.9.2 Alternative EAE models

In this study, EAE was induced by immunising C57BL/6 (the background of the

p110δD910A/D910A mice) mice with the MOG35-55 neuroantigen, which results in a

progressive and chronic paralysis in animals. However, as discussed in the

introduction of this thesis, there are several different models available for researching

neuro-inflammation (section 1.3.3). One of these, induced by immunising SJL/J mice

with the neuroantigen PLP139-151 (section 1.3.3.3), results in the development of an

EAE disease course which more closely mimics RR-MS in that it is a remitting-

relapsing disease course (120). Testing the effect of inhibition of p110δ during the

relapse phase of EAE would be useful as this may lead to reduced immune cell


234

activation and trafficking to the CNS, thereby reducing the severity of relapses. This

also has the added benefit of closely mimicking the way that p110δ-inhibition may

therapeutically benefit MS patients. Future work may therefore elucidate the affects

of IC87114 treatment on the progression of the relapse stage of EAE in this model.

In addition, SJL/J mice are highly susceptible to EAE that is induced by adoptively

transferring encephalitogenic cells, whereas C57BL/6 mice are not. Inducing

adoptive EAE with either cells from p110δD910A/D910A mice that have been back-

crossed on to a SJL/J background or in which encephalitogenic transferred cells have

been inhibited with IC87114 may provide information on the role of p110δ in

trafficking of activated cells to the CNS and the induction of CNS inflammation.

As well as using alternative EAE models, the cuprizone mediated model of

demyelination, where mice are fed cuprizone in drinking water (which results in

copper deficiency and the ablation of oligodendrocytes in the CNS), is another

method of investigating neuro-inflammation (133). Cuprizone-mediated

demyelination results from oligodendrocyte death and myelin is phagocytosed by

microglia and peripheral macrophages, which therefore allows the study of

demyelination within the CNS independently of myelin-specific cell-mediated

immune responses. In addition, removal of cuprizone from the diet results in

remyelination within the CNS. As p110δ has been shown to be expressed in the CNS

(484), it will be important to observe whether inactivation of p110δ in CNS resident

cells such as oligodendrocytes and microglia will affect CNS remyelination. This

will be significant as loss of oligodendrocyte function, which could reduce

remyelination, would not be a desirable outcome of p110δ inhibition that is

otherwise intended to reduce the immune response.

In addition to using other models of neuroinflammation, it is possible that alteration

of the immunisation protocol used in this study may lead to different experimental

results. Here, EAE was induced by immunising mice with 100μg of the MOG35-55

neuroantigen, which results in the development of an ascending paralysis and a

chronic and severe disease course whereby most animals experience complete hind-

limb paralysis and some fore-limb paralysis. However, work that was ongoing in the


235

laboratory where this research was performed during the writing of this thesis has

shown that if mice are immunised with reduced amounts of MOG35-55 (as low as

25μg/mouse) they can still develop EAE that achieves a similar disease severity,

albeit with a slightly delayed disease onset (Comerford, I., et. al., unpublished). In

addition, it has been observed in this laboratory that immunising several gene knock-

out strains of mice with lower doses of MOG35-55 can afford a clearer distinction

between differences in EAE pathogenesis in experimental cohorts. For example, in

one strain, immunising with lower doses of MOG35-55 has resulted in a complete lack

of EAE disease developing in these animals, whereas wild-type mice still develop

EAE with a similar severity as that observed when 100μg of MOG35-55 is used for

immunisation (S. McColl, I. Comerford, W. Litchfield, personal communication).

These results are relevant as they highlight the potential importance of the

immunisation method in the context of the p110δ inhibitor studies. It is possible that

immunisation with 100μg of MOG35-55 and CFA presents such a strong ongoing

immunological challenge that it cannot be overcome by the inhibition of p110δ with

IC87114. This is supported by the findings in chapter 5 that demonstrate that cells

from naïve mice that were treated in vivo with IC87114 did not proliferate in

response to anti-CD3/anti-CD28 stimulation to the same level as vehicle control

treated cells. However, when mice were immunised with CFA, thereby activating the

immune system, IC87114 treatment in vivo did not reduce the ex vivo proliferation of

CD4+ T cells or B220+ B cells. Therefore, activation of the immune system with

CFA may be sufficient to override inhibitory affects of IC87114. Furthermore,

whereas the p110δD910A/D910A animals have a complete genetic inhibition of p110δ

function in every cell, IC87114 may only be capable of partially inhibiting p110δ

function when administered in vivo and may preferentially affect the function of

p110δ in different cells (discussed more in 6.9.3). Therefore, IC87114 treatment may

not cause sufficient inhibition of p110δ in relevant cells to allow the disease outcome

to be significantly affected. Future studies may therefore focus on altering the dose

of MOG35-55, and perhaps also CFA, used for initiating EAE and on determining

whether this can affect the outcome of IC87114 administration to mice with the

disease without compromising the EAE that develops in the control cohort.


236

6.9.3 p110δ attenuation and its impact on cells of the immune system

In addition to optimising both the IC87114 dosing strategy and the levels of MOG35-

55 required to induce disease in this model, it will be important to elucidate the effect

of IC87114 on different cell populations in vivo. While IC87114 has already been

demonstrated to inhibit neutrophil trafficking in vivo (368-370), there is minimal

evidence in the literature reporting the consequences of p110δ inhibition by IC87114

on cells such as antigen-specific T and B cells and other non-antigen specific

leukocytes in vivo. In addition, it is possible that IC87114 is inhibiting regulatory T

as well as regulatory B cells, both of which have been implicated in the control and

regulation of EAE (62, 191, 217-225). Studies into the differentiation and function of

these cell types in p110δ-inhibited animals will be important to delineate the impact

of p110δ inhibition on EAE progression, regulation and animal survival.

Furthermore, it is known that the in vivo half-life of the p110δ inhibitor, IC87114, is

higher in B cells than T cells (Kamal Puri, Calistoga Pharmaceuticals, personal

communication). This may be an important distinction when considering targeting

this protein to reduce pathologies such as autoimmune diseases. It will be important

to determine the half-life of IC87114 in many immune cells, as well as the effects of

p110δ inhibition on these cells, and tailor therapies towards diseases which are

caused by the cell-types in which IC87114 inhibits p110δ and cellular function most

effectively.

6.10 CONCLUDING REMARKS

Prior to this study, the role of p110δ in autoimmunity was not clear. Despite this, due

to the fact that p110δ expression is largely limited to cells of the immune system and

that these cells are responsible for a variety of different autoimmune pathologies,

further research into the specific affect that p110δ inactivation could have on a model

of autoimmunity was warranted. While future studies will be necessary, particularly

into the efficacy of p110δ inhibitors, this study has provided novel insights into the

importance of p110δ in immune cell function, and has established a basis for further

research into targeting this protein as a therapeutic for pathologies such as

autoimmune diseases.

��

CHAPTER 7

References

��

CHAPTER 7: References

238

1. Fruman, D. A., and G. Bismuth. 2009. Fine tuning the immune response with PI3K. Immunol Rev 228:253-272.

2. Liu, P., H. Cheng, T. M. Roberts, and J. J. Zhao. 2009. Targeting the phosphoinositide 3-kinase pathway in cancer. Nat Rev Drug Discov 8:627-644.

3. Procko, E., and S. R. McColl. 2005. Leukocytes on the move with phosphoinositide 3-kinase and its downstream effectors. Bioessays 27:153-163.

4. Vanhaesebroeck, B., K. Ali, A. Bilancio, B. Geering, and L. C. Foukas. 2005. Signalling by PI3K isoforms: insights from gene-targeted mice. Trends Biochem Sci 30:194-204.

5. Vanhaesebroeck, B., S. J. Leevers, G. Panayotou, and M. D. Waterfield. 1997. Phosphoinositide 3-kinases: a conserved family of signal transducers. Trends Biochem Sci 22:267-272.

6. Vanhaesebroeck, B., and M. D. Waterfield. 1999. Signaling by distinct classes of phosphoinositide 3-kinases. Exp Cell Res 253:239-254.

7. Ward, S., Y. Sotsios, J. Dowden, I. Bruce, and P. Finan. 2003. Therapeutic potential of phosphoinositide 3-kinase inhibitors. Chem Biol 10:207-213.

8. Ward, S. G., and F. M. Marelli-Berg. 2009. Mechanisms of chemokine and antigen-dependent T-lymphocyte navigation. Biochem J 418:13-27.

9. Williams, R., A. Berndt, S. Miller, W. C. Hon, and X. Zhang. 2009. Form and flexibility in phosphoinositide 3-kinases. Biochem Soc Trans 37:615-626.

10. Yuan, T. L., and L. C. Cantley. 2008. PI3K pathway alterations in cancer: variations on a theme. Oncogene 27:5497-5510.

11. Del Prete, G. 2008. The complexity of the CD4 T-cell responses: old and new T-cell subsets. Parassitologia 50:9-16.

12. Harrington, L. E., R. D. Hatton, P. R. Mangan, H. Turner, T. L. Murphy, K. M. Murphy, and C. T. Weaver. 2005. Interleukin 17-producing CD4+ effector T cells develop via a lineage distinct from the T helper type 1 and 2 lineages. Nat Immunol 6:1123-1132.

13. Lancki, D. W., and F. W. Fitch. 1992. Cytolytic T lymphocytes: an overview of their characteristics. Biotherapy 5:71-81.

14. Romagnani, S. 2006. Regulation of the T cell response. Clin Exp Allergy 36:1357-1366.

15. Zhou, L., M. M. Chong, and D. R. Littman. 2009. Plasticity of CD4+ T cell lineage differentiation. Immunity 30:646-655.

16. Slavik, J. M., J. E. Hutchcroft, and B. E. Bierer. 1999. CD28/CTLA-4 and CD80/CD86 families: signaling and function. Immunol Res 19:1-24.

17. Dong, C., and R. A. Flavell. 2001. Th1 and Th2 cells. Curr Opin Hematol 8:47-51.

18. Mosmann, T. R., and S. Sad. 1996. The expanding universe of T-cell subsets: Th1, Th2 and more. Immunol Today 17:138-146.

19. Sakaguchi, S., N. Sakaguchi, M. Asano, M. Itoh, and M. Toda. 1995. Immunologic self-tolerance maintained by activated T cells expressing IL-2 receptor alpha-chains (CD25). Breakdown of a single mechanism of self-tolerance causes various autoimmune diseases. J Immunol 155:1151-1164.


239

20. Das, J., C. H. Chen, L. Yang, L. Cohn, P. Ray, and A. Ray. 2001. A critical role for NF-kappa B in GATA3 expression and TH2 differentiation in allergic airway inflammation. Nat Immunol 2:45-50.

21. Zhang, D. H., L. Cohn, P. Ray, K. Bottomly, and A. Ray. 1997. Transcription factor GATA-3 is differentially expressed in murine Th1 and Th2 cells and controls Th2-specific expression of the interleukin-5 gene. J Biol Chem 272:21597-21603.

22. Zheng, W., and R. A. Flavell. 1997. The transcription factor GATA-3 is necessary and sufficient for Th2 cytokine gene expression in CD4 T cells. Cell 89:587-596.

23. Zhu, J., B. Min, J. Hu-Li, C. J. Watson, A. Grinberg, Q. Wang, N. Killeen, J. F. Urban, Jr., L. Guo, and W. E. Paul. 2004. Conditional deletion of Gata3 shows its essential function in T(H)1-T(H)2 responses. Nat Immunol 5:1157-1165.

24. Chung, D. R., D. L. Kasper, R. J. Panzo, T. Chitnis, M. J. Grusby, M. H. Sayegh, and A. O. Tzianabos. 2003. CD4+ T cells mediate abscess formation in intra-abdominal sepsis by an IL-17-dependent mechanism. J Immunol 170:1958-1963.

25. Happel, K. I., P. J. Dubin, M. Zheng, N. Ghilardi, C. Lockhart, L. J. Quinton, A. R. Odden, J. E. Shellito, G. J. Bagby, S. Nelson, and J. K. Kolls. 2005. Divergent roles of IL-23 and IL-12 in host defense against Klebsiella pneumoniae. J Exp Med 202:761-769.

26. Huang, W., L. Na, P. L. Fidel, and P. Schwarzenberger. 2004. Requirement of interleukin-17A for systemic anti-Candida albicans host defense in mice. J Infect Dis 190:624-631.

27. Infante-Duarte, C., H. F. Horton, M. C. Byrne, and T. Kamradt. 2000. Microbial lipopeptides induce the production of IL-17 in Th cells. J Immunol 165:6107-6115.

28. Stockinger, B., and M. Veldhoen. 2007. Differentiation and function of Th17 T cells. Curr Opin Immunol 19:281-286.

29. Bettelli, E., Y. Carrier, W. Gao, T. Korn, T. B. Strom, M. Oukka, H. L. Weiner, and V. K. Kuchroo. 2006. Reciprocal developmental pathways for the generation of pathogenic effector TH17 and regulatory T cells. Nature 441:235-238.

30. Harrington, L. E., P. R. Mangan, and C. T. Weaver. 2006. Expanding the effector CD4 T-cell repertoire: the Th17 lineage. Curr Opin Immunol 18:349-356.

31. Ivanov, II, B. S. McKenzie, L. Zhou, C. E. Tadokoro, A. Lepelley, J. J. Lafaille, D. J. Cua, and D. R. Littman. 2006. The orphan nuclear receptor RORgammat directs the differentiation program of proinflammatory IL-17+ T helper cells. Cell 126:1121-1133.

32. Mangan, P. R., L. E. Harrington, D. B. O'Quinn, W. S. Helms, D. C. Bullard, C. O. Elson, R. D. Hatton, S. M. Wahl, T. R. Schoeb, and C. T. Weaver. 2006. Transforming growth factor-beta induces development of the T(H)17 lineage. Nature 441:231-234.

33. Veldhoen, M., R. J. Hocking, C. J. Atkins, R. M. Locksley, and B. Stockinger. 2006. TGFbeta in the context of an inflammatory cytokine milieu


240

supports de novo differentiation of IL-17-producing T cells. Immunity 24:179-189.

34. Veldhoen, M., R. J. Hocking, R. A. Flavell, and B. Stockinger. 2006. Signals mediated by transforming growth factor-beta initiate autoimmune encephalomyelitis, but chronic inflammation is needed to sustain disease. Nat Immunol 7:1151-1156.

35. Fan, Z., and Q. Zhang. 2005. Molecular mechanisms of lymphocyte-mediated cytotoxicity. Cell Mol Immunol 2:259-264.

36. Pardo, J., J. I. Aguilo, A. Anel, P. Martin, L. Joeckel, C. Borner, R. Wallich, A. Mullbacher, C. J. Froelich, and M. M. Simon. 2009. The biology of cytotoxic cell granule exocytosis pathway: granzymes have evolved to induce cell death and inflammation. Microbes Infect 11:452-459.

37. Coombes, J. L., N. J. Robinson, K. J. Maloy, H. H. Uhlig, and F. Powrie. 2005. Regulatory T cells and intestinal homeostasis. Immunol Rev 204:184-194.

38. Sakaguchi, S. 2004. Naturally arising CD4+ regulatory t cells for immunologic self-tolerance and negative control of immune responses. Annu Rev Immunol 22:531-562.

39. Fontenot, J. D., M. A. Gavin, and A. Y. Rudensky. 2003. Foxp3 programs the development and function of CD4+CD25+ regulatory T cells. Nat Immunol 4:330-336.

40. Fontenot, J. D., J. P. Rasmussen, L. M. Williams, J. L. Dooley, A. G. Farr, and A. Y. Rudensky. 2005. Regulatory T cell lineage specification by the forkhead transcription factor foxp3. Immunity 22:329-341.

41. Hori, S., T. Nomura, and S. Sakaguchi. 2003. Control of regulatory T cell development by the transcription factor Foxp3. Science 299:1057-1061.

42. Khattri, R., T. Cox, S. A. Yasayko, and F. Ramsdell. 2003. An essential role for Scurfin in CD4+CD25+ T regulatory cells. Nat Immunol 4:337-342.

43. Wan, Y. Y., and R. A. Flavell. 2005. Identifying Foxp3-expressing suppressor T cells with a bicistronic reporter. Proc Natl Acad Sci U S A 102:5126-5131.

44. Sallusto, F., J. Geginat, and A. Lanzavecchia. 2004. Central memory and effector memory T cell subsets: function, generation, and maintenance. Annu Rev Immunol 22:745-763.

45. Liu, Y. J., J. Zhang, P. J. Lane, E. Y. Chan, and I. C. MacLennan. 1991. Sites of specific B cell activation in primary and secondary responses to T cell-dependent and T cell-independent antigens. Eur J Immunol 21:2951-2962.

46. Parker, D. C. 1993. T cell-dependent B cell activation. Annu Rev Immunol 11:331-360.

47. Vos, Q., A. Lees, Z. Q. Wu, C. M. Snapper, and J. J. Mond. 2000. B-cell activation by T-cell-independent type 2 antigens as an integral part of the humoral immune response to pathogenic microorganisms. Immunol Rev 176:154-170.

48. Baumgarth, N. 2000. A two-phase model of B-cell activation. Immunol Rev 176:171-180.

49. Market, E., and F. N. Papavasiliou. 2003. V(D)J recombination and the evolution of the adaptive immune system. PLoS Biol 1:E16.


241

50. Stavnezer, J., J. E. Guikema, and C. E. Schrader. 2008. Mechanism and regulation of class switch recombination. Annu Rev Immunol 26:261-292.

51. Banchereau, J., F. Briere, C. Caux, J. Davoust, S. Lebecque, Y. J. Liu, B. Pulendran, and K. Palucka. 2000. Immunobiology of dendritic cells. Annu Rev Immunol 18:767-811.

52. Banchereau, J., and R. M. Steinman. 1998. Dendritic cells and the control of immunity. Nature 392:245-252.

53. Aderem, A., and D. M. Underhill. 1999. Mechanisms of phagocytosis in macrophages. Annu Rev Immunol 17:593-623.

54. MacMicking, J., Q. W. Xie, and C. Nathan. 1997. Nitric oxide and macrophage function. Annu Rev Immunol 15:323-350.

55. Faurschou, M., and N. Borregaard. 2003. Neutrophil granules and secretory vesicles in inflammation. Microbes Infect 5:1317-1327.

56. Segal, A. W. 2005. How neutrophils kill microbes. Annu Rev Immunol 23:197-223.

57. Smith, J. A. 1994. Neutrophils, host defense, and inflammation: a double-edged sword. J Leukoc Biol 56:672-686.

58. Harding, F. A., J. G. McArthur, J. A. Gross, D. H. Raulet, and J. P. Allison. 1992. CD28-mediated signalling co-stimulates murine T cells and prevents induction of anergy in T-cell clones. Nature 356:607-609.

59. Martin, P. J., J. A. Ledbetter, Y. Morishita, C. H. June, P. G. Beatty, and J. A. Hansen. 1986. A 44 kilodalton cell surface homodimer regulates interleukin 2 production by activated human T lymphocytes. J Immunol 136:3282-3287.

60. Weiss, A., B. Manger, and J. Imboden. 1986. Synergy between the T3/antigen receptor complex and Tp44 in the activation of human T cells. J Immunol 137:819-825.

61. Szabo, S. J., S. T. Kim, G. L. Costa, X. Zhang, C. G. Fathman, and L. H. Glimcher. 2000. A novel transcription factor, T-bet, directs Th1 lineage commitment. Cell 100:655-669.

62. McGeachy, M. J., L. A. Stephens, and S. M. Anderton. 2005. Natural recovery and protection from autoimmune encephalomyelitis: contribution of CD4+CD25+ regulatory cells within the central nervous system. J Immunol 175:3025-3032.

63. Korn, T., E. Bettelli, W. Gao, A. Awasthi, A. Jager, T. B. Strom, M. Oukka, and V. K. Kuchroo. 2007. IL-21 initiates an alternative pathway to induce proinflammatory T(H)17 cells. Nature 448:484-487.

64. Osorio, F., S. LeibundGut-Landmann, M. Lochner, K. Lahl, T. Sparwasser, G. Eberl, and C. Reis e Sousa. 2008. DC activated via dectin-1 convert Treg into IL-17 producers. Eur J Immunol 38:3274-3281.

65. Xu, Q., J. Lee, E. Jankowska-Gan, J. Schultz, D. A. Roenneburg, L. D. Haynes, S. Kusaka, H. W. Sollinger, S. J. Knechtle, A. M. VanBuskirk, J. R. Torrealba, and W. J. Burlingham. 2007. Human CD4+CD25low adaptive T regulatory cells suppress delayed-type hypersensitivity during transplant tolerance. J Immunol 178:3983-3995.

66. Yang, X. O., R. Nurieva, G. J. Martinez, H. S. Kang, Y. Chung, B. P. Pappu, B. Shah, S. H. Chang, K. S. Schluns, S. S. Watowich, X. H. Feng, A. M. Jetten, and C. Dong. 2008. Molecular antagonism and plasticity of regulatory and inflammatory T cell programs. Immunity 29:44-56.


242

67. Zhou, L., Ivanov, II, R. Spolski, R. Min, K. Shenderov, T. Egawa, D. E. Levy, W. J. Leonard, and D. R. Littman. 2007. IL-6 programs T(H)-17 cell differentiation by promoting sequential engagement of the IL-21 and IL-23 pathways. Nat Immunol 8:967-974.

68. Lee, Y. K., H. Turner, C. L. Maynard, J. R. Oliver, D. Chen, C. O. Elson, and C. T. Weaver. 2009. Late developmental plasticity in the T helper 17 lineage. Immunity 30:92-107.

69. Lexberg, M. H., A. Taubner, A. Forster, I. Albrecht, A. Richter, T. Kamradt, A. Radbruch, and H. D. Chang. 2008. Th memory for interleukin-17 expression is stable in vivo. Eur J Immunol 38:2654-2664.

70. Wei, G., L. Wei, J. Zhu, C. Zang, J. Hu-Li, Z. Yao, K. Cui, Y. Kanno, T. Y. Roh, W. T. Watford, D. E. Schones, W. Peng, H. W. Sun, W. E. Paul, J. J. O'Shea, and K. Zhao. 2009. Global mapping of H3K4me3 and H3K27me3 reveals specificity and plasticity in lineage fate determination of differentiating CD4+ T cells. Immunity 30:155-167.

71. Zhou, X., L. T. Jeker, B. T. Fife, S. Zhu, M. S. Anderson, M. T. McManus, and J. A. Bluestone. 2008. Selective miRNA disruption in T reg cells leads to uncontrolled autoimmunity. J Exp Med 205:1983-1991.

72. Engelhardt, B. 2008. The blood-central nervous system barriers actively control immune cell entry into the central nervous system. Curr Pharm Des 14:1555-1565.

73. Mrass, P., and W. Weninger. 2006. Immune cell migration as a means to control immune privilege: lessons from the CNS and tumors. Immunol Rev 213:195-212.

74. Xiao, B. G., and H. Link. 1998. Immune regulation within the central nervous system. J Neurol Sci 157:1-12.

75. Romero-Pinel, L., S. Martinez-Yelamos, L. Gubieras, E. Matas, L. Bau, M. Kremenchutzky, and T. Arbizu. 2009. Anticipation of age at onset in familial multiple sclerosis. Eur J Neurol.

76. Kremenchutzky, M., D. Cottrell, G. Rice, W. Hader, J. Baskerville, W. Koopman, and G. C. Ebers. 1999. The natural history of multiple sclerosis: a geographically based study. 7. Progressive-relapsing and relapsing-progressive multiple sclerosis: a re-evaluation. Brain 122 ( Pt 10):1941-1950.

77. Keegan, B. M., and J. H. Noseworthy. 2002. Multiple sclerosis. Annu Rev Med 53:285-302.

78. Grau-Lopez, L., D. Raich, C. Ramo-Tello, M. Naranjo-Gomez, A. Davalos, R. Pujol-Borrell, F. E. Borras, and E. Martinez-Caceres. 2009. Myelin peptides in multiple sclerosis. Autoimmun Rev 8:650-653.

79. Jahn, O., S. Tenzer, and H. B. Werner. 2009. Myelin proteomics: molecular anatomy of an insulating sheath. Mol Neurobiol 40:55-72.

80. Goverman, J. 2009. Autoimmune T cell responses in the central nervous system. Nat Rev Immunol 9:393-407.

81. Compston, A. 1997. Genetic epidemiology of multiple sclerosis. J Neurol Neurosurg Psychiatry 62:553-561.

82. Noseworthy, J. H., C. Lucchinetti, M. Rodriguez, and B. G. Weinshenker. 2000. Multiple sclerosis. N Engl J Med 343:938-952.


243

83. Ebers, G. C., A. D. Sadovnick, and N. J. Risch. 1995. A genetic basis for familial aggregation in multiple sclerosis. Canadian Collaborative Study Group. Nature 377:150-151.

84. 2009. Genome-wide association study identifies new multiple sclerosis susceptibility loci on chromosomes 12 and 20. Nat Genet 41:824-828.

85. 2009. The expanding genetic overlap between multiple sclerosis and type I diabetes. Genes Immun 10:11-14.

86. Aulchenko, Y. S., I. A. Hoppenbrouwers, S. V. Ramagopalan, L. Broer, N. Jafari, J. Hillert, J. Link, W. Lundstrom, E. Greiner, A. Dessa Sadovnick, D. Goossens, C. Van Broeckhoven, J. Del-Favero, G. C. Ebers, B. A. Oostra, C. M. van Duijn, and R. Q. Hintzen. 2008. Genetic variation in the KIF1B locus influences susceptibility to multiple sclerosis. Nat Genet 40:1402-1403.

87. Ban, M., A. Goris, A. R. Lorentzen, A. Baker, T. Mihalova, G. Ingram, D. R. Booth, R. N. Heard, G. J. Stewart, E. Bogaert, B. Dubois, H. F. Harbo, E. G. Celius, A. Spurkland, R. Strange, C. Hawkins, N. P. Robertson, F. Dudbridge, J. Wason, P. L. De Jager, D. Hafler, J. D. Rioux, A. J. Ivinson, J. L. McCauley, M. Pericak-Vance, J. R. Oksenberg, S. L. Hauser, D. Sexton, J. Haines, S. Sawcer, and A. Compston. 2009. Replication analysis identifies TYK2 as a multiple sclerosis susceptibility factor. Eur J Hum Genet 17:1309-1313.

88. Chapman, J., S. Vinokurov, A. Achiron, D. M. Karussis, K. Mitosek-Szewczyk, M. Birnbaum, D. M. Michaelson, and A. D. Korczyn. 2001. APOE genotype is a major predictor of long-term progression of disability in MS. Neurology 56:312-316.

89. Ebers, G. C., and D. A. Dyment. 1998. Genetics of multiple sclerosis. Semin Neurol 18:295-299.

90. Fazekas, F., S. Strasser-Fuchs, H. Kollegger, T. Berger, W. Kristoferitsch, H. Schmidt, C. Enzinger, M. Schiefermeier, C. Schwarz, B. Kornek, M. Reindl, K. Huber, R. Grass, G. Wimmer, K. Vass, K. H. Pfeiffer, H. P. Hartung, and R. Schmidt. 2001. Apolipoprotein E epsilon 4 is associated with rapid progression of multiple sclerosis. Neurology 57:853-857.

91. Hafler, D. A., A. Compston, S. Sawcer, E. S. Lander, M. J. Daly, P. L. De Jager, P. I. de Bakker, S. B. Gabriel, D. B. Mirel, A. J. Ivinson, M. A. Pericak-Vance, S. G. Gregory, J. D. Rioux, J. L. McCauley, J. L. Haines, L. F. Barcellos, B. Cree, J. R. Oksenberg, and S. L. Hauser. 2007. Risk alleles for multiple sclerosis identified by a genomewide study. N Engl J Med 357:851-862.

92. Oksenberg, J. R., S. E. Baranzini, L. F. Barcellos, and S. L. Hauser. 2001. Multiple sclerosis: genomic rewards. J Neuroimmunol 113:171-184.

93. Rubio, J. P., J. Stankovich, J. Field, N. Tubridy, M. Marriott, C. Chapman, M. Bahlo, D. Perera, L. J. Johnson, B. D. Tait, M. D. Varney, T. P. Speed, B. V. Taylor, S. J. Foote, H. Butzkueven, and T. J. Kilpatrick. 2008. Replication of KIAA0350, IL2RA, RPL5 and CD58 as multiple sclerosis susceptibility genes in Australians. Genes Immun 9:624-630.

94. Friese, M. A., K. B. Jakobsen, L. Friis, R. Etzensperger, M. J. Craner, R. M. McMahon, L. T. Jensen, V. Huygelen, E. Y. Jones, J. I. Bell, and L. Fugger. 2008. Opposing effects of HLA class I molecules in tuning autoreactive CD8+ T cells in multiple sclerosis. Nat Med 14:1227-1235.


244

95. Gregersen, J. W., K. R. Kranc, X. Ke, P. Svendsen, L. S. Madsen, A. R. Thomsen, L. R. Cardon, J. I. Bell, and L. Fugger. 2006. Functional epistasis on a common MHC haplotype associated with multiple sclerosis. Nature 443:574-577.

96. Olerup, O., and J. Hillert. 1991. HLA class II-associated genetic susceptibility in multiple sclerosis: a critical evaluation. Tissue Antigens 38:1-15.

97. Lauer, K. 1994. The risk of multiple sclerosis in the U.S.A. in relation to sociogeographic features: a factor-analytic study. J Clin Epidemiol 47:43-48.

98. Sibley, W. A., C. R. Bamford, and K. Clark. 1985. Clinical viral infections and multiple sclerosis. Lancet 1:1313-1315.

99. Kurtzke, J. F. 2000. Epidemiology of multiple sclerosis. Does this really point toward an etiology? Lectio Doctoralis. Neurol Sci 21:383-403.

100. Ascherio, A., K. L. Munger, E. T. Lennette, D. Spiegelman, M. A. Hernan, M. J. Olek, S. E. Hankinson, and D. J. Hunter. 2001. Epstein-Barr virus antibodies and risk of multiple sclerosis: a prospective study. JAMA 286:3083-3088.

101. Soldan, S. S., R. Berti, N. Salem, P. Secchiero, L. Flamand, P. A. Calabresi, M. B. Brennan, H. W. Maloni, H. F. McFarland, H. C. Lin, M. Patnaik, and S. Jacobson. 1997. Association of human herpes virus 6 (HHV-6) with multiple sclerosis: increased IgM response to HHV-6 early antigen and detection of serum HHV-6 DNA. Nat Med 3:1394-1397.

102. Taus, C., E. Pucci, E. Cartechini, A. Fie, G. Giuliani, M. Clementi, and S. Menzo. 2000. Absence of HHV-6 and HHV-7 in cerebrospinal fluid in relapsing-remitting multiple sclerosis. Acta Neurol Scand 101:224-228.

103. Bagert, B. A. 2009. Epstein-Barr virus in multiple sclerosis. Curr Neurol Neurosci Rep 9:405-410.

104. Pender, M. P. 2003. Infection of autoreactive B lymphocytes with EBV, causing chronic autoimmune diseases. Trends Immunol 24:584-588.

105. Pender, M. P. 2009. Does Epstein-Barr virus infection in the brain drive the development of multiple sclerosis? Brain 132:3196-3198.

106. Pender, M. P. 2009. Preventing and curing multiple sclerosis by controlling Epstein-Barr virus infection. Autoimmun Rev 8:563-568.

107. Pender, M. P., P. A. Csurhes, A. Lenarczyk, C. M. Pfluger, and S. R. Burrows. 2009. Decreased T cell reactivity to Epstein-Barr virus infected lymphoblastoid cell lines in multiple sclerosis. J Neurol Neurosurg Psychiatry 80:498-505.

108. Baxter, A. G. 2007. The origin and application of experimental autoimmune encephalomyelitis. Nat Rev Immunol 7:904-912.

109. Rivers, T. M., and F. F. Schwentker. 1935. Encephalomyelitis Accompanied by Myelin Destruction Experimentally Produced in Monkeys. J Exp Med 61:689-702.

110. Rivers, T. M., D. H. Sprunt, and G. P. Berry. 1933. Observations on Attempts to Produce Acute Disseminated Encephalomyelitis in Monkeys. J Exp Med 58:39-53.

111. Stuart, G., and K. S. Krikorian. 1928. The neuro-paralytic accidents of anti-rabies treatment. Ann. Trop. Med. 22.


245

112. Stuart, G., and K. S. Krikorian. 1930. A fatal neuro-paralytic accident of antirabies treatment. Lancet 1:1123-1125.

113. Kabat, E. A., A. Wolf, and A. E. Bezer. 1947. The Rapid Production of Acute Disseminated Encephalomyelitis in Rhesus Monkeys by Injection of Heterologous and Homologous Brain Tissue with Adjuvants. J Exp Med 85:117-130.

114. Morgan, I. M. 1947. Allergic Encephalomyelitis in Monkeys in Response to Injection of Normal Monkey Nervous Tissue. J Exp Med 85:131-140.

115. Wolf, S. D., B. N. Dittel, F. Hardardottir, and C. A. Janeway, Jr. 1996. Experimental autoimmune encephalomyelitis induction in genetically B cell-deficient mice. J Exp Med 184:2271-2278.

116. Freund, J., E. R. Stern, and T. M. Pisini. 1947. Isoallergic encephalomyelitis and radiculitis in guinea pigs after one injection of brain and mycobacteria in water-in-oil emulsion. Journal of Immunology 57:179-194.

117. Krishnamoorthy, G., and H. Wekerle. 2009. EAE: an immunologist's magic eye. Eur J Immunol 39:2031-2035.

118. Mendel, I., N. Kerlero de Rosbo, and A. Ben-Nun. 1995. A myelin oligodendrocyte glycoprotein peptide induces typical chronic experimental autoimmune encephalomyelitis in H-2b mice: fine specificity and T cell receptor V beta expression of encephalitogenic T cells. Eur J Immunol 25:1951-1959.

119. Amor, S., N. Groome, C. Linington, M. M. Morris, K. Dornmair, M. V. Gardinier, J. M. Matthieu, and D. Baker. 1994. Identification of epitopes of myelin oligodendrocyte glycoprotein for the induction of experimental allergic encephalomyelitis in SJL and Biozzi AB/H mice. J Immunol 153:4349-4356.

120. Tuohy, V. K., R. A. Sobel, Z. Lu, R. A. Laursen, and M. B. Lees. 1992. Myelin proteolipid protein: minimum sequence requirements for active induction of autoimmune encephalomyelitis in SWR/J and SJL/J mice. J Neuroimmunol 39:67-74.

121. Ando, D. G., J. Clayton, D. Kono, J. L. Urban, and E. E. Sercarz. 1989. Encephalitogenic T cells in the B10.PL model of experimental allergic encephalomyelitis (EAE) are of the Th-1 lymphokine subtype. Cell Immunol 124:132-143.

122. Greer, J. M., C. Klinguer, E. Trifilieff, R. A. Sobel, and M. B. Lees. 1997. Encephalitogenicity of murine, but not bovine, DM20 in SJL mice is due to a single amino acid difference in the immunodominant encephalitogenic epitope. Neurochem Res 22:541-547.

123. Huseby, E. S., D. Liggitt, T. Brabb, B. Schnabel, C. Ohlen, and J. Goverman. 2001. A pathogenic role for myelin-specific CD8(+) T cells in a model for multiple sclerosis. J Exp Med 194:669-676.

124. Kerlero de Rosbo, N., I. Mendel, and A. Ben-Nun. 1995. Chronic relapsing experimental autoimmune encephalomyelitis with a delayed onset and an atypical clinical course, induced in PL/J mice by myelin oligodendrocyte glycoprotein (MOG)-derived peptide: preliminary analysis of MOG T cell epitopes. Eur J Immunol 25:985-993.

125. Kibler, R. F., R. B. Fritz, F. Chou, C. H. Jen Chou, N. Y. Peacocke, N. M. Brown, and D. E. McFarlin. 1977. Immune response of Lewis rats to peptide


246

C1 (residues 68-88) of guinea pig and rat myelin basic proteins. J Exp Med 146:1323-1331.

126. Morris-Downes, M. M., K. McCormack, D. Baker, D. Sivaprasad, J. Natkunarajah, and S. Amor. 2002. Encephalitogenic and immunogenic potential of myelin-associated glycoprotein (MAG), oligodendrocyte-specific glycoprotein (OSP) and 2',3'-cyclic nucleotide 3'-phosphodiesterase (CNPase) in ABH and SJL mice. J Neuroimmunol 122:20-33.

127. Pollinger, B., G. Krishnamoorthy, K. Berer, H. Lassmann, M. R. Bosl, R. Dunn, H. S. Domingues, A. Holz, F. C. Kurschus, and H. Wekerle. 2009. Spontaneous relapsing-remitting EAE in the SJL/J mouse: MOG-reactive transgenic T cells recruit endogenous MOG-specific B cells. J Exp Med 206:1303-1316.

128. Stefferl, A., A. Schubart, M. Storch, A. Amini, I. Mather, H. Lassmann, and C. Linington. 2000. Butyrophilin, a milk protein, modulates the encephalitogenic T cell response to myelin oligodendrocyte glycoprotein in experimental autoimmune encephalomyelitis. J Immunol 165:2859-2865.

129. Wekerle, H., K. Kojima, J. Lannes-Vieira, H. Lassmann, and C. Linington. 1994. Animal models. Ann Neurol 36 Suppl:S47-53.

130. Zamvil, S. S., D. J. Mitchell, A. C. Moore, K. Kitamura, L. Steinman, and J. B. Rothbard. 1986. T-cell epitope of the autoantigen myelin basic protein that induces encephalomyelitis. Nature 324:258-260.

131. Zhong, M. C., L. Cohen, A. Meshorer, N. Kerlero de Rosbo, and A. Ben-Nun. 2000. T-cells specific for soluble recombinant oligodendrocyte-specific protein induce severe clinical experimental autoimmune encephalomyelitis in H-2(b) and H-2(s) mice. J Neuroimmunol 105:39-45.

132. Madsen, L. S., E. C. Andersson, L. Jansson, M. krogsgaard, C. B. Andersen, J. Engberg, J. L. Strominger, A. Svejgaard, J. P. Hjorth, R. Holmdahl, K. W. Wucherpfennig, and L. Fugger. 1999. A humanized model for multiple sclerosis using HLA-DR2 and a human T-cell receptor. Nat Genet 23:343-347.

133. Matsushima, G. K., and P. Morell. 2001. The neurotoxicant, cuprizone, as a model to study demyelination and remyelination in the central nervous system. Brain Pathol 11:107-116.

134. Gold, R., C. Linington, and H. Lassmann. 2006. Understanding pathogenesis and therapy of multiple sclerosis via animal models: 70 years of merits and culprits in experimental autoimmune encephalomyelitis research. Brain 129:1953-1971.

135. Sriram, S., and I. Steiner. 2005. Experimental allergic encephalomyelitis: a misleading model of multiple sclerosis. Ann Neurol 58:939-945.

136. Teitelbaum, D., A. Meshorer, T. Hirshfeld, R. Arnon, and M. Sela. 1971. Suppression of experimental allergic encephalomyelitis by a synthetic polypeptide. Eur J Immunol 1:242-248.

137. Lublin, F. D., M. Lavasa, C. Viti, and R. L. Knobler. 1987. Suppression of acute and relapsing experimental allergic encephalomyelitis with mitoxantrone. Clin Immunol Immunopathol 45:122-128.

138. Yednock, T. A., C. Cannon, L. C. Fritz, F. Sanchez-Madrid, L. Steinman, and N. Karin. 1992. Prevention of experimental autoimmune encephalomyelitis by antibodies against alpha 4 beta 1 integrin. Nature 356:63-66.


247

139. Simka, M. 2009. Blood brain barrier compromise with endothelial inflammation may lead to autoimmune loss of myelin during multiple sclerosis. Curr Neurovasc Res 6:132-139.

140. Bagaeva, L. V., P. Rao, J. M. Powers, and B. M. Segal. 2006. CXC chemokine ligand 13 plays a role in experimental autoimmune encephalomyelitis. J Immunol 176:7676-7685.

141. Balashov, K. E., J. B. Rottman, H. L. Weiner, and W. W. Hancock. 1999. CCR5(+) and CXCR3(+) T cells are increased in multiple sclerosis and their ligands MIP-1alpha and IP-10 are expressed in demyelinating brain lesions. Proc Natl Acad Sci U S A 96:6873-6878.

142. Bielecki, B., A. Mazurek, P. Wolinski, and A. Glabinski. 2007. Expression of chemokine receptors CCR7 and CCR8 in the CNS during ChREAE. Scand J Immunol 66:383-392.

143. Columba-Cabezas, S., B. Serafini, E. Ambrosini, and F. Aloisi. 2003. Lymphoid chemokines CCL19 and CCL21 are expressed in the central nervous system during experimental autoimmune encephalomyelitis: implications for the maintenance of chronic neuroinflammation. Brain Pathol 13:38-51.

144. de Lemos, C., J. E. Christensen, A. Nansen, T. Moos, B. Lu, C. Gerard, J. P. Christensen, and A. R. Thomsen. 2005. Opposing effects of CXCR3 and CCR5 deficiency on CD8+ T cell-mediated inflammation in the central nervous system of virus-infected mice. J Immunol 175:1767-1775.

145. Eltayeb, S., A. L. Berg, H. Lassmann, E. Wallstrom, M. Nilsson, T. Olsson, A. Ericsson-Dahlstrand, and D. Sunnemark. 2007. Temporal expression and cellular origin of CC chemokine receptors CCR1, CCR2 and CCR5 in the central nervous system: insight into mechanisms of MOG-induced EAE. J Neuroinflammation 4:14.

146. Kohler, R. E., A. C. Caon, D. O. Willenborg, I. Clark-Lewis, and S. R. McColl. 2003. A role for macrophage inflammatory protein-3 alpha/CC chemokine ligand 20 in immune priming during T cell-mediated inflammation of the central nervous system. J Immunol 170:6298-6306.

147. Kohler, R. E., I. Comerford, S. Townley, S. Haylock-Jacobs, I. Clark-Lewis, and S. R. McColl. 2008. Antagonism of the chemokine receptors CXCR3 and CXCR4 reduces the pathology of experimental autoimmune encephalomyelitis. Brain Pathol 18:504-516.

148. Liu, L., D. Huang, M. Matsui, T. T. He, T. Hu, J. Demartino, B. Lu, C. Gerard, and R. M. Ransohoff. 2006. Severe disease, unaltered leukocyte migration, and reduced IFN-gamma production in CXCR3-/- mice with experimental autoimmune encephalomyelitis. J Immunol 176:4399-4409.

149. Antel, J. P., and T. Owens. 1999. Immune regulation and CNS autoimmune disease. J Neuroimmunol 100:181-189.

150. Aranami, T., and T. Yamamura. 2008. Th17 Cells and autoimmune encephalomyelitis (EAE/MS). Allergol Int 57:115-120.

151. Cua, D. J., J. Sherlock, Y. Chen, C. A. Murphy, B. Joyce, B. Seymour, L. Lucian, W. To, S. Kwan, T. Churakova, S. Zurawski, M. Wiekowski, S. A. Lira, D. Gorman, R. A. Kastelein, and J. D. Sedgwick. 2003. Interleukin-23 rather than interleukin-12 is the critical cytokine for autoimmune inflammation of the brain. Nature 421:744-748.


248

152. Dore-Duffy, P., R. Balabanov, J. Rafols, and R. H. Swanborg. 1996. Recovery phase of acute experimental autoimmune encephalomyelitis in rats corresponds to development of endothelial cell unresponsiveness to interferon gamma activation. J Neurosci Res 44:223-234.

153. Eng, L. F., R. S. Ghirnikar, and Y. L. Lee. 1996. Inflammation in EAE: role of chemokine/cytokine expression by resident and infiltrating cells. Neurochem Res 21:511-525.

154. Hofstetter, H. H., S. M. Ibrahim, D. Koczan, N. Kruse, A. Weishaupt, K. V. Toyka, and R. Gold. 2005. Therapeutic efficacy of IL-17 neutralization in murine experimental autoimmune encephalomyelitis. Cell Immunol 237:123-130.

155. Issazadeh, S., M. Mustafa, A. Ljungdahl, B. Hojeberg, A. Dagerlind, R. Elde, and T. Olsson. 1995. Interferon gamma, interleukin 4 and transforming growth factor beta in experimental autoimmune encephalomyelitis in Lewis rats: dynamics of cellular mRNA expression in the central nervous system and lymphoid cells. J Neurosci Res 40:579-590.

156. Komiyama, Y., S. Nakae, T. Matsuki, A. Nambu, H. Ishigame, S. Kakuta, K. Sudo, and Y. Iwakura. 2006. IL-17 plays an important role in the development of experimental autoimmune encephalomyelitis. J Immunol 177:566-573.

157. Krakowski, M., and T. Owens. 1996. Interferon-gamma confers resistance to experimental allergic encephalomyelitis. Eur J Immunol 26:1641-1646.

158. Kuwabara, T., F. Ishikawa, T. Yasuda, K. Aritomi, H. Nakano, Y. Tanaka, Y. Okada, M. Lipp, and T. Kakiuchi. 2009. CCR7 ligands are required for development of experimental autoimmune encephalomyelitis through generating IL-23-dependent Th17 cells. J Immunol 183:2513-2521.

159. Langrish, C. L., Y. Chen, W. M. Blumenschein, J. Mattson, B. Basham, J. D. Sedgwick, T. McClanahan, R. A. Kastelein, and D. J. Cua. 2005. IL-23 drives a pathogenic T cell population that induces autoimmune inflammation. J Exp Med 201:233-240.

160. O'Connor, R. A., C. T. Prendergast, C. A. Sabatos, C. W. Lau, M. D. Leech, D. C. Wraith, and S. M. Anderton. 2008. Cutting edge: Th1 cells facilitate the entry of Th17 cells to the central nervous system during experimental autoimmune encephalomyelitis. J Immunol 181:3750-3754.

161. Popko, B., J. G. Corbin, K. D. Baerwald, J. Dupree, and A. M. Garcia. 1997. The effects of interferon-gamma on the central nervous system. Mol Neurobiol 14:19-35.

162. Powell, M. B., D. Mitchell, J. Lederman, J. Buckmeier, S. S. Zamvil, M. Graham, N. H. Ruddle, and L. Steinman. 1990. Lymphotoxin and tumor necrosis factor-alpha production by myelin basic protein-specific T cell clones correlates with encephalitogenicity. Int Immunol 2:539-544.

163. Segal, B. M. 2003. Experimental autoimmune encephalomyelitis: cytokines, effector T cells, and antigen-presenting cells in a prototypical Th1-mediated autoimmune disease. Curr Allergy Asthma Rep 3:86-93.

164. Segal, G. M., T. D. Smith, M. C. Heinrich, F. S. Ey, and G. C. Bagby, Jr. 1992. Specific repression of granulocyte-macrophage and granulocyte colony-stimulating factor gene expression in interleukin-1-stimulated endothelial cells with antisense oligodeoxynucleotides. Blood 80:609-616.


249

165. Stromnes, I. M., L. M. Cerretti, D. Liggitt, R. A. Harris, and J. M. Goverman. 2008. Differential regulation of central nervous system autoimmunity by T(H)1 and T(H)17 cells. Nat Med 14:337-342.

166. Willenborg, D. O., S. Fordham, C. C. Bernard, W. B. Cowden, and I. A. Ramshaw. 1996. IFN-gamma plays a critical down-regulatory role in the induction and effector phase of myelin oligodendrocyte glycoprotein-induced autoimmune encephalomyelitis. J Immunol 157:3223-3227.

167. dos Santos, A. C., M. M. Barsante, R. M. Arantes, C. C. Bernard, M. M. Teixeira, and J. Carvalho-Tavares. 2005. CCL2 and CCL5 mediate leukocyte adhesion in experimental autoimmune encephalomyelitis--an intravital microscopy study. J Neuroimmunol 162:122-129.

168. Ishizu, T., M. Osoegawa, F. J. Mei, H. Kikuchi, M. Tanaka, Y. Takakura, M. Minohara, H. Murai, F. Mihara, T. Taniwaki, and J. Kira. 2005. Intrathecal activation of the IL-17/IL-8 axis in opticospinal multiple sclerosis. Brain 128:988-1002.

169. Kroenke, M. A., T. J. Carlson, A. V. Andjelkovic, and B. M. Segal. 2008. IL-12- and IL-23-modulated T cells induce distinct types of EAE based on histology, CNS chemokine profile, and response to cytokine inhibition. J Exp Med 205:1535-1541.

170. Miyagishi, R., S. Kikuchi, T. Fukazawa, and K. Tashiro. 1995. Macrophage inflammatory protein-1 alpha in the cerebrospinal fluid of patients with multiple sclerosis and other inflammatory neurological diseases. J Neurol Sci 129:223-227.

171. Sorensen, T. L., M. Tani, J. Jensen, V. Pierce, C. Lucchinetti, V. A. Folcik, S. Qin, J. Rottman, F. Sellebjerg, R. M. Strieter, J. L. Frederiksen, and R. M. Ransohoff. 1999. Expression of specific chemokines and chemokine receptors in the central nervous system of multiple sclerosis patients. J Clin Invest 103:807-815.

172. Ibrahim, M. Z., A. T. Reder, R. Lawand, W. Takash, and S. Sallouh-Khatib. 1996. The mast cells of the multiple sclerosis brain. J Neuroimmunol 70:131-138.

173. Kruger, P. G., L. Bo, K. M. Myhr, A. E. Karlsen, A. Taule, H. I. Nyland, and S. Mork. 1990. Mast cells and multiple sclerosis: a light and electron microscopic study of mast cells in multiple sclerosis emphasizing staining procedures. Acta Neurol Scand 81:31-36.

174. Secor, V. H., W. E. Secor, C. A. Gutekunst, and M. A. Brown. 2000. Mast cells are essential for early onset and severe disease in a murine model of multiple sclerosis. J Exp Med 191:813-822.

175. Ben-Nun, A., and I. R. Cohen. 1981. Vaccination against autoimmune encephalomyelitis (EAE): attenuated autoimmune T lymphocytes confer resistance to induction of active EAE but not to EAE mediated by the intact T lymphocyte line. Eur J Immunol 11:949-952.

176. Hauser, S. L., K. A. Ault, M. J. Levin, M. R. Garovoy, and H. L. Weiner. 1981. Natural killer cell activity in multiple sclerosis. J Immunol 127:1114-1117.

177. Kastrukoff, L. F., N. G. Morgan, D. Zecchini, R. White, A. J. Petkau, J. Satoh, and D. W. Paty. 1998. A role for natural killer cells in the immunopathogenesis of multiple sclerosis. J Neuroimmunol 86:123-133.


250

178. Takahashi, K., T. Aranami, M. Endoh, S. Miyake, and T. Yamamura. 2004. The regulatory role of natural killer cells in multiple sclerosis. Brain 127:1917-1927.

179. Trachtenberg, E. A. 2009. Understanding the role of natural killer cell receptors and their human leukocyte antigen ligands in multiple sclerosis. Ann Neurol 65:626-628.

180. Babbe, H., A. Roers, A. Waisman, H. Lassmann, N. Goebels, R. Hohlfeld, M. Friese, R. Schroder, M. Deckert, S. Schmidt, R. Ravid, and K. Rajewsky. 2000. Clonal expansions of CD8(+) T cells dominate the T cell infiltrate in active multiple sclerosis lesions as shown by micromanipulation and single cell polymerase chain reaction. J Exp Med 192:393-404.

181. Crawford, M. P., S. X. Yan, S. B. Ortega, R. S. Mehta, R. E. Hewitt, D. A. Price, P. Stastny, D. C. Douek, R. A. Koup, M. K. Racke, and N. J. Karandikar. 2004. High prevalence of autoreactive, neuroantigen-specific CD8+ T cells in multiple sclerosis revealed by novel flow cytometric assay. Blood 103:4222-4231.

182. Friese, M. A., and L. Fugger. 2005. Autoreactive CD8+ T cells in multiple sclerosis: a new target for therapy? Brain 128:1747-1763.

183. Friese, M. A., and L. Fugger. 2009. Pathogenic CD8(+) T cells in multiple sclerosis. Ann Neurol 66:132-141.

184. Melzer, N., S. G. Meuth, and H. Wiendl. 2009. CD8+ T cells and neuronal damage: direct and collateral mechanisms of cytotoxicity and impaired electrical excitability. Faseb J 23:3659-3673.

185. Skulina, C., S. Schmidt, K. Dornmair, H. Babbe, A. Roers, K. Rajewsky, H. Wekerle, R. Hohlfeld, and N. Goebels. 2004. Multiple sclerosis: brain-infiltrating CD8+ T cells persist as clonal expansions in the cerebrospinal fluid and blood. Proc Natl Acad Sci U S A 101:2428-2433.

186. Benveniste, E. N. 1997. Role of macrophages/microglia in multiple sclerosis and experimental allergic encephalomyelitis. J Mol Med 75:165-173.

187. Ben-Nun, A., H. Otmy, and I. R. Cohen. 1981. Genetic control of autoimmune encephalomyelitis and recognition of the critical nonapeptide moiety of myelin basic protein in guinea pigs are exerted through interaction of lymphocytes and macrophages. Eur J Immunol 11:311-316.

188. Bettelli, E., D. Baeten, A. Jager, R. A. Sobel, and V. K. Kuchroo. 2006. Myelin oligodendrocyte glycoprotein-specific T and B cells cooperate to induce a Devic-like disease in mice. J Clin Invest 116:2393-2402.

189. Fillatreau, S., C. H. Sweenie, M. J. McGeachy, D. Gray, and S. M. Anderton. 2002. B cells regulate autoimmunity by provision of IL-10. Nat Immunol 3:944-950.

190. Krishnamoorthy, G., H. Lassmann, H. Wekerle, and A. Holz. 2006. Spontaneous opticospinal encephalomyelitis in a double-transgenic mouse model of autoimmune T cell/B cell cooperation. J Clin Invest 116:2385-2392.

191. Matsushita, T., K. Yanaba, J. D. Bouaziz, M. Fujimoto, and T. F. Tedder. 2008. Regulatory B cells inhibit EAE initiation in mice while other B cells promote disease progression. J Clin Invest 118:3420-3430.

192. Correale, J., M. McMillan, K. McCarthy, T. Le, and L. P. Weiner. 1995. Isolation and characterization of autoreactive proteolipid protein-peptide


251

specific T-cell clones from multiple sclerosis patients. Neurology 45:1370-1378.

193. Schluesener, H. J., and H. Wekerle. 1985. Autoaggressive T lymphocyte lines recognizing the encephalitogenic region of myelin basic protein: in vitro selection from unprimed rat T lymphocyte populations. J Immunol 135:3128-3133.

194. Gran, B., G. X. Zhang, S. Yu, J. Li, X. H. Chen, E. S. Ventura, M. Kamoun, and A. Rostami. 2002. IL-12p35-deficient mice are susceptible to experimental autoimmune encephalomyelitis: evidence for redundancy in the IL-12 system in the induction of central nervous system autoimmune demyelination. J Immunol 169:7104-7110.

195. Gutcher, I., E. Urich, K. Wolter, M. Prinz, and B. Becher. 2006. Interleukin 18-independent engagement of interleukin 18 receptor-alpha is required for autoimmune inflammation. Nat Immunol 7:946-953.

196. O'Garra, A., L. Steinman, and K. Gijbels. 1997. CD4+ T-cell subsets in autoimmunity. Curr Opin Immunol 9:872-883.

197. Tran, E. H., E. N. Prince, and T. Owens. 2000. IFN-gamma shapes immune invasion of the central nervous system via regulation of chemokines. J Immunol 164:2759-2768.

198. Zhang, G. X., B. Gran, S. Yu, J. Li, I. Siglienti, X. Chen, M. Kamoun, and A. Rostami. 2003. Induction of experimental autoimmune encephalomyelitis in IL-12 receptor-beta 2-deficient mice: IL-12 responsiveness is not required in the pathogenesis of inflammatory demyelination in the central nervous system. J Immunol 170:2153-2160.

199. McKenzie, B. S., R. A. Kastelein, and D. J. Cua. 2006. Understanding the IL-23-IL-17 immune pathway. Trends Immunol 27:17-23.

200. Murphy, C. A., C. L. Langrish, Y. Chen, W. Blumenschein, T. McClanahan, R. A. Kastelein, J. D. Sedgwick, and D. J. Cua. 2003. Divergent pro- and antiinflammatory roles for IL-23 and IL-12 in joint autoimmune inflammation. J Exp Med 198:1951-1957.

201. Hue, S., P. Ahern, S. Buonocore, M. C. Kullberg, D. J. Cua, B. S. McKenzie, F. Powrie, and K. J. Maloy. 2006. Interleukin-23 drives innate and T cell-mediated intestinal inflammation. J Exp Med 203:2473-2483.

202. Kullberg, M. C., D. Jankovic, C. G. Feng, S. Hue, P. L. Gorelick, B. S. McKenzie, D. J. Cua, F. Powrie, A. W. Cheever, K. J. Maloy, and A. Sher. 2006. IL-23 plays a key role in Helicobacter hepaticus-induced T cell-dependent colitis. J Exp Med 203:2485-2494.

203. Uhlig, H. H., B. S. McKenzie, S. Hue, C. Thompson, B. Joyce-Shaikh, R. Stepankova, N. Robinson, S. Buonocore, H. Tlaskalova-Hogenova, D. J. Cua, and F. Powrie. 2006. Differential activity of IL-12 and IL-23 in mucosal and systemic innate immune pathology. Immunity 25:309-318.

204. Yen, D., J. Cheung, H. Scheerens, F. Poulet, T. McClanahan, B. McKenzie, M. A. Kleinschek, A. Owyang, J. Mattson, W. Blumenschein, E. Murphy, M. Sathe, D. J. Cua, R. A. Kastelein, and D. Rennick. 2006. IL-23 is essential for T cell-mediated colitis and promotes inflammation via IL-17 and IL-6. J Clin Invest 116:1310-1316.

205. Lock, C., G. Hermans, R. Pedotti, A. Brendolan, E. Schadt, H. Garren, A. Langer-Gould, S. Strober, B. Cannella, J. Allard, P. Klonowski, A. Austin, N.


252

Lad, N. Kaminski, S. J. Galli, J. R. Oksenberg, C. S. Raine, R. Heller, and L. Steinman. 2002. Gene-microarray analysis of multiple sclerosis lesions yields new targets validated in autoimmune encephalomyelitis. Nat Med 8:500-508.

206. Matusevicius, D., P. Kivisakk, B. He, N. Kostulas, V. Ozenci, S. Fredrikson, and H. Link. 1999. Interleukin-17 mRNA expression in blood and CSF mononuclear cells is augmented in multiple sclerosis. Mult Scler 5:101-104.

207. Kebir, H., K. Kreymborg, I. Ifergan, A. Dodelet-Devillers, R. Cayrol, M. Bernard, F. Giuliani, N. Arbour, B. Becher, and A. Prat. 2007. Human TH17 lymphocytes promote blood-brain barrier disruption and central nervous system inflammation. Nat Med 13:1173-1175.

208. Fainardi, E., M. Castellazzi, T. Bellini, M. C. Manfrinato, E. Baldi, I. Casetta, E. Paolino, E. Granieri, and F. Dallocchio. 2006. Cerebrospinal fluid and serum levels and intrathecal production of active matrix metalloproteinase-9 (MMP-9) as markers of disease activity in patients with multiple sclerosis. Mult Scler 12:294-301.

209. Tesmer, L. A., S. K. Lundy, S. Sarkar, and D. A. Fox. 2008. Th17 cells in human disease. Immunol Rev 223:87-113.

210. Yong, V. W., R. K. Zabad, S. Agrawal, A. Goncalves Dasilva, and L. M. Metz. 2007. Elevation of matrix metalloproteinases (MMPs) in multiple sclerosis and impact of immunomodulators. J Neurol Sci 259:79-84.

211. Leipe, J., A. Skapenko, P. E. Lipsky, and H. Schulze-Koops. 2005. Regulatory T cells in rheumatoid arthritis. Arthritis Res Ther 7:93.

212. Mottonen, M., J. Heikkinen, L. Mustonen, P. Isomaki, R. Luukkainen, and O. Lassila. 2005. CD4+ CD25+ T cells with the phenotypic and functional characteristics of regulatory T cells are enriched in the synovial fluid of patients with rheumatoid arthritis. Clin Exp Immunol 140:360-367.

213. Nadkarni, S., C. Mauri, and M. R. Ehrenstein. 2007. Anti-TNF-alpha therapy induces a distinct regulatory T cell population in patients with rheumatoid arthritis via TGF-beta. J Exp Med 204:33-39.

214. Homann, D., A. Holz, A. Bot, B. Coon, T. Wolfe, J. Petersen, T. P. Dyrberg, M. J. Grusby, and M. G. von Herrath. 1999. Autoreactive CD4+ T cells protect from autoimmune diabetes via bystander suppression using the IL-4/Stat6 pathway. Immunity 11:463-472.

215. Tarbell, K. V., S. Yamazaki, K. Olson, P. Toy, and R. M. Steinman. 2004. CD25+ CD4+ T cells, expanded with dendritic cells presenting a single autoantigenic peptide, suppress autoimmune diabetes. J Exp Med 199:1467-1477.

216. Tonkin, D. R., J. He, G. Barbour, and K. Haskins. 2008. Regulatory T cells prevent transfer of type 1 diabetes in NOD mice only when their antigen is present in vivo. J Immunol 181:4516-4522.

217. Costantino, C. M., C. Baecher-Allan, and D. A. Hafler. 2008. Multiple sclerosis and regulatory T cells. J Clin Immunol 28:697-706.

218. Hori, S., M. Haury, A. Coutinho, and J. Demengeot. 2002. Specificity requirements for selection and effector functions of CD25+4+ regulatory T cells in anti-myelin basic protein T cell receptor transgenic mice. Proc Natl Acad Sci U S A 99:8213-8218.

219. Kohm, A. P., P. A. Carpentier, H. A. Anger, and S. D. Miller. 2002. Cutting edge: CD4+CD25+ regulatory T cells suppress antigen-specific autoreactive


253

immune responses and central nervous system inflammation during active experimental autoimmune encephalomyelitis. J Immunol 169:4712-4716.

220. Yu, P., R. K. Gregg, J. J. Bell, J. S. Ellis, R. Divekar, H. H. Lee, R. Jain, H. Waldner, J. C. Hardaway, M. Collins, V. K. Kuchroo, and H. Zaghouani. 2005. Specific T regulatory cells display broad suppressive functions against experimental allergic encephalomyelitis upon activation with cognate antigen. J Immunol 174:6772-6780.

221. Gartner, D., H. Hoff, U. Gimsa, G. R. Burmester, and M. C. Brunner-Weinzierl. 2006. CD25 regulatory T cells determine secondary but not primary remission in EAE: impact on long-term disease progression. J Neuroimmunol 172:73-84.

222. Zhang, X., J. Reddy, H. Ochi, D. Frenkel, V. K. Kuchroo, and H. L. Weiner. 2006. Recovery from experimental allergic encephalomyelitis is TGF-beta dependent and associated with increases in CD4+LAP+ and CD4+CD25+ T cells. Int Immunol 18:495-503.

223. Astier, A. L., G. Meiffren, S. Freeman, and D. A. Hafler. 2006. Alterations in CD46-mediated Tr1 regulatory T cells in patients with multiple sclerosis. J Clin Invest 116:3252-3257.

224. Huan, J., N. Culbertson, L. Spencer, R. Bartholomew, G. G. Burrows, Y. K. Chou, D. Bourdette, S. F. Ziegler, H. Offner, and A. A. Vandenbark. 2005. Decreased FOXP3 levels in multiple sclerosis patients. J Neurosci Res 81:45-52.

225. Venken, K., N. Hellings, K. Hensen, J. L. Rummens, R. Medaer, B. D'Hooghe M, B. Dubois, J. Raus, and P. Stinissen. 2006. Secondary progressive in contrast to relapsing-remitting multiple sclerosis patients show a normal CD4+CD25+ regulatory T-cell function and FOXP3 expression. J Neurosci Res 83:1432-1446.

226. Conlon, P., J. R. Oksenberg, J. Zhang, and L. Steinman. 1999. The immunobiology of multiple sclerosis: an autoimmune disease of the central nervous system. Neurobiol Dis 6:149-166.

227. Lindert, R. B., C. G. Haase, U. Brehm, C. Linington, H. Wekerle, and R. Hohlfeld. 1999. Multiple sclerosis: B- and T-cell responses to the extracellular domain of the myelin oligodendrocyte glycoprotein. Brain 122 ( Pt 11):2089-2100.

228. Steinman, L. 2001. Multiple sclerosis: a two-stage disease. Nat Immunol 2:762-764.

229. Wucherpfennig, K. W., I. Catz, S. Hausmann, J. L. Strominger, L. Steinman, and K. G. Warren. 1997. Recognition of the immunodominant myelin basic protein peptide by autoantibodies and HLA-DR2-restricted T cell clones from multiple sclerosis patients. Identity of key contact residues in the B-cell and T-cell epitopes. J Clin Invest 100:1114-1122.

230. Hemmer, B., J. J. Archelos, and H. P. Hartung. 2002. New concepts in the immunopathogenesis of multiple sclerosis. Nat Rev Neurosci 3:291-301.

231. Lucchinetti, C., W. Bruck, J. Parisi, B. Scheithauer, M. Rodriguez, and H. Lassmann. 2000. Heterogeneity of multiple sclerosis lesions: implications for the pathogenesis of demyelination. Ann Neurol 47:707-717.

232. Dhib-Jalbut, S. 2002. Mechanisms of action of interferons and glatiramer acetate in multiple sclerosis. Neurology 58:S3-9.


254

233. Fernandez, O., A. Antiquedad, T. Arbizu, A. Capdevila, P. de Castro, J. C. Correa de Sa, J. A. Garcia-Merino, G. Izquierdo, A. Magalhaes, X. Montalban, and et al. 1995. Treatment of relapsing-remitting multiple sclerosis with natural interferon beta: a multicenter, randomized clinical trial. Mult Scler 1 Suppl 1:S67-69.

234. Neuhaus, O., C. Farina, H. Wekerle, and R. Hohlfeld. 2001. Mechanisms of action of glatiramer acetate in multiple sclerosis. Neurology 56:702-708.

235. Yong, V. W. 2002. Differential mechanisms of action of interferon-beta and glatiramer aetate in MS. Neurology 59:802-808.

236. Stuve, O., R. Gold, A. Chan, E. Mix, U. Zettl, and B. C. Kieseier. 2008. alpha4-Integrin antagonism with natalizumab: effects and adverse effects. J Neurol 255 Suppl 6:58-65.

237. Cohen, J. A. 2009. Emerging therapies for relapsing multiple sclerosis. Arch Neurol 66:821-828.

238. Bilancio, A., K. Okkenhaug, M. Camps, J. L. Emery, T. Ruckle, C. Rommel, and B. Vanhaesebroeck. 2006. Key role of the p110delta isoform of PI3K in B-cell antigen and IL-4 receptor signaling: comparative analysis of genetic and pharmacologic interference with p110delta function in B cells. Blood 107:642-650.

239. Clayton, E., G. Bardi, S. E. Bell, D. Chantry, C. P. Downes, A. Gray, L. A. Humphries, D. Rawlings, H. Reynolds, E. Vigorito, and M. Turner. 2002. A crucial role for the p110delta subunit of phosphatidylinositol 3-kinase in B cell development and activation. J Exp Med 196:753-763.

240. Dil, N., and A. J. Marshall. 2009. Role of phosphoinositide 3-kinase p110 delta in TLR4- and TLR9-mediated B cell cytokine production and differentiation. Mol Immunol 46:1970-1978.

241. Durand, C. A., K. Hartvigsen, L. Fogelstrand, S. Kim, S. Iritani, B. Vanhaesebroeck, J. L. Witztum, K. D. Puri, and M. R. Gold. 2009. Phosphoinositide 3-kinase p110 delta regulates natural antibody production, marginal zone and B-1 B cell function, and autoantibody responses. J Immunol 183:5673-5684.

242. Grasis, J. A., C. D. Browne, and C. D. Tsoukas. 2003. Inducible T cell tyrosine kinase regulates actin-dependent cytoskeletal events induced by the T cell antigen receptor. J Immunol 170:3971-3976.

243. Hebeis, B. J., E. Vigorito, and M. Turner. 2004. The p110delta subunit of phosphoinositide 3-kinase is required for the lipopolysaccharide response of mouse B cells. Biochem Soc Trans 32:789-791.

244. Jou, S. T., N. Carpino, Y. Takahashi, R. Piekorz, J. R. Chao, N. Carpino, D. Wang, and J. N. Ihle. 2002. Essential, nonredundant role for the phosphoinositide 3-kinase p110delta in signaling by the B-cell receptor complex. Mol Cell Biol 22:8580-8591.

245. Kumar, A., T. D. Humphreys, K. N. Kremer, P. S. Bramati, L. Bradfield, C. E. Edgar, and K. E. Hedin. 2006. CXCR4 physically associates with the T cell receptor to signal in T cells. Immunity 25:213-224.

246. Labno, C. M., C. M. Lewis, D. You, D. W. Leung, A. Takesono, N. Kamberos, A. Seth, L. D. Finkelstein, M. K. Rosen, P. L. Schwartzberg, and J. K. Burkhardt. 2003. Itk functions to control actin polymerization at the


255

immune synapse through localized activation of Cdc42 and WASP. Curr Biol 13:1619-1624.

247. Llorian, M., Z. Stamataki, S. Hill, M. Turner, and I. L. Martensson. 2007. The PI3K p110delta is required for down-regulation of RAG expression in immature B cells. J Immunol 178:1981-1985.

248. Okkenhaug, K., A. Bilancio, G. Farjot, H. Priddle, S. Sancho, E. Peskett, W. Pearce, S. E. Meek, A. Salpekar, M. D. Waterfield, A. J. Smith, and B. Vanhaesebroeck. 2002. Impaired B and T cell antigen receptor signaling in p110delta PI 3-kinase mutant mice. Science 297:1031-1034.

249. Okkenhaug, K., D. T. Patton, A. Bilancio, F. Garcon, W. C. Rowan, and B. Vanhaesebroeck. 2006. The p110delta isoform of phosphoinositide 3-kinase controls clonal expansion and differentiation of Th cells. J Immunol 177:5122-5128.

250. Sauer, S., L. Bruno, A. Hertweck, D. Finlay, M. Leleu, M. Spivakov, Z. A. Knight, B. S. Cobb, D. Cantrell, E. O'Connor, K. M. Shokat, A. G. Fisher, and M. Merkenschlager. 2008. T cell receptor signaling controls Foxp3 expression via PI3K, Akt, and mTOR. Proc Natl Acad Sci U S A 105:7797-7802.

251. Swat, W., V. Montgrain, T. A. Doggett, J. Douangpanya, K. Puri, W. Vermi, and T. G. Diacovo. 2006. Essential role of PI3Kdelta and PI3Kgamma in thymocyte survival. Blood 107:2415-2422.

252. Alcazar, I., M. Marques, A. Kumar, E. Hirsch, M. Wymann, A. C. Carrera, and D. F. Barber. 2007. Phosphoinositide 3-kinase gamma participates in T cell receptor-induced T cell activation. J Exp Med 204:2977-2987.

253. Oak, J. S., M. P. Matheu, I. Parker, M. D. Cahalan, and D. A. Fruman. 2007. Lymphocyte cell motility: the twisting, turning tale of phosphoinositide 3-kinase. Biochem Soc Trans 35:1109-1113.

254. Hawkins, P. T., T. R. Jackson, and L. R. Stephens. 1992. Platelet-derived growth factor stimulates synthesis of PtdIns(3,4,5)P3 by activating a PtdIns(4,5)P2 3-OH kinase. Nature 358:157-159.

255. Vanhaesebroeck, B., S. J. Leevers, K. Ahmadi, J. Timms, R. Katso, P. C. Driscoll, R. Woscholski, P. J. Parker, and M. D. Waterfield. 2001. Synthesis and function of 3-phosphorylated inositol lipids. Annu Rev Biochem 70:535-602.

256. Kurig, B., A. Shymanets, T. Bohnacker, Prajwal, C. Brock, M. R. Ahmadian, M. Schaefer, A. Gohla, C. Harteneck, M. P. Wymann, E. Jeanclos, and B. Nurnberg. 2009. Ras is an indispensable coregulator of the class IB phosphoinositide 3-kinase p87/p110gamma. Proc Natl Acad Sci U S A 106:20312-20317.

257. Pacold, M. E., S. Suire, O. Perisic, S. Lara-Gonzalez, C. T. Davis, E. H. Walker, P. T. Hawkins, L. Stephens, J. F. Eccleston, and R. L. Williams. 2000. Crystal structure and functional analysis of Ras binding to its effector phosphoinositide 3-kinase gamma. Cell 103:931-943.

258. Rubio, I., P. Rodriguez-Viciana, J. Downward, and R. Wetzker. 1997. Interaction of Ras with phosphoinositide 3-kinase gamma. Biochem J 326 ( Pt 3):891-895.


256

259. Walker, E. H., O. Perisic, C. Ried, L. Stephens, and R. L. Williams. 1999. Structural insights into phosphoinositide 3-kinase catalysis and signalling. Nature 402:313-320.

260. Vanhaesebroeck, B., M. J. Welham, K. Kotani, R. Stein, P. H. Warne, M. J. Zvelebil, K. Higashi, S. Volinia, J. Downward, and M. D. Waterfield. 1997. P110delta, a novel phosphoinositide 3-kinase in leukocytes. Proc Natl Acad Sci U S A 94:4330-4335.

261. Dhand, R., K. Hara, I. Hiles, B. Bax, I. Gout, G. Panayotou, M. J. Fry, K. Yonezawa, M. Kasuga, and M. D. Waterfield. 1994. PI 3-kinase: structural and functional analysis of intersubunit interactions. EMBO J 13:511-521.

262. Deane, J. A., and D. A. Fruman. 2004. Phosphoinositide 3-kinase: diverse roles in immune cell activation. Annu Rev Immunol 22:563-598.

263. Pons, S., T. Asano, E. Glasheen, M. Miralpeix, Y. Zhang, T. L. Fisher, M. G. Myers, Jr., X. J. Sun, and M. F. White. 1995. The structure and function of p55PIK reveal a new regulatory subunit for phosphatidylinositol 3-kinase. Mol Cell Biol 15:4453-4465.

264. Okkenhaug, K., and B. Vanhaesebroeck. 2001. New responsibilities for the PI3K regulatory subunit p85 alpha. Sci STKE 2001:pe1.

265. Stephens, L., A. Smrcka, F. T. Cooke, T. R. Jackson, P. C. Sternweis, and P. T. Hawkins. 1994. A novel phosphoinositide 3 kinase activity in myeloid-derived cells is activated by G protein beta gamma subunits. Cell 77:83-93.

266. Suire, S., J. Coadwell, G. J. Ferguson, K. Davidson, P. Hawkins, and L. Stephens. 2005. p84, a new Gbetagamma-activated regulatory subunit of the type IB phosphoinositide 3-kinase p110gamma. Curr Biol 15:566-570.

267. Voigt, P., M. B. Dorner, and M. Schaefer. 2006. Characterization of p87PIKAP, a novel regulatory subunit of phosphoinositide 3-kinase gamma that is highly expressed in heart and interacts with PDE3B. J Biol Chem 281:9977-9986.

268. Brock, C., M. Schaefer, H. P. Reusch, C. Czupalla, M. Michalke, K. Spicher, G. Schultz, and B. Nurnberg. 2003. Roles of G beta gamma in membrane recruitment and activation of p110 gamma/p101 phosphoinositide 3-kinase gamma. J Cell Biol 160:89-99.

269. Krugmann, S., P. T. Hawkins, N. Pryer, and S. Braselmann. 1999. Characterizing the interactions between the two subunits of the p101/p110gamma phosphoinositide 3-kinase and their role in the activation of this enzyme by G beta gamma subunits. J Biol Chem 274:17152-17158.

270. Patrucco, E., A. Notte, L. Barberis, G. Selvetella, A. Maffei, M. Brancaccio, S. Marengo, G. Russo, O. Azzolino, S. D. Rybalkin, L. Silengo, F. Altruda, R. Wetzker, M. P. Wymann, G. Lembo, and E. Hirsch. 2004. PI3Kgamma modulates the cardiac response to chronic pressure overload by distinct kinase-dependent and -independent effects. Cell 118:375-387.

271. Rameh, L. E., A. Arvidsson, K. L. Carraway, 3rd, A. D. Couvillon, G. Rathbun, A. Crompton, B. VanRenterghem, M. P. Czech, K. S. Ravichandran, S. J. Burakoff, D. S. Wang, C. S. Chen, and L. C. Cantley. 1997. A comparative analysis of the phosphoinositide binding specificity of pleckstrin homology domains. J Biol Chem 272:22059-22066.


257

272. Ferguson, K. M., J. M. Kavran, V. G. Sankaran, E. Fournier, S. J. Isakoff, E. Y. Skolnik, and M. A. Lemmon. 2000. Structural basis for discrimination of 3-phosphoinositides by pleckstrin homology domains. Mol Cell 6:373-384.

273. Vanhaesebroeck, B., and D. R. Alessi. 2000. The PI3K-PDK1 connection: more than just a road to PKB. Biochem J 346 Pt 3:561-576.

274. Brazil, D. P., J. Park, and B. A. Hemmings. 2002. PKB binding proteins. Getting in on the Akt. Cell 111:293-303.

275. Chan, T. O., S. E. Rittenhouse, and P. N. Tsichlis. 1999. AKT/PKB and other D3 phosphoinositide-regulated kinases: kinase activation by phosphoinositide-dependent phosphorylation. Annu Rev Biochem 68:965-1014.

276. Manning, B. D., and L. C. Cantley. 2007. AKT/PKB signaling: navigating downstream. Cell 129:1261-1274.

277. Scheid, M. P., and J. R. Woodgett. 2001. PKB/AKT: functional insights from genetic models. Nat Rev Mol Cell Biol 2:760-768.

278. Song, G., G. Ouyang, and S. Bao. 2005. The activation of Akt/PKB signaling pathway and cell survival. J Cell Mol Med 9:59-71.

279. Kane, L. P., V. S. Shapiro, D. Stokoe, and A. Weiss. 1999. Induction of NF-kappaB by the Akt/PKB kinase. Curr Biol 9:601-604.

280. Brunet, A., A. Bonni, M. J. Zigmond, M. Z. Lin, P. Juo, L. S. Hu, M. J. Anderson, K. C. Arden, J. Blenis, and M. E. Greenberg. 1999. Akt promotes cell survival by phosphorylating and inhibiting a Forkhead transcription factor. Cell 96:857-868.

281. Burgering, B. M., and G. J. Kops. 2002. Cell cycle and death control: long live Forkheads. Trends Biochem Sci 27:352-360.

282. Kops, G. J., R. H. Medema, J. Glassford, M. A. Essers, P. F. Dijkers, P. J. Coffer, E. W. Lam, and B. M. Burgering. 2002. Control of cell cycle exit and entry by protein kinase B-regulated forkhead transcription factors. Mol Cell Biol 22:2025-2036.

283. Stahl, M., P. F. Dijkers, G. J. Kops, S. M. Lens, P. J. Coffer, B. M. Burgering, and R. H. Medema. 2002. The forkhead transcription factor FoxO regulates transcription of p27Kip1 and Bim in response to IL-2. J Immunol 168:5024-5031.

284. Yusuf, I., X. Zhu, M. G. Kharas, J. Chen, and D. A. Fruman. 2004. Optimal B-cell proliferation requires phosphoinositide 3-kinase-dependent inactivation of FOXO transcription factors. Blood 104:784-787.

285. Christian, S. L., P. V. Sims, and M. R. Gold. 2002. The B cell antigen receptor regulates the transcriptional activator beta-catenin via protein kinase C-mediated inhibition of glycogen synthase kinase-3. J Immunol 169:758-769.

286. Saito, K., A. M. Scharenberg, and J. P. Kinet. 2001. Interaction between the Btk PH domain and phosphatidylinositol-3,4,5-trisphosphate directly regulates Btk. J Biol Chem 276:16201-16206.

287. Schwartzberg, P. L. 2003. Amplifying Btk's signal. Immunity 19:634-636. 288. Saito, K., K. F. Tolias, A. Saci, H. B. Koon, L. A. Humphries, A.

Scharenberg, D. J. Rawlings, J. P. Kinet, and C. L. Carpenter. 2003. BTK regulates PtdIns-4,5-P2 synthesis: importance for calcium signaling and PI3K activity. Immunity 19:669-678.


258

289. Spaargaren, M., E. A. Beuling, M. L. Rurup, H. P. Meijer, M. D. Klok, S. Middendorp, R. W. Hendriks, and S. T. Pals. 2003. The B cell antigen receptor controls integrin activity through Btk and PLCgamma2. J Exp Med 198:1539-1550.

290. Saijo, K., I. Mecklenbrauker, A. Santana, M. Leitger, C. Schmedt, and A. Tarakhovsky. 2002. Protein kinase C beta controls nuclear factor kappaB activation in B cells through selective regulation of the IkappaB kinase alpha. J Exp Med 195:1647-1652.

291. Shinohara, H., T. Yasuda, Y. Aiba, H. Sanjo, M. Hamadate, H. Watarai, H. Sakurai, and T. Kurosaki. 2005. PKC beta regulates BCR-mediated IKK activation by facilitating the interaction between TAK1 and CARMA1. J Exp Med 202:1423-1431.

292. Bernards, A., and J. Settleman. 2004. GAP control: regulating the regulators of small GTPases. Trends Cell Biol 14:377-385.

293. Bos, J. L., H. Rehmann, and A. Wittinghofer. 2007. GEFs and GAPs: critical elements in the control of small G proteins. Cell 129:865-877.

294. Fukata, M., M. Nakagawa, and K. Kaibuchi. 2003. Roles of Rho-family GTPases in cell polarisation and directional migration. Curr Opin Cell Biol 15:590-597.

295. Welch, H. C., W. J. Coadwell, L. R. Stephens, and P. T. Hawkins. 2003. Phosphoinositide 3-kinase-dependent activation of Rac. FEBS Lett 546:93-97.

296. Gillingham, A. K., and S. Munro. 2007. The small G proteins of the Arf family and their regulators. Annu Rev Cell Dev Biol 23:579-611.

297. Isakoff, S. J., T. Cardozo, J. Andreev, Z. Li, K. M. Ferguson, R. Abagyan, M. A. Lemmon, A. Aronheim, and E. Y. Skolnik. 1998. Identification and analysis of PH domain-containing targets of phosphatidylinositol 3-kinase using a novel in vivo assay in yeast. EMBO J 17:5374-5387.

298. Stambolic, V., A. Suzuki, J. L. de la Pompa, G. M. Brothers, C. Mirtsos, T. Sasaki, J. Ruland, J. M. Penninger, D. P. Siderovski, and T. W. Mak. 1998. Negative regulation of PKB/Akt-dependent cell survival by the tumor suppressor PTEN. Cell 95:29-39.

299. Tamguney, T., and D. Stokoe. 2007. New insights into PTEN. J Cell Sci 120:4071-4079.

300. Damen, J. E., L. Liu, P. Rosten, R. K. Humphries, A. B. Jefferson, P. W. Majerus, and G. Krystal. 1996. The 145-kDa protein induced to associate with Shc by multiple cytokines is an inositol tetraphosphate and phosphatidylinositol 3,4,5-triphosphate 5-phosphatase. Proc Natl Acad Sci U S A 93:1689-1693.

301. Di Cristofano, A., P. Kotsi, Y. F. Peng, C. Cordon-Cardo, K. B. Elkon, and P. P. Pandolfi. 1999. Impaired Fas response and autoimmunity in Pten+/- mice. Science 285:2122-2125.

302. Di Cristofano, A., B. Pesce, C. Cordon-Cardo, and P. P. Pandolfi. 1998. Pten is essential for embryonic development and tumour suppression. Nat Genet 19:348-355.

303. Fruman, D. A., S. B. Snapper, C. M. Yballe, L. Davidson, J. Y. Yu, F. W. Alt, and L. C. Cantley. 1999. Impaired B cell development and proliferation in absence of phosphoinositide 3-kinase p85alpha. Science 283:393-397.


259

304. Suzuki, A., M. T. Yamaguchi, T. Ohteki, T. Sasaki, T. Kaisho, Y. Kimura, R. Yoshida, A. Wakeham, T. Higuchi, M. Fukumoto, T. Tsubata, P. S. Ohashi, S. Koyasu, J. M. Penninger, T. Nakano, and T. W. Mak. 2001. T cell-specific loss of Pten leads to defects in central and peripheral tolerance. Immunity 14:523-534.

305. Suzuki, H., Y. Terauchi, M. Fujiwara, S. Aizawa, Y. Yazaki, T. Kadowaki, and S. Koyasu. 1999. Xid-like immunodeficiency in mice with disruption of the p85alpha subunit of phosphoinositide 3-kinase. Science 283:390-392.

306. Fox, J. A., K. Ung, S. G. Tanlimco, and F. R. Jirik. 2002. Disruption of a single Pten allele augments the chemotactic response of B lymphocytes to stromal cell-derived factor-1. J Immunol 169:49-54.

307. Heit, B., S. M. Robbins, C. M. Downey, Z. Guan, P. Colarusso, B. J. Miller, F. R. Jirik, and P. Kubes. 2008. PTEN functions to 'prioritize' chemotactic cues and prevent 'distraction' in migrating neutrophils. Nat Immunol 9:743-752.

308. Mosser, V. A., Y. Li, and M. J. Quon. 2001. PTEN does not modulate GLUT4 translocation in rat adipose cells under physiological conditions. Biochem Biophys Res Commun 288:1011-1017.

309. Nakashima, N., P. M. Sharma, T. Imamura, R. Bookstein, and J. M. Olefsky. 2000. The tumor suppressor PTEN negatively regulates insulin signaling in 3T3-L1 adipocytes. J Biol Chem 275:12889-12895.

310. Tang, X., A. M. Powelka, N. A. Soriano, M. P. Czech, and A. Guilherme. 2005. PTEN, but not SHIP2, suppresses insulin signaling through the phosphatidylinositol 3-kinase/Akt pathway in 3T3-L1 adipocytes. J Biol Chem 280:22523-22529.

311. Thong, F. S., C. B. Dugani, and A. Klip. 2005. Turning signals on and off: GLUT4 traffic in the insulin-signaling highway. Physiology (Bethesda) 20:271-284.

312. Ooms, L. M., K. A. Horan, P. Rahman, G. Seaton, R. Gurung, D. S. Kethesparan, and C. A. Mitchell. 2009. The role of the inositol polyphosphate 5-phosphatases in cellular function and human disease. Biochem J 419:29-49.

313. Sleeman, M. W., K. E. Wortley, K. M. Lai, L. C. Gowen, J. Kintner, W. O. Kline, K. Garcia, T. N. Stitt, G. D. Yancopoulos, S. J. Wiegand, and D. J. Glass. 2005. Absence of the lipid phosphatase SHIP2 confers resistance to dietary obesity. Nat Med 11:199-205.

314. Prasad, N. K., M. Tandon, S. Badve, P. W. Snyder, and H. Nakshatri. 2008. Phosphoinositol phosphatase SHIP2 promotes cancer development and metastasis coupled with alterations in EGF receptor turnover. Carcinogenesis 29:25-34.

315. Choi, Y., J. Zhang, C. Murga, H. Yu, E. Koller, B. P. Monia, J. S. Gutkind, and W. Li. 2002. PTEN, but not SHIP and SHIP2, suppresses the PI3K/Akt pathway and induces growth inhibition and apoptosis of myeloma cells. Oncogene 21:5289-5300.

316. Liu, Q., F. Shalaby, J. Jones, D. Bouchard, and D. J. Dumont. 1998. The SH2-containing inositol polyphosphate 5-phosphatase, ship, is expressed during hematopoiesis and spermatogenesis. Blood 91:2753-2759.

317. Helgason, C. D., J. E. Damen, P. Rosten, R. Grewal, P. Sorensen, S. M. Chappel, A. Borowski, F. Jirik, G. Krystal, and R. K. Humphries. 1998.


260

Targeted disruption of SHIP leads to hemopoietic perturbations, lung pathology, and a shortened life span. Genes Dev 12:1610-1620.

318. Oh, S. Y., T. Zheng, M. L. Bailey, D. L. Barber, J. T. Schroeder, Y. K. Kim, and Z. Zhu. 2007. Src homology 2 domain-containing inositol 5-phosphatase 1 deficiency leads to a spontaneous allergic inflammation in the murine lung. J Allergy Clin Immunol 119:123-131.

319. Luo, J. M., Z. L. Liu, H. L. Hao, F. X. Wang, Z. R. Dong, and R. Ohno. 2004. Mutation analysis of SHIP gene in acute leukemia. Zhongguo Shi Yan Xue Ye Xue Za Zhi 12:420-426.

320. Luo, J. M., H. Yoshida, S. Komura, N. Ohishi, L. Pan, K. Shigeno, I. Hanamura, K. Miura, S. Iida, R. Ueda, T. Naoe, Y. Akao, R. Ohno, and K. Ohnishi. 2003. Possible dominant-negative mutation of the SHIP gene in acute myeloid leukemia. Leukemia 17:1-8.

321. Horan, K. A., K. Watanabe, A. M. Kong, C. G. Bailey, J. E. Rasko, T. Sasaki, and C. A. Mitchell. 2007. Regulation of FcgammaR-stimulated phagocytosis by the 72-kDa inositol polyphosphate 5-phosphatase: SHIP1, but not the 72-kDa 5-phosphatase, regulates complement receptor 3 mediated phagocytosis by differential recruitment of these 5-phosphatases to the phagocytic cup. Blood 110:4480-4491.

322. Kamen, L. A., J. Levinsohn, and J. A. Swanson. 2007. Differential association of phosphatidylinositol 3-kinase, SHIP-1, and PTEN with forming phagosomes. Mol Biol Cell 18:2463-2472.

323. Huber, M., C. D. Helgason, J. E. Damen, L. Liu, R. K. Humphries, and G. Krystal. 1998. The src homology 2-containing inositol phosphatase (SHIP) is the gatekeeper of mast cell degranulation. Proc Natl Acad Sci U S A 95:11330-11335.

324. Lesourne, R., W. H. Fridman, and M. Daeron. 2005. Dynamic interactions of Fc gamma receptor IIB with filamin-bound SHIP1 amplify filamentous actin-dependent negative regulation of Fc epsilon receptor I signaling. J Immunol 174:1365-1373.

325. Gibbs, B. F., A. Rathling, D. Zillikens, M. Huber, and H. Haas. 2006. Initial Fc epsilon RI-mediated signal strength plays a key role in regulating basophil signaling and deactivation. J Allergy Clin Immunol 118:1060-1067.

326. Vonakis, B. M., S. Gibbons, Jr., R. Sora, J. M. Langdon, and S. M. MacDonald. 2001. Src homology 2 domain-containing inositol 5' phosphatase is negatively associated with histamine release to human recombinant histamine-releasing factor in human basophils. J Allergy Clin Immunol 108:822-831.

327. Vonakis, B. M., D. W. Macglashan, Jr., N. Vilarino, J. M. Langdon, R. S. Scott, and S. M. MacDonald. 2008. Distinct characteristics of signal transduction events by histamine-releasing factor/translationally controlled tumor protein (HRF/TCTP)-induced priming and activation of human basophils. Blood 111:1789-1796.

328. Parsa, K. V., L. P. Ganesan, M. V. Rajaram, M. A. Gavrilin, A. Balagopal, N. P. Mohapatra, M. D. Wewers, L. S. Schlesinger, J. S. Gunn, and S. Tridandapani. 2006. Macrophage pro-inflammatory response to Francisella novicida infection is regulated by SHIP. PLoS Pathog 2:e71.


261

329. Rajaram, M. V., L. P. Ganesan, K. V. Parsa, J. P. Butchar, J. S. Gunn, and S. Tridandapani. 2006. Akt/Protein kinase B modulates macrophage inflammatory response to Francisella infection and confers a survival advantage in mice. J Immunol 177:6317-6324.

330. Brauweiler, A., I. Tamir, J. Dal Porto, R. J. Benschop, C. D. Helgason, R. K. Humphries, J. H. Freed, and J. C. Cambier. 2000. Differential regulation of B cell development, activation, and death by the src homology 2 domain-containing 5' inositol phosphatase (SHIP). J Exp Med 191:1545-1554.

331. Brauweiler, A. M., I. Tamir, and J. C. Cambier. 2000. Bilevel control of B-cell activation by the inositol 5-phosphatase SHIP. Immunol Rev 176:69-74.

332. Freeburn, R. W., K. L. Wright, S. J. Burgess, E. Astoul, D. A. Cantrell, and S. G. Ward. 2002. Evidence that SHIP-1 contributes to phosphatidylinositol 3,4,5-trisphosphate metabolism in T lymphocytes and can regulate novel phosphoinositide 3-kinase effectors. J Immunol 169:5441-5450.

333. Gloire, G., E. Charlier, S. Rahmouni, C. Volanti, A. Chariot, C. Erneux, and J. Piette. 2006. Restoration of SHIP-1 activity in human leukemic cells modifies NF-kappaB activation pathway and cellular survival upon oxidative stress. Oncogene 25:5485-5494.

334. Helgason, C. D., C. P. Kalberer, J. E. Damen, S. M. Chappel, N. Pineault, G. Krystal, and R. K. Humphries. 2000. A dual role for Src homology 2 domain-containing inositol-5-phosphatase (SHIP) in immunity: aberrant development and enhanced function of b lymphocytes in ship -/- mice. J Exp Med 191:781-794.

335. Kashiwada, M., G. Cattoretti, L. McKeag, T. Rouse, B. M. Showalter, U. Al-Alem, M. Niki, P. P. Pandolfi, E. H. Field, and P. B. Rothman. 2006. Downstream of tyrosine kinases-1 and Src homology 2-containing inositol 5'-phosphatase are required for regulation of CD4+CD25+ T cell development. J Immunol 176:3958-3965.

336. Liu, Q., A. J. Oliveira-Dos-Santos, S. Mariathasan, D. Bouchard, J. Jones, R. Sarao, I. Kozieradzki, P. S. Ohashi, J. M. Penninger, and D. J. Dumont. 1998. The inositol polyphosphate 5-phosphatase ship is a crucial negative regulator of B cell antigen receptor signaling. J Exp Med 188:1333-1342.

337. Osborne, M. A., G. Zenner, M. Lubinus, X. Zhang, Z. Songyang, L. C. Cantley, P. Majerus, P. Burn, and J. P. Kochan. 1996. The inositol 5'-phosphatase SHIP binds to immunoreceptor signaling motifs and responds to high affinity IgE receptor aggregation. J Biol Chem 271:29271-29278.

338. Parry, R. V., S. J. Harris, and S. G. Ward. Fine tuning T lymphocytes: A role for the lipid phosphatase SHIP-1. Biochim Biophys Acta 1804:592-597.

339. Arcaro, A., and M. P. Wymann. 1993. Wortmannin is a potent phosphatidylinositol 3-kinase inhibitor: the role of phosphatidylinositol 3,4,5-trisphosphate in neutrophil responses. Biochem J 296 ( Pt 2):297-301.

340. Baggiolini, M., B. Dewald, J. Schnyder, W. Ruch, P. H. Cooper, and T. G. Payne. 1987. Inhibition of the phagocytosis-induced respiratory burst by the fungal metabolite wortmannin and some analogues. Exp Cell Res 169:408-418.

341. Ito, K., G. Caramori, and I. M. Adcock. 2007. Therapeutic potential of phosphatidylinositol 3-kinase inhibitors in inflammatory respiratory disease. J Pharmacol Exp Ther 321:1-8.


262

342. Vlahos, C. J., W. F. Matter, K. Y. Hui, and R. F. Brown. 1994. A specific inhibitor of phosphatidylinositol 3-kinase, 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one (LY294002). J Biol Chem 269:5241-5248.

343. Ward, S. G., and P. Finan. 2003. Isoform-specific phosphoinositide 3-kinase inhibitors as therapeutic agents. Curr Opin Pharmacol 3:426-434.

344. Walker, E. H., M. E. Pacold, O. Perisic, L. Stephens, P. T. Hawkins, M. P. Wymann, and R. L. Williams. 2000. Structural determinants of phosphoinositide 3-kinase inhibition by wortmannin, LY294002, quercetin, myricetin, and staurosporine. Mol Cell 6:909-919.

345. Wymann, M. P., G. Bulgarelli-Leva, M. J. Zvelebil, L. Pirola, B. Vanhaesebroeck, M. D. Waterfield, and G. Panayotou. 1996. Wortmannin inactivates phosphoinositide 3-kinase by covalent modification of Lys-802, a residue involved in the phosphate transfer reaction. Mol Cell Biol 16:1722-1733.

346. Banin, S., L. Moyal, S. Shieh, Y. Taya, C. W. Anderson, L. Chessa, N. I. Smorodinsky, C. Prives, Y. Reiss, Y. Shiloh, and Y. Ziv. 1998. Enhanced phosphorylation of p53 by ATM in response to DNA damage. Science 281:1674-1677.

347. Brunn, G. J., J. Williams, C. Sabers, G. Wiederrecht, J. C. Lawrence, Jr., and R. T. Abraham. 1996. Direct inhibition of the signaling functions of the mammalian target of rapamycin by the phosphoinositide 3-kinase inhibitors, wortmannin and LY294002. EMBO J 15:5256-5267.

348. Davies, S. P., H. Reddy, M. Caivano, and P. Cohen. 2000. Specificity and mechanism of action of some commonly used protein kinase inhibitors. Biochem J 351:95-105.

349. Izzard, R. A., S. P. Jackson, and G. C. Smith. 1999. Competitive and noncompetitive inhibition of the DNA-dependent protein kinase. Cancer Res 59:2581-2586.

350. Withers, D. J., D. M. Ouwens, B. T. Nave, G. C. van der Zon, C. M. Alarcon, M. E. Cardenas, J. Heitman, J. A. Maassen, and P. R. Shepherd. 1997. Expression, enzyme activity, and subcellular localization of mammalian target of rapamycin in insulin-responsive cells. Biochem Biophys Res Commun 241:704-709.

351. Knight, Z. A., and K. M. Shokat. 2007. Chemically targeting the PI3K family. Biochem Soc Trans 35:245-249.

352. Hayakawa, M., H. Kaizawa, H. Moritomo, T. Koizumi, T. Ohishi, M. Okada, M. Ohta, S. Tsukamoto, P. Parker, P. Workman, and M. Waterfield. 2006. Synthesis and biological evaluation of 4-morpholino-2-phenylquinazolines and related derivatives as novel PI3 kinase p110alpha inhibitors. Bioorg Med Chem 14:6847-6858.

353. Hayakawa, M., K. Kawaguchi, H. Kaizawa, T. Koizumi, T. Ohishi, M. Yamano, M. Okada, M. Ohta, S. Tsukamoto, F. I. Raynaud, P. Parker, P. Workman, and M. D. Waterfield. 2007. Synthesis and biological evaluation of sulfonylhydrazone-substituted imidazo[1,2-a]pyridines as novel PI3 kinase p110alpha inhibitors. Bioorg Med Chem 15:5837-5844.

354. Knight, Z. A., B. Gonzalez, M. E. Feldman, E. R. Zunder, D. D. Goldenberg, O. Williams, R. Loewith, D. Stokoe, A. Balla, B. Toth, T. Balla, W. A. Weiss, R. L. Williams, and K. M. Shokat. 2006. A pharmacological map of


263

the PI3-K family defines a role for p110alpha in insulin signaling. Cell 125:733-747.

355. Jackson, S. P., S. M. Schoenwaelder, I. Goncalves, W. S. Nesbitt, C. L. Yap, C. E. Wright, V. Kenche, K. E. Anderson, S. M. Dopheide, Y. Yuan, S. A. Sturgeon, H. Prabaharan, P. E. Thompson, G. D. Smith, P. R. Shepherd, N. Daniele, S. Kulkarni, B. Abbott, D. Saylik, C. Jones, L. Lu, S. Giuliano, S. C. Hughan, J. A. Angus, A. D. Robertson, and H. H. Salem. 2005. PI 3-kinase p110beta: a new target for antithrombotic therapy. Nat Med 11:507-514.

356. Knight, Z. A., G. G. Chiang, P. J. Alaimo, D. M. Kenski, C. B. Ho, K. Coan, R. T. Abraham, and K. M. Shokat. 2004. Isoform-specific phosphoinositide 3-kinase inhibitors from an arylmorpholine scaffold. Bioorg Med Chem 12:4749-4759.

357. Camps, M., T. Ruckle, H. Ji, V. Ardissone, F. Rintelen, J. Shaw, C. Ferrandi, C. Chabert, C. Gillieron, B. Francon, T. Martin, D. Gretener, D. Perrin, D. Leroy, P. A. Vitte, E. Hirsch, M. P. Wymann, R. Cirillo, M. K. Schwarz, and C. Rommel. 2005. Blockade of PI3Kgamma suppresses joint inflammation and damage in mouse models of rheumatoid arthritis. Nat Med 11:936-943.

358. Pomel, V., J. Klicic, D. Covini, D. D. Church, J. P. Shaw, K. Roulin, F. Burgat-Charvillon, D. Valognes, M. Camps, C. Chabert, C. Gillieron, B. Francon, D. Perrin, D. Leroy, D. Gretener, A. Nichols, P. A. Vitte, S. Carboni, C. Rommel, M. K. Schwarz, and T. Ruckle. 2006. Furan-2-ylmethylene thiazolidinediones as novel, potent, and selective inhibitors of phosphoinositide 3-kinase gamma. J Med Chem 49:3857-3871.

359. Sadhu, C., B. Masinovsky, K. Dick, C. G. Sowell, and D. E. Staunton. 2003. Essential role of phosphoinositide 3-kinase delta in neutrophil directional movement. J Immunol 170:2647-2654.

360. Sadhu, C., K. Dick, W. T. Tino, and D. E. Staunton. 2003. Selective role of PI3K delta in neutrophil inflammatory responses. Biochem Biophys Res Commun 308:764-769.

361. Geng, L., J. Tan, E. Himmelfarb, A. Schueneman, K. Niermann, J. Brousal, A. Fu, K. Cuneo, E. A. Kesicki, J. Treiberg, J. S. Hayflick, and D. E. Hallahan. 2004. A specific antagonist of the p110delta catalytic component of phosphatidylinositol 3'-kinase, IC486068, enhances radiation-induced tumor vascular destruction. Cancer Res 64:4893-4899.

362. Ali, K., A. Bilancio, M. Thomas, W. Pearce, A. M. Gilfillan, C. Tkaczyk, N. Kuehn, A. Gray, J. Giddings, E. Peskett, R. Fox, I. Bruce, C. Walker, C. Sawyer, K. Okkenhaug, P. Finan, and B. Vanhaesebroeck. 2004. Essential role for the p110delta phosphoinositide 3-kinase in the allergic response. Nature 431:1007-1011.

363. Ali, K., M. Camps, W. P. Pearce, H. Ji, T. Ruckle, N. Kuehn, C. Pasquali, C. Chabert, C. Rommel, and B. Vanhaesebroeck. 2008. Isoform-specific functions of phosphoinositide 3-kinases: p110 delta but not p110 gamma promotes optimal allergic responses in vivo. J Immunol 180:2538-2544.

364. Condliffe, A. M., K. Davidson, K. E. Anderson, C. D. Ellson, T. Crabbe, K. Okkenhaug, B. Vanhaesebroeck, M. Turner, L. Webb, M. P. Wymann, E. Hirsch, T. Ruckle, M. Camps, C. Rommel, S. P. Jackson, E. R. Chilvers, L. R. Stephens, and P. T. Hawkins. 2005. Sequential activation of class IB and


264

class IA PI3K is important for the primed respiratory burst of human but not murine neutrophils. Blood 106:1432-1440.

365. Heit, B., L. Liu, P. Colarusso, K. D. Puri, and P. Kubes. 2008. PI3K accelerates, but is not required for, neutrophil chemotaxis to fMLP. J Cell Sci 121:205-214.

366. Konrad, S., S. R. Ali, K. Wiege, S. N. Syed, L. Engling, R. P. Piekorz, E. Hirsch, B. Nurnberg, R. E. Schmidt, and J. E. Gessner. 2008. Phosphoinositide 3-kinases gamma and delta, linkers of coordinate C5a receptor-Fcgamma receptor activation and immune complex-induced inflammation. J Biol Chem 283:33296-33303.

367. Lee, K. S., H. K. Lee, J. S. Hayflick, Y. C. Lee, and K. D. Puri. 2006. Inhibition of phosphoinositide 3-kinase delta attenuates allergic airway inflammation and hyperresponsiveness in murine asthma model. Faseb J 20:455-465.

368. Liu, L., K. D. Puri, J. M. Penninger, and P. Kubes. 2007. Leukocyte PI3Kgamma and PI3Kdelta have temporally distinct roles for leukocyte recruitment in vivo. Blood 110:1191-1198.

369. Puri, K. D., T. A. Doggett, J. Douangpanya, Y. Hou, W. T. Tino, T. Wilson, T. Graf, E. Clayton, M. Turner, J. S. Hayflick, and T. G. Diacovo. 2004. Mechanisms and implications of phosphoinositide 3-kinase delta in promoting neutrophil trafficking into inflamed tissue. Blood 103:3448-3456.

370. Randis, T. M., K. D. Puri, H. Zhou, and T. G. Diacovo. 2008. Role of PI3Kdelta and PI3Kgamma in inflammatory arthritis and tissue localization of neutrophils. Eur J Immunol 38:1215-1224.

371. Sujobert, P., V. Bardet, P. Cornillet-Lefebvre, J. S. Hayflick, N. Prie, F. Verdier, B. Vanhaesebroeck, O. Muller, F. Pesce, N. Ifrah, M. Hunault-Berger, C. Berthou, B. Villemagne, E. Jourdan, B. Audhuy, E. Solary, B. Witz, J. L. Harousseau, C. Himberlin, T. Lamy, B. Lioure, J. Y. Cahn, F. Dreyfus, P. Mayeux, C. Lacombe, and D. Bouscary. 2005. Essential role for the p110delta isoform in phosphoinositide 3-kinase activation and cell proliferation in acute myeloid leukemia. Blood 106:1063-1066.

372. Zhang, T. T., K. Okkenhaug, B. F. Nashed, K. D. Puri, Z. A. Knight, K. M. Shokat, B. Vanhaesebroeck, and A. J. Marshall. 2008. Genetic or pharmaceutical blockade of p110delta phosphoinositide 3-kinase enhances IgE production. J Allergy Clin Immunol 122:811-819 e812.

373. Bi, L., I. Okabe, D. J. Bernard, A. Wynshaw-Boris, and R. L. Nussbaum. 1999. Proliferative defect and embryonic lethality in mice homozygous for a deletion in the p110alpha subunit of phosphoinositide 3-kinase. J Biol Chem 274:10963-10968.

374. Bi, L., I. Okabe, D. J. Bernard, and R. L. Nussbaum. 2002. Early embryonic lethality in mice deficient in the p110beta catalytic subunit of PI 3-kinase. Mamm Genome 13:169-172.

375. Fruman, D. A., F. Mauvais-Jarvis, D. A. Pollard, C. M. Yballe, D. Brazil, R. T. Bronson, C. R. Kahn, and L. C. Cantley. 2000. Hypoglycaemia, liver necrosis and perinatal death in mice lacking all isoforms of phosphoinositide 3-kinase p85 alpha. Nat Genet 26:379-382.

376. Hirsch, E., V. L. Katanaev, C. Garlanda, O. Azzolino, L. Pirola, L. Silengo, S. Sozzani, A. Mantovani, F. Altruda, and M. P. Wymann. 2000. Central role


265

for G protein-coupled phosphoinositide 3-kinase gamma in inflammation. Science 287:1049-1053.

377. Terauchi, Y., Y. Tsuji, S. Satoh, H. Minoura, K. Murakami, A. Okuno, K. Inukai, T. Asano, Y. Kaburagi, K. Ueki, H. Nakajima, T. Hanafusa, Y. Matsuzawa, H. Sekihara, Y. Yin, J. C. Barrett, H. Oda, T. Ishikawa, Y. Akanuma, I. Komuro, M. Suzuki, K. Yamamura, T. Kodama, H. Suzuki, S. Koyasu, S. Aizawa, K. Tobe, Y. Fukui, Y. Yazaki, and T. Kadowaki. 1999. Increased insulin sensitivity and hypoglycaemia in mice lacking the p85 alpha subunit of phosphoinositide 3-kinase. Nat Genet 21:230-235.

378. Chen, D., F. Mauvais-Jarvis, M. Bluher, S. J. Fisher, A. Jozsi, L. J. Goodyear, K. Ueki, and C. R. Kahn. 2004. p50alpha/p55alpha phosphoinositide 3-kinase knockout mice exhibit enhanced insulin sensitivity. Mol Cell Biol 24:320-329.

379. Ueki, K., C. M. Yballe, S. M. Brachmann, D. Vicent, J. M. Watt, C. R. Kahn, and L. C. Cantley. 2002. Increased insulin sensitivity in mice lacking p85beta subunit of phosphoinositide 3-kinase. Proc Natl Acad Sci U S A 99:419-424.

380. Tassi, I., M. Cella, S. Gilfillan, I. Turnbull, T. G. Diacovo, J. M. Penninger, and M. Colonna. 2007. p110gamma and p110delta phosphoinositide 3-kinase signaling pathways synergize to control development and functions of murine NK cells. Immunity 27:214-227.

381. Webb, L. M., E. Vigorito, M. P. Wymann, E. Hirsch, and M. Turner. 2005. Cutting edge: T cell development requires the combined activities of the p110gamma and p110delta catalytic isoforms of phosphatidylinositol 3-kinase. J Immunol 175:2783-2787.

382. Bandyopadhyay, G. K., J. G. Yu, J. Ofrecio, and J. M. Olefsky. 2005. Increased p85/55/50 expression and decreased phosphotidylinositol 3-kinase activity in insulin-resistant human skeletal muscle. Diabetes 54:2351-2359.

383. Barbour, L. A., S. Mizanoor Rahman, I. Gurevich, J. W. Leitner, S. J. Fischer, M. D. Roper, T. A. Knotts, Y. Vo, C. E. McCurdy, S. Yakar, D. Leroith, C. R. Kahn, L. C. Cantley, J. E. Friedman, and B. Draznin. 2005. Increased P85alpha is a potent negative regulator of skeletal muscle insulin signaling and induces in vivo insulin resistance associated with growth hormone excess. J Biol Chem 280:37489-37494.

384. Barbour, L. A., J. Shao, L. Qiao, W. Leitner, M. Anderson, J. E. Friedman, and B. Draznin. 2004. Human placental growth hormone increases expression of the p85 regulatory unit of phosphatidylinositol 3-kinase and triggers severe insulin resistance in skeletal muscle. Endocrinology 145:1144-1150.

385. del Rincon, J. P., K. Iida, B. D. Gaylinn, C. E. McCurdy, J. W. Leitner, L. A. Barbour, J. J. Kopchick, J. E. Friedman, B. Draznin, and M. O. Thorner. 2007. Growth hormone regulation of p85alpha expression and phosphoinositide 3-kinase activity in adipose tissue: mechanism for growth hormone-mediated insulin resistance. Diabetes 56:1638-1646.

386. Dominici, F. P., D. Cifone, A. Bartke, and D. Turyn. 1999. Alterations in the early steps of the insulin-signaling system in skeletal muscle of GH-transgenic mice. Am J Physiol 277:E447-454.

387. Kok, K., B. Geering, and B. Vanhaesebroeck. 2009. Regulation of phosphoinositide 3-kinase expression in health and disease. Trends Biochem Sci 34:115-127.


266

388. Laville, M., D. Auboeuf, Y. Khalfallah, N. Vega, J. P. Riou, and H. Vidal. 1996. Acute regulation by insulin of phosphatidylinositol-3-kinase, Rad, Glut 4, and lipoprotein lipase mRNA levels in human muscle. J Clin Invest 98:43-49.

389. Lefai, E., M. Roques, N. Vega, M. Laville, and H. Vidal. 2001. Expression of the splice variants of the p85alpha regulatory subunit of phosphoinositide 3-kinase in muscle and adipose tissue of healthy subjects and type 2 diabetic patients. Biochem J 360:117-126.

390. Tsuchida, H., M. Bjornholm, M. Fernstrom, D. Galuska, P. Johansson, H. Wallberg-Henriksson, J. R. Zierath, S. Lake, and A. Krook. 2002. Gene expression of the p85alpha regulatory subunit of phosphatidylinositol 3-kinase in skeletal muscle from type 2 diabetic subjects. Pflugers Arch 445:25-31.

391. Oak, J. S., J. A. Deane, M. G. Kharas, J. Luo, T. E. Lane, L. C. Cantley, and D. A. Fruman. 2006. Sjogren's syndrome-like disease in mice with T cells lacking class 1A phosphoinositide-3-kinase. Proc Natl Acad Sci U S A 103:16882-16887.

392. Shayesteh, L., Y. Lu, W. L. Kuo, R. Baldocchi, T. Godfrey, C. Collins, D. Pinkel, B. Powell, G. B. Mills, and J. W. Gray. 1999. PIK3CA is implicated as an oncogene in ovarian cancer. Nat Genet 21:99-102.

393. Spender, L. C., W. Lucchesi, G. Bodelon, A. Bilancio, C. E. Karstegl, T. Asano, O. Dittrich-Breiholz, M. Kracht, B. Vanhaesebroeck, and P. J. Farrell. 2006. Cell target genes of Epstein-Barr virus transcription factor EBNA-2: induction of the p55alpha regulatory subunit of PI3-kinase and its role in survival of EREB2.5 cells. J Gen Virol 87:2859-2867.

394. Zhang, L., J. Huang, N. Yang, J. Greshock, S. Liang, K. Hasegawa, A. Giannakakis, N. Poulos, A. O'Brien-Jenkins, D. Katsaros, R. Butzow, B. L. Weber, and G. Coukos. 2007. Integrative genomic analysis of phosphatidylinositol 3'-kinase family identifies PIK3R3 as a potential therapeutic target in epithelial ovarian cancer. Clin Cancer Res 13:5314-5321.

395. Zhu, Q., H. Youn, J. Tang, O. Tawfik, K. Dennis, P. F. Terranova, J. Du, P. Raynal, J. B. Thrasher, and B. Li. 2008. Phosphoinositide 3-OH kinase p85alpha and p110beta are essential for androgen receptor transactivation and tumor progression in prostate cancers. Oncogene 27:4569-4579.

396. Deane, J. A., M. J. Trifilo, C. M. Yballe, S. Choi, T. E. Lane, and D. A. Fruman. 2004. Enhanced T cell proliferation in mice lacking the p85beta subunit of phosphoinositide 3-kinase. J Immunol 172:6615-6625.

397. Fukao, T., M. Tanabe, Y. Terauchi, T. Ota, S. Matsuda, T. Asano, T. Kadowaki, T. Takeuchi, and S. Koyasu. 2002. PI3K-mediated negative feedback regulation of IL-12 production in DCs. Nat Immunol 3:875-881.

398. Glassford, J., E. Vigorito, I. Soeiro, P. A. Madureira, G. Zoumpoulidou, J. J. Brosens, M. Turner, and E. W. Lam. 2005. Phosphatidylinositol 3-kinase is required for the transcriptional activation of cyclin D2 in BCR activated primary mouse B lymphocytes. Eur J Immunol 35:2748-2761.

399. Hess, K. L., A. C. Donahue, K. L. Ng, T. I. Moore, J. Oak, and D. A. Fruman. 2004. Frontline: The p85alpha isoform of phosphoinositide 3-kinase is


267

essential for a subset of B cell receptor-initiated signaling responses. Eur J Immunol 34:2968-2976.

400. Lu-Kuo, J. M., D. A. Fruman, D. M. Joyal, L. C. Cantley, and H. R. Katz. 2000. Impaired kit- but not FcepsilonRI-initiated mast cell activation in the absence of phosphoinositide 3-kinase p85alpha gene products. J Biol Chem 275:6022-6029.

401. Piatelli, M. J., C. Wardle, J. Blois, C. Doughty, B. R. Schram, T. L. Rothstein, and T. C. Chiles. 2004. Phosphatidylinositol 3-kinase-dependent mitogen-activated protein/extracellular signal-regulated kinase kinase 1/2 and NF-kappa B signaling pathways are required for B cell antigen receptor-mediated cyclin D2 induction in mature B cells. J Immunol 172:2753-2762.

402. Suzuki, H., S. Matsuda, Y. Terauchi, M. Fujiwara, T. Ohteki, T. Asano, T. W. Behrens, T. Kouro, K. Takatsu, T. Kadowaki, and S. Koyasu. 2003. PI3K and Btk differentially regulate B cell antigen receptor-mediated signal transduction. Nat Immunol 4:280-286.

403. Stephens, L. R., A. Eguinoa, H. Erdjument-Bromage, M. Lui, F. Cooke, J. Coadwell, A. S. Smrcka, M. Thelen, K. Cadwallader, P. Tempst, and P. T. Hawkins. 1997. The G beta gamma sensitivity of a PI3K is dependent upon a tightly associated adaptor, p101. Cell 89:105-114.

404. Voigt, P., C. Brock, B. Nurnberg, and M. Schaefer. 2005. Assigning functional domains within the p101 regulatory subunit of phosphoinositide 3-kinase gamma. J Biol Chem 280:5121-5127.

405. Johnson, C., S. J. Marriott, and L. S. Levy. 2007. Overexpression of p101 activates PI3Kgamma signaling in T cells and contributes to cell survival. Oncogene 26:7049-7057.

406. Fruman, D. A., and L. C. Cantley. 2002. Phosphoinositide 3-kinase in immunological systems. Semin Immunol 14:7-18.

407. Brown, R. A., J. Domin, A. Arcaro, M. D. Waterfield, and P. R. Shepherd. 1999. Insulin activates the alpha isoform of class II phosphoinositide 3-kinase. J Biol Chem 274:14529-14532.

408. Falasca, M., W. E. Hughes, V. Dominguez, G. Sala, F. Fostira, M. Q. Fang, R. Cazzolli, P. R. Shepherd, D. E. James, and T. Maffucci. 2007. The role of phosphoinositide 3-kinase C2alpha in insulin signaling. J Biol Chem 282:28226-28236.

409. Cosemans, J. M., I. C. Munnix, R. Wetzker, R. Heller, S. P. Jackson, and J. W. Heemskerk. 2006. Continuous signaling via PI3K isoforms beta and gamma is required for platelet ADP receptor function in dynamic thrombus stabilization. Blood 108:3045-3052.

410. Gilio, K., I. C. Munnix, P. Mangin, J. M. Cosemans, M. A. Feijge, P. E. van der Meijden, S. Olieslagers, M. B. Chrzanowska-Wodnicka, R. Lillian, S. Schoenwaelder, S. Koyasu, S. O. Sage, S. P. Jackson, and J. W. Heemskerk. 2009. Non-redundant roles of phosphoinositide 3-kinase isoforms alpha and beta in glycoprotein VI-induced platelet signaling and thrombus formation. J Biol Chem 284:33750-33762.

411. Roche, S., J. Downward, P. Raynal, and S. A. Courtneidge. 1998. A function for phosphatidylinositol 3-kinase beta (p85alpha-p110beta) in fibroblasts during mitogenesis: requirement for insulin- and lysophosphatidic acid-mediated signal transduction. Mol Cell Biol 18:7119-7129.


268

412. Tamura, N., K. Hazeki, N. Okazaki, Y. Kametani, H. Murakami, Y. Takaba, Y. Ishikawa, K. Nigorikawa, and O. Hazeki. 2009. Specific role of phosphoinositide 3-kinase p110alpha in the regulation of phagocytosis and pinocytosis in macrophages. Biochem J 423:99-108.

413. Guillermet-Guibert, J., K. Bjorklof, A. Salpekar, C. Gonella, F. Ramadani, A. Bilancio, S. Meek, A. J. Smith, K. Okkenhaug, and B. Vanhaesebroeck. 2008. The p110beta isoform of phosphoinositide 3-kinase signals downstream of G protein-coupled receptors and is functionally redundant with p110gamma. Proc Natl Acad Sci U S A 105:8292-8297.

414. An, H. J., N. H. Cho, H. S. Yang, K. B. Kwak, N. K. Kim, D. Y. Oh, S. W. Lee, H. O. Kim, and J. J. Koh. 2007. Targeted RNA interference of phosphatidylinositol 3-kinase p110-beta induces apoptosis and proliferation arrest in endometrial carcinoma cells. J Pathol 212:161-169.

415. Elis, W., E. Triantafellow, N. M. Wolters, K. R. Sian, G. Caponigro, J. Borawski, L. A. Gaither, L. O. Murphy, P. M. Finan, and J. P. Mackeigan. 2008. Down-regulation of class II phosphoinositide 3-kinase alpha expression below a critical threshold induces apoptotic cell death. Mol Cancer Res 6:614-623.

416. Boller, D., A. Schramm, K. T. Doepfner, T. Shalaby, A. O. von Bueren, A. Eggert, M. A. Grotzer, and A. Arcaro. 2008. Targeting the phosphoinositide 3-kinase isoform p110delta impairs growth and survival in neuroblastoma cells. Clin Cancer Res 14:1172-1181.

417. Byun, D. S., K. Cho, B. K. Ryu, M. G. Lee, J. I. Park, K. S. Chae, H. J. Kim, and S. G. Chi. 2003. Frequent monoallelic deletion of PTEN and its reciprocal associatioin with PIK3CA amplification in gastric carcinoma. Int J Cancer 104:318-327.

418. Fenic, I., K. Steger, C. Gruber, C. Arens, and J. Woenckhaus. 2007. Analysis of PIK3CA and Akt/protein kinase B in head and neck squamous cell carcinoma. Oncol Rep 18:253-259.

419. Liu, Z., P. Hou, M. Ji, H. Guan, K. Studeman, K. Jensen, V. Vasko, A. K. El-Naggar, and M. Xing. 2008. Highly prevalent genetic alterations in receptor tyrosine kinases and phosphatidylinositol 3-kinase/akt and mitogen-activated protein kinase pathways in anaplastic and follicular thyroid cancers. J Clin Endocrinol Metab 93:3106-3116.

420. Ma, Y. Y., S. J. Wei, Y. C. Lin, J. C. Lung, T. C. Chang, J. Whang-Peng, J. M. Liu, D. M. Yang, W. K. Yang, and C. Y. Shen. 2000. PIK3CA as an oncogene in cervical cancer. Oncogene 19:2739-2744.

421. Massion, P. P., P. M. Taflan, Y. Shyr, S. M. Rahman, P. Yildiz, B. Shakthour, M. E. Edgerton, M. Ninan, J. J. Andersen, and A. L. Gonzalez. 2004. Early involvement of the phosphatidylinositol 3-kinase/Akt pathway in lung cancer progression. Am J Respir Crit Care Med 170:1088-1094.

422. Sticht, C., C. Hofele, C. Flechtenmacher, F. X. Bosch, K. Freier, P. Lichter, and S. Joos. 2005. Amplification of Cyclin L1 is associated with lymph node metastases in head and neck squamous cell carcinoma (HNSCC). Br J Cancer 92:770-774.

423. Kang, S., A. Denley, B. Vanhaesebroeck, and P. K. Vogt. 2006. Oncogenic transformation induced by the p110beta, -gamma, and -delta isoforms of class I phosphoinositide 3-kinase. Proc Natl Acad Sci U S A 103:1289-1294.


269

424. Smrcka, A. V., J. R. Hepler, K. O. Brown, and P. C. Sternweis. 1991. Regulation of polyphosphoinositide-specific phospholipase C activity by purified Gq. Science 251:804-807.

425. Hamm, H. E. 1998. The many faces of G protein signaling. J Biol Chem 273:669-672.

426. Murga, C., L. Laguinge, R. Wetzker, A. Cuadrado, and J. S. Gutkind. 1998. Activation of Akt/protein kinase B by G protein-coupled receptors. A role for alpha and beta gamma subunits of heterotrimeric G proteins acting through phosphatidylinositol-3-OH kinasegamma. J Biol Chem 273:19080-19085.

427. Del Prete, A., W. Vermi, E. Dander, K. Otero, L. Barberis, W. Luini, S. Bernasconi, M. Sironi, A. Santoro, C. Garlanda, F. Facchetti, M. P. Wymann, A. Vecchi, E. Hirsch, A. Mantovani, and S. Sozzani. 2004. Defective dendritic cell migration and activation of adaptive immunity in PI3Kgamma-deficient mice. EMBO J 23:3505-3515.

428. Ji, H., F. Rintelen, C. Waltzinger, D. Bertschy Meier, A. Bilancio, W. Pearce, E. Hirsch, M. P. Wymann, T. Ruckle, M. Camps, B. Vanhaesebroeck, K. Okkenhaug, and C. Rommel. 2007. Inactivation of PI3Kgamma and PI3Kdelta distorts T-cell development and causes multiple organ inflammation. Blood 110:2940-2947.

429. Laffargue, M., R. Calvez, P. Finan, A. Trifilieff, M. Barbier, F. Altruda, E. Hirsch, and M. P. Wymann. 2002. Phosphoinositide 3-kinase gamma is an essential amplifier of mast cell function. Immunity 16:441-451.

430. Li, Z., H. Jiang, W. Xie, Z. Zhang, A. V. Smrcka, and D. Wu. 2000. Roles of PLC-beta2 and -beta3 and PI3Kgamma in chemoattractant-mediated signal transduction. Science 287:1046-1049.

431. Naccache, P. H., S. Levasseur, G. Lachance, S. Chakravarti, S. G. Bourgoin, and S. R. McColl. 2000. Stimulation of human neutrophils by chemotactic factors is associated with the activation of phosphatidylinositol 3-kinase gamma. J Biol Chem 275:23636-23641.

432. Reif, K., K. Okkenhaug, T. Sasaki, J. M. Penninger, B. Vanhaesebroeck, and J. G. Cyster. 2004. Cutting edge: differential roles for phosphoinositide 3-kinases, p110gamma and p110delta, in lymphocyte chemotaxis and homing. J Immunol 173:2236-2240.

433. Sasaki, T., J. Irie-Sasaki, R. G. Jones, A. J. Oliveira-dos-Santos, W. L. Stanford, B. Bolon, A. Wakeham, A. Itie, D. Bouchard, I. Kozieradzki, N. Joza, T. W. Mak, P. S. Ohashi, A. Suzuki, and J. M. Penninger. 2000. Function of PI3Kgamma in thymocyte development, T cell activation, and neutrophil migration. Science 287:1040-1046.

434. Saudemont, A., F. Garcon, H. Yadi, M. Roche-Molina, N. Kim, A. Segonds-Pichon, A. Martin-Fontecha, K. Okkenhaug, and F. Colucci. 2009. p110gamma and p110delta isoforms of phosphoinositide 3-kinase differentially regulate natural killer cell migration in health and disease. Proc Natl Acad Sci U S A 106:5795-5800.

435. Barber, D. F., A. Bartolome, C. Hernandez, J. M. Flores, C. Redondo, C. Fernandez-Arias, M. Camps, T. Ruckle, M. K. Schwarz, S. Rodriguez, A. C. Martinez, D. Balomenos, C. Rommel, and A. C. Carrera. 2005. PI3Kgamma inhibition blocks glomerulonephritis and extends lifespan in a mouse model of systemic lupus. Nat Med 11:933-935.


270

436. Gatson, N. N., H. Ji, I. E. Gienapp, F. Song, T. L. Papenfuss, M. Camps, T. Ruckle, J. M. Zimmerer, T. M. Shawler, B. Lu, C. Gerard, A. Kithcart, N. Powell, A. J. Fischer, A. R. Satoskar, C. Rommel, and C. C. Whitacre. 2007. A distinct role for PI3Kgamma in suppressing the development and progression of experimental autoimmune encephalomyelitis (EAE). J Immunol 178.

437. MacDonald, P. E., J. W. Joseph, D. Yau, J. Diao, Z. Asghar, F. Dai, G. Y. Oudit, M. M. Patel, P. H. Backx, and M. B. Wheeler. 2004. Impaired glucose-stimulated insulin secretion, enhanced intraperitoneal insulin tolerance, and increased beta-cell mass in mice lacking the p110gamma isoform of phosphoinositide 3-kinase. Endocrinology 145:4078-4083.

438. Chang, J. D., G. K. Sukhova, P. Libby, E. Schvartz, A. H. Lichtenstein, S. J. Field, C. Kennedy, S. Madhavarapu, J. Luo, D. Wu, and L. C. Cantley. 2007. Deletion of the phosphoinositide 3-kinase p110gamma gene attenuates murine atherosclerosis. Proc Natl Acad Sci U S A 104:8077-8082.

439. Oudit, G. Y., and Z. Kassiri. 2007. Role of PI3 kinase gamma in excitation-contraction coupling and heart disease. Cardiovasc Hematol Disord Drug Targets 7:295-304.

440. Barbi, J., H. E. Cummings, B. Lu, S. Oghumu, T. Ruckle, C. Rommel, W. Lafuse, C. C. Whitacre, and A. R. Satoskar. 2008. PI3Kgamma (PI3Kgamma) is essential for efficient induction of CXCR3 on activated T cells. Blood 112:3048-3051.

441. Jarmin, S. J., R. David, L. Ma, J. G. Chai, H. Dewchand, A. Takesono, A. J. Ridley, K. Okkenhaug, and F. M. Marelli-Berg. 2008. T cell receptor-induced phosphoinositide-3-kinase p110delta activity is required for T cell localization to antigenic tissue in mice. J Clin Invest 118:1154-1164.

442. Matheu, M. P., J. A. Deane, I. Parker, D. A. Fruman, and M. D. Cahalan. 2007. Class IA phosphoinositide 3-kinase modulates basal lymphocyte motility in the lymph node. J Immunol 179:2261-2269.

443. Hanahan, D., and R. A. Weinberg. 2000. The hallmarks of cancer. Cell 100:57-70.

444. Arcaro, A., and A. S. Guerreiro. 2007. The phosphoinositide 3-kinase pathway in human cancer: genetic alterations and therapeutic implications. Curr Genomics 8:271-306.

445. Fresno Vara, J. A., E. Casado, J. de Castro, P. Cejas, C. Belda-Iniesta, and M. Gonzalez-Baron. 2004. PI3K/Akt signalling pathway and cancer. Cancer Treat Rev 30:193-204.

446. Jiang, B. H., and L. Z. Liu. 2008. PI3K/PTEN signaling in tumorigenesis and angiogenesis. Biochim Biophys Acta 1784:150-158.

447. Cornillet-Lefebvre, P., W. Cuccuini, V. Bardet, J. Tamburini, L. Gillot, N. Ifrah, P. Nguyen, F. Dreyfus, P. Mayeux, C. Lacombe, and D. Bouscary. 2006. Constitutive phosphoinositide 3-kinase activation in acute myeloid leukemia is not due to p110delta mutations. Leukemia 20:374-376.

448. Billottet, C., L. Banerjee, B. Vanhaesebroeck, and A. Khwaja. 2009. Inhibition of class I phosphoinositide 3-kinase activity impairs proliferation and triggers apoptosis in acute promyelocytic leukemia without affecting atra-induced differentiation. Cancer Res 69:1027-1036.


271

449. Sawyer, C., J. Sturge, D. C. Bennett, M. J. O'Hare, W. E. Allen, J. Bain, G. E. Jones, and B. Vanhaesebroeck. 2003. Regulation of breast cancer cell chemotaxis by the phosphoinositide 3-kinase p110delta. Cancer Res 63:1667-1675.

450. Denley, A., S. Kang, U. Karst, and P. K. Vogt. 2008. Oncogenic signaling of class I PI3K isoforms. Oncogene 27:2561-2574.

451. Caramori, G., A. Pandit, and A. Papi. 2005. Is there a difference between chronic airway inflammation in chronic severe asthma and chronic obstructive pulmonary disease? Curr Opin Allergy Clin Immunol 5:77-83.

452. Chatham, W. W., R. Swaim, H. Frohsin, Jr., L. W. Heck, E. J. Miller, and W. D. Blackburn, Jr. 1993. Degradation of human articular cartilage by neutrophils in synovial fluid. Arthritis Rheum 36:51-58.

453. Mohr, W., G. Kohler, and D. Wessinghage. 1981. Polymorphonuclear granulocytes in rheumatic tissue destruction. II. Demonstration of PMNs in rheumatoid nodules by electron microscopy. Rheumatol Int 1:21-28.

454. Mohr, W., B. Pelster, and D. Wessinghage. 1984. Polymorphonuclear granulocytes in rheumatic tissue destruction. VI. The occurrence of PMNs in menisci of patients with rheumatoid arthritis. Rheumatol Int 5:39-44.

455. Mohr, W., H. Westerhellweg, and D. Wessinghage. 1981. Polymorphonuclear granulocytes in rheumatic tissue destruction. III. an electron microscopic study of PMNs at the pannus-cartilage junction in rheumatoid arthritis. Ann Rheum Dis 40:396-399.

456. Mohr, W., A. Wild, and H. P. Wolf. 1981. Role of polymorphs in inflammatory cartilage destruction in adjuvant arthritis of rats. Ann Rheum Dis 40:171-176.

457. Nathan, C. 2006. Neutrophils and immunity: challenges and opportunities. Nat Rev Immunol 6:173-182.

458. Lee, K. S., S. J. Park, S. R. Kim, K. H. Min, S. M. Jin, K. D. Puri, and Y. C. Lee. 2006. Phosphoinositide 3-kinase-delta inhibitor reduces vascular permeability in a murine model of asthma. J Allergy Clin Immunol 118:403-409.

459. Nashed, B. F., T. Zhang, M. Al-Alwan, G. Srinivasan, A. J. Halayko, K. Okkenhaug, B. Vanhaesebroeck, K. T. Hayglass, and A. J. Marshall. 2007. Role of the phosphoinositide 3-kinase p110delta in generation of type 2 cytokine responses and allergic airway inflammation. Eur J Immunol 37:416-424.

460. Bradding, P., A. F. Walls, and S. T. Holgate. 2006. The role of the mast cell in the pathophysiology of asthma. J Allergy Clin Immunol 117:1277-1284.

461. Guo, H., A. Samarakoon, B. Vanhaesebroeck, and S. Malarkannan. 2008. The p110 delta of PI3K plays a critical role in NK cell terminal maturation and cytokine/chemokine generation. J Exp Med 205:2419-2435.

462. Kim, N., A. Saudemont, L. Webb, M. Camps, T. Ruckle, E. Hirsch, M. Turner, and F. Colucci. 2007. The p110delta catalytic isoform of PI3K is a key player in NK-cell development and cytokine secretion. Blood 110:3202-3208.

463. Krishnamoorthy, N., T. B. Oriss, M. Paglia, M. Fei, M. Yarlagadda, B. Vanhaesebroeck, A. Ray, and P. Ray. 2008. Activation of c-Kit in dendritic


272

cells regulates T helper cell differentiation and allergic asthma. Nat Med 14:565-573.

464. Patton, D. T., O. A. Garden, W. P. Pearce, L. E. Clough, C. R. Monk, E. Leung, W. C. Rowan, S. Sancho, L. S. Walker, B. Vanhaesebroeck, and K. Okkenhaug. 2006. Cutting edge: the phosphoinositide 3-kinase p110 delta is critical for the function of CD4+CD25+Foxp3+ regulatory T cells. J Immunol 177:6598-6602.

465. Rommel, C., M. Camps, and H. Ji. 2007. PI3K delta and PI3K gamma: partners in crime in inflammation in rheumatoid arthritis and beyond? Nat Rev Immunol 7:191-201.

466. Podbielska, M., and E. L. Hogan. 2009. Molecular and immunogenic features of myelin lipids: incitants or modulators of multiple sclerosis? Mult Scler 15:1011-1029.

467. Pettinelli, C. B., R. B. Fritz, C. H. Chou, and D. E. McFarlin. 1982. Encephalitogenic activity of guinea pig myelin basic protein in the SJL mouse. J Immunol 129:1209-1211.

468. t Hart, B. A., M. van Meurs, H. P. Brok, L. Massacesi, J. Bauer, L. Boon, R. E. Bontrop, and J. D. Laman. 2000. A new primate model for multiple sclerosis in the common marmoset. Immunol Today 21:290-297.

469. Amor, S., J. K. O'Neill, M. M. Morris, R. M. Smith, D. C. Wraith, N. Groome, P. J. Travers, and D. Baker. 1996. Encephalitogenic epitopes of myelin basic protein, proteolipid protein, myelin oligodendrocyte glycoprotein for experimental allergic encephalomyelitis induction in Biozzi ABH (H-2Ag7) mice share an amino acid motif. J Immunol 156:3000-3008.

470. Adelmann, M., J. Wood, I. Benzel, P. Fiori, H. Lassmann, J. M. Matthieu, M. V. Gardinier, K. Dornmair, and C. Linington. 1995. The N-terminal domain of the myelin oligodendrocyte glycoprotein (MOG) induces acute demyelinating experimental autoimmune encephalomyelitis in the Lewis rat. J Neuroimmunol 63:17-27.

471. Brok, H. P., A. Uccelli, N. Kerlero De Rosbo, R. E. Bontrop, L. Roccatagliata, N. G. de Groot, E. Capello, J. D. Laman, K. Nicolay, G. L. Mancardi, A. Ben-Nun, and B. A. Hart. 2000. Myelin/oligodendrocyte glycoprotein-induced autoimmune encephalomyelitis in common marmosets: the encephalitogenic T cell epitope pMOG24-36 is presented by a monomorphic MHC class II molecule. J Immunol 165:1093-1101.

472. Amor, S., D. Baker, N. Groome, and J. L. Turk. 1993. Identification of a major encephalitogenic epitope of proteolipid protein (residues 56-70) for the induction of experimental allergic encephalomyelitis in Biozzi AB/H and nonobese diabetic mice. J Immunol 150:5666-5672.

473. Tuohy, V. K., and D. M. Thomas. 1995. Sequence 104-117 of myelin proteolipid protein is a cryptic encephalitogenic T cell determinant for SJL/J mice. J Neuroimmunol 56:161-170.

474. Kaushansky, N., R. Hemo, M. Eisenstein, and A. Ben-Nun. 2007. OSP/claudin-11-induced EAE in mice is mediated by pathogenic T cells primarily governed by OSP192Y residue of major encephalitogenic region OSP179-207. Eur J Immunol 37:2018-2031.

475. Fontoura, P., P. P. Ho, J. DeVoss, B. Zheng, B. J. Lee, B. A. Kidd, H. Garren, R. A. Sobel, W. H. Robinson, M. Tessier-Lavigne, and L. Steinman. 2004.


273

Immunity to the extracellular domain of Nogo-A modulates experimental autoimmune encephalomyelitis. J Immunol 173:6981-6992.

476. Bettelli, E., M. Pagany, H. L. Weiner, C. Linington, R. A. Sobel, and V. K. Kuchroo. 2003. Myelin oligodendrocyte glycoprotein-specific T cell receptor transgenic mice develop spontaneous autoimmune optic neuritis. J Exp Med 197:1073-1081.

477. Na, S. Y., Y. Cao, C. Toben, L. Nitschke, C. Stadelmann, R. Gold, A. Schimpl, and T. Hunig. 2008. Naive CD8 T-cells initiate spontaneous autoimmunity to a sequestered model antigen of the central nervous system. Brain 131:2353-2365.

478. Waldner, H., M. J. Whitters, R. A. Sobel, M. Collins, and V. K. Kuchroo. 2000. Fulminant spontaneous autoimmunity of the central nervous system in mice transgenic for the myelin proteolipid protein-specific T cell receptor. Proc Natl Acad Sci U S A 97:3412-3417.

479. Lafaille, J. J., K. Nagashima, M. Katsuki, and S. Tonegawa. 1994. High incidence of spontaneous autoimmune encephalomyelitis in immunodeficient anti-myelin basic protein T cell receptor transgenic mice. Cell 78:399-408.

480. Goverman, J., A. Woods, L. Larson, L. P. Weiner, L. Hood, and D. M. Zaller. 1993. Transgenic mice that express a myelin basic protein-specific T cell receptor develop spontaneous autoimmunity. Cell 72:551-560.

481. Geering, B., P. R. Cutillas, G. Nock, S. I. Gharbi, and B. Vanhaesebroeck. 2007. Class IA phosphoinositide 3-kinases are obligate p85-p110 heterodimers. Proc Natl Acad Sci U S A 104:7809-7814.

482. Hu, P., A. Mondino, E. Y. Skolnik, and J. Schlessinger. 1993. Cloning of a novel, ubiquitously expressed human phosphatidylinositol 3-kinase and identification of its binding site on p85. Mol Cell Biol 13:7677-7688.

483. Chantry, D., A. Vojtek, A. Kashishian, D. A. Holtzman, C. Wood, P. W. Gray, J. A. Cooper, and M. F. Hoekstra. 1997. p110delta, a novel phosphatidylinositol 3-kinase catalytic subunit that associates with p85 and is expressed predominantly in leukocytes. J Biol Chem 272:19236-19241.

484. Eickholt, B. J., A. I. Ahmed, M. Davies, E. A. Papakonstanti, W. Pearce, M. L. Starkey, A. Bilancio, A. C. Need, A. J. Smith, S. M. Hall, F. P. Hamers, K. P. Giese, E. J. Bradbury, and B. Vanhaesebroeck. 2007. Control of axonal growth and regeneration of sensory neurons by the p110delta PI 3-kinase. PLoS One 2:e869.

485. Inukai, K., M. Anai, E. Van Breda, T. Hosaka, H. Katagiri, M. Funaki, Y. Fukushima, T. Ogihara, Y. Yazaki, Kikuchi, Y. Oka, and T. Asano. 1996. A novel 55-kDa regulatory subunit for phosphatidylinositol 3-kinase structurally similar to p55PIK Is generated by alternative splicing of the p85alpha gene. J Biol Chem 271:5317-5320.

486. Inukai, K., M. Funaki, T. Ogihara, H. Katagiri, A. Kanda, M. Anai, Y. Fukushima, T. Hosaka, M. Suzuki, B. C. Shin, K. Takata, Y. Yazaki, M. Kikuchi, Y. Oka, and T. Asano. 1997. p85alpha gene generates three isoforms of regulatory subunit for phosphatidylinositol 3-kinase (PI 3-Kinase), p50alpha, p55alpha, and p85alpha, with different PI 3-kinase activity elevating responses to insulin. J Biol Chem 272:7873-7882.

487. Antonetti, D. A., P. Algenstaedt, and C. R. Kahn. 1996. Insulin receptor substrate 1 binds two novel splice variants of the regulatory subunit of


274

phosphatidylinositol 3-kinase in muscle and brain. Mol Cell Biol 16:2195-2203.

488. Fruman, D. A., L. C. Cantley, and C. L. Carpenter. 1996. Structural organization and alternative splicing of the murine phosphoinositide 3-kinase p85 alpha gene. Genomics 37:113-121.

489. Bernstein, H. G., G. Keilhoff, M. Reiser, S. Freese, and R. Wetzker. 1998. Tissue distribution and subcellular localization of a G-protein activated phosphoinositide 3-kinase. An immunohistochemical study. Cell Mol Biol (Noisy-le-grand) 44:973-983.

490. Stoyanov, B., S. Volinia, T. Hanck, I. Rubio, M. Loubtchenkov, D. Malek, S. Stoyanova, B. Vanhaesebroeck, R. Dhand, B. Nurnberg, and et al. 1995. Cloning and characterization of a G protein-activated human phosphoinositide-3 kinase. Science 269:690-693.

491. Zhao, M., B. Song, J. Pu, T. Wada, B. Reid, G. Tai, F. Wang, A. Guo, P. Walczysko, Y. Gu, T. Sasaki, A. Suzuki, J. V. Forrester, H. R. Bourne, P. N. Devreotes, C. D. McCaig, and J. M. Penninger. 2006. Electrical signals control wound healing through phosphatidylinositol-3-OH kinase-gamma and PTEN. Nature 442:457-460.

492. Hallmann, D., K. Trumper, H. Trusheim, K. Ueki, C. R. Kahn, L. C. Cantley, D. A. Fruman, and D. Horsch. 2003. Altered signaling and cell cycle regulation in embryonal stem cells with a disruption of the gene for phosphoinositide 3-kinase regulatory subunit p85alpha. J Biol Chem 278:5099-5108.

493. Ueki, K., D. A. Fruman, S. M. Brachmann, Y. H. Tseng, L. C. Cantley, and C. R. Kahn. 2002. Molecular balance between the regulatory and catalytic subunits of phosphoinositide 3-kinase regulates cell signaling and survival. Mol Cell Biol 22:965-977.

494. Ueki, K., D. A. Fruman, C. M. Yballe, M. Fasshauer, J. Klein, T. Asano, L. C. Cantley, and C. R. Kahn. 2003. Positive and negative roles of p85 alpha and p85 beta regulatory subunits of phosphoinositide 3-kinase in insulin signaling. J Biol Chem 278:48453-48466.

495. Rodriguez-Borlado, L., D. F. Barber, C. Hernandez, M. A. Rodriguez-Marcos, A. Sanchez, E. Hirsch, M. Wymann, A. C. Martinez, and A. C. Carrera. 2003. Phosphatidylinositol 3-kinase regulates the CD4/CD8 T cell differentiation ratio. J Immunol 170:4475-4482.

496. Pilkington, K. R., I. Clark-Lewis, and S. R. McColl. 2004. Inhibition of generation of cytotoxic T lymphocyte activity by a CCL19/macrophage inflammatory protein (MIP)-3beta antagonist. J Biol Chem 279:40276-40282.

497. Thomas, M. L. 1989. The leukocyte common antigen family. Annu Rev Immunol 7:339-369.

498. Campbell, J. J., E. P. Bowman, K. Murphy, K. R. Youngman, M. A. Siani, D. A. Thompson, L. Wu, A. Zlotnik, and E. C. Butcher. 1998. 6-C-kine (SLC), a lymphocyte adhesion-triggering chemokine expressed by high endothelium, is an agonist for the MIP-3beta receptor CCR7. J Cell Biol 141:1053-1059.

499. Forster, R., A. Schubel, D. Breitfeld, E. Kremmer, I. Renner-Muller, E. Wolf, and M. Lipp. 1999. CCR7 coordinates the primary immune response by establishing functional microenvironments in secondary lymphoid organs. Cell 99:23-33.


275

500. Yoshida, R., T. Imai, K. Hieshima, J. Kusuda, M. Baba, M. Kitaura, M. Nishimura, M. Kakizaki, H. Nomiyama, and O. Yoshie. 1997. Molecular cloning of a novel human CC chemokine EBI1-ligand chemokine that is a specific functional ligand for EBI1, CCR7. J Biol Chem 272:13803-13809.

501. Chen, J., B. P. Vistica, H. Takase, D. I. Ham, R. N. Fariss, E. F. Wawrousek, C. C. Chan, J. A. DeMartino, J. M. Farber, and I. Gery. 2004. A unique pattern of up- and down-regulation of chemokine receptor CXCR3 on inflammation-inducing Th1 cells. Eur J Immunol 34:2885-2894.

502. Ebert, L. M., and S. R. McColl. 2002. Up-regulation of CCR5 and CCR6 on distinct subpopulations of antigen-activated CD4+ T lymphocytes. J Immunol 168:65-72.

503. Homey, B., M. C. Dieu-Nosjean, A. Wiesenborn, C. Massacrier, J. J. Pin, E. Oldham, D. Catron, M. E. Buchanan, A. Muller, R. deWaal Malefyt, G. Deng, R. Orozco, T. Ruzicka, P. Lehmann, S. Lebecque, C. Caux, and A. Zlotnik. 2000. Up-regulation of macrophage inflammatory protein-3 alpha/CCL20 and CC chemokine receptor 6 in psoriasis. J Immunol 164:6621-6632.

504. Nakajima, C., T. Mukai, N. Yamaguchi, Y. Morimoto, W. R. Park, M. Iwasaki, P. Gao, S. Ono, H. Fujiwara, and T. Hamaoka. 2002. Induction of the chemokine receptor CXCR3 on TCR-stimulated T cells: dependence on the release from persistent TCR-triggering and requirement for IFN-gamma stimulation. Eur J Immunol 32:1792-1801.

505. Cramer, M., and D. G. Braun. 1975. Immunological memory: stable IgG patterns determine in vivo responsiveness at the clonal level. Scand J Immunol 4:63-70.

506. de Voer, R. M., F. R. van der Klis, C. W. Engels, R. M. Schepp, J. van de Kassteele, E. A. Sanders, G. T. Rijkers, and G. A. Berbers. 2009. Kinetics of antibody responses after primary immunization with meningococcal serogroup C conjugate vaccine or secondary immunization with either conjugate or polysaccharide vaccine in adults. Vaccine 27:6974-6982.

507. Omori, S. A., M. H. Cato, A. Anzelon-Mills, K. D. Puri, M. Shapiro-Shelef, K. Calame, and R. C. Rickert. 2006. Regulation of class-switch recombination and plasma cell differentiation by phosphatidylinositol 3-kinase signaling. Immunity 25:545-557.

508. Moser, B., and P. Loetscher. 2001. Lymphocyte traffic control by chemokines. Nat Immunol 2:123-128.

509. Lobb, R. R., and M. E. Hemler. 1994. The pathophysiologic role of alpha 4 integrins in vivo. J Clin Invest 94:1722-1728.

510. Hansen, S. H., A. Olsson, and J. E. Casanova. 1995. Wortmannin, an inhibitor of phosphoinositide 3-kinase, inhibits transcytosis in polarized epithelial cells. J Biol Chem 270:28425-28432.

511. Joly, M., A. Kazlauskas, and S. Corvera. 1995. Phosphatidylinositol 3-kinase activity is required at a postendocytic step in platelet-derived growth factor receptor trafficking. J Biol Chem 270:13225-13230.

512. Joly, M., A. Kazlauskas, F. S. Fay, and S. Corvera. 1994. Disruption of PDGF receptor trafficking by mutation of its PI-3 kinase binding sites. Science 263:684-687.


276

513. Martinez-Gac, L., B. Alvarez, Z. Garcia, M. Marques, M. Arrizabalaga, and A. C. Carrera. 2004. Phosphoinositide 3-kinase and Forkhead, a switch for cell division. Biochem Soc Trans 32:360-361.

514. Valius, M., and A. Kazlauskas. 1993. Phospholipase C-gamma 1 and phosphatidylinositol 3 kinase are the downstream mediators of the PDGF receptor's mitogenic signal. Cell 73:321-334.

515. Acosta-Rodriguez, E. V., G. Napolitani, A. Lanzavecchia, and F. Sallusto. 2007. Interleukins 1beta and 6 but not transforming growth factor-beta are essential for the differentiation of interleukin 17-producing human T helper cells. Nat Immunol 8:942-949.

516. van Beelen, A. J., Z. Zelinkova, E. W. Taanman-Kueter, F. J. Muller, D. W. Hommes, S. A. Zaat, M. L. Kapsenberg, and E. C. de Jong. 2007. Stimulation of the intracellular bacterial sensor NOD2 programs dendritic cells to promote interleukin-17 production in human memory T cells. Immunity 27:660-669.

517. Wilson, N. J., K. Boniface, J. R. Chan, B. S. McKenzie, W. M. Blumenschein, J. D. Mattson, B. Basham, K. Smith, T. Chen, F. Morel, J. C. Lecron, R. A. Kastelein, D. J. Cua, T. K. McClanahan, E. P. Bowman, and R. de Waal Malefyt. 2007. Development, cytokine profile and function of human interleukin 17-producing helper T cells. Nat Immunol 8:950-957.

518. Nurieva, R., X. O. Yang, G. Martinez, Y. Zhang, A. D. Panopoulos, L. Ma, K. Schluns, Q. Tian, S. S. Watowich, A. M. Jetten, and C. Dong. 2007. Essential autocrine regulation by IL-21 in the generation of inflammatory T cells. Nature 448:480-483.

519. Chen, W., W. Jin, N. Hardegen, K. J. Lei, L. Li, N. Marinos, G. McGrady, and S. M. Wahl. 2003. Conversion of peripheral CD4+CD25- naive T cells to CD4+CD25+ regulatory T cells by TGF-beta induction of transcription factor Foxp3. J Exp Med 198:1875-1886.

520. Luther, S. A., H. L. Tang, P. L. Hyman, A. G. Farr, and J. G. Cyster. 2000. Coexpression of the chemokines ELC and SLC by T zone stromal cells and deletion of the ELC gene in the plt/plt mouse. Proc Natl Acad Sci U S A 97:12694-12699.

��

CHAPTER 8

Appendix

��

CHAPTER 8: Appendix

278

Referee’s Comments and responses

1) p25, last sentence.

Please elaborate a little as to why lack of PTEN leads to diminished containment and

clearance e.g indicate that this is thought to be due to lack of ability to prioritise

movement to relevant chemoattractant cues.

The above sentence should read:

A lack of PTEN leads to diminished bacterial containment and clearance and reduced

neutrophil-mediated arthritic inflammation respectively in these models (307). This

is due to an inability of neutrophils to prioritise movement to relevant

chemoattractant cues without the PTEN-mediated generation of a leading edge at the

cell surface.

2) p27, para 1.

The candidate should state the key pharmacological difference between the modes of

action of wortmannin and Ly294002 e.g covalent irreversible binding of wortmannin

vs competitive/reversible action of Ly294002.

The first paragraph of section ‘1.4.4.1 Pan-PI3K inhibitors’ should read:

Two low-molecular-weight, cell-permeable pan-PI3K inhibitors, Wortmannin and

LY294002, have been commercially available for a number of years and have

enabled many initial studies into the function of PI3Ks (7, 339-343). These reagents

have been important analytical tools for the development of the PI3K field and our

current understanding of PI3K signalling. The chemical structures of Wortmannin

and LY294002 are shown in Figures 1.9A and 1.9B respectively. Wortmannin binds

covalently to PI3Ks whereas LY294002 binds in a competitive/reversible fashion.

Both compounds potently inhibit class I PI3Ks at low concentrations by binding to

the ATP binding pocket in the catalytic domain of the p110 subunits (344, 345).

Wortmannin has a lower IC50 (Wortmannin IC50 = 4.2nM vs. LY294002 IC50 =

1.4μM) whereas LY294002 has a longer half-life and both have been used

successfully, independently or in combination (344). It must be taken in to account

CHAPTER 8: Appendix

279

that both have off-target effects in that they both also inhibit the mammalian target of

rapamycin (mTOR) and DNA-depenndent protein kinase (DNA-PK). Wortmannin

also inhibits ataxia telangiectasiamutated protein (ATM) and type II Proline-rish

domain-containing inositol 5-phosphate kinases (PIPkins) α and β, whilst LY294002

can also inhibit casein kinase-2 (CK-2) (255, 346-350). However, if both

Wortmannin and LY294002 are used at low concentrations (approximately 20-50nM

and 10-100μM respectively) their specificity is largely restricted to PI3Ks.

3) p28, para. 1

Please elaborate a little on how the cited IC50 values for IC87114 were obtained e.g

were the obtained using cell-based assays and if not, whether the values are accurate

reflections of potency in cell-based assays. The IC50 values are a little different to

ones I am familiar with, but the source reference is not immediately clear, so please

clarify source of IC50 values.

The IC50 values mentioned in this paper are taken directly from the cited article (ref.

359: Sadhu, C., B. Masinovsky, K. Dick, C. G. Sowell, and D. E. Staunton. 2003.

Essential role of phosphoinositide 3-kinase delta in neutrophil directional movement.

J Immunol 170:2647-2654). The assay was performed in a cell-free system as

described in the materials and methods section of this article. It is possible that this

method of evaluating the IC50 for the IC87114 compound does not truly reflect the

IC50 values that would be determined in cell-based assays. Despite this, it has been

clearly demonstrated that, at similar concentrations to those used in our study,

IC87114 can inhibit cell proliferation, migration, activation and function and reduce

survival in several different cell types (238, 240, 359, 360, 362-372).

4) p30, para. 2

The candidate may want to cite recent papers concerning the distinct roles for p84

and p101 in mast cells (Bohnacker et al Science Signaling 2 (74) ra 27)

The abovementioned passage should read:

CHAPTER 8: Appendix

280

While there has been a plethora of research focusing on the class IA PI3K regulatory

subunits, there has been less on the class IB regulatory subunits p101 and p84. The

expression of both is limited mostly to cells of the immune system, however p84 is

also expressed in cardiac tissue and has been demonstrated to be important for

kinase-independent p110γ/PDE3B-mediated scaffolding in the heart (267, 270, 403,

404). Both subunits have been implicated in p110γ activation, and p101 over-

expression has been demonstrated to enhance survival of T cells (405) as well as

mast cell motility and activation (521). However, aside from this, very little is known

about the specific function of p110 and p84.

The following reference is added:

521. Bohnacker, T., Marone, R., Collman, E., Calvez, R., Hirsch, E. and Wymann,

M.P. 2009. PI3Kgamma adaptor subunits define coupling to degranulation

and cell motility by distinct PtdIns(3,4,5)P3 pools in mast cells. Sci Signal.

2(74):1-12.

5) p31, last sentence:

Other more relevant references should be included to support the role of PI3K

gamma in T cell activation e.g Alcazar et al J Exp Med 2007 Nov 26; 204 (12):2977-

87.

The abovementioned passage should read: PI3Kγ has also been implicated in the

activation of T cells (252, 440), although its role in this respect is less well-defined.

4) p31, first para:

The candidate states that targeting of p110α and p110β in disease is unlikely to be

therapeutically beneficial. However, several pharmaceutical companies are pursuing

p110alpha as an anti-cancer target, so this statement needs to be revised

accordingly.

The first paragraph of page 31 should read:

CHAPTER 8: Appendix

281

Despite the implication of both p110α and p110β in disease, due to their widespread

expression and involvement in several critical cellular processes it will be difficult to

therapeutically target these proteins without off-target affects. However, several

pharmaceutical companies are currently developing p110α and p110β inhibitors,

presumably with cell/tissue-specific targeting methods, as anti-cancer drugs. While

this is promising, due to the more limited expression and function of the p110δ and

p110γ catalytic PI3K subunits it may be more successful and less complicated to

target these proteins as therapeutics for metastatic cancers and diseases where

immune cells are implicated.

5) p74 and Fig 3.1 p107

On p74 (M&M) and legend for fig 3.1 (p107) the candidate refers to 500bp and

300bp products as denoting the heterozygous p110δD910A/WT mice while mice with

only 500bp product represent the homozygous p110δD910A/D910A mice. However, in the

figure on p107, the annotation indicates differently. Please clarify and correct

accordingly.

The annotation on Figure 3.1A (p107) is incorrect. The band gel lane showing two

bands (one at 500bp and one at 300bp) is representative of the p110δD910A/WT mice

(not the p110δD910A/D910A mice) and the gel lane with only one band at 500bp is

representative of the p110δD910A/D910A mice (not the p110δD910A/WT mice).

6) On p116, I am a little unclear as to what the candidate means by a cumulative

disease score. Please clarify.

The cumulative disease scores were calculated by adding the scores in a cumulative

fashion i.e. day 1 + day 2 + day 3 and so on. Therefore, for example, the ‘cumulative

disease score’ shown at day 20 post-immunisation represents the sum total of the

EAE disease scores from day 1-20.

CHAPTER 8: Appendix

282

7) p121, Fig 3.6

In the immunohistochemistry experiments it is not clear how the candidate defines a

CD45+ lesion e.g in fig 3.6 how many lesions are present in panel A? It would be

useful to indicate individual lesions with arrows as in fig 4.6.

The lesions have been defined as areas where there are >10 CD45+ cells. Areas that

had a large mass of CD45+ cells were counted as one lesion. Arrows on the above

figure indicate areas which were defined as CD45+ lesions.


Day

15

Day

28

A

CHAPTER 8: Appendix

283

8) p141/fig 4.1

The percentage values in panels A and B are markedly higher than in the

representative Facs data e.g in fig 4.1B the histobars indicate that the % CD4+ T

cells that are CCR7 in the p110δD910A/D910A mice is around 80%, yet the

representative data indicated it is only 22%. This is a massive difference and given

the modest error bars, difficult to reconcile. Please comment accordingly /clarify

exact “n” values for each histobar.

The percentage of CD4+ cells that are CCR7+ was calculated as follows:

(x/(x+y))*100

where x = the upper right quadrant (CD4+/CCR7+ cells) and y = the upper left

quadrant (CD4+ cells only)

Therefore, in the case of the abovementioned figure the calculation is as follows:

(22.57/(22.57+4.74))*100 = 82.6%.

n = 6-8 mice per group for these figures.

9) p156, fig 4.9

Please clarify the “typical DC phenotype” used to identify these cells in the legend

and/or materials section.

A ‘typical’ DC was determined by observing the size and surface phenotype of the

cells under a light microscope with trypan blue staining. Large cells with dendrite-

like projections (as opposed to the smaller and smoother immature DCs and

lymphocytes that can be found in such cultures) were considered to be mature DCs.

10) Fig 5.10 and 5.14

The overall percentage of cells responding to CD3/CD28 seems rather low in fig

5.10 compared to fig 5.14. The rationale for exploring the effect of in vivo pre-

treatment of IC87114 under EAE conditions vs ex vivo CD3/CD28-stimulated

proliferation in fig 5.14 is unclear. Would it not be better to study the effect of

IC87114 on ex vivo proliferative responses to MOG peptide under these conditions?

I’m a little unclear as to why in vivo administration of IC87114 under normal

CHAPTER 8: Appendix

284

conditions inhibits ex vivo CD3/CD28 responses in fig 5.10 but not in fig 5.14 after

EAE immunisation? Does this reflect differences in use of splenocytes vs lymph node

T cells in these two experiments?

The data shown in Figures 5.10 and 5.14 were generated from different experiments

performed on different days. It is agreed that there was low levels of proliferation

observed in the experiment presented in Figure 5.10A, however the nature of these

experiments sometimes means that only low levels of proliferation is observed. This

experiment was performed three times with similar results. It has been our

experience that CD3/CD28 does not always generate high levels of naïve CD4+ T

cell proliferation in vitro. The data shown in Figure 5.10 was generated by

stimulating lymphocytes from a naïve mouse with anti-CD3 and anti-CD28

antibodies, whereas lymphocytes isolated from a mouse immunised with MOG and

CFA were used to generate the data shown in Figure 5.14. It is hypothesised that the

immunisation of MOG-CFA results in such a significant activation of the immune

system that this overrides any inhibitory effects of IC87114, which may be why there

were disparate results observed in Figure 5.10 (with naïve cells) and 5.14 (with

activated cells). Future directions on how to address this are discussed in section 6.9

(with a particular focus in section 6.9.3).

As we have had difficulty with simulating T cells with the MOG35-55 peptide ex vivo,

and to be consistent between the two experiments shown in the abovementioned

figures, anti-CD3/anti-CD28 stimulation was used instead.

The reviewer notes that the differences observed may reflect the use of splenocytes

or lymph node cells in the different experiments. It is also possible that this may have

played a role. Naïve mice have very small lymph nodes so splenocytes were used so

that sufficient yields of cells were obtained for the experiments in Figure 5.10. As

mice are immunised with MOG-CFA in the hind flanks and scruff of the neck,

lymphocytes from the inguinal and brachial lymph nodes were used for the

experiment shown in Figure 5.14 as it was assumed that these would be more

activated than splenocytes. It is possible that this difference has influenced the

outcome of these experiments.

CHAPTER 8: Appendix

285

11) p207, fig 5.11

It is not clear why samples were taken on different days post-immunisation. Please

clarify.

The purpose of taking these samples was to ensure that there was good coverage of

the IC87114 compound in the mice throughout the disease course, hence the samples

were taken at different days post-immunisation. Samples were also taken at different

time-points as an added investigation into the half-life of IC87114 in the plasma of

mice. While it would have been ideal to do these studies separately, these results still

demonstrate that even though there are measurable IC87114 levels throughout

disease at 2, 3 and 5 hours post-IC87114 administration, by 12 hours post-

administration there is very little IC87114 detectable in the plasma of mice.

Therefore, mice are presumed to have high levels of bioavailable IC87114 for most

of the time, however it is assumed that the compound is routinely cleared from the

blood of mice before the next dose was received.

12) The discussion is surprisingly short. I would like to see it improved by the

provision of a schematic model(s) to help visualise the candidate’s theories and

interpretation of the data in the context of existing knowledge. The applicant should

consider revising her discussion accordingly.

Please see Figure 6.1 and the corresponding figure legend.

13) ref 468, p272: Remove the “t” typo.

This reference is correct, the authors name is “B.A. ‘t Hart”.

14) There is inconsistence in the use of “p110” and “PI3K” when referring to

catalytic isoforms e.g “p110δ” and “p110γ” etc also referred to as “PI3Kδ” and

“PI3Kγ”. Please be consistent.

CHAPTER 8: Appendix

286

It was the aim of the author to use the term “PI3K” when referring to the

p110/regulatory subunit PI3K heterodimer complex. The “p110δ” terminology was

used when specifically referring to the p110 catalytic subunit.

CHAPTER 8: Appendix

287

Figure 6.1: The role of p110δ in EAE. The pathogenesis of EAE is multifaceted.

This study has indicated that there are several steps in which p110δ may be

important. The p110δ protein was shown not to be important for antigen-uptake by

DCs (A), DC trafficking to the draining lymph nodes (B) or presentation of antigen

to T cells (C). However, p110δ inactivation results in intrinsic defects in T cell

biology that may lead to reduced Th1 differentiation (D) in the lymph nodes as well

as a profound reduction in Th17 cell differentiation (E). Production/secretion of the

cytokines IL-17 and IFN-γ were reduced (F) and apoptosis of CD4+ T cells was

increased without functional p110δ (G). There was a significant reduction in B cell

function which may be a result of inefficient T cell-mediated activation (H) and

apoptosis of B cells was observed to be increased (I). The p110δ protein is involved

in B cell trafficking (J) and may also play a role in trafficking of T cells to the CNS

(K). Animals lacking functional p110δ had fewer CD45+ cells (L), Th17 cells (M), B

cells (N) and macrophages (O) in the CNS. There was no MOG-specific IgG

detectable in p110δ-deficient mice (P). While the function of p110δ in

oligodendrocytes (Q) and microglia (R) has not been addressed, future studies may

elucidate a role for p110δ in microglia function in the CNS as well as remyelination

by oligodendrocytes.

CHAPTER 8: Appendix

288

Naïve T cell Activated Th1 cell

Activated Th17 cell Activated CD8+ T cell

Naïve B cell Plasma cell

Dendritic cell Neuron

Oligodendrocyte

Microglia

Myelin sheath (CNS-specific) antigen

Cytokines/chemokines Macrophage

IFN-γ IL-17

Neutrophil NK cell

Apoptotic T cell Apoptotic B cell

CHAPTER 8: Appendix

289

Skin

Centra

l Nervous S

yste

m

BBB

BBB

Lymph

oid tissue

Dend

ritic

cell

MOG +

CFA

Immunisa

tion

B

H CD4

+ T

cells

E

G

Th17

cells

IL-17

&

IFN-γ

F

A

K

J

Neuron

Plasm

a ce

ll

Neutrop

hil

Cytok

ines/

Chemok

ines

L

Macroph

age

O

M

Oligod

end

rocyte

Q

Microglia

R

NK ce

ll

P

N

Th1 ce

lls

D

C

I A

poptotic

B ce

lls

Apoptotic

T ce

lls

The role of class IA PI3Kδ in - digital.library.adelaide.edu.au · The role of class IA PI3Kδ in experimental autoimmune encephalomyelitis Sarah Haylock-Jacobs, B.Sc. (Biomed. Sci.)

Documents