-
Cellular/Molecular
Schwann Cell LRP1 Regulates Remak Bundle Ultrastructureand
Axonal Interactions to Prevent Neuropathic Pain
Sumihisa Orita,1,5 Kenneth Henry,1 Elisabetta Mantuano,1 Kazuyo
Yamauchi,1,5 Alice De Corato,1,6Tetsuhiro Ishikawa,1,5M. Laura
Feltri,7 LawrenceWrabetz,7 Alban Gaultier,2Melanie Pollack,1Mark
Ellisman,3Kazuhisa Takahashi,5 Steven L. Gonias,2 andW. Marie
Campana1,4Departments of 1Anesthesiology, 2Pathology, and
3Neurosciences, and 4Program in Neurosciences, University of
California, San Diego, La Jolla, California92093, 5Department of
Orthopedic Surgery, Graduate School of Medicine, Chiba University,
2608670 Chiba, Japan, 6Department of Pharmacology,Cattolica
University, 00168 Rome, Italy, and 7Hunter James Kelly Research
Institute, School of Medicine and Biomedical Sciences, State
University of NewYork at Buffalo, Buffalo, New York 14214
Trophic support and myelination of axons by Schwann cells in the
PNS are essential for normal nerve function. Herein, we show
thatdeletionof theLDLreceptor-relatedprotein-1 (LRP1)gene
inSchwanncells (scLRP1/) induces abnormalities in
axonmyelinationandin ensheathmentof
axonsbynonmyelinatingSchwanncells inRemakbundles. These anatomical
changes in thePNSwere associatedwithmechanical allodynia, even in
the absence of nerve injury. In response to crush injury, sciatic
nerves in scLRP1/ mice showedaccelerated degeneration and Schwann
cell death. Remyelinated axons were evident 20 d after crush injury
in control mice, yet werelargely absent in scLRP1/ mice. In the
partial nerve ligation model, scLRP1/ mice demonstrated
significantly increased andsustained mechanical allodynia and loss
of motor function. Evidence for central sensitization in pain
processing included increasedp38MAPK activation and activation of
microglia in the spinal cord. These studies identify LRP1 as an
essential mediator of normalSchwann cellaxonal interactions and as
a pivotal regulator of the Schwann cell response to PNS injury in
vivo. Mice in which LRP1 isdeficient in Schwann cells represent a
model for studying how abnormalities in Schwann cell physiology may
facilitate and sustainchronic pain.
IntroductionSchwann cells originate in the neural crest and
differentiate bytwo alternative pathways. Nonmyelinating Schwann
cells en-sheath multiple small-caliber C-fibers to form Remak
bundles.Schwann cells, which associate with larger axons, segregate
theseaxons and myelinate them at a one-to-one ratio. Schwann
cellax-onal interactions are critical in controlling
thephysiologyofbothcelltypes (Jessen and Mirsky, 1999; Witt and
Brady, 2000). Althoughseveral receptors havebeen implicated in
axonal-Schwanncell inter-actions (Feltri et al., 2002; Taveggia and
Salzer, 2007; Yu et al., 2007),this process remains incompletely
understood.
In injury to the peripheral nervous system (PNS), Schwanncells
are activated andplay a critical role in the programmed seriesof
steps that lead to eventual nerve regeneration (Grinspan et
al.,1996;Meier et al., 1999). Activated Schwann cells at the injury
site
de-differentiate, proliferate, migrate, and participate in
phagocy-tosis of debris (Chen et al., 2007). Extracellular matrix
(ECM)proteins, which are secreted by Schwann cells, assemble into
ascaffold that facilitates axonal regeneration (Bunge and
Pearse,2003; Chen et al., 2007). When the response to PNS injury
isabnormal, as in end-bulb neuroma formation or
denervationhyperalgesia, chronic neuropathic pain may result
(Rogawskiand Loscher, 2004). Chronic neuropathic pain is a highly
preva-lent health problemand there is a profoundneed to identify
noveltargets for therapeutics development (Goldberg and
McGee,2011).
The endocytic, transmembrane receptor, LDL receptor-related
protein (LRP1), is a potent regulator of Schwann cellphysiology in
vitro (Campana et al., 2006a). LRP1 binds diverseproteins produced
in the injured PNS, including proteases suchas MMP-9 and ECM
proteins (Strickland et al., 1990; La Fleur etal., 1996; Akassoglou
et al., 2000; Strickland et al., 2002). Ligand-binding to LRP1
activates prosurvival signaling, including ERK/MAP kinase, the
PI3K-Akt pathway (Campana et al., 2006a;Mantuano et al., 2008).
LRP1 also promotes Schwann cell sur-vival by antagonizing the
unfolded-protein response (Mantuanoet al., 2011). By regulating Rho
family GTPases, LRP1 promotesSchwann cell migration (Mantuano et
al., 2010). Thus, Schwanncell LRP1 expresses multiple activities
that may be important inthe response to PNS injury.
LRP1 gene deletion in the mouse is embryonic-lethal (Herz etal.,
1992), precluding the use of this mouse model system to
Received July 13, 2012; revised Feb. 9, 2013; accepted Feb. 12,
2013.Author contributions: S.O., K.H., E.M., K.Y., A.D., A.G.,
K.T., S.L.G., andW.M.C. designed research; S.O., K.H., E.M.,
K.Y., A.D., T.I., A.G., M.P., and W.M.C. performed research;
F.M.L., L.W., A.G., and M.H.E. contributed
unpublishedreagents/analytic tools; S.O., K.H., E.M., K.Y., A.D.,
T.I., F.M.L., L.W., A.G., M.P., M.H.E., K.T., S.L.G., and
W.M.C.analyzed data; K.H., S.L.G., and W.M.C. wrote the paper.
This work was supported by NINDS Grants R01 NS-057456, R01
NS-054671, P30 NS047101, NCRR5P41RR004050-24,
andNIGMSP41GM103412-24, andby theUeharaMemorial Foundation.Wewould
like to thankDonna Hacelrode, Timo Meerloo, and Ying Jones for
excellent technical assistance.
The authors declare no competing financial
interests.Correspondence should be addressed to Dr. Wendy Campana,
Department of Anesthesiology, University of
California, San Diego, 9500 Gilman Drive, MTF 447, La Jolla, CA
92093-0629. E-mail:
[email protected]:10.1523/JNEUROSCI.3342-12.2013
Copyright 2013 the authors 0270-6474/13/335590-13$15.00/0
5590 The Journal of Neuroscience, March 27, 2013
33(13):55905602
-
characterize Schwann cell LRP1. Furthermore, other cell
typespresent in the injured peripheral nerve, including neurons
andmacrophages, express LRP1 (Lillis et al., 2008). Thus, results
ob-tained using reagents such as receptor-associated protein
(RAP),which antagonize LRP1 in all cell types, may be difficult to
inter-pret. To address this problem, we developed a unique
mousemodel in which LRP1 is deleted under the control of the
P0promoter, which is active selectively in Schwann cells (Feltri et
al.,1999).
Herein, we show that LRP1 gene deletion in Schwann
cells(scLRP1/) affects the structure of uninjured nerve fibers,
in-cluding myelinated fibers and C-fibers in Remak bundles.
Thesechanges are associated with altered pain processing even in
theabsence of injury. LRP1 deficiency in Schwann cells also
substan-tially compromises the response to injury. Accelerated
degen-eration, Schwann cell death, and reduced regeneration
areobserved in association with robust and sustained
neuropathicpain.We conclude that Schwann cell LRP1 is required for
normalSchwann cellaxonal interactions and as a pivotal regulator of
theresponse to PNS injury.
Materials andMethodsAnimals. Transgenic mice carrying LRP1
alleles with LoxP sites, so thatCre-mediated recombination
eliminates part of the promoter and thefirst two exons (LRP1
flox/flox mice), were originally generated by Rohl-mann et al.
(1996). We obtained mice that carry two copies of the floxedLRP1
gene and Cre recombinase expressed under the control of the
Ly-sozymeMpromoter (Overton et al., 2007). Thesemice were
crossedwithC57BL/6mice to regenerate LRP1 flox/flox mice, without
LysM-Cre, in theC57BL/6 genetic background. PCR analysis was
performed on genomicDNA isolated from tail clips (BioPioneer).
Homozygous floxed lrp1 al-leles were identified by a 350bp fragment
amplified by PCR using for-ward 5CATACCCTCTTCAAACCCCTTC3 and
reverse 5GCAAGCTCTCCTGGTCAG-ACC3 primers (Fig. 1). P0-Cre mice, in
which Creis expressed selectively in Schwann cells, were previously
described (Feltriet al., 1999, 2002). For our studies, P0-Cre mice
in the C57BL/6 geneticbackground were crossed with LRP1 flox/flox
mice. Progeny that wereheterozygous for the LRP1 floxed gene and
P0-Cre-positive were bredwithLRP1 flox/flox mice. Approximately 25%
of the resulting pups were ho-mozygous for the LRP1 floxed gene and
P0-Cre-positive, as anticipated fora system in which there is no
embryonic lethality. These mice were bredwith LRP1 flox/flox mice
to generate experimental animals. Male litter-mates that were used
in experiments were LRP1 flox/flox and eitherP0-Cre-positive or
P0-Cre-negative. Hemizygous P0-Cre mice wereidentified by a 492 bp
fragment amplified in PCRs using forward
5CCACCACCTCTCCATTG-CAC3andreverse5GCTGGCCCAAATGTTCGTGG3
primers.Mice that are deficient in Schwann cell LRP1 are
calledscLRP1/mice and littermate controls containing Schwann cell
LRP1are called scLRP1/ mice. All breeding procedures were
performedaccording to the protocols approved by the University of
California, SanDiego Committee on Animal Research, and conform to
NIH Guidelinesfor Animal Use. All mice were housed with a 12 /12 h
light/ dark cyclewith ad libitum access to food and water.Mouse
surgery. In crush injury experiments, mice were anesthetized
with 3% isoflurane (IsoSol, VedCo) and maintained with 2%
isoflurane.An incision was made along the long axis of the femur.
The sciatic nervewas exposed at mid-thigh level by separating the
biceps femoris and thegluteus superficialis and then carefully
cleared of surrounding connectivetissue. The sciatic nerve was
crushed twice for 30 s with flat forceps(Azzouz et al., 1996). The
site of crush injurywasmarkedwith an epineu-ral suture on the
muscle surface. The muscle and skin layers were closedusing 6.0
silk sutures. In partial nerve ligation (PNL; Seltzer
model)studies, adult mice were subjected to PNL of the left sciatic
nerve (Seltzeret al., 1990) under anesthesia using 3% isoflurane
initially, as describedabove. The sciatic nerve was exposed at
mid-thigh level as describedabove. A 9-0 silk suture was inserted
into the nerve with a curved,reversed-cutting mini-needle, and
ligated so that the dorsal one-third to
one-half of the nerve thickness was held within the ligature.
The woundwas closed with a single muscle suture and the skin was
tightly suturedwith 4-0 nylon suture. In sham-operated animals, the
nerve was exposedat mid-thigh level but not ligated. Some animals
received minocycline(Sigma). Minocycline was prepared and dissolved
in sterile water. Micereceived daily intraperitoneal injections (40
mg/kg) for 7 d, with the firstinjection administered 4 h before
surgery. The dosage ofminocyclinewasdetermined based on the
previous reports regarding the therapeutic ef-ficacy of minocycline
(Ledeboer et al., 2005).Motor and sensory function. Male mice were
randomized and accli-
mated to the test chamber for 1 h before performing behavioral
tests.Baseline thresholds were obtained for 3 d before surgery.
Following sur-gery, tests were performed every day until death.
Mechanical allodyniawas assessed by probing the hindpaw with
non-noxious graded stimuli
Figure 1. LRP1 inactivation in Schwann cells. A, Double-label
immunofluorescence micros-copy of LRP1 (green) in an adult
myelinated sciatic nerve fiber. Nuclei are identified with
DAPI(blue). Note some residual LRP1 immunoreactivity in axoplasm of
scLRP1/ nerves not as-sociated with Schwann cells. Images represent
n 4mice/group. Scale bar, 4m. B, Quanti-fication of LRP1
immunoreactive Schwann cells and axons in uninjured sciatic
nerves.Immunoreactive cells were counted in 4 separate sections
from eachmouse (*p 0.01; n 4mice/group). C, Immunofluorescence
microscopy of LRP1 (red) in DRGs. Note similar intensityand
distribution of immunoreactivity in DRG neuron cell bodies. Nuclei
are identified with DAPI(blue). Scale bar, 45m.
Orita et al. LRP1 and Axon-Schwann Cell Interactions in PNS J.
Neurosci., March 27, 2013 33(13):55905602 5591
-
(von Frey filaments ranging from 0.008 to 6 g of force) applied
perpen-dicularly to the plantar surface of the paw (between the
footpads)through wire-mesh observation cages. The paw withdrawal
threshold(PWT) was determined by sequentially increasing and
decreasing thestimulus strength and analyzingwithdrawal data using
aDixon nonpara-metric test (Dixon, 1980), as described by Chaplan
et al. (1994). Motortesting was performed using a rotarod. Mice
were randomized andplaced on a rotating cylinder that accelerated
from 4 to 40 rotations perminute (rpm) over 5 min (Ugo Basile).
Mice were allowed to remain onthe cylinder for amaximumof 700 s and
the time to failure wasmeasuredin different trials (two trials with
four replicates per day). Any miceremaining on the apparatus after
700 s were removed and their timeswere scored as 700 s (Bolis et
al., 2005). In all behavior studies, experi-mentalists were blinded
to group identity.TUNEL staining. TUNEL assays were performed as
described by Grin-
span et al. (1996), with a few modifications. Briefly, adult
sciatic nervesimmediately distal to injury sites (3 mm) were
dissected, fixed in 4%paraformaldehyde in PBS for 2 h, and then
cryopreserved. Cryosectionswere prepared and mounted on glass
slides. TUNEL-staining was per-formed using the ApopTag Fluorescein
in situ Apoptosis Detection Kit(Millipore). Labeled sections were
mounted with coverslips using Pro-long Gold and nuclei were
counterstained by DAPI. Images were cap-tured on a Leica DM IRE2
fluorescent microscope.Immunoblot analysis. Immunoblot analysis was
performed as previ-
ously described (Campana et al., 2006a; Mantuano et al., 2008).
Briefly,extracts of sciatic nerve 3 mm distal from an injury site
and spinal dorsalhorn (ipsilateral and contralateral from the L4L6
lumbar enlargement)were prepared in RIPA buffer. The protein
content of each extract wasdetermined by bicinchoninic acid (BCA)
assay. An equivalent amount ofprotein (20 g per lane) was subjected
to 10% SDS-PAGE and electro-transferred to nitrocellulose
membranes. Blots were blocked with 5%nonfat dry milk in Tris-HCl
buffered saline, pH 7.4, with Tween 20 andsubsequently incubated
with primary polyclonal antibodies to cleavedcaspase-3 (1:500; Cell
Signaling Technology), LRP1 (1:1000; C-terminal,Sigma), phospho-p38
MAPK, total-p38 MAPK (1:1000; Cell SignalingTechnology), myelin
basic protein (MBP, 1:1000; Abcam), or monoclo-nal antibody
to-actin (1:2000; Sigma) overnight at 4C. Antibody bind-ing was
detected by HRP-conjugated species-specific secondaryantibodies
(1:2000; Cell Signaling Technology) followed by
enhancedchemiluminescence (GE Healthcare). Blots were scanned
(Canoscan)and densitometry was performed using ImageJ
software.Immunofluorescence microscopy and
immunohistochemistry.Mice were
anesthetized with 3% isoflurane (IsoSol; VedCo) and subjected to
intra-cardiac perfusion with fresh 4% paraformaldehyde in 0.1 M
sodiumphosphate buffer. Tissue (sciatic nerve, DRGs) was dissected,
cryopro-tected, and cut into 1020 m sections. Spinal cord tissue
from thelumbar region (L4L6) was sectioned as transverse
free-floating spinalsections (35m). Aminimumof four sections per
animal were analyzed.Nonspecific binding sites were blocked with
10% goat or horse-serum in0.1% Triton X-100 and PBS for 60 min at
room temperature, and thenincubated with primary antibodies diluted
in blocking solution over-night at 4C. The following primary
antibodies were used: LRP1 (C-terminal) (Sigma-Aldrich, 1:1000); P0
(Millipore, 1:100); p-p38 MAPK(Cell Signaling Technology, 1:200);
OX-42 (Serotec, 1:800); and IgG atappropriate matched dilution.
Tissue was washed in PBS and incubatedwith the appropriate
fluorescent secondary antibodies (Alexa Fluor 488- or594-conjugated
antibodies, 1:1000; Invitrogen) for 1h at roomtemperature.For
dual-labeling studies, a second set of primary and secondary
antibodieswas added. Preparations were mounted on slides using
Pro-long Gold withDAPI for nuclear labeling (Invitrogen). Images
were captured on an Olym-pus Fluoview1000 confocal microscope.
In some cases, nerves were processed for paraffin embedding as
de-scribed previously (Campana and Myers, 2001; Mantuano et al.,
2011).Nerve sections were cut (4m) and incubatedwith Tris-EDTA
(VentanaDiscovery Ultra Medical Systems) for 4 min and 8 min cycles
at 95C.Three sections from each nerve were sampled. Nonspecific
binding wasblocked with 10% nonfat milk. Primary antibodies (S100
andMBP;Mil-lipore)were subsequently incubated in antibody diluent
(Dako) for 1 h at22C. Next, sections were incubated with anti-mouse
antibodies conju-
gated toHRP (VentanaDiscoveryUltraMedical Systems) and
developedwith 33 diaminobenzidine (DAB). Some sections were treated
with sec-ondary antibody only, as a control. Imaging was performed
using a LeicaDCF2500 microscope with Leica Imaging Software 2.8.1
(LeicaMicrosystems).Quantitative analysis of S100-positive Schwann
cells. The number of
S100-positive cells was determined in the mouse sciatic nerve 1
d aftercrush lesion. Countingwas performed 3mmdistal to the crush
injury siteand in the contralateral (nonlesioned) nerve. S100
immunostaining waslocated in Schwann cell cytoplasm and only
S100-positive cytoplasm increscentswas counted. Countingwas
performedusing a lightmicroscope(Leitz Wetzlar Dialux 20) with the
40 objective and an ocular gridcontaining 10 10 squares. One square
was 25 25 m (625 m2).Counting of S100 Schwann cells in the distal
nerve sections was per-formed in a total of 20 squares per section,
representing 10% of thetotal nerve bundle area.Transmission
electron microscopy. Sciatic nerves from scLRP1/ and
littermate control mice were processed for plastic embedding as
de-scribed previously (Campana et al., 2006b). Glutaraldehyde
(2.5%)/0.1 Msodium phosphate, 150 mM NaCl, pH 7.4 (Fixation
Buffer), was applieddirectly onto mouse sciatic nerves before
removal. Resected tissue wasfurther incubated in Fixation Buffer
for an additional 72 h at 4C,washed, chilled in 0.1 M Cacodylate
Buffer, pH 7.4, and then secondarilyfixed in 1% Osmium Tetroxide/CB
for 30 min. Sciatic nerve sampleswere further washed and then
dehydrated in serially increasing concen-trations of ethanol.
Specimens were embedded in Durcupan resin(Sigma-Aldrich). Semithin
sections (5060 nm) were applied to coppergrids (300 mesh). The
grids were viewed using a Tecnai G2 Spirit BioT-WIN transmission
electron microscope (TEM) equipped with an Eagle4k HS digital
camera (FEI) or with a JOEL FX1200 Transmission Elec-tron
Microscope.Quantitative TEM analysis. Ultrathin sections (5060 nm)
of sciatic
nerve were used to count myelinated nerve fibers and Remak
bundles inscLRP1/ and scLRP1/ mice. Nerves were imaged at 1900.
My-elinated fibers, C-fibers and Remak bundles were counted in a
500 m2
surface area using OpenLab software (Improvision). The number of
my-elinating and nonmyelinating Schwann cells is presented as the
averageper cross-section. For g ratios, mean axonal and fiber (axon
includingmyelin sheath) diameters were measured. The g ratio was
determined bydividing the mean axon diameter by the mean fiber
diameter. Myelinarea was determined by subtracting the axonal area
from the total fiberarea. Approximately 100120 nerve fibers were
counted from three in-dividual animals per genotype. Axon diameters
from both genotypeswere divided into three groups: 03, 3.16, and
6.1 m, and the fre-quency of g ratio was recorded and averaged for
each group. The criteriaused for defining abnormal nonmyelinating
Schwann cells was (1) thepresence of an axon greater than 2 m in
the Remak bundle and (2)lack of Schwann cell cytoplasm between
axons so that multiple axons arewithin one cytoplasmic
domain.Statistical analysis. Behavioral and functional data are
presented as the
mean SEM. Results were analyzed by repeated-measures ANOVA
andScheffes post hoc test. For quantitative immunohistochemistry
andTEM, immunoblotting, and qPCR data, we performed a one-wayANOVA
followed by a Tukeys post hoc test when more than two groupsof
results were compared. A Students t test was used when two
groupswere compared. For nonparametric data, a KolmogorovSmirnov
testwas used to measure and compare frequency distributions. In all
statis-tical analysis, a significance criterion of p 0.05 was
used.
ResultsTargeted disruption of LRP1 in Schwann cellsMice
harboring loxP recognition sites in the LRP1 gene(Rohlmann et al.,
1996) were crossed with mice in which Crerecombinase is expressed
under the control of the P0 promoter(Feltri et al., 1999). The P0
promoter becomes active specificallyin Schwann cell precursors at
embryonic day 13.514.5, includ-ing cells that develop into
myelinating and nonmyelinatingSchwann cells; the P0 promoter is
inactive in other glial cells and
5592 J. Neurosci., March 27, 2013 33(13):55905602 Orita et al.
LRP1 and Axon-Schwann Cell Interactions in PNS
-
dorsal root ganglion neurons (Feltri et al., 1999, 2002). Mice
thatare homozygous for the LRP1floxed gene and carry the
P0-Crerecombinase transgene (scLRP1/) were grossly normal.
Theseanimals were fertile and born at the expected Mendelian
fre-quency, without evidence for embryonic lethality. Adult
micewere the same size and weight as mice that were homozygous
forthe LRP1floxed gene and negative for P0-Cre (scLRP1/). Gaitand
motor function were qualitatively intact, and there was noevidence
of overt neurological abnormalities.
scLRP1/ and scLRP1/ mice were killed at 10 weeks.mRNA was
harvested from uninjured sciatic nerves. LRP1mRNA levels were
determined by qPCR (n 8 mice/group).LRP1mRNAwas reduced by 52 5% in
nerves from scLRP1/
mice, compared with nerves isolated from scLRP1/mice (p0.01),
suggesting that the LRP1 gene was indeed deleted in asubpopulation
of cells present in the sciatic nerve. Immunofluo-rescence
microscopy, using antibody specific for LRP1, showedloss of antigen
(green fluorescence) in association with the nucle-ated cytoplasmic
crescents of myelinating Schwann cells inscLRP1/ mice (Fig. 1A).
Axonal immunoreactivity was stillobserved in sections of nerve from
scLRP1/ mice, as antici-pated (Campana et al., 2006a). By visual
examination,95% ofthe myelinating Schwann cells were
LRP1-immunonegative inscLRP1/mice, comparedwith Schwann cells from
scLRP1/
mice, which were uniformly LRP1-immunopositive (Fig. 1B). Asa
further control, we examined dorsal root ganglia (DRGs) fromscLRP1/
and scLRP1/mice. LRP1 was detected in the neu-ronal cell bodies in
DRGs of control animals, as previously re-ported (Shi et al.,
2009). Conditional LRP1 gene deletion inSchwann cells did not
affect LRP1 expression in DRG neuronalcell bodies (Fig. 1C).
LRP1 gene deletion in Schwann cells affects the phenotype
ofmyelinating and nonmyelinating cellsNonlesioned sciatic nerves
were examined histologically by pre-paring semithin plastic
sections, which were stained with meth-ylene blue/Azure II. By
light microscopy, the morphology of thesciatic nerves from
scLRP1/mice appeared normal (Fig. 2A).Axons of various diameters
were present at proportions that ap-peared similar to those
observed in scLRP1/ mice. The num-ber ofmyelinated axons per field
(500m2) was not significantlydifferent in scLRP1/ (19 1) compared
with scLRP1/
(21 2) mice.When uninjured sciatic nerves from scLRP1/ mice
were
examined by TEM, we noticed that the thickness of the
myelinsurrounding many axons appeared decreased (Fig. 2A). To
ex-plore this observation, we selected, at random, 47
myelinatedaxons from scLRP1/mice, with diameters ranging from
3.16m, and 48 equivalently sized axons from scLRP1/ nerves.Axonal
andmyelin areas were determined. Themean axonal areafor the cohort
of axons from scLRP1/ mice was actuallyslightly greater than that
of the wild-type cohort. Nevertheless,the mean myelin area for the
cohort of axons from scLRP1/
nerves was significantly decreased (p 0.01; Fig. 2B).Next, we
conducted a more comprehensive analysis of TEM
images, calculating g ratios, which report mean axonal
diametersdivided bymean fiber diameters. Figure 2C shows that the g
ratiosappeared increased in nerves from scLRP1/ mice across
thecontinuum of axon size (p 0.05; KolmogorovSmirnov). Weconfirmed
this observation by applying statistical analysis to
axonpopulations thatwere stratified according to size. For axons
rang-ing from 0 to 3 m, the g ratios were 0.54 0.02 for scLRP1/
mice and 0.64 0.02 for scLRP1/ mice (mean SEM, p 0.001). For
axons ranging from3 to 6m, the g ratioswere 0.580.01 for scLRP1/
nerves and 0.68 0.01 for scLRP1/ nerves(p 0.001). For axons ranging
from 6 to 8 m, the g ratios were0.62 0.01 for scLRP1/nerves and
0.72 0.02 for scLRP1/
nerves (p 0.001).In normal peripheral nerves, nonmyelinating
Schwann cells
ensheath multiple small pain transmitting axons (C-fibers)
toform Remak bundles. Figure 3A shows TEM images of Remakbundles
from scLRP1/ and scLRP1/ mice. In scLRP1/
mice, C-fibers ensheathed by nonmyelinating Schwann cells
werewell organized and of normal size (1.2 m). Distinct Schwanncell
cytoplasm separated each individual axon. In contrast, nervesfrom
scLRP1/ mice had axons in Remak bundles that ap-peared abnormally
shaped and ensheathed (Fig. 3B). The per-centage of axons that was
2 m in diameter was significantlyincreased (p 0.01) and the
percentage of axons that appeared
Figure2. Effects of LRP1deletionon the structure ofmyelinating
Schwann cells.A, Semithintransverse sections of uninjured sciatic
nerves from scLRP1/ and scLRP1/ mice werestained with methylene
blue/Azure II. Scale bar, 12m. B, TEM analysis of a myelinated
axonand quantification of axon andmyelin area in scLRP1/ or scLRP1/
sciatic nerves (*p0.05 compared with scLRP1/ nerve). Scale bar, 3.0
m. C, Scatter plots of g ratio versusaxon diameter for myelinated
axons from scLRP1/ and scLRP1/ mice (n 100120axons/genotype).
Higher g ratios were observed in scLRP1/ nerves compared
withscLRP1/ (**p 0.01).
Orita et al. LRP1 and Axon-Schwann Cell Interactions in PNS J.
Neurosci., March 27, 2013 33(13):55905602 5593
-
improperly separated from neighboring axons by Schwann
cellcytoplasm was also significantly increased (p 0.01). The
den-sity of nonmyelinating Schwann cells in nerve sections
fromscLRP1/ mice (5.1 0.5 per 500 m2 field) was not signifi-
cantly changed compared with littermate control mice (5.5 0.8per
500 m2); however, we observed a significant increase in thenumber
of Remak bundles containing21 axons in scLRP1/
mice (p 0.05; Fig. 3C). Collectively, these findings suggest
thatthere are abnormalities in Schwann cellaxonal interactions,
inscLRP1/ mice, involving myelinating and nonmyelinatingSchwann
cells.
Given the abnormalities observed in Schwann cellaxonal
ul-trastructure in uninjured scLRP1/mice, we performed
evokedsensory and motor testing experiments. Mechanical
allodyniawasmeasured by non-noxious probing of the hindpaw using
vonFrey filaments in adult mice. A significant reduction in
sensorythreshold was observed in scLRP1/mice (1.3 0.15 g),
com-pared with 2.3 0.3 g in scLRP1/ mice, which indicates thatthese
scLRP1/mice have mechanical allodynia in the absenceof injury (p
0.05; see Fig. 8). Motor function was measured byRotarod testing.
No change in motor function was evident(108 3 s in scLRP1 /mice and
107 4 in scLRP1/mice;and see Fig. 8).
Nerve degeneration is accelerated after injury inscLRP1/miceTo
determine whether LRP1 deficiency in Schwann cells affectsthe
response to injury, sciatic nerves were crush-injured inscLRP1/ and
scLRP1/ mice. Distal nerve sections (3 mmfrom the crush injury
site) were examined by immunohisto-chemistry (IHC), using an
antibody that detects MBP. We choseto imageMBP to highlightmyelin
structure. In uninjured nerves,MBP immunoreactivity was relatively
similar in both genotypes(Fig. 4A,B). The immunostain clearly
demarcated intact myelin-ated axons of variable size.
One day after crush injury, nerves from scLRP1/ miceshowed
profound loss of MBP immunoreactivity, reflecting de-generation of
myelin sheaths, together with large areas of edemaand apparent loss
of nerve fiber architecture (Fig. 4D). In thecontrol scLRP1/ mice,
1 d after crush injury, the structure ofthe nerve remained more
intact (Fig. 4C), suggesting that degen-eration was accelerated in
scLRP1/mice. Five days after crushinjury, degeneration of myelin
sheath structure was still moreadvanced in scLRP1/mice; however, at
this time point, nervedegeneration was obvious in the control
scLRP1/mice as well(Fig. 4E,F).
To confirm the results of our IHC studies, we performed
im-munoblotting experiments to detect MBP. In uninjured
(con-tralateral) nerves, we did not detect significant differences
in thetotal level of MBP, despite the ultrastructural changes in
myelinsheaths in nerves from scLRP1/ mice observed by TEM
(Fig.4G,H). There are many possible explanations for this
result,including a change in the composition of PNS myelin
inscLRP1/ mice; however, the major focus of this experimentwas to
confirm more rapid degradation of myelin following in-jury in
scLRP1/ mice. Five days after nerve injury, when de-generation was
apparent in control nerves, the level of MBP wassignificantly
decreased in nerve extracts from scLRP1/ mice.We interpret these
IHC and immunoblotting results to indicatemore rapid and robust
degeneration of myelin in crush-injurednerves from scLRP1/ mice.
When immunoblots were per-formed using equivalent amounts of
extracted sciatic nerve pro-tein, -neuronal tubulin was not
significantly decreased 5 d aftercrush-injury in nerves from
scLRP1/ and scLRP1/ mice,
Figure 3. LRP1 deletion in Schwann cells alters Remak bundle
properties. A, TEM of transversethin sections of sciatic nerves
from scLRP1/ and scLRP1/mice. Asterisks identify axonswith2m
diameter. Thick arrows demarcate areas in which the amount of
Schwann cell cytoplasmbetween axons is decreased/absent. B,
Quantification of abnormal Remak bundles per surface area(500m2) in
scLRP1/ and scLRP1/mice. Abnormal Remakbundles are defined as (and
seeMaterial andMethods): (1) thepresenceofaxonsgreater
than2mintheRemakbundle; and (2)lack of Schwann cell
cytoplasmbetween individual axons so thatmultiple axons arewithin
one cyto-plasmic domain. Abnormal Remak bundles were counted and
expressed as a percentage of totalnumber of Remakbundles. Data are
presented as themean SEM (**p 0.01). C, The number ofRemakbundles
per surface area (500m2) in scLRP1/ and scLRP1/ sciatic nerves in
eachoffour categorieswas counted. Categories are distinguished by
the number of ensheathed axons. Datarepresent themean SEM for
4mice/genotype (*p 0.05 comparedwith littermate controls).
5594 J. Neurosci., March 27, 2013 33(13):55905602 Orita et al.
LRP1 and Axon-Schwann Cell Interactions in PNS
-
suggesting that axonal cytoskeleton does not degenerate at
thesame rate as myelin in crush-injured nerves.
Schwann cell survival is compromised after nerve injury invivo
by LRP1 deficiencyIn Schwann cells, LRP1 functions as a
cell-signaling receptor,activating prosurvival pathways and
antagonizing endoplasmicreticulum stress signaling (Campana et al.,
2006a; Mantuano etal., 2011). To identify pathways that may be
responsible for theaccelerated degeneration of crush-injured
sciatic nerves inscLRP1/ mice, we performed TUNEL-labeling
experiments.In control, uninjured contralateral nerves,
TUNEL-positive cellswere rare in both scLRP1/ and scLRP1/ mice
(Fig. 5A,B).Following crush injury, TUNEL positivity increased
selectively inscLRP1/ nerves (Fig. 5C,D). TUNEL positivity was
detected in36 9% of the DAPI-labeled cells in injured nerves
fromscLRP1/ mice, compared with 3% in injured nerves
fromscLRP1/mice (p 0.05).
Next, we testedwhether apoptotic cell signaling is increased
inscLRP1/ nerves compared with scLRP1/ nerves. Nerve ex-
tracts were isolated 1 d after crush injury and subjected to
immu-noblot analysis. The total level of LRP1 (85 kDa light chain)
wasdecreased in scLRP1/mice (Fig. 5E). This was anticipated
be-cause, after nerve injury, LRP1 expression in axons rapidly
de-clines and Schwann cells are responsible for an increased
fractionof total LRP1 in the nerve (Campana et al., 2006a).
Cleavedcaspase-3 was significantly increased in sciatic nerves
fromscLRP1/ mice, providing further evidence that LRP1 defi-ciency
in Schwann cells compromises cell viability after nerveinjury.
We subjected our immunoblotting results to densitometry
anal-ysis with standardization against -actin (Fig. 5F). LRP1 light
chainwas significantlydecreased in injured sciaticnerves
fromscLRP1/
mice (p 0.05) and cleaved caspase-3 was significantly
increased
Figure 4. Degeneration is accelerated following crush injury of
sciatic nerves in scLRP1/
mice. Immunohistochemistry ofMBP in sciatic nerves
fromscLRP1/and scLRP1/mice isshown inuninjured sciatic nerves
(A,B); in distal nerve sections (C,D; 3mmdistal fromthe crushsite)
recovered 1 d after injury; and distal nerve sections (E, F )
recovered 5 d after injury. Scalebar, 25m. Note the loss of MBP and
accelerated degeneration in injured scLRP1/ nerves.Images are
representative of those obtainedwith 4mice per group.G, MBPwas
determined byimmunoblot analysis in extracts on nerves isolated 5 d
after nerve injury. H, Quantification ofMBP ratios by densitometry
5 d after sciatic nerve crush injury. Data represent themean SEMfor
4 mice/genotype (*p 0.05 compared with littermate controls).
Figure 5. Schwann cell viability is compromised in scLRP1/ mice.
AD, Sections ofcrush-injured and control, contralateral sciatic
nerves were analyzed by TUNEL-staining(green). Nuclei are stained
blue with DAPI. Images are representative of those observed with
3mice/cohort. Scale bar, 15m. E, Immunoblot analysis of LRP1 (85
kDa) and cleaved caspase-3in sciatic nerve distal to a crush injury
site. Nerves were isolated 1 d after injury. Equal amountsof nerve
protein (30 g) were loaded in each lane and subjected to SDS-PAGE.
-Actin wasmeasured as a loading control. Each lane represents an
individual animal (n 3/group). F,Quantification of LRP1 in sciatic
nerve and cleaved caspase-3 by densitometry. Quantification ofLRP1
in spinal cord by densitometry. Data are expressed as mean SEM (*p
0.05).
Orita et al. LRP1 and Axon-Schwann Cell Interactions in PNS J.
Neurosci., March 27, 2013 33(13):55905602 5595
-
(p 0.05). As a control, we showed that LRP1 was not regulated
inspinal cords isolated from scLRP1/ animals.
To further test the hypothesis that LRP1 deficiency inSchwann
cells compromises cell viability after nerve injury, wesubjected
sections of sciatic nerve to S100 IHC. S100 is a welldefined
Schwann cell marker (Jessen and Mirsky, 2005). Inuninjured nerves
from scLRP1/ and scLRP1/ mice, theIHC images were similar.
Representative low-magnificationand high-magnification images of
scLRP1/ nerves areshown in Figure 6, A and B, respectively. One day
after crush-injury, activated Schwann cells with plump, robustly
S100-immunopositive cytoplasmic crescents were abundant innerves
from scLRP1/ mice (Fig. 6C,D). In nerves fromscLRP1/ mice,
activated Schwann cells were more difficultto identify (Fig. 6E,F).
Interestingly, the residual Schwanncells in these nerves
demonstrated contracted cytoplasm orappeared degenerated (see F ).
Large areas devoid of immuno-stain suggested extensive nerve edema.
We quantitated the
number of S100-immunopositive Schwann cell crescents
anddemonstrated a significant decrease in crescents in
injurednerves from scLRP1/mice (p 0.01; Fig. 6G). The numberof
Schwann cell crescents was not decreased in contralateral,uninjured
nerves.
Schwann cells are known to be essential for peripheral
nerveregeneration (Ide, 1996). Because Schwann cell survival is
com-promised in scLRP1/ mice, we subjected scLRP1/ andscLRP1/mice
to crush injury and studied recovered nerves byTEM, 20 d after
injury. Myelinated axons were evident in nervesisolated from
scLRP1/mice (Fig. 6H). Because axonal deteri-oration downstreamof
crush injury sites is typically complete, weinterpreted the
presence of myelinated axons 20 d after injuryas evidence of nerve
regeneration. By contrast, sections ofscLRP1/ nerves showed no
evidence of successfully remyeli-nated axons. Instead,
degeneratedmyelin swirls, electron-opaquestructures resembling
vacuoles, and numerous onion bulb for-mations, which form from
layers of Schwann cell cytoplasm,werepresent, suggestive of failed
regeneration (Thomas, 1970; Oharaand Ikuta, 1988).
scLRP1/mice develop severe and sustainedneuropathic painThe
relationship between abnormal Schwann cellaxonal inter-actions,
demyelination, and pain has been previously reported(Fujita et al.,
2007; Ueda, 2008). Thus, we hypothesized that ab-normal Schwann
cellaxonal interactions in scLRP1/ micewould result in altered pain
responses following injury. To testthis hypothesis, mice were
subjected to PNL, which is a well es-tablished neuropathic
painmodel (Shir and Seltzer, 1990). In thismodel system, one-third
to one-half of the sciatic nerve is ligated.Heterogeneity in damage
to different areas of a single nerve isapparent in semithin
sections of nerve from scLRP1/ andscLRP/ mice, isolated 20 d after
PNL and stained with meth-ylene blue/Azure II (Fig. 7A,B). When the
most highly damagedareas of the nerves were examined at high power,
some of themajor observations from the crush injury model system
wereconserved. In these areas of scLRP1/ nerves, degenerating
ax-ons and inflammatory cells were abundant. Similar areas fromthe
nerves of scLRP1/ mice showed substantial evidence ofregeneration,
including thinly myelinated axons with small di-ameters (Fig.
7C,D). The myelinated axons are most likely axonscoming through or
around surgical ligations. These differencesalso were apparent by
TEM (Fig. 7E,F). The onion bulb forma-tions in sections of nerve
from scLRP1/ mice, subjected toPNL 20 d before nerve harvest,
provide suggestive evidence forfailed regeneration (Thomas,
1970).
To confirm that the abundance of myelinated fibers is de-creased
in scLRP1/ mice, we performed immunoblotting ex-periments to detect
MBP in sciatic nerves 20 d after PNL (Fig.7G).MBP levels were not
significantly different in uninjured con-tralateral nerves isolated
from scLRP1/ and scLRP1/mice,confirming the results shown in Figure
4G. Twenty days afterPNL, MBP was significantly decreased in distal
nerve extractsfrom scLRP1/ and scLRP1/mice, compared with levels
ob-served in uninjured nerves. Furthermore, the level of MBP
wasdecreased in injured nerves isolated from scLRP1/mice, com-pared
with injured nerves from scLRP1/ mice. Densitometryanalysis
confirmed that these results were significant (Fig. 7H).The greater
decrease in MBP in injured nerves from scLRP1/
mice may be multifactorial, and include the fact that axonal
de-generation is more robust in scLRP1/ nerves. However, at20 d,
the lower level of MBP observed in nerves isolated from
Figure 6. Loss of Schwann cells and failed regeneration in
crush-injured sciatic nerves fromscLRP1/ mice. AF, S100
immunohistochemistry of uninjured and crush-injured sciaticnerves.
Note the intense immunoreactivity of Schwann cell crescents in the
injured (muchmoreactivated) control nerves (arrowheads). In scLRP1/
nerves (F ), fewer intact S100-immunopositive crescents are present
and degenerating Schwann cells are visible (asterisks).Images are
representative of studieswith 4mice per group. Scale bar, 12m.G,
Quantificationof S100-immunoreactive Schwann cell crescents in
tissue sections (**p 0.01; n 1620sections/group). H, TEM analysis
of crush-injured sciatic nerves after 20 d in scLRP1/
andscLRP1/mice. Arrow points to onion bulb formation.
5596 J. Neurosci., March 27, 2013 33(13):55905602 Orita et al.
LRP1 and Axon-Schwann Cell Interactions in PNS
-
scLRP1/ mice also is interpreted as resulting from failure
ofregenerating myelinated axons to penetrate into the distal
nervesegment.
Next, mechanical allodynia was measured using von Freyhairs for
up to 19 d following PNL. scLRP1/ mice exhibitedstatistically
significant (p 0.05) allodynia during baseline test-ing (Fig. 8A).
After nerve injury, scLRP1/ mice developed
robust mechanical allodynia, characterized by significantly
lowerpaw withdrawal thresholds, compared with scLRP1/ mice(p 0.01).
Mechanical allodynia was sustained in scLRP1/
mice for 19 d, when the experiments were terminated. By
con-trast, scLRP1/ began to recover 15 d after injury, as
anticipated(Ulmann et al., 2008). By 19 d, thresholds in injured
scLRP1/
mice were nearly equivalent to those recorded in uninjured
andsham-operated scLRP1/ animals. Sham-operated scLRP1/
mice had significant allodynia initially (the first week) but
recov-ered to baseline levels 11 d after surgery.
Motor function was assessed by Rotarod testing. Before
nerveinjury, scLRP1/ and scLRP1/ mice demonstrated equiva-lent
motor function (Fig. 8B). PNL transiently decreased motorfunction
in scLRP1/ mice; however, in scLRP1/ mice, lossofmotor
functionwasmore substantial and sustained (p 0.01).Sham-operated
scLRP1/ and scLRP1/ mice also initiallydemonstrated decreased motor
function, but function was com-pletely restored by 17 d (p 0.01;
Fig. 8B). PNL typically doesnot induce sustained motor loss. These
results suggest that ab-normal Schwann cellaxonal interactions in
scLRP1/ mice
Figure 7. Characterization of structural changes following PNL
of sciatic nerves inscLRP1/mice. AD, Transverse semithin plastic
sections of PNL-injured sciatic nerves iso-lated 20 d after injury
and stained with methylene blue/Azure II. Asterisks in A and B
identifyareas shown in C and D at higher magnification. Arrowheads
in C identify myelinated axons.Arrowheads inD showdegeneratednerve
fibers.E,F, TEManalysis of PNL-injured sciatic nervesisolated 20 d
after injury. The images shown are representative of studies
conducted with 34mice/group. G, Immunoblot analysis of MBP levels
in PNL-injured nerves isolated 20 d afterinjury. Each lane
represents an individual mouse. H, Quantification of immunoblots by
densi-tometry (*p 0.05; n 4/group).
Figure 8. Sensory and motor deficits are exacerbated and
sustained in scLRP1/ micefollowing PNL. A, Mechanical allodynia was
measured by non-noxious probing of the hindpawusing von Frey
filaments before and after PNL. Data are expressed as means SEM
(N1012/cohort). Differences in treatment groups were compared by
Scheffes post hoc test(*p 0.05 comparing genotypes at baseline; *p
0.05 compared with sham-operated micein the same genotype; **p 0.01
comparing scLRP1/ mice with all groups). B, Rotarodtesting of
scLRP1/ and scLRP1/ mice before and after PNL. The time until
failure isplotted (*p 0.05 compared with sham-operated mice, n
12/cohort).
Orita et al. LRP1 and Axon-Schwann Cell Interactions in PNS J.
Neurosci., March 27, 2013 33(13):55905602 5597
-
may affect the function of diverse neuronal cells types in
sciaticnerve injury.
scLRP1/mice demonstrate increased p38MAPKphosphorylation and
activation of microglia in the spinalcord in response to PNLp38MAPK
phosphorylation andmicroglial activation in the spi-nal dorsal horn
have been identified as key biomarkers of neuro-pathic pain
processing (Ji and Suter, 2007). To assess thesebiomarkers, we
subjected scLRP1/ and scLRP1/ mice toPNL. Spinal cords were
harvested 7 d later. Phospho-p38 MAPK(P-p38MAPK) and the microglial
cell marker, CD11b/OX-42,were analyzed by immunofluorescence
microscopy. In the unin-jured spinal cords from scLRP1/ and scLRP1/
mice,phospho-p38 MAPK was barely detectable (Fig. 9A,B), as
antici-pated. In the injured spinal cords from scLRP1/
mice,phospho-p38MAPKwas increased on the ipsilateral side,
relativeto the contralateral side, in lamina I through III;
however, in-creased antigen alsowas observed in the contralateral
dorsal horn(Fig. 9C). Phospho-p38 MAPK was substantially increased
inboth magnitude and distribution in the ipsilateral dorsal horn
ofinjured scLRP1/mice (Fig. 9D). Robust signal extended fromlamina
I all the way to lamina VI, with extension into the con-tralateral
spinal dorsal horn.
OX-42 immunofluorescence also was increased in the ipsilat-eral
dorsal horn of scLRP1/ mice, 7 d after PNL, comparedwith scLRP1/
mice (Fig. 9E,F), suggesting extensive micro-glial cell
proliferation, recruitment, and/or activation. Immuno-fluorescence
intensity was quantitated by densitometry and isshown for
phospho-p38MAPK and OX-42 in Figure 9,G andH,respectively. Both
markers were significantly increased in inten-sity in the
ipsilateral horn in scLRP1/ mice, compared withscLRP1/mice (p
0.05).
To confirm the results of our immunofluorescence micros-copy
studies, tissue from the spinal dorsal horn was harvested 7 dafter
PNL and subjected to immunoblot analysis. Phospho-p38MAPKwas
occasionally detected in uninjured spinal dorsal horn,in scLRP1/
mice; however, the signal was extremely weak.Following PNL,
phospho-p38 MAPK was readily detected andsignal was significantly
greater in scLRP1/ mice, comparedwith scLRP1/mice. Total p38MAPKwas
unchanged (Fig. 9I).Immunoblots showing phopho-p38 MAPK and total
MAPKwere subjected to densitometry. The results are quantified
andsummarized in Figure 9J.
To determine whether p38 MAPK was activated in microgliain the
spinal cords of scLRP1/ mice that were subjected toPNL, we
performed dual-labeling immunofluorescence micros-copy studies.
Areas of phospho-p38 MAPK immunostaining(green) colocalized with
microglial cell marker, OX-42 (red),suggesting that p38MAPK was
activated in microglia (Fig. 10A).However, phospho-p38MAPK
immunoreactivity also occasion-ally colocalized with NeuN, a
neuronal marker, as well (resultsnot shown). These findings are
consistent with previousobservations regarding p38 MAPK activation
in the spinal cord(Svensson et al., 2008; Zhang et al., 2010).
Minocycline is an antibiotic known to inhibit microglial
acti-vation in injured spinal cords (Raghavendra et al., 2004).
Todemonstrate that microglial activation contributes to the
sus-tained mechanical allodynia observed in scLRP1/ mice, wetreated
scLRP1/ and scLRP1/ mice with minocycline (40mg/kg) by
intraperitoneal injection 4 h before PNL and thendaily. Cohorts of
scLRP1/ and scLRP1/mice were injectedwith vehicle, as a control.
Mechanical allodynia was monitored
daily before surgery and from 4 to 8 d after PNL. At day 4,
bothscLRP1/ and scLRP1/mice, which were treated with vehi-cle,
demonstrated allodynia (Fig. 10B). Control scLRP1/micetreated with
minocycline showed significantly less allodynia, asanticipated.
Although scLRP1/mice, which were treated withminocycline,
demonstrated a trend toward reduced allodynia,the drug was
minimally effective at best and extensive allodyniaremained
throughout the testing period. We interpret these re-sults to
suggest that the more extensive damage associated withPNL in
scLRP1/ nerves overwhelms the activity of this drug.
DiscussionBased mainly on in vitro studies, we have previously
shown thatmembrane-anchored LRP1 orchestrates many Schwann cell
ac-
Figure9. Sustained pain-related behavior in scLRP1/mice is
associatedwith phosphor-ylation of p38 MAPK (P-p38MAPK) and
activation of microglia in the spinal dorsal horn.
AD,Immunofluorescence for P-p38MAPK in the spinal dorsal horn of
mice in uninjured (A, B) andinjured (C,D) 7 d after PNL. E, F,
Immunofluorescence of cd11b/OX-42 in the spinal dorsal hornafter 7
dof PNL injury. Images are representative of those obtained in
studieswith 34micepercohort. Each pair of images shown in AF (A and
BD, E and F ) is matched for exposure. Scalebar, 400m. G, H,
Quantification by densitometry of P-p38MAPK and OX-42 in the
ipsilateraland contralateral spinal dorsal horn. Signal intensity
in the ipsilateral horn was significantlyincreased in scLRP1/ mice
compared with scLRP1/ mice (*p 0.05, n 4/group).Signal intensity
also was significantly increased in the ipsilateral compared with
the contralat-eral horn for each biomarker (*p 0.05). I, Immunoblot
analysis of P-p38MAPK in spinal corddorsal horn isolated 7 d after
PNL. Equal amounts of protein (50g) were loaded in each laneand
subjected to SDS-PAGE. Total p38 MAPK was determined as a loading
control. J, Quantifi-cation of P-p38MAPK to T-p38MAPK ratio by
densitometry in uninjured and injured spinal cord(n 34 mice) *p
0.05 comparing injury in each genotype.
5598 J. Neurosci., March 27, 2013 33(13):55905602 Orita et al.
LRP1 and Axon-Schwann Cell Interactions in PNS
-
tivities that are observed in vivo, when the PNS is injured
andSchwann cells become activated. These include activation of
pro-survival cell-signaling pathways (Campana et al., 2006a) and
pro-motion of cell migration (Mantuano et al., 2008, 2011). In
thisstudy, we have shown that in the uninjured rodent
peripheralnerve, LRP1 deficiency in Schwann cells is associated
with ultra-structural changes in both myelinating and
nonmyelinatingSchwann cells. After peripheral nerve injury, nerve
degenerationis accelerated and associated with substantial loss of
Schwann cellviability, as might have been predicted by previous in
vitro cell-signaling studies. Accelerated degeneration is
associated with in-creased and sustained allodynia, more extensive
loss of motorfunction, and apparently failed regeneration. scLRP1/
micedemonstrate increased central sensitization in response to PNL,
asevidenced by activation of p38 MAPK and microglial activation
inthe dorsal horn of the spinal cord. Overall, these studies
indicate apervasive role for LRP1 in regulating Schwann cell
physiology andthe response to peripheral nerve injury.
A striking abnormality was noted in the ultrastructure
ofnonmyelinating Schwann cells and their interaction with
pain-transmitting axons in uninjured nerves isolated from
scLRP1/
mice. Abnormal Remak bundles werecharacterized by (1) axons with
mean di-ameters exceeding 2 m; (2) improperseparation of axons by
Schwann cell cyto-plasm; and (3) a greater frequency of Re-mak
bundles in which a high number ofaxons are contained. The presence
of largecaliber axons in Remak bundles in nervesfrom scLRP1/ mice
may reflect incor-poration of axons that are typically my-elinated
in wild-type nerves or axonalswelling due to improper
ensheathment.That LRP1 deficiency regulates axonalsorting is
plausible because LRP1 regu-lates 1 integrin levels on the cell
surfaceof diverse cell types (Salicioni et al., 2004).Conditional
deletion of 1 integrin inSchwann cells has profound effects on
ax-onal sorting and myelination (Feltri et al.,2002). Dilation of
axons within Remakbundles may be observed when there isinsufficient
Schwann cell trophic support(Chen et al., 2003). The presence of
anincreased number of axons in associationwith LRP1-deficient
Schwann cells hasnot been explained; however, we hy-pothesize that
the previously demon-strated activity of LRP1 as a regulator ofRho
family GTPases may be involved(Mantuano et al., 2010). Rho
GTPasesare known to control Schwann cell cyto-skeletal and plasma
membrane dynam-ics required for development of correctaxonal
interactions and myelination(Melendez-Vasquez et al., 2004).
Schwann cells in Remak bundles aretermed first responders to
injury or dis-ease in the PNS microenvironment(Griffin and
Thompson, 2008). The al-tered Remak bundle structure we ob-served
may underlie the presence ofallodynia in scLRP1/ mice in the
ab-
sence of injury. Small C-fibers ensheathed by
nonmyelinatingSchwann cells are high-threshold pain-producing
neurons. If ax-ons are improperly ensheathed by Schwann cells, then
adjacentaxons come into contact. This provides amechanism for
impulseconduction through the nerve membrane in either direction,
al-lowing neighboring axons to cross-talk and engage in
sponta-neous ephaptic transmission (Sadjadpour, 1975; Ueda,
2008).Ultrastructural abnormalities in myelinated Schwann cells
alsomay have contributed to the baseline changes in sensory
process-ing in uninjured scLRP1/ mice. A fibers, which are
myelin-ated, mediate a large proportion of withdrawal reactions
tolight-touch (Shir and Seltzer, 1990) and contribute to
excessivesensitivity in human peripheral demyelinating and
degenerativediseases (Pentland and Donald, 1994).
Following nerve injury, in each of the model systems we
stud-ied, evidence for more rapid and/or severe nerve
degenerationwas observed in scLRP1/mice. These anatomic changes
wereassociated with more severe loss of nerve function. We
recognizeat least three candidate mechanisms by which LRP1
deficiency inSchwann cells may exacerbate responses to nerve injury
and neu-ropathic pain. First, sciatic nerves in scLRP1/ mice
already
Figure 10. P-p38MAPK localizes to microglia in injured mice. A,
Double-label immunofluorescence microscopy of OX-42 (red)and
P-p38MAPK (green) in the ipsilateral spinal dorsal horn in scLRP1/
and scLRP1/mice 7 d after PNL. Colocalization ofP-p38MAPK andOX-42
is shown in yellow. Cell nucleiwere identified by DAPI (blue).
Scale bar, 5m.B, Mechanical allodyniawasmeasured in mice before and
after PNL by non-noxious probing of the hindpaws with von Frey
filaments. Mice were treatedsystemically withminocycline (40mg/kg)
or vehicle 4 h before PNL and daily for 7 d after PNL (*p 0.05
comparing scLRP1/
mice treatedwithminocycline to scLRP1/mice treatedwith vehicle;
no significant differences between scLRP1/micewithand without
minocycline; n 6/cohort).
Orita et al. LRP1 and Axon-Schwann Cell Interactions in PNS J.
Neurosci., March 27, 2013 33(13):55905602 5599
-
exhibit lower thresholds before injury and therefore may
re-spond to noxious stimuli in an exaggerated manner. Second,the
accelerated degeneration of myelinated nerve fibers ob-served in
scLRP1/ mice may cause extensive modificationsin neurolemma
architecture. These changes increase sodiumchannel activity and
turnover in the neural membranes,thereby contributing to sustained
afferent hyperexcitability ininjured nerves (Devor et al., 1993).
Moreover, demyelinationand subsequent physical crosstalk between
noxious and in-nocuous fibers may lead to pathological
pain-generating syn-apses involving A-fibers (Ueda, 2006, 2011).
Third, indirecteffects of myelinated fiber degeneration on
neighboringSchwann cells in Remak bundles may explain the rapid
onsetand sustaining of exacerbated mechanical allodynia.
Previ-ously, it has been shown that Schwann cells in Remak
bundlestransition to a proliferating phenotype when exposed to
degen-erating myelinated fibers (Murinson et al., 2005), which
coin-cides with induction of spontaneous C-fiber activity (Wu et
al.,2002). Myelin and lipid products in the injured nerves
ofscLRP1/ mice also may indirectly exacerbate the activity
ofC-fibers that are abnormally supported by LRP1-deficient
non-myelinating Schwann cells.
LRP1 is released from cell-surfaces by -secretases (Liu et
al.,2009). The shed form of LRP1 contains the intact 515 kDa
LRP1-chain and part of the ectodomain region of the 85 kDa
chain.Shed LRP1 is biologically active as a regulator of the
functionof both Schwann cells (Gaultier et al., 2008) and
macrophages(Gorovoy et al., 2010). In the injured PNS, shed LRP1
coun-teracts the activity of proinflammatory cytokines known
toactivate nociceptors, including TNF- and IL-1 (Gaultier et
al.,2008). Loss of LRP1 in scLRP1/ mice would be expected
todecrease the pool of available shed LRP1 in the injured
PNS,thereby de-repressing TNF- and IL-1 from inhibition.
Thesecytokines are known to induce central sensitization in the
spinaldorsal horn (Schafers et al., 2003), which may underpin some
ofthe allodynia associatedwith chronic neuropathic pain (Hathwayet
al., 2009). Evidence of central sensitization observed
inscLRP1/mice included robust and sustained activation of p38MAPK
in the spinal dorsal horn and activation of spinal micro-glia.
Thus, loss of shed LRP1 from the injured PNS may havecontributed to
hyperactivity of spinal dorsal horn neurons andmay have modulated
spinal cord synaptic transmission that ischaracterized by pain
hypersensitivity. Lack of shed LRP1 alsomay have de-repress factors
that induce demyelination in theperiphery, such as lysophosphatidic
acid, which has been shownto initiate sustained microglia
activation (Fujita et al., 2007;Ueda, 2008).
Our ultrastructural studies of sciatic nerves that were
injuredfor 20 d provided additional clues regarding sustained pain
statesin scLRP1/ mice. In both the PNL and crush injury
modelsystems, the presence of prominent onion bulb formations
sug-gested that axonal regeneration was initiated but then failed
inthese mice (Thomas, 1970). Onion bulb formation is
typicallyobserved after repeated injury to the peripheral nerve of
wild-type mice (Ohara and Ikuta, 1988). Increased ectopic
activityfrom aborted regenerating sprouts can maintain
allodynia(Nachemson and Bennett, 1993). Aberrant axonal
regenerationmay contribute to allodynic states and spontaneous pain
ob-served in chemotherapy-induced neuropathies and
peripheralneuropathies, such as CharcotMarieTooth disease type 1
andtype 4 (Carter et al., 1998) and GuillainBarre syndrome(Pentland
and Donald, 1994). Because abnormalities in sciatic
nerve function are sustained in scLRP1/mice, these mice
mayprovide a model of chronic neuropathic pain states in
humans.
Deletion of LRP1 selectively in Schwann cells represents aloss
of function model system. However, based on our results,we offer
some novel hypotheses regarding Schwann cell LRP1 as atarget for
therapeutics development in neuropathic pain. Wepropose that it may
be possible to enhance LRP1 receptor activa-tion as a pathway to
further improve Schwann cell viability, ca-pacity for migration,
and secretion of mediators involved in theresponse to PNS injury.
We previously described recombinantproducts, derived from
2-macroglobulin and MMP-9, whichfunction as LRP1 agonists,
activating cell signaling in Schwanncells (Mantuano et al., 2008;
Mantuano et al., 2011). Similarly,derivatives of shed LRP1, by
their capacity to regulate TNF- andIL-1 (Gaultier et al., 2008),
may limit central sensitization. Arecent population-based
genome-wide association study showedthat an LRP1 SNP is
associatedwith commonmigraine headache,linking LRP1 to migraine
pathophysiology (Chasman et al.,2011). The molecular mechanism
underlying this genetic associ-ation remains to be determined. We
propose that the ability ofLRP1 to couple endocytosis and
phagocytosis of extracellular li-gands and debris with cell
signaling responses underlies many ofthe activities of LRP1 in
Schwann cells, which may be exploitedfor therapeutics development
to improve the PNS response toinjury.
In summary, we have shown that LRP1 is amajor determinantof
normal structure of both nonmyelinating and myelinatingSchwann cell
phenotypes. When LRP1 is deleted, Schwann cellphysiology is altered
and this is evident in PNS injury. Walleriandegeneration is
accelerated, regeneration is aborted, and painstates are
exacerbated and sustained. Overall, these studies dem-onstrate a
pervasive relationship between normal Schwann cellphysiology and
preventing of neuropathic pain.
ReferencesAkassoglou K, Kombrinck KW, Degen JL, Strickland S
(2000) Tissue
plasminogen activator-mediated fibrinolysis protects against
axonaldegeneration and demyelination after sciatic nerve injury. J
Cell Biol149:11571166. CrossRef Medline
Azzouz M, Kenel PF, Warter JM, Poindron P, Borg J (1996)
Enhnacementof mouse sciatic nerve regeneration by the long chain
fatty alcohol,N-Hexacosanol. Exp Neurol 138:189197. CrossRef
Medline
Bolis A, Coviello S, Bussini S, Dina G, Pardini C, Previtali SC,
Malaguti M,Morana P, Del Carro U, Feltri ML, Quattrini A, Wrabetz
L, Bolino A(2005) Loss of Mtmr2 phosphatase in Schwann cells but
not in motorneurons causes Cahrcot-Marie-Tooth type 4B1 neuropathy
with myelinoutfoldings. J Neurosci 25:85678577. CrossRef
Medline
Bunge MB, Pearse DD (2003) Transplantation strategies to promote
repairof the injured spinal cord. J Rehabil Res Dev 40:5562.
CrossRef Medline
CampanaWM,Myers RR (2001) Erythropoietin and erythropoietin
recep-tors in the peripheral nervous system: changes after nerve
injury. FASEB J15:18041806. Medline
Campana WM, Li X, Dragojlovic N, Janes J, Gaultier A, Gonias SL
(2006a)The low-density lipoprotein receptor-related protein is a
pro-survivalreceptor in Schwann cells: possible implications in
peripheral nerve in-jury. J Neurosci 26:1119711207. CrossRef
Medline
Campana WM, Li X, Shubayev VI, Angert M, Cai K, Myers RR
(2006b)Erythropoietin reduces Schwann cell TNF-alpha,Wallerian
degenerationand pain-related behaviors after peripheral nerve
injury. Eur J Neurosci23:617626. CrossRef Medline
Carter GT, Jensen MP, Galer BS, Kraft GH, Crabtree LD, Beardsley
RM,AbreschRT, BirdTD (1998) Neuropathic pain
inCharcot-Marie-Toothdisease. Arch Phys Med Rehabil 79:15601564.
CrossRef Medline
Chaplan SR, Bach FW, Pogrel JW,Chung JM, YakshTL (1994)
Quantitativeassessment of tactile allodynia in the rat paw. J
Neurosci Methods 53:5563. CrossRef Medline
Chasman DI, Schurks M, Anttila V, de Vries B, Schminke U, Launer
LJ,
5600 J. Neurosci., March 27, 2013 33(13):55905602 Orita et al.
LRP1 and Axon-Schwann Cell Interactions in PNS
-
Terwindt GM, van denMaagdenberg AM, Fendrich K, Volzke H, Ernst
F,Griffiths LR, Buring JE, Kallela M, Freilinger T, Kubisch C,
Ridker PM,Palotie A, Ferrari MD, Hoffmann W, et al. (2011)
Genome-wide asso-ciation study reveals three susceptibility loci
for commonmigraine in thegeneral population. Nat Genet 43:695698.
CrossRef Medline
Chen S, Rio C, Ji RR, Dikkes P, Coggeshall RE, Woolf CJ, Corfas
G (2003)Disruption of ErbB receptor signaling in adult
non-myelinating Schwanncells causes progressive sensory loss.
NatNeurosci 6:11861193. CrossRefMedline
Chen ZL, Yu WM, Strickland S (2007) Peripheral regeneration.
Annu RevNeurosci 30:209233. CrossRef Medline
DevorM, Govrin-LippmannR, Angelides K (1993) Na channel
immuno-localization in peripheral mammalian axons and changes
following nerveinjury and neuroma formation. J Neurosci
13:19761992. Medline
DixonWJ (1980) Efficient analysis of experimental observations.
Annu RevPharmacol Toxicol 20:441462. CrossRef Medline
Feltri ML, DAntonio M, Previtali S, Fasolini M, Messing A,
Wrabetz L(1999) P0-Cre transgenic mice for inactivation of adhesion
molecules inSchwann cells. Ann N Y Acad Sci 883:116123. CrossRef
Medline
Feltri ML, Graus Porta D, Previtali SC, Nodari A, Migliavacca B,
Cassetti A,Littlewood-Evans A, Reichardt LF, Messing A, Quattrini
A, Mueller U,Wrabetz L (2002) Conditional disruption of beta 1
integrin in Schwanncells impedes interactions with axons. J Cell
Biol 156:199209. CrossRefMedline
Fujita R, Kiguchi N, UedaH (2007) LPA-mediated demyelination in
ex vivoculture of dorsal root. Neurochem Internat 50:351355.
CrossRef
Gaultier A, Arandjelovic S, Li X, Janes J, Dragojlovic N, Zhou
GP, Dolkas J,Myers RR, Gonias SL, Campana WM (2008) A shed form of
LDLreceptor-related protein-1 regulates peripheral nerve injury and
neuro-pathic pain in rodents. J Clin Invest 118:161172. CrossRef
Medline
Goldberg DS, McGee SJ (2011) Pain as a global public health
priority. BMCPublic Health 11:770775. CrossRef Medline
Gorovoy M, Gaultier A, Campana WM, Firestein GS, Gonias SL
(2010) In-flammatory mediators promote production of shed
LRP1/CD91, whichregulates cell signaling and cytokine expression
bymacrophages. J LeukocBiol 88:769778. CrossRef Medline
Griffin JW, Thompson WJ (2008) Biology and pathology of
nonmyelinat-ing Schwann cells. Glia 56:15181531. CrossRef
Medline
Grinspan JB, Marchionni MA, Reeves M, Coulaloglou M, Scherer SS
(1996)Axonal interactions regulate Schwann cell apoptosis in
developing pe-ripheral nerve: neuregulin receptors and the role of
neuregulins. J Neu-rosci 16:61076118. Medline
HathwayGJ, Vega-AvelairaD,MossA, IngramR, FitzgeraldM (2009)
Brief,low frequency stimulation of rat peripheral C-fibres evokes
prolongedmicroglial-induced central sensitization in adults but not
in neonates.Pain 144:110118. CrossRef Medline
Herz J, Clouthier DE, Hammer RE (1992) LDL receptor-related
proteininternalizes and degrades uPA-PAI-1 complexes and is
essential for em-bryo implantation. Cell 71:411421. CrossRef
Medline
Ide C (1996) Peripheral nerve regeneration. Neurosci Res
25:101121.CrossRef Medline
Jessen KR, Mirsky R (1999) Schwann cells and their precursors
emerge asmajor regulators of nerve development. Trends Neurosci
22:402410.CrossRef Medline
Jessen KR, Mirsky R (2005) The origin and development of glial
cells inperipheral nerves. Nat Rev Neurosci 6:671682. CrossRef
Medline
Ji RR, Suter MR (2007) p38 MAPK, microglial signaling, and
neuropathicpain. Mol Pain 3:33. CrossRef Medline
La Fleur M, Underwood JL, Rappolee DA, Werb Z (1996) Basement
mem-brane and repair of injury to peripheral nerve: defining a
potential role formacrophages, matrix metalloproteinases, and
tissue inhibitor ofmetalloproteinases-1. J Exp Med 184:23112326.
CrossRef Medline
Ledeboer A, Sloane EM, Milligan ED, Frank MG, Mahony JH, Maier
SF,Watkins LR (2005) Minocycline attenuates mechanical allodynia
andproinflammatory cytokine expression in rat models of pain
facilitation.Pain 115:7183. CrossRef Medline
Lillis AP, Van Duyn LB, Murphy-Ullrich JE, Strickland DK (2008)
LDLreceptor related protein 1: unique tissue specific functions
revealed byselective gene knockout studies. Physiol Rev 88:887918.
CrossRefMedline
Liu Q, Zhang J, Tran H, Verbeek MM, Reiss K, Estus S, Bu G
(2009) LRP1
shedding in human brain: roles of ADAM10 and ADAM17. Mol
Neuro-degener 4:17. CrossRef Medline
Mantuano E, Inoue G, Li X, Takahashi K, Gaultier A, Gonias SL,
CampanaWM (2008) The hemopexin domain of matrix metalloproteinase-9
ac-tivates cell signaling and promotes migration of schwann cells
by bindingto low-density lipoprotein receptor-related protein. J
Neurosci 28:1157111582. CrossRef Medline
Mantuano E, Jo M, Gonias SL, Campana WM (2010) Low density
lipopro-tein receptor-related protein (LRP1) regulats Rac1 and RhoA
recipri-coally to control Schwann cell adhesion and migration. J
Biol Chem 285:1425914266. CrossRef Medline
Mantuano E, Henry K, Yamauchi T, Hiramatsu N, Yamauchi K, Orita
S,Takahashi K, Lin JH, Gonias SL, Campana WM (2011) The
unfoldedprotein response is amajormechanismbywhich LRP1 regulates
Schwanncell survival after injury. J Neurosci 31:1337613385.
CrossRef Medline
Meier C, Parmantier E, Brennan A, Mirsky R, Jessen KR (1999)
DevelopingSchwann cells acquire the ability to survive without
axons by establishingan autocrine circuit involving insulin-like
growth factor, neurotrophin-3,andplatelet-derived growth factor-BB.
JNeurosci 19:38473859.Medline
Melendez-Vasquez CV, Einheber S, Salzer JL (2004) Rho kinase
regulatesschwann cell myelination and formation of associated
axonal domains.J Neurosci 24:39533963. CrossRef Medline
Murinson BB, Archer DR, Li Y, Griffin JW (2005) Degeneration of
myelin-ated efferent fibers promptsmitosis in Remak Schwann cells
of uninjuredC-fiber afferents. J Neurosci 25:11791187. CrossRef
Medline
Nachemson AK, Bennett GJ (1993) Does pain damage spinal cord
neurons?Transsynaptic degeneration in rat following a surgical
incision. NeurosciLett 162:7880. CrossRef Medline
Ohara S, Ikuta F (1988) Schwann cell resonses during
regeneration after oneor more crush injuries to myelinated nerve
fibres. Neuropath Appl Neu-robiol 14:229245. CrossRef
Overton CD, Yancey PG, Major AS, Linton MF, Fazio S (2007)
Deletion ofmacrophage LDL receptor-related protein increases
atherogenesis in themouse. Circ Res 100:670677. CrossRef
Medline
Pentland B, Donald SM (1994) Pain in the Guillain-Barre
syndrome: a clin-ical review. Pain 59:159164. CrossRef Medline
Raghavendra V, Tanga FY, DeLeo JA (2004) Attenuation of
morphinetolerance, withdrawal-induced hyperalgesia, and associated
spinal in-flammatory immune responses by propentofylline in rats.
Neuropsy-chopharmacology 29:327334. CrossRef Medline
Rogawski MA, Loscher W (2004) The neurobiology of antiepileptic
drugsfor the treatment of nonepileptic conditions. Nat Med
10:685692.CrossRef Medline
Rohlmann A, Gotthardt M, Willnow TE, Hammer RE, Herz J (1996)
Sus-tained somatic gene inactivation by viral transfer of Cre
recombinase. NatBiotechnol 14:15621565. CrossRef Medline
Sadjadpour K (1975) Postfacial palsy phenomena: faulty nerve
regenerationor ephaptic transmission? Brain Res 95:403406. CrossRef
Medline
Salicioni AM,Gaultier A, Brownlee C, CheezumMK,Gonias SL (2004)
Lowdensity lipoprotein receptor-related protein-1 promotes beta1
integrinmaturation and transport to the cell surface. J Biol Chem
279:1000510012. Medline
Schafers M, Lee DH, Brors D, Yaksh TL, Sorkin LS (2003)
Increased sensi-tivity of injured and adjacent uninjured rat
primary sensory neurons toexogenous tumor necrosis factor-alpha
after spinal nerve ligation. J Neu-rosci 23:30283038. Medline
Seltzer Z, Dubner R, Shir Y (1990) A novel behavioral model of
neuropathicpain disorders produced in rats by partial sciatic nerve
injury. Pain 43:205218. CrossRef Medline
Shi Y,MantuanoE, InoueG,CampanaWM,Gonias SL (2009) Ligand
bind-ing to LRP1 transactivates Trk receptors by a Src family
kinase-dependentpathway. Sci Signal 2: ra18. Medline
Shir Y, Seltzer Z (1990) A-fibers mediate mechanical
hyperesthesia and al-lodynia and C-fibers mediate thermal
hyperalgesia in a new model ofcausalgiform pain disorders in rats.
Neurosci Lett 115:6267. CrossRefMedline
Strickland DK, Ashcom JD, Williams S, Burgess WH, Migliorini M,
Ar-graves WS (1990) Sequence identity between the
alpha2-macroglobulin receptor and low density lipoprotein
receptor-related protein suggests that this molecule is a
multifunctional recep-tor. J Biol Chem 265:1740117404. Medline
Orita et al. LRP1 and Axon-Schwann Cell Interactions in PNS J.
Neurosci., March 27, 2013 33(13):55905602 5601
-
Strickland DK, Gonias SL, Argraves WS (2002) Diverse roles for
the LDLreceptor family. Trends Endocrinol Metab 13:6674. CrossRef
Medline
Svensson C,Medicherla S, Malkmus S, Jiang Y, Ma JY, Kerr I,
Brainin-Mattos J,Powell HC, Luo ZD, Chakravarty S, Dugar S, Higgins
LS, Protter AA, YakshTL (2008) Role of p38 mitogen activated
protein kinase in a model ofosteosarcoma-induced pain. Pharmacol
Biochem Behav 90:664675.Medline
Taveggia C, Salzer JL (2007) PARsing the events of myelination.
Nat Neu-rosci 10:1718. CrossRef Medline
Thomas PK (1970) The cellular responses to nerve injury. J Anat
106:463470. Medline
Ueda H (2006) Molecular mechanisms of neuropathic
pain-phenotypicswitch and initiation mechanisms. Pharmacol Ther
109:5777. CrossRefMedline
UedaH (2008) Peripheralmechanisms of neuropathic pain-
involvement oflysophosphatidic acid receptor-mediated
demyelination. Mol Pain 4:11.CrossRef Medline
Ueda H (2011) Lysophosphadic acid as the initiator of
neuropathic pain.Biol Pharm Bull 34:11541158. CrossRef Medline
Ulmann L, Hatcher JP, Hughes JP, Chaumont S, Green PJ, Conquet
F, BuellGN, Reeve AJ, Chessell IP, Rassendren F (2008)
Up-regulation of P2X4receptors in spinalmicroglia after peripheral
nerve injurymediates BDNFrelease and neuropathic pain. J Neurosci
28:1126311268. CrossRefMedline
Witt A, Brady ST (2000) Unwrapping new layers of complexity in
axon/glialrelationships. Glia 29:112117. CrossRef Medline
Wu G, Ringkamp M, Murinson BB, Pogatzki EM, Hartke TV,
WeerahandiHM, Campbell JN, Griffin JW, Meyer RA (2002) Degeneration
of my-elinated efferent fibers induces spontaneous activity in
uninjured C-fiberafferents. J Neurosci 22:77467753. Medline
YuWM, Yu H, Chen ZL (2007) Laminins in peripheral nerve
developmentand muscular dystrophy. Mol Neurobiol 35:288297.
CrossRef Medline
Zhang H, Nei H, Dougherty PM (2010) A p38 mitogen-activated
proteinkinase-dependent mechanism of disinhibition in spinal
synaptic trans-mission induced by tumor necrosis factor-alpha. J
Neurosci 30:1284412855. CrossRef Medline
5602 J. Neurosci., March 27, 2013 33(13):55905602 Orita et al.
LRP1 and Axon-Schwann Cell Interactions in PNS
Schwann Cell LRP1 Regulates Remak Bundle Ultrastructure and
Axonal Interactions to Prevent Neuropathic
PainIntroductionMaterials and MethodsResultsTargeted disruption of
LRP1 in Schwann cellsDiscussionReferences