Saccharomyces cer&ae RH03 Gene, Encoding a GTPase ... · and SEC4, taken together with the fact that the Rab-type GTPase Sec4p is required to fuse secretory vesicles ... S MALL GTPases

Copyright 0 1996 by the Genetics Society of America

Genetic Analysis of the Saccharomyces cer&ae RH03 Gene, Encoding a Rho-Type Small GTPase, Provides Evidence for a Role in Bud Formation

Jun Imai, Akio Toh-e and Yasushi Matsui

Department of Biological Sciences, Graduate School of Science, The University of Tokyo, Tokyo 113, Japan

ABSTRACT RHO? encodes a Rho-type small GTPase of the yeast Saccharomyces cereuisiae. We isolated temperature-

sensitive alleles and a dominant active allele of RH03. Ts- rho? cells lost cell polarity during bud formation and grew more isotropically than wild-type cells at nonpermissive temperatures. In contrast, cells carrying a dominant active mutant RHO? displayed cold sensitivity, and the cells became elongated and bent, often at the position where actin patches were concentrated. These phenotypes of the rho3 mutants strongly suggest that RHO? is involved in directing the growing points during bud formation. In addition, we found that SR06, previously isolated as a multicopy suppressor of rho?, is the same as SEW. The sec4-2 mutation was synthetic lethal with temperature-sensitive rho3 mutations and suppressed the cold sensitivity caused by a dominant active mutant RH03. The genetic interactions between RHO? and SEC4, taken together with the fact that the Rab-type GTPase Sec4p is required to fuse secretory vesicles together with plasma membrane for exocytosis, support a model in which the Rhosp pathway modulates morphogenesis during bud growth via directing organization of the actin cytoskeleton and the position of the secretory machinery for exocytosis.

S MALL GTPases of the Ras superfamily act as molecular switches through their conformational change

between the GTP-bound active form and GDP-bound inactive form of the proteins (BARBACID 1987; BOURNE et al. 1991; BOGUSKI and MCCORMICK 1993). In the yeast Saccharomyces cereuisiae, three Rho-type GTPases of the Ras superfamily, Cdc42p, Rho3p, and Rho4p, partici- pate in the morphogenetic event of bud formation (AD- AMS et al. 1990; JOHNSON and PRINGLE 1990; MATSUI and TOH-E 1992a,b). In bud formation, cell polarity is established and the cytoskeleton is reorganized. Patches of actin filaments become concentrated at the bud site, to which transport of secretory vesicles is directed for the construction of the daughter cell surface (TKACZ and LAMPEN 1972; FIELD and SCHEKMAN 1980; PRINGLE and HARTWELL 1981; WIB et al. 1982; ~ A M S and PRIN- GLE 1984; KILMARTIN and ADAMS 1984; NOVICK and BOTSTEIN 1985; PRINGLE et al. 1986; DRUBIN 1991; JOHN-

STON et al. 1991). Loss of Cdc42p function disrupts the asymmetric localization of actin filaments and causes cells to become unbudded, large, and round (ADAMS et al. 1990; JOHNSON and PRINGLE 1990; ZIMAN andJOHN- SON 1994). Cells carrying a dominant active CDC42 mutation (e.g., CDC42v""'2) initiate bud emergence independent of the cell cycle and cells with multiple buds are accumulated (ZIMAN et al. 1991). These facts suggest that Cdc42p is required for cell polarity establishment at the initiation of bud emergence.

Cell deleted for R H 0 3 grow very slowly, and simulta- neous disruption of R H 0 4 enhances the growth defect, whereas disruption of R H 0 4 alone does not inhibit cell

Corresponding authur; Yasushi Matsui, Department of Biological Sci- ences, Graduate School of Science, The University of Tokyo, Hongo, Bunkyo-ku, Tokyo 113, Japan.

Genetics 142: 359-369 (February, 1996)

growth. In addition, RH04 is a multicopy suppressor of rho3 (MATSUI and TOH-E 1992a), suggesting that Rho4p possesses a Rho3prelated function. Arho3 Arho4 cells, where both Rho3p and Rho4p are depleted using a conditionally expressed promoter, undergo lysis with small buds (MATSUI and TOH-E 199213). These facts suggest that Rho3p and Rho4p are required for bud growth. The genes SROl - SR09 were previously isolated as multicopy suppressors of rho3. SR02 is the same as CDC42 and SROl is identical to BEMl (MATSUI and TOH-E 1992b). BEMl encodes a SH3 domain-bearing protein required for cell polarization both during bud formation and during the formation of mating projec- tions (BENDER and PRINGLE 1991; CHANT et al. 1991; CHENEVERT et al. 1992). The genetic interactions of R H 0 3 with BEMl and CDC42 suggest that R H 0 3 is involved in development or maintenance of cell polarization.

During bud formation, the function of the exocytic machinery is restricted to the site of cell-surface growth (TKACZ and LAMPEN 1972; FIELD and SCHEKMAN 1980). SEC4 encodes a Rab-type GTPase of the Ras superfamily and is essential for exocytosis at the step of fusion of secretory vesicles with the plasma membrane (NOVICK and SCHEKMAN 1979; SALMINEN and NOVICK 1987). Not surprisingly, Sec4p is concentrated in the growing bud (SALMINEN and NOVICK 1989), and it may play a pivotal role in exocytosis by controlling a plasma membrane- associated complex including other essential components for exocytosis, such as Sec8p and Secl5p (SALMI- NEN and NOVICK 1989; BOWSER and NOVICK 1991).

In this study, we identified and characterized Ts- mutants and a dosedependent dominant active mutant of RH03. In addition, we show genetic interaction between R H 0 3 and SEC4, which establishes a connection

360 J. Imai, A. Toh-e and Y. Matsui

TABLE 1

Yeast strains used in this study

Strain Genotype Reference or source

YPH499 YPH5OO WH501

YMR505

YMR510

YMR400

YMR401

YMR402

YMR3732-2B YMR3732-5D YJR3-5A YJLRl3

YJR3-5B YJR3-OA

YJR3-SA YJR3-9A

YJR3-1 OA ANSMC YJS42A

YJRS3412A YJRS3412B

YJRS342A

MATa ura3-52 leu2 his3 trpl lys2 ade2 MATa ura3-52 leu2 his3 trpl lys2 ade2 MATa/MATa ura3-52/ura3-52 leu2/leu2 his3/his? trpl/trpl lys2/

MATa rho3::LEU2 pGALZRHO4 leu2 ura3::HIS3 his3 trpl lys2

MATa rho3::LEU2 rho4::HIS3pGALZRHO4 leu2 his3 trpl lys2

MATa rho4::HIS3 ura3 leu2 his3 trpl lys2 ade2

lys2 ade2/ade2

ade2

ade2

MATa rho4::HIS3 ura3 leu2 his3 trpl lys2 ade2

MATa/MATa rho4 : : HIS3/rho4: : HIS3 ura3-52/ura3-52 leu2/leu2

MATa rho3“I:TRPl ura3 leu2 his3 trpl lys2 ade2 MATa rho3-1: TRPl rh04:: HIS3 ura3 leu2 his3 trpl lys2 ade2 MATa rhop-z’8: TRPl ura3 leu2 his3 trpl lys2 ade2 MATa rho?m-z28: TRpl rh04:: HIS3 A ltel::URA3 ura3 leu2 his3

MATa rho3’a-”8:TRPl rho4::HIS3 ura3 leu2 his? trpl lys2 ade2 MATa pGALZRH03 leu2 his3 trpl lys2 ade2

his3/his3 trpl/trpl lys2/lys2 ade2/ade2

trpl lys2 ade2

MATa rhop’””’”:TRPl ura3 leu2 his3 trpl lys2 ade2 MATa pGAL7:rho~’””” leu2 his3 trpl lys2 ade2

MATa rhop”~131.%-zz8. .TIP1 ura3 leu2 his3 trpl lys2 ade2 MATa sec4-2 ura3 leu2 his3 MATa sec4-2 ura3 leu2 his3 trpl lys2 ade2

Ma& rho3-1:TRPl sec4-2 ura3 leu2 his3 trpl lys2 ade2 MATa rho3-1: TRPl rh04:: HIS3 sec4-2 ura3 leu2 his3 trpl lys2

MATa sec4-2 PGALZrhop’””’ leu2 his3 trpl lys2 ade2 ade2

SIKORSKI and HIETER (1989) SIKORSKI and HIETER (1989) SIKORSIU and HIETER (1989)

MATSUI and TOH-E (1992b)

MATSUI and TOH-E (1992b)

This study (YPH500 transformed with rho4 disruption plasmid; MATSUI and TOH-E 1992a)

This study (YPH499 transformed with rho4 disruption plasmid; MATSUI and TOH-E 1992a)

YMR400 X YMR401

This study This study This study YJR3-5A transformed with Ztel disruption

This study This study (WH499 containing integrated

plasmid (SHIRAYAMA et ai. 1994)

pGALFRH03 using the YIpUGAL7- derived plasmid.)

This study This study (WH499 containing integrated

pGAL7~hop““~’ using the YIpUGAL7- derived plasmid.)

This study from A. NAKANO, Tokyo This study (derived from a series of

crosses involving YPH499 and a sec4-2 progeny of ANS48C)

This study This study

This study (YJS42A containing integrated P G A L Z ~ ~ O ~ ‘ “ ~ ’ ~ ’ using the YIpUGAL7- derived plasmid.)

~~

All strains listed above, except for ANS48C, YJS42A, and YJRS34 strains, are isogenic to YPH499 except for the indicated ~ ____~ ____ _____ _ _ _ _ _ ~ ~-

genotype. YJS42A and YJRS34 strains are congenic to WH499 except for the indicated genotype.

between components necessary for cell polarization and components of the exocytic apparatus.

MATERIALS AND METHODS

Microbiological techniques: Yeast transformations were performed by the method of ITO et al. (1983). Rich medium containing glucose (YPD) and synthetic minimal medium (SD) were as described (SHERMAN et al. 1986). SC contains 0.5% casamino acid (Difco) and 100 mg/l each of uracil, adenine sulfate, and tryptophan in SD. WGal and SCGal are WD and SC, respectively, except that 2% glucose is replaced with 5% galactose and 0.3% sucrose. SGU and SCGal-U are SC and SCGal, respectively, lacking uracil. SGT is SC lacking tryptophan.

Strains, plasmids, and replacement of RHO3 The yeast strains used are listed in Table 1 . Plasmids pRS314RH03 and

pRS316-RHO3 carry the l.&kb KpnI-XhoI fragment (Figure 1) of RH03 in centromeric plasmids pRS314 and pRS316 (SIKORSKI and HIETER 1989), respectively. Plasmid KS’-RH03 carries the 1.8-kb I.(pnI-XhoI fragment of RHO?in pBluescript KS’ (Stratagene). Plasmids pSRO6, pSR061, pSRO6-2, and pSRO6-3, carrying SR06, were isolated previously (MATSUI and TOH-E 1992b) from a yeast genomic library based on the multiplecopy-plasmid YEp24 (CARLSON and BOTSTEIN 1982). pSRO6 was digested with SmaI and BstXI and ligated after blunting the BstXI overhang to construct pSRO6AB. pSRO6- 3 was digested with PuuII and ligated to construct pSRO6AP. The 3.5-kb Sall-Sac1 fragment from pSRO6-3 was inserted into pBluescript KS’, digested with HindIII, and ligated after blunting the HindIII overhang to construct pKSSRO6AH. To construct pSROGAH, the 3.5-kb Sall-Sac1 fragment from pKSSRO6AH was inserted into pY0326 ( O m et al. 1991), a highcopy-number plasmid that harbors the 2pm plasmid ori-

Yeast rho3 Mutants 361

H-ras

RH03

Val-12 &I-17 -34 "119 /

Val-25 A&-30 G-41 Ala-131 Asp198 &-228

K;

C E H B X

500bp RH03

FIGURE 1.-Mutations in H-rus and R H 0 3 (above) and the restriction map of R H 0 3 (below). The coding regions are represented by boxes. GTPase domains and CAAX motif are represented by black boxes. The Q n I site in the map is from the multicloning site of the original R H 0 3 clone (MATSUI and TOH-E 1992a). B, BumHI; C, BcA; E, Eco47III; H, HindIII; K, KpnI; V, EcoRV, and X, XhoI.

gin of replication in the URAS-containing pRS306 (SIKORSKI and HIETER 1989).

The mutant rho3 alleles, r h 0 3 ~ " " ~ ~ - , rhop;" , and were constructed with the oligonucleotidedirected

in vitro mutagenesis system (Amersham) using pRS314RH03 as a template and the following primers: 5'-TTGGGCGAC- GTCGCCTGTGGT ( r h 0 3 ~ " " ~ ~ ) , 5"GCCTGTGGTAAGAAT- TCGTTGCTGA ( rhoP; 'O) , 5"GTITATGAGTCGACTGTT- TTT ( r h 0 3 S " ~ ~ ) , and 5'CTAGAGTGCGCATTAAGAAACA

were constructed by replacing the sequence upstream of the BcA site (Figure 1) of with the corresponding sequence of rhojAFn-30 and respectively. rhop""3)" As@98 was constructed by replacing the se uence downstream of the Eco47III site (Fig- ure 1) of rhojA"- 31 with the corresponding sequence of rho3- 1, which was obtained by random mutagenesis (see text).

For the construction of multicopy plasmids carrying R H 0 3 and mutated rho3 alleles, the 1.8-kb QnI-XhoI fragment (Fig- ure 1) , carrying R H 0 3 or one of the mutated rho3 alleles, was inserted between K$nI and XhoI sites of pY0324 (OHYA et al. 1991), a high-copy-number plasmid that harbors the 2-pm plasmid origin of replication in the TRPl-containing pRS304 (SIKORSKI and HIETER 1989).

The construction of plasmids and method for the replacement of the R H 0 3 allele with mutant rho3 alleles were as follows. The 1.7-kb HindIII-Hind111 fragment, carrying the 3'- portion of the coding region and 3'-noncoding region of R H 0 3 (Figure 1), was inserted into the HindIII site of pUCll9 (VIEIRA and MESSING 1987), and the EcoRV site, located in the 3'-noncoding region of R H 0 3 (Figure l), was changed into a SmuI site by insertion of a SmuI linker (Takara syuzo, Tokyo) to obtain pUCRHO3-3'. The SmuI site of pJ280 UONES and PRAKA~H 1990) was changed into an XhoI site by insertion of an XhoI linker (Takara syuzo, Tokyo) and the 1.1-kb XhoI-SphI fragment, carrying TRPI, from the pJ280- derived plasmid was inserted between the XhoI site (in the 3'- noncoding region of RH03, see Figure 1) and the SphI site (in the multicloning site of pUC119) of pUCRH03-3' to obtain pYI3. Each of the 1.8-kb K$nI-XhoI fragments carrying R H 0 3 and mutant rho3 alleles was inserted between the KpnI site (from the multicloning site of pUCl19) and the SUA site (from the sequence of pJJ280) of pYI3 to obtain a plasmid for the replacement of the R H 0 3 allele. The resulting plasmids were digested with QnI and SmaI and introduced into cells by replacement transformation. Diploid cells (strain YPH501) were used to replace the R H 0 3 locus, and the resulting transformants were sporulated and dissected to obtain

(rh0yila-131). r h o p - 3 0 . Ala-131 and rh03%-47, Ala-I31

9

Trp' segregants carrying the mutated allele of RH03. The replacement of the R H 0 3 locus was confirmed by Southern blotting or tetrad analysis.

The allele was constructed by polymerase chain reaction (PCR SAIKI et ul. 1988). Using the convergent primers 5'-CCCAGATCTGAATTCAACATGTCATTTCTA- TGTG and 5"GGGAGATCTGAATTCAGCTGGATCCAC- TGTCAC, we amplified the fragment of the coding region of r h 0 3 ~ ~ ~ " ~ , where cysteine 228 was replaced with serine and a stop codon was inserted next to the serine codon (Figure 1). The 50-bp HzndIII (in the coding region)-EcoRI (from the sequence of the primer) fragment, encoding the C-terminus of from the amplified fragment was inserted between the HindIII and EcoRI sites of =+-RH03 to construct KS+-RH03Ser""R. To construct rh03~'~-"'* ser-22s,

the sequence downstream of the HindIII site (located in the R H 0 3 coding region; Figure 1) of rh03~""'" was replaced with the corresponding sequence of rho3"r"228. The 1.4-kb KpnI-EcoRI fragments carrying rhoym-228 and rh03~"-

and pYI3 (for replacement). The R H 0 3 alleles under the control of the GAL7 promoter

(pGAL7:rho3) were constructed as follows. The complete R H 0 3 coding region was amplified from each of the mutated rho3 genes by PCR using the two convergent primers, 5"CCG AGATCTGAATTCAACATGTCTCTATGTG and 5'-CCG AATTCAGATCTACATAATGGTACAGCTG, or using the

rimers for the construction of rhop-228, in the case of rho3s""- '28. The amplified fragments, digested with BgAI, were inserted into the BgAI site of YIpUGAL7 (MATSUI and TOH-E 1992b). The resultant plasmids were digested with StuI and introduced into cells to be integrated at the ura3 locus.

When PCR or the oligonucleotidedirected mutagenesis method was used, the sequences of the resultant R H 0 3 regions were determined to confirm the precise replication during the procedures. Nucleotide sequences were determined by the method of SANCER et al. (1977).

Suppression of rho3 A Arho3 disruptant (strain YMR505), which carries pGAL7:RHO4 ( R H 0 4 under the control of the GAL7 promoter), grows poorly on glucose-containing medium, but grows well on galactose-containing medium because R H 0 4 can serve as a multicopy suppressor of rho3 (MAT- SUI and TOH-E 1992a,b). YMR505 with a multicopy plasmid based on YEp24 (BOTSTEIN et al. 1979) or pY0326 (OHYA et al. 1991), growing on SGal-U, was streaked on SC-U or YPD and incubated for 3 days at 30".

Isolation of a temperaturesensitive allele of RHO3 pRS314RH03 was mutagenized by treatment with hydroxylamine as described by HASHIMOTO and SEKICUCHI (1976). Two micrograms of DNA were incubated with 3.6 mM hydroxylamine hydrochloride at 37", and fractions were recovered during the incubation of 24-48 hr. The treated DNA was introduced into Escherichia coli to amplify the DNA. The amplified DNA was introduced into Arho3 Arho4 pGAL7:RHO4 cells (strain YMR510). The resulting transformants were streaked on two WD plates, and one plate was incubated at 25" and the other at 37". Transformants that grew at 25" but not at 37" on YPD were selected and plasmids were recovered from the transformants. The recovered plasmids were reintroduced into YMR510 to test whether the plasmid conferred the Ts- phenotype on YPD plates. R H 0 3 in the wild-type strain YPH501 and the Arh04 strain YMR402 was replaced with rho3 from each of the candidate plasmids using pYI3 (see above) by replacement transformation. When the Trp+ segregants from the transformed diploid displayed the Ts- phenotype, we judged that the rho3 allele used in the transformation was a temperature-sensitive allele of RH03.

Anti-Rho3p antisera: EcoRI-EcoRI fragment from pOPR3

I 3 I , &r-228 were inserted into pY0324 (for overexpression)


(MATSUI and TOH-E 1992a), carrying the RH03coding region, was inserted into the EcoRI site of pCEXKG vector for production of GST-fused Rho3p in E. coli. Purification of the GST- fused protein was performed as described previously (SHIRA- YAMA rf al. 1995). The purified GST-fused RhoJp was used as an antigen to raise anti-Rho3p antibodies in rabbits.

Morphological observations: Cells were stained with rhodamine-phalloidin (to reveal actin filaments), and 4',6'diami- dino-2-phenylindole (DAM) (to reveal DNA) as described (PRING1.E: rf nl. 1989). Samples were observed with an epiflu- orophotomicroscope (Olympns RH-2).

Assay for the secretion of invertase: The assay method was described by GOI.IKTE:IN and ~ M P E N (1975). rho3 cells, sed- 2 cells (for the control of a secretiondeficient strain), and wild-type cells were cultured in WD with 5% glucose, harvested, and inoculated into WD that contained 0.2% glucose instead of 2% and incubated at nonpermissive temperatures. Aliquots of the culture were fractionated after 0, 1, 2, 3, and 4 hr from the inoculation and activities of invertase were measured.

RESULTS

Identification of temperature-sensitive rho3 mutants: Arho3 cells grow very slowly at 25, 30, and 37", whereas Arho3 Ark04 cells do not grow at 30" or above (MATSUI and TOH-E 1992a; data not shown). Therefore we screened temperature-sensitive alleles of R H 0 3 in a Ark03 Arho4- background. As a result, a temperature- sensitive allele of RH03, designated rho3-I, which conferred temperature-sensitive growth on Arho3 Arho4 cells when introduced, was isolated by random mutagenesis with hydroxylamine. rho3-1 Arho4 cells (strain YMR3732-5D) did not grow at 37" and, unexpectedly, rho3-l RH04 cells (strain YMR3732-2B) also did not grow at 37" (Figure 2A; see DISCUSSION). Disruption of RH04 enhanced the Ts- phenotype of rho3-1 cells; the rho3-1 Arho4 strain YMR3732-5D did not grow at 34" whereas the rho3-I strain YMR3732-2B grew poorly at 34" (data not shown). The Ts- growth phenotype of rho3-1 cells was recessive since introduction of RH03on a centromeric plasmid suppressed the Ts- phenotype of the rho3-1 strain (data not shown).

Determination of the nucleotide sequence of the rho3-I coding region revealed that nucleotide 593 on the coordinate of the R H 0 3 sequence (MATSUI and TOH-E 1992a) was mutated from guanine to adenine. This mutation resulted in the substitution of glycine 198 for aspartate (Figure 1). The replacement of the sequence between the BdI and BnmHI sites (Figure 1) in the wild-type RH03 with the corresponding segment of the rho3-I mutant gene resulted in a temperature sensitive allele of R H 0 3 (data not shown). This indicated that this mutation is responsible for the Ts- phenotype. The substituted residue is not located in the conserved motifs for binding and hydrolysis of GTP, but i t is highly conserved within the Ras superfamily. The corresponding residue in all members belonging to the Ras superfamily, with the exception of human K-ms2A, is glycine or asparagine. It is possible that this

10" IC

1 0" 0 4 8 1 2 0 4 8 1 2

TIME (h)

FIGURE 2.-Growth of rho?--I and r h 0 3 ~ ~ ' ~ ~ cells. (A) rho?- 1 Art104 strain YMR3732-5D (a). rlto?-l strain YMR3732-2B (b) , rh03'"'~'~ Arh04 strain YJR95B (c), r h 0 3 ~ ' ~ ~ ~ ~ strain YJR% 5A (d), Arho4strain YMR400 (e), and wild-type strain WH.500 (0 were streaked on WD plates and incubated for 2 d a y at the indicated temperatures. (R and C) rho?-I Aril04 strain YMR3732-5D (B) and rt~03~~~'~Ar/zo4strain YJR95B (C) growing exponentially in WD at 25" were split and either shifted at time zero to 37" or grown at 2.5". Cells were harvested at the times indicated and counted using a counting chamber. 0, 25"; ., 37".

residue is important for the stability of small GTPases at elevated temperatures.

The cysteine residue in the CAAX motif at the G terminus of the Rastype and Rho-type GTPases is modi- fied by prenylation and is important for the function of the GTPases (BARBACID 1987; ZIMAN d nl. 1991). The Gterminal sequence of RhoSp, Cys-Thr-Ile-Met, corre- sponds to this motif (Figure 1). We constructed rho3""-

, which encodes Rho3p terminating in Ser instead of Cys-Thr-Ile-Met (Figure 1). A rfto3%-22" strain (YJR55A) grew normally at 25", but did not grow at 37" (Figure 2A). Disruption of RH04 enhanced the Ts- phenotype of rho3k-22" cells; the rh03"".~'" Arho4 strain vR3-5B did not grow at 34" whereas the r h 0 3 ~ ~ ~ ~ " strain YJR3-5A grew poorly at 34" (data not shown). The Ts- phenotype was recessive since YJR3-5A carrying R H 0 3 on a centromeric plasmid was Ts' (data not shown).

As both rho3-1 and rho3s7.z28 were recessive alleles and overexpression of either alleles from the GAL7 promoter did not confer any dominant effect on cell growth (data not shown), we conclude that both rho3-I and rho3k-22" mutations are loss-of-function mutations. These results indicate that the CAAX motif of Rho3p is required at elevated temperatures.

228


Western-blot analysis using anti-Rho3p antibodies revealed that the amounts of Rho3p in both the rh03-I and r h 0 3 ~ - ~ ~ " strains were reduced at 37", suggesting that the reduced amounts of Rho3p might confer the temperature sensitivity of the rho3 strains. However, both the rho3-I strain carrying rh3-I on a multicopy plasmid and the rh03"~-~'~ strain carrying rh03~~~' '~ on a multicopy plasmid produced larger amounts of Rho3p than did the wild-type strain at 37". The temperature sensitivity of these strains were slightly weakened, com- paring with the Ts- rho3 strains without the plasmids, but yet these rlzo3strains with the plasmids still displayed the temperature-sensitive phenotype (data not shown). These results indicate that reduction of the Rho3p activ- i ty at nonpermissive temperature, rather than the reduced amount of Rho3p, is responsible for the temperature sensitivity of the rho3 strains.

The morphology of temperature-sensitive rho3 cells ut nonpermissive temperatures: For elucidating the role of RhoSp, we observed the morphology of the Ts- rho3 mutant cells at nonpermissive temperatures. In this study, we examined the phenotypes of Ts- rho3 strains in the Arlzo4 background, as well as in the RH04+ background, because it is possible that the Rho3prelated activity from RH04 might affect the phenotypes of the Ts- rho3 strains.

Growth of both the rho3-1 Arho4 strain YMR3732-5D and the rho3~-22s Arho4 strain YJR3-5B arrested after about 6-8 hr from a shift to 37" (Figure 2, B and C ) , and the viability of these cells began to be reduced at this time (data not shown). These Ts- rho3 Arho4 cells became enlarged and rounded 6 hr after the shift to 37" (Figure 3, B and E), and actin patches lied scattered throughout the cell surface and few actin cables were observed (Figure 3, D and G). In contrast, in the rho3 Arho4 cells at 25", actin patches were concentrated in the bud and actin cables ran through the mother cell (data not shown) as observed in wild-type cells (Figure 3A; ADAM and PRINCLE 1984; KILMARTIN and ADAMS 1984). Similar results were obtained with cells of the RH04+ background ( i .e . , using rho3-1 strain YMR3732- 2B and rho3"r~22" strain YJR35A), except that these rho3 strains required longer incubation (9- 11 hr) at 37" for cell growth arrest (data not shown). These observations indicate that the rho3 cells lost cell polarity at nonpermissive temperatures and grew more isotropically than wild-type cells. During incubation of the Ts- rho3strains (strains YMR3732-5D, YJRMB, YMR3732-2B, and Y J R 3 5A) at 37", the fractions of unbudded cells, small-budded cells, and large-budded cells all were about 28- 36% of total cells and the proportions did not vary noticeably. In this regard, the phenotype is different from that of mutants affected in bud emergence ( . g . , the cdc42 mutant), which are arrested uniformly as unbudded cells (ADAMS et nl. 1990). To examine this point more precisely, we constructed rho3 Altel cells. LIE1 is required for the termination of M phase at low tempera-

FIGIXI. J . -Morpl lo loq 01' rho3 T s . cclls. M'iltl-type strain YPH.NO(A), rh3-1 Art104 strain MilR5752-51) (B-I)), and r/l "j%\jT.??X A r h 4 strain YJRMR (E-G) growing exponentially in YPD at 25" were shilted to Sf " . Cclls were harvested 8 hr after the shift and stained with rhodamine-phalloidin (A, D, and G) and with DAPI (C and F). ( B and E) Phase-contrast. bar, I O pm.

tures and at 11" Alkl cells are arrested uniformly at telophase (SHIRAYAMA nl. 1994). The r h 0 3 ~ - ' ~ ~ Arho4 Altel cells (strain YJLR13) that were arrested at telophase by the incubation at 11" were shifted to 37". The fraction of the small-budded cells was <5% of total cells at the shift but became "34% 8 hr after the shift to 37". These morphological observations strongly suggest that Rho3p is required to maintain cell polarity for bud growth but is not essential for the initiation of bud emergence.

Identification of a dose-dependent dominant rho3 mutation: For a complementary study, we introduced three mutations into RH03 that might confer dominant effects. Glycine 25 was replaced by valine in rlm31"'"'5, and aspartate 131 was replaced by alanine in rlto3"""'3', producing mutant Rho3ps analogous to the constitu- tively activated products of the human H-rtls"""" and H-

was replaced by asparagine, producing a mutant Rho3p analogous to the H-rn.8""" product that binds tightly to the GTP-GDP exchange factor for ras proteins (ras GEF), depletes ras GEF, and thus confers a dominant inhibitory phenotype (Figure 1; POMFRS P I nl. 1989; BOURNE et nl. 1991; BOWSKI and MCCORMICK 1993).

I I9 , respectively (Figure 1). In threonine

364 J . Imai, A. Tohe and Y. Matsui

FIGLW 4.-Cold scnsitivitv o f ' cells carrying r/w3'"'"'. ( A ) Wild-type strain WH500 carrying multiplecopy plasmid pY0324 (a), and YPH.500 carrying r/~03'~'"~''. A/"- " (b) 1

(e), and (0 on pY0324 were streaked on SGU plates and

incubated at 15" for 1 week or at 30" for 2 days. (B) wild-type strain WH500 (a and b), r/203'~~'"~~' strain YJRSSA (c and d), and YJRSSA with pRS316RHO3 (e and f], a centromeric plasmid carrying RH03, were streaked on W D plates and incubated at 30" for 2 days or at 36" for 3 days.

For the overexpression of each of the mutated RH03 genes in wild-type cells (strain YPH500), we introduced multicopy plasmids carrying these mutant genes and also constructed cells carrying the mutant genes expressed from the GAL7 promoter. Both methods for overexpression produced essentially the same results. Cells expressing either rh03'"'"~~ or rho3'"~3'' grew a little more slowly than cells expressing wild-type IW03 (data not shown) and the morphology of the cells was normal. In contrast, cells expressing rho?'"'-'3' displayed a Cs- phenotype (Figure 4 A , sector f). Introduction of rho3"'".

on a centromeric plasmid did not suppress the Arho3 defect, whereas both rh03"""~~ and rho3"""" did, indicating that both rh03"""~ and rh03"'""' retain RH03 function but rh03"~"~-~"does not (data not shown). Western- blot analysis using anti-RhoSp antibodies revealed that almost the same amounts of Rho3p were produced from rh03"~"~*, ~ h 0 3 " ~ ~ - ~ ~ ~ , rho3A/,t-/ 31 , and wild-type RH03, on a multicopy plasmid (Figure 5), indicating that the rho3"1"-I 31 mutation alters RhoSp qualitatively.

We replaced one of the RH03 genes in the wild-type diploid strain YPH501 with rh03""~~~', and cells were then sporulated and dissected. We obtained rh03"'""~' segregants only when spores were germinated at 234". The rh03""""' cells could not grow <SO" (Figure 4B, sectors c and d). The cold sensitivity of the rhoY1"'.'" cells was recessive because it was suppressed by one

rho3%-4i. A/n-/3/ (c), rhoy\/n./3/. A s p / ' M (d), rhoyl/n./3/. Sn-22X

r h o ~ / " . / 3 /

30

copy of RH03 (Figure 4B, sectors e and f) , and r } z o p I 31 /+ diploid cells grew well at low temperatures (data not shown). These results indicate that rh03'~~'""~ is a dose-dependent dominant mutation.

Characterization of rh03""'"': In contrast to the dominant active mutation rn.~'"'"''y, the corresponding cI)(.42'\l".I I S A , mutation is reported to act as a dominant

inhibitory mutation like rd1"r-17 (ZIMAN and JOHNSON 1994). Dominant inhibitory mutations confer almost the same phenotypes as those displayed by cells carrying Ioss-of-function mutation; e . 6 , C Z I C ~ , P " " ~ cells fail in cell polarization like cdc42-I cells under restrictive con- ditions. In this context, is likely to be a dominant active mutation and not a dominant inhibitory one, because the phenotypes displayed by cells express-

were different from those displayed by rho3-1 cells and A r h 3 disruptants (see below and MAT- SUI and TOH-E 1992b).

To test this hypothesis, we combined loss-of function mutations with rh03'"''-'~~. Mutations in the effector domain of Ras (P.R., H-~SI;"'~; Figure l ) suppress the effect of dominant active mutations (BARBACID 1987; BOURNE d nl. 1991; BOGUSKI and MCCORMICK 1993). rh03j"~', where proline 47 in the putative effector domain of RhoSp was replaced with serine, produced nonfunctional Rho3p; rho3%"li on a centromeric plasmid could not complement the Arho3 deletion (data not shown). Both cells harboring rho3*-". on a multicopy plasmid and cells expressing rh03%.~'* '1""131 from the GAL7 promoter did not display cold sensitivity (Figure 4 A , sector c). Western-blot analysis using anti-RhoSp antibodies revealed that almost the same amounts of RhoSp were produced from rh03*~~, rh03""-'~', and rh413~~'. (data not shown). These results indicate that the putative effector domain is critical for RH03 function and for the dominant effect of rh03"'""~'.

The loss-of function mutation rho3"'""", corresponding to rn.c'1'""7, also suppressed the Cs- phenotype; cells

on a multicopy plasmid grew normally at 15" (Figure 4 A , sector b). This result is analogous to that obtained with the dominant active mutation rn.?"1-12, which is suppressed intramolecularly by the dominant inhibitory mutation rn~~'n~17 (POWERS P/ nl. 1989).

Moreover, rho3%-22" and rho3-1 ( k . , rho3""g1yx), Ts- mutations producing loss-of-function, also suppressed the dominant effect of rhoP1'""3'; cells overexpressing

grew normally at 15" (Figure 4 A , sectors d and e). In addition, r}zo~11"'131. .%?22N cells (strain YJR3-IOA) could grow at 30" and grew slowly at 57" (data not shown), whereas r/zo3%-22,~ cells could not grow at 37" (Figure 2) and rho?1"""' cells could not grow at SO" (Figure 4B). These results indicate that the effect of the rh03"'""~' mutation was suppressed by the loss-of-function mutation and the reduction of RH03 function by the mutation is suppressed by the rh03"""'~' mutation. From

ing r}loylId 31

carwing rhoylsn-3~l. A b - l i 1

either r } z o ~ l I ~ r - 1 3 1 . Svr-228 or r ~ o ~ l l ~ - 1 3 1 . As/+IYX


FIGURE 5.-Morpholop of cells producing activated RhoJp. P(;AI-7:1~~03strain YJRS-OA (A) and pGAI ,7 : r /~o~'" ' '~ ' strain YR3- 9A (D and E) growing ex onentially in SCGal-U at 30" were shifted to 15" (A, D, and E). Cells were harvested 48 hr after the shift and stained. rho3".''Pstrain YJRS8A growing exponentially in YPD at 36" was shifted to 25" (B and C). Cells were harvested 6 hr after the shift and stained. Cells were stained with rhodamine-phalloidin (A, C, and E). (B and D) Phasecontrast. The bar shown in C (valid for A-C) and the bar in E (valid also for D) represent 10 pm.

these results, we conclude that the rh03+~""'~' mutation behaves as do dominant active mutations of the Ras superfamily.

Morphology of Y ? z o ~ - * ~ ' cells: Cells harboring rh03""'3'

expressed from the GAL7 promoter (pGAL7:rh3"h-13' strain YJR39A), growing in galactose-containing medium at 30°, were shifted to 15"; 12 hr after the shift, the pGAL7:rh3"h"3' strain became elongated and bent (Figure 6D), whereas cells harboring wild-type RH03 expressed from the GAL7promoter (pCAL7:RH03) displayed almost normal morphology (Figure 6A). In the pGAL7:rh31""'3' cells, actin patches were concentrated in the bud neck and/or in the mother cells, in addition to (or instead of) the bud, where wild-type cells preferentially concentrate actin patches. The positions of the actin patches often cor- responded to the points of the cell surface elongated or bent in pGAL7:dKd"'"13' cells (Figure 6E). A similar aberrant cell shape was observed in the rh3'""13' strain. When the rh3"""13' strain YJCMA growing at 36" was shifted to 25", the cells arrested growth 6 hr after the shift and be-

FIGURE 6.-Amount of Rho3p in the cells carrying multiple copies of RH03. Cell lysate (containing -5 pg of total protein) from wild-type strain YPH5OO (lane l) , Arho3 strain YMR505 (lane 2), and wild-type strain YPH500 with the pY0324based multicopy plasmid carrying RH03 (lane S),

(lane 41, RHO?"""' (lane 5), and (lane 6) was fractionated by SDSgel electrophoresis and analyzed by Western-blot analysis using anti-RhoSp antibody. An arrow indicates the migrating position of RhoJp.

~ ~ 0 3 W 0 . 2 5

came long, thin and bent (Figure 6B). The organization of actin filaments was aberrant as observed in the pGAZA7:rh3"'""3' cells at nonpermissive temperatures (Fig- ure 6C).

Characterization of SR06 and genetic interactions between SR06 and RHO3 Previously, we identified SR06 as a multicopy suppressor of rho3 (MATSUI and TOH-E 1992b). The suppression activity was mapped to the region containing a PVuII site (Figure 7). The nucleotide sequence of this region was identical to that of SEC4 (data not shown) and disruption of the SEC4 OW by introducing a frameshift mutation at the internal Hind111 site abolished the suppression activity (Figure 7, pSROGAH), indicating that SRO6 is SEC4. In contrast, RH03 did not serve as a multicopy suppressor of sec4 because neither a high dose of RH03 nor expression of rho3"""'3' suppressed the Ts- phenotype of sec42cells at 36" (data not shown). The possibility of a synthetic-

B S B I I I suppression

Of d r h d

pSRO6 + pSR06-1 + pSR06-2 + pSRO6-3 + pSR06AP - pSRO6AH - - pSRo6AB pH . . . +

I . B

SEC4

._I ,05kb,

FIGURE 7.-Map of SR06. The restriction map of the SR06 region is shown at the top. Inserts of the plasmids were dia- grammed below the map. A, the position of the filling-up of the Hind111 overhang. Suppression activities were summarized in the right panel (+ and - indicate growth and no growth, respectively, of Arho3 cells harboring the plasmids indicated in the left). Open arrows represent the coding region of SEC4. P, I'uuII; B, BslXI; H, HindIII; and S, Sad.

366 J . Imai, A. Toh-e and Y. Matsui

I FI~;I'KI;. X.-(;cnctic interaction l~ct~vccn /U /Oi and . W X .

(A) s~r4-2 strain YJS4-'LA ( a ) , Ad104 strain YMR400 (b), 1-1103- I strain YMR3732-213 (c), rl103-1 Art104 strain WR3732-5D (d), .wr4-21-110?-1 strain YJRS34-12A (e), and s~r-4-2 rh?-I A r h 4 strain YJRS34-12R (0 were streaked on W D plates and incubated at 1.5' for 1 weck, at 2.5" for 2 days, or at 28" for 2 davs. (l3) srr4-2 p~;A1,7:1-/703~"~'" strain YJRS34-92A (a ) , srr4-2 strain YJS4-'LA carrying M UGal7, a control Mp plasmid (h), and SEC4' /KAI~7:r/t03~"" strain YJRWA (c), were streaked on a SCGaI-U plate and incubated at 25" for 3 davs.

lethal interaction between RH03 and SEC4 was tested as follows. The SPI-4-2 strain YJS42A was crossed with the rho3-1 A r h 4 strain YMR3732-5D and the resulting diploid was analyzed by tetrad analysis. s~r4-2, rho3-I, SPI-4-2 Arho4, and rh3-I Arho4 segregants grew below 31". However, SPI-4-2 rho3-l and m 4 - 2 rho3-I A r h 4 segregants could not grow at 28" or above and also showed a Cs- phenotype; they grew very poorly below 20" (Fig- ure SA). These phenotypes indicate synthetic lethality between rh3-I and SPI-4-2. The growth defect of SPI-4-2 rh3-1 segregants and wr4-2 rh3-I Arho4 segregants at 28" and 20" was suppressed by either RH03 or SIX4 on a centromeric plasmid (data not shown).

We tested whether the SPI-4-2 mutation suppressed the cold sensitive phenotype of pGAL7:r/~,o~'"'."' cells. pGAI,7:r/zo~"'""' was introduced into SPI-4-2 cells and into isogenic wild-type cells (SI.:C4+ cells). As observed in the experiments described above, !XC4' cells expressing rI103"""'~' grew very poorly at 25" and were elongated. I n contrast, ser4-2 cells expressing r/~oY~""'~' grew well at 25" (Figure 8B) and were less elongated than the pGA1A7:rho2"'""3' SI:'C4+ cells (data not shown). None of the .~Pc~--sPI-23 mutations, except for .w4 , suppressed the cold sensitivity of cells expressing rho3"""'" (data not shown).

The genetic interaction between RH03and SEC4sug- gested the possibility that Rho3p might be involved in

the secretory process. We tested whether the mutation in RH03 conferred a secretiondefective phenotype by measuring secreted invertase activity of rho3 cells. No significant defect in invertase-secretion was detected in the Ts- rho3 cells (strains YMR3732-2B, YMR3732-5D, YJR3-5A, and YJR35B) incubated at 37" and in rho3"'"'"' cells (strain YJR38A) incubated at 25", although the secretion of invertase was not detected in sec4-2 cells (strain YJS42A) 1 hr after the shift to 37" (data not shown). This result indicates that rho3 mutants do not show a Sec- phenotype.

DISCUSSION

Mutations in RH03 can cause temperature*ensitive g o d The temperature-sensitive mutations rho3-1

) and rh03~~' '~ are loss-of-function mutations because they are recessive and have no dominant effects on cell growth, even when overexpressed. In contrast to the fact that both rho3-l cells and rh03\""'" cells could not grow at 37", the Arho3 cells grow slowly at 37". Thus, the presence of a nonfunctional RhoSp, rather than the lack of function @ ~ S P , is inhibitory and the temperature- sensitive rho3 mutations differ from simple loss-of-function mutations. An analogous case has been reported in Dbf2p kinase. DBF2 and DBF20 encode a pair of functionally redundant kinases and deletion of DRF2 is lethal only when DBF20 is deleted (TOW P/ al. 1991). However, dbj2 loss-of-function mutations are conditionally lethal even in the presence of the wild-type DBF20 gene. This may be because the nonfunctional Dbf2p sequesters SpolPp, a limiting factor for both the kinases, from Dbf20p (PARKES andJoHNsToN 1992; TOW andJOHNSTON 19%). As a high dose of RH04 comple- ments Arh03 (MATSUI and TOH-E 1992a), it is possible that Rho4p can substitute for Rho3p in the Rho3p pathway. The survival of Arho3 cells requires Rho4p since Arho3 cells did not grow at 30" and above the temperatures (MATSUI and TOH-E 1992a). Therefore, it is highly conceivable that the nonfunctional Rho3p, which may still interact with the component(s) of the Rho3p pathway, prevents Rho4p from substituting for Rho3p in the pathway and Rho4p can replace Rho3p efficiently only in the absence of Rho3p.

Characteristics of various mutations of RHO3 Among various rho3 mutants (Figure 1 ) , rho?""' " is a dominant active mutation analogous to those reported for other members of the Ras superfamily, P.g.,

(BARBACID 1987; ZIMAN et al. 1991). However, the dosedependence displayed by r ~ , o ~ \ / f l - / 3 ' is a novel characteristic, because the other dominant active mutations of the Ras superfamily are dominant, independent of the dose. The recessive phenotype of r/1oP'"""' (Figure 4B) suggests that Rho3p may require a factor to mediate coupling with a putative Rho3p effector to exert its function. Assuming that Rho- 3pAla-131 has less affinity for the unknown factor than

( rhoy\ \/+ I ")s

H-raS/<J-//V and cI)C42\+8/-/2


wild-type Rhosp, in the presence of wild-type Rhosp, an increased amount of RhoSpAla-131 would be required for efficient coupling with the factor and thus with the effector, but in the absence of wild-type Rho3p, Rho3pAla-131 can couple efficiently with these factors. It has been reported that rho GDI, which binds to Rho- type GTPases, has a potential activity of transferring the Rho-type GTPase in a membrane-attaching state to that in a cytosol-localizing state, and vice versa (TAKAI et al. 1992). A molecule required to transport Rhosp to the effector is a candidate for the unknown factor.

The RH03 function is involved in cell polarity maintenance: Ts- rho3 cells lost cell polarity at nonpermissive temperatures and displayed defects in bud growth, indicating that Rho3p is required to maintain cell polarity for bud formation. By the following criteria, RHO? mutants are different from those of CDC42, which is critical for the initiation of bud emergence. (1) Ts- cdc42 mutants are arrested uniformly as depolarized unbudded cells (ADAMS et al. 1990), whereas the fraction of unbudded cells in the Ts- rho3 cells at nonpermissive temperatures did not increase significantly. (2) The multibudded cells are accumulated in the culture of cells expressing dominant active mutant CDC42 (ZIMAN et al. 1991), whereas cells expressing rho?’-’’’ did not show the phenotype. These differences and the result that the synchronized Ts- rho3 cells could initiate bud emergence at 37” strongly suggest that Rho3p is not critical for the initiation of bud emergence.

In a previous study, we observed that Arho3 Arho4 cells died as lysed small-budded cells (MATSUI and TOH-E 1992b). This terminal morphology is different from that of Ts- rho3 cells. However, when the osmolar- ity of the culture medium for the Arho3 Arho4 cells was adjusted to prevent the abortive cell lysis, the Arho3 Arho4 cells arrested as depolarized cells with a terminal morphology similar to that of the Ts- rho? cells (MATSUI

and TOH-E 199213). These results indicate that a primary defect caused by absence of RH03 function is loss of cell polarity.

Rho3p is involved in determining the positions for surface growth: The locations at which actin patches are organized and exocytosis is executed are arranged dynamically under the control of cell polarity functions in order that the proper region of cell surface in the bud grows. The dosedependent dominant active rho? causes mislocalization of actin patches, and the cells become elongated and bent, often at the position where actin patches were concentrated (Figure 6, D and E). These phenotypes of cells expressing rhoy’a-’3’ suggest that Rho3p plays an important role in directing the organization of the actin cytoskeleton and the localization of the machinery for exocytosis. In this context, it is noteworthy that RH03 interacts genetically with SEC4. Sec4p is involved in exocytosis. The defect and acceleration of an upstream factor can be suppressed by an acceleration and a defect, respectively, of the down-

stream factor in the same pathway. In this study, we found that SEC4 can serve as a multicopy suppressor of rho? and that the cold sensitivity of the r h 0 9 ~ ” ~ ’ mutant is suppressed by the sec4-2 mutation. These genetic interactions between SEC4 and RH03 suggest that RH03 functions upstream of SEC4. However, rho? mutants did not display a Sec- phenotype, indicating that Rh03p does not play a direct role in secretion. The close relationship between the actin cytoskeleton and the vectorial transport of secretory vesicles has been observed in studies on yeast actin and actin-binding proteins Myo2p (myosin), Tpmlp (tropomyosin), and actin capping proteins (NOVICK and BOTSTEIN 1985; JOHNSTON et al. 1991; AMATRUDA et al. 1992; LIU and BRETSCHER 1992). We interpret the genetic interaction between SEC4 and RH03 to indicate that the RH03 pathway functions u p stream of the SEC4 pathway; that is, the RH03 pathway is involved in the organization of the actin cytoskeleton that affects the SEC4 pathway for exocytosis.

During bud formation many factors are required, and protein-protein interactions among some of these factors have been reported. Cdc24p, the GEF for Cdc42p, which is required for cell polarity establishment, interacts not only with Cdc42p but also with Rsrlp/Budlp, which is involved in the determination of the bud site (SLOAT et al. 1981; BENDER and PRINGLE 1989; CHANT and HERSKOWTZ 1991; ZHENC et al. 1994, 1995). In addition, the Cterminal half of Bemlp interacts with Cdc24p (PETERSON et al. 1994), and the SH3 domain of Bemlp binds the Boi proteins that are required for bud formation (Y. MATSUI, R. MATSUI, R. AKADA, and A. TOH-E, unpublished results; L. BENDER, H. LO, H. LEE, J. PETERSON, and A. BENDER, Indiana University, personal communication). These protein-protein interactions strongly suggest that formation of a protein complex at the bud site (bud-site complex) is required for bud formation. The fact that RHO? can serve as a multicopy suppressor of boi mutations (Y. MATSUI, R. MATSUI, R. AKADA, and A. TOH-E, unpublished results; L. BENDER, H. Lo, H. LEE, J. PETERSON, and A. BENDER, Indiana University, personal communication), along with the fact that BEMI and CDC42 can serve as multicopy suppressors of rho3, suggests that Rho3p par- ticipates in the assembly of the complex. It has been reported in mammalian cells that Rho-type GTPases regulate the formation of the actin cytoskeleton during membrane ruffling and the assembly of focal adhesions, actin stress fibers, and microspikes (RIDLEY and HALL

1992; RIDLEY et al. 1992; KOZMA et al. 1995). During the formation of focal adhesions, a protein complex including talin, vinculin, and integrin functions as an actin nucleation site (BURRIDGE et al. 1988). It is likely that yeast Rho-type GTPases control the assembly of the protein complex that acts as an actin nucleation site to organize the actin cytoskeleton for bud growth. The bud-site complex is probably dynamic throughout the cell cycle to coordinate proper bud growth and must


be stabilized, dissociated, and reassembled according to the stages of bud growth (LEW and REED 1995). We postulate a model in which RHO3function controls the stability and development of the bud site complex that finally tethers the cytoskeleton and secretory machinery for exocytosis.

We thank R. RUGGIERI for the critical reading of this manuscript. We thank A. N M O for providing sec mutants used in this study and for his helpful discussions. We thank R. MATSUI for her technical assistance and A. BENDER for communication of unpublished results. Part of this work was supported by a grant for scientific work from Monbusho; J.I. is a recipient of the Fellowship of the Japan Society for the Promotion of Science for Japanese Junior Scientists.

LITERATURE CITED

ADMs, A. E. M., and J. R. PRINGLE, 1984 Relationship of actin and tubulin distribution to bud growth in wild-type and morphogenetic-mutant Saccharomyces cermisiae. J. Cell Biol. 98: 934-945.

ADMs, A. E. M., D. I. JOHNSON, R. M. LONGNECKER, B. F. SLOAT and J. R. PRINGLE, 1990 W C 4 2 and CDC43, two additional genes involved in budding and the establishment of cell polarity in the yeast Saccharomyces cerevisiae. J. Cell Biol. 111: 131-142.

AMATRUDA, J. F., D. J. GATTERMEIR, T. S. KARPOVA and J. A. COOPER, 1992 Effects of null mutations and overexpression of capping protein on morphogenesis, actin distribution and polarized secretion in yeast. J. Cell Biol. 119: 1151-1162.

BARBACID, M., 1987 ras genes. Annu. Rev. Biochem. 56: 779-827. BENDER, A,, and J. R. PRINGLE, 1989 Multicopy suppression of the

cdc24 budding defect in yeast by W C 4 2 and three newly identified genes including the rmrelated gene RSRI. Proc. Natl. Acad. Sci. USA 86: 9976-9980.

BENDER, A,, and J. R. PRINGLE, 1991 Use of a screen for synthetic lethal and multicopy suppressee mutants to identify two new genes involved in morphogenesis in Saccharomyces cerevisiae. Mol. Cell. Biol. 11: 1295-1305.

BOGUSKI, M. S., and F. MCCORMICK, 1993 Proteins regulating Ras and i t s relatives. Nature 366: 643-654.

BOTSTEIN, D., S. C. FALCO, S. E. STEWART, M. BRENNAN, S. SCHERER et al., 1979 Sterile host yeasts (SHY): a eukaryotic system of biological containment for recombinant DNA experiments. Gene 8: 17-24.

BOURNE, H. R., D. A. SANDERS and F. MCCORMICK, 1991 The GTPase superfamily: conserved structure and molecular mechanism. Na- ture 349 117-127.

BOWSER, R., and P. NOVICK, 1991 Secl5 protein, an essential component of the exocytotic apparatus, is associated with the plasma membrane and with a soluble 19.5s particle. J. Cell Biol. 112 1117-1131.

BURRIDGE, IC, K. FATH, T. KELLY, G. NUCKOLLS and C. TURNER, 1988 Focal adhesions: transmembrane junctions between the extracellu- lar matrix and the cytoskeleton. Annu. Rev. Cell Biol. 4 487-525.

CABIB, E., R. ROBERTS and B. BOWERS, 1982 Synthesis of the yeast cell wall and its regulation. Annu. Rev. Biochem. 51: 763-793.

CARISON, M., and D. BOTSTEIN, 1982 Two differentially regulated mRNAs with different 5’ ends encode secreted and intracellular forms of yeast invertase. Cell 28: 145-154.

CHANT, J., and I. HERSKOWTZ, 1991 Genetic control of bud site selection in yeast by a set of gene products that constitute a morphogenetic pathway. Cell 65: 1203-1212.

CHANT, J., K. CORRADO, J. R. PRINCLE and I. HERSKOWITZ, 1991 Yeast BlD5 , encoding a putative GDP-GTP exchange factor, is necessary for bud site selection and interacts with bud formation gene BEMI. Cell 65: 1213-1224.

C H E N E ~ R T , J., K. CORRADO, A. BENDER, J. PRINGIX and I. HERSKOW- ITZ, 1992 A yeast gene (BEMI) necessary for cell polarization whose product contains two SH3 domains. Nature 356: 77-79.

DRUBIN, D. G, 1991 Development of cell polarity in budding yeast. Cell 65: 1093-1096.

FIELD, C., and R. SCHEKMAN, 1980 Localized secretion of acid phos- phatase reflects the pattern of cell surface growth in Saccharomyces cerevisiae. J. Cell Biol. 86: 123-128.

GOLDSTEIN, A., and J. 0. LAMPEN, 1975 P-D-Fructofuranoside fruc- tohydrolase from yeast. Methods Enzymol. 42: 504-511.

HASHIMOTO, T., and M. SEKIGUCHI, 1976 Isolation of temperature- sensitive mutants of R plasmid by in vitro mutagenesis with hydroxylamine. J. Bacteriol. 127: 1561-1563.

ITO, H., Y. FUKUDA, K. MURATA and A. KIMURA, 1983 Transforma- tion of intact yeast cells treated with alkali cations. J. Bacteriol. 153: 163-168.

JOHNSON, D. I . , and J. R. PRINGLE, 1990 Molecular characterization of CDC42, a Saccharomyces cerevisiae gene involved in the develop rnent of cell polarity. J. Cell Biol. 111: 143-152.

JOHNSTON, G. C., J. A. PRENDERGAST and R. A. SINGER, 1991 The Saccharomyces mevisiae MY02 gene encodes an essential myosin for vectorial transport of vesicles. J. Cell Biol. 113: 539-551.

JONES, J. S., and L. PRAKASH, 1990 Yeast Saccharomyces cerevisiae se- lectable markers in pUC18 polylinkers. Yeast 6: 363-366.

KILMARTIN, J. V., and A. E. M. ADAMS, 1984 Structural re- arrangements of tubulin and actin during the cell cycle of the yeast Saccharomyces. J. Cell Biol. 98: 922-933.

KOZMA, R., S. AHMED, A. BEST and L. LIM, 1995 The Ras-related protein Cdc42Hs and bradykinin promote formation of periph- eral actin microspikes and filopodia in Swiss 3T3 fibroblasts. Mol. Cell. Biol. 15: 1942-1952.

LEW, D. J., and S. I. REED, 1995 Cell cycle control of morphogenesis in budding yeast. Curr. Opin. Genet. Dev. 5: 17-23.

LIU, H., and A. BRETSCHER, 1992 Characterization of TPMl dis- rupted yeast cells indicates an involvement of tropomyosin in directed vesicular transport. J. Cell Biol. 118: 285-299.

MATSUI, Y., and A. TOH-E, 1992a Isolation and characterization of two novel ras superfamily genes in Saccharomyces mevisiae. Gene 114 43-49.

MATSUI, Y., and A. TOH-E, 199213 Yeast R H 0 3 and RH04 rac superfamily genes are necessary for bud growth, and their defect is suppressed by a high dose of bud formation genes CDC42 and BEMI. Mol. Cell. Biol. 12: 5690-5699.

NOVICK, P., and D. BOTSTEIN, 1985 Phenotypic analysis of temperature-sensitive yeast actin mutants. Cell 40: 405-416.

NOVICK, P., and R. SCHEKMAN, 1979 Secretion and cell surface growth are blocked in a temperature-sensitive mutant of Succharo- myces cerevisiae. Proc. Natl. Acad. Sci. USA 76: 1858-1862.

et al., 1991 Yeast CALI is a structural and functional homologue to the DPRI(RAM) gene involved in ras processing. J. Biol. Chem.

PARKES, V., and L. H. JOHNSTON, 1992 SP012 and SIT4 suppress mutations in DBF2, which encodes a cell cycle protein kinase that is periodically expressed. Nucleic Acids Res. 2 0 5617-5623

PETERSON, J., Y. ZHENG, L. BENDER, A. MYERS, R. CERIONE et ab, 1994 Interactions between the bud emergence proteins Bemlp and Bem2p and Rho-type GTPases in yeast. J. Cell Biol. 127: 1395- 1406.

POWERS, S., K. O’NEILL and M. WIGLER, 1989 Dominant yeast and mammalian RAS mutants that interfere with the CDC25-dependent activation of wild-type RAS in Saccharomyces cerevisiae. Mol. Cell. Biol. 9: 390-395.

PRINGLE, J. R., and L. H. HARTWELL, 1981 The Saccharomyces cerevisiae cell cycle, pp. 97- 142 in The Molecular Biology of the Yeast Saccharo- myces: Life Cycle and Inheritance, edited by J. N. STRATHERN, J. R. BROACH, and E. W. JONES. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

PRINGLE, J. R., S. H. LILLIE, A. E. M. ADAMS, C. W. JACOBS, B. K. HAARER et al., 1986 Cellular morphogenesis in the yeast cell cycle, pp. 47-80 in Yeast Cell Biology, edited by J. HICKS. Alan R. Liss Inc., New York.

PRINGLE, J. R., R. A. PRESTON, A. E. M. ADAMS, T. STEARNS, D. G. DRUBIN et al., 1989 Fluorescence microscopy methods for yeast. Methods Cell Biol. 31: 357-435.

RIDLEY, A. J., and A. HALL, 1992 The small GTP-binding protein rho regulates the assembly of focal adhesions and actin stress fibers in response to growth factors. Cell 70: 389-399.

RIDLEY, A. J., H. F. PATERSON, C. L. JOHNSTON, D. DIEKMANN and A. HAIL, 1992 The small GTP-binding protein rac regulates growth factor-induced membrane ruffling. Cell 70: 401-410.

SAIKI, R. K., D. H. GELFAND, S. STOFFEL, S. L. SCHARF, R. HIGUCHI et al., 1988 Primerdirected enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239: 487-491.

OHYA, Y., M. GOEBI., L. E. GOODMAN, S. PETERSEN-BJORN,J. D. FRIESEN

266: 12356-12360.


SALMINEN, A,, and P. J. NOVICK, 1987 A raslike protein is required for a post-Golgi event in yeast secretion. Cell 49: 527-538.

SALMINEN, A., and P. J. NOVICK, 1989 The Secl5 protein responds to the function of the GTP binding protein, Sec4, to control vesicular traffic in yeast. J. Cell Biol. 109 1023-1036.

SANGER, F., S. NICKLEN and A. R. COULSON, 1977 DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 7 4

SHERMAN, F., G. R. FINK and J. B. HICKS, 1986 Methods in Yeast Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Har- bor, W.

SHIRAYAMA, M., Y. MATSUI, K. TANAKA and A. TOH-E, 1994 Isolation of a W C 2 5 family gene, MSZ2/LTEl, as a multicopy suppressor of iral. Yeast 1 0 451-461.

SHIRAYAMA, M. Y. MATSUI and A. TOH-E, 1995 The yeast TEMl gene, which encodes a GTP-binding protein, is involved in termination of M phase. Mol. Cell. Biol. 14: 7476-7482.

SIKORSKI, R. S., and P. HIETER, 1989 A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122: 19-27.

SLOAT, B. F., A. E. M. ADAMS and J. R. PRINGLE, 1981 Role of the CDC24 gene product in cellular morphogenesis during the Sac- charomyces cereuisiae cell cycle. J. Cell Biol. 8 9 395-405.

TAKAI, Y., K. KAIBUCHI, A. KIKUCHI and M. KAWATA, 1992 Small GTP-binding proteins. Int. Rev. Cytol. 133: 187-230.

TKACZ, J. S., and J. 0. LAMPEN, 1972 Wall replication in Saccharomyces

5463-5467.

species: use of fluoresceinconjugated concanavalin A to reveal the site of mannan insertion. J. Gen. Microbiol. 7 2 243-247.

Tom, J. H., and L. H. JOHNSTON, 1993 SpolZ is a limiting factor that interacts with the cell cycle protein kinases Dbf2 and Dbf20, which are involved in mitotic chromatid disjunction. Genetics

Tom, J. H., H. ARAKI, A. SUCINO and L. H. JOHNSTON, 1991 The cell- cycle-regulated budding yeast gene DBF2, encoding a putative protein kinase, has a homologue that is not under cell-cycle control. Gene 104: 63-70

VIEIRA, J., and J. MESSING, 1987 Production of single-stranded plasmid DNA. Methods Enzymol. 153 3-9.

ZHENG, Y., R. CERIONE and A. BENDER, 1994 Control of the yeast bud-site assembly GTPase Cdc42. J. Biol. Chem. 269: 2369-2372.

ZHENG, Y., A. BENDER and R. A. CERIONE, 1995 Interactions among proteins involved in bud-site selection and bud-site assembly in Saccharcmyces cereuisiae. J. Biol. Chem. 270 626-630.

ZIMAN, M., J. M. O’BRIEN, L. A. OUELLETTE, W. R. CHURCH and D. I. JOHNSON, 1991 Mutational analysis of WC42Sc, a Saccharomyces cereuisiae gene that encodes a putative GTP-binding protein involved in the control of cell polarity. Mol. Cell. Biol. 11: 3537- 3544.

ZIMAN, M., and D. I. JOHNSON, 1994 Genetic evidence for a functional interaction between Saccharomyces cerm’siae GDC24 and W C 4 2 . Yeast 10: 463-474.

135 963-971.

Communicating editor: F. WINSTON

Saccharomyces cer&ae RH03 Gene, Encoding a GTPase ... · and SEC4, taken together with the fact that the Rab-type GTPase Sec4p is required to fuse secretory vesicles ... S MALL GTPases

Documents