Recognition of RNA Polymerase II and Transcription Bubbles by XPG, CSB, and TFIIH: Insights for Transcription-Coupled Repair and Cockayne Syndrome

Seediscussions,stats,andauthorprofilesforthispublicationat:https://www.researchgate.net/publication/7519427

RecognitionofRNApolymeraseIIandtranscriptionbubblesbyXPG,CSB,andTFIIH:Insightsfortranscription-coupledrepairandCockayneSyndrome

ArticleinMolecularCell·November2005

DOI:10.1016/j.molcel.2005.09.022·Source:PubMed

CITATIONS

144

READS

54

10authors,including:

Someoftheauthorsofthispublicationarealsoworkingontheserelatedprojects:

Derivepredictivemechanism-basedmodelsforDNAdamageresponsessuitabletosupport

canceretiology,prognosis,therapeuticstrategiesandoutcomesViewproject

AltafHSarker

LawrenceBerkeleyNationalLaboratory

34PUBLICATIONS917CITATIONS

SEEPROFILE

SusanTsutakawa

LawrenceBerkeleyNationalLaboratory

42PUBLICATIONS1,252CITATIONS

SEEPROFILE

EricCampeau

ZenithEpigeneticsCorporation

33PUBLICATIONS1,817CITATIONS

SEEPROFILE

JohnTainer

UniversityofTexasMDAndersonCancerCenter

525PUBLICATIONS32,756CITATIONS

SEEPROFILE

Allin-textreferencesunderlinedinbluearelinkedtopublicationsonResearchGate,

lettingyouaccessandreadthemimmediately.

Availablefrom:JohnTainer

Retrievedon:05October2016

1

Supplemental Data

Recognition of RNA Polymerase II and Transcription

Bubbles by XPG, CSB, and TFIIH: Insights for

Transcription-Coupled Repair and Cockayne Syndrome Altaf H. Sarker, Susan E. Tsutakawa, Seth Kostek, Cliff Ng, David S. Shin, Marian Peris, Eric Campeau, John A. Tainer, Eva Nogales, and Priscilla K. Cooper

Supplemental Experimental Procedures

Protein Purification For recombinant expression of XPG, the cDNA was inserted into a pFastBacTM vector, expressed in either High FiveTM or Sf9 insect cells, and purified to 95% homogeneity essentially as described (Evans et al., 1997). Protein concentration was estimated from comparison with BSA on a Coomassie stained PAGE gel. A nuclease contaminant was detected in every XPG preparation, as previously observed by Evans et al. For use in the Far Western assays only, a heart muscle kinase (HMK) recognition sequence tag, RRASV, was added at the C-terminus. The vector pFastBacTM XFX was constructed by replacing the DNA sequence for XPG residues 79-785 with that for residues 82-128 from P. furiosus FEN-1, whose structure has been determined (Hosfield et al., 1998). XFX was expressed in High5 insect cells and harvested 72 hours post-infection. Cell pellet from 500 ml culture was resuspended in 20 ml of cell lysis buffer (20 mM Tris pH 7.5, 5 mM EDTA, 10% glycerol, 0.8% NP40, 1 mM dithiothreitol (DTT), 0.5 µg/ml pepstatin, 0.5 µg/ml leupeptin, 1x Protease Inhibitor Cocktail Set I (Calbiochem), 0.1 mM phenylmethylsulfonylfluoride (PMSF)) for 15 min on ice. The lysate was clarified by ultracentrifugation at 110,000 x g for 20 min. The supernatant was applied to a 15 ml SP-Sepharose column, equilibrated with 500 mM NaCl in IEX buffer (20 mM Tris pH 7.5, 1 mM EDTA, 5% glycerol, 0.8% Nonidet P40 (NP40), 1 mM DTT, 0.5 µg/ml pepstatin, 0.5 µg/ml leupeptin, 0.1 mM PMSF). XFX eluted at approximately 620 mM NaCl on a 15 column volume gradient from 500-1500 mM NaCl. XFX-containing fractions were dialyzed to 50 mM NaCl in IEX buffer and applied to a 15 mL Q Sepharose column equilibrated with IEX buffer + 100 mM NaCl. XFX eluted at approximately 180 mM NaCl on a gradient from 100-1000 mM NaCl. Protein was concentrated using a Centriplus 30, and protein concentration was estimated with a BCA Assay using BSA as the standard. Concentrated protein was stored at -80°C in 1:1 dilution with 100% glycerol. Recombinant XPG∆C baculovirus was constructed by subcloning a DNA fragment containing the first 1012 amino acids of XPG into the baculovirus transfer vector pFastBacTM (Gibco Life Technologies). XPG∆C was expressed in High FiveTM or Sf9 insect cells and harvested ~65 hours post-infection. Cells from 1 L of insect cell culture were pelleted at 1600 x g and

2

resuspended in 20 ml of cell lysis buffer (as above except using 0.5% Igepal, instead of NP40). The cell suspension was incubated on ice for twenty minutes, sonicated (3 x 15 sec, 50% duty, setting 3, Branson Sonifier 250), and clarified by ultracentrifugation at 110,000 x g for 20 minutes. The supernatant was filtered through 5 µm and 0.8 µm filters, and the salt concentration was adjusted to 100 mM NaCl. The supernatant was applied to a 20 ml Q Sepharose (Pharmacia Biosciences) equilibrated with 100 mM + Buffer C (20 mM Tris, pH 7.5, 1 mM EDTA, 10% glycerol, 0.2 % Igepal, 1 mM DTT, 0.1 mM PMSF, 0.5 µg/ml leupeptin, 0.5 µg/ml pepstatin, 1 µg/ml aprotinin). XPG∆C eluted at approximately 250 mM NaCl on a 15 column volume gradient of 100 mM to 1500 mM NaCl. XPG∆C fractions were adjusted from 250 mM NaCl to 50 mM NaCl with Buffer C and applied to a 10 ml SP-sepharose column (Pharmacia Biosciences). XPG∆C eluted at approximately 180 mM KCl on a 15 column volume gradient of 50 mM to 750 mM KCl in Buffer C. Peak fractions were then applied to a 5 ml Hydroxyapatite Bio-Gel HTP matrix (Bio-Rad), equilibrated in Buffer P (10% glycerol, 0.1% Igepal, 1 M KCl, 1mM EDTA, 1 mM DTT, 0.1 mM PMSF, 0.5 µg/ml leupeptin, 0.5 µg/ml pepstatin, 1 µg/ml aprotinin) containing 150 mM sodium phosphate, pH 6.8. XPG∆C eluted at approximately 350 mM phosphate on a 10 column volume gradient from 150 to 500 mM Phosphate in buffer P. The peak fractions were applied to a 10 ml phosphocellulose column (Whatman P-11) equilibrated in Buffer A (25 mM HEPES-KOH, pH 7.8, 10% glycerol, 1 mM EDTA, 0.1% Igepal, 1 mM DTT, 0.1 mM PMSF, 0.5 µg/ml leupeptin, 0.5 µg/ml pepstatin, 1 µg/ml aprotinin). XPG∆C eluted at approximately 175 mM KCl on a 15 column volume gradient from 0 to 1 M KCl. The peak fractions were then applied to Q-Sepharose column equilibrated in 100 mM NaCl + Buffer D (25 mM HEPES-KOH, pH 7.0, 10% glycerol, 1 mM EDTA, 0.1% Igepal, 1 mM DTT, 0.1 mM PMSF, 0.5 µg/ml leupeptin, 0.5 µg/ml pepstatin, 1 µg/ml aprotinin). XPG∆C eluted at approximately 670 mM KCl from a 15 column volume gradient from 100 mM to 670 mM KCl in Buffer D. XPG∆C-containing fractions were then concentrated to at least 200 µg/ml as determined by BCA assay, and then diluted with 1:1 with glycerol before storage at -80°C. To express the C-term domain, the XPG cDNA sequence from 1012 to 1186 was inserted into a pDEST 15 vector (Invitrogen), which placed the GST sequence at the N-terminus. Expression of the GST-C-term was induced with 1 mM IPTG for 25 h at 16°C in BL21 DE3 cells transformed with the expression vector. Cells were suspended in sonication buffer (50 mM Tris-HCl pH 8.0, 500 mM NaCl, 1 mM EDTA and 0.02% NP40) and were lysed by sonication. The sample was clarified by centrifugation at 13,000 rpm and the supernatant was applied to a glutathione sepharose 4B column equilibrated with sonication buffer. The column was washed with 20 column volumes of sonication buffer and the bound protein was eluted with sonication buffer containing 10 mM reduced gluthathione. The peak fractions were identified by SDS PAGE, combined, and diluted five-fold to 100 mM final salt concentration and applied onto an SP-Sepharose column. The column was washed and the protein was eluted at approximately 450 mM NaCl on a salt gradient of 100 to 900 mM (10 column volume). Peak fractions were combined, dialyzed into a buffer containing 150 mM NaCl and stored at -80°C. Protein concentration was estimated from comparison with BSA on a Coomassie stained PAGE gel. To express the R-domain, the DNA sequence for residues 86 to 765 with a C-terminal HMK tag (RRASV) was inserted into a pET15b vector, which placed a hexaHis tag at the N-terminus. Expression of the R-domain was induced in BL21-RIL cells transformed with the pET15b R-domain vector with 0.4 mM IPTG for 16 hrs at 18°C. Cells were lysed in 6M Guanidine, 20 mM

3

NaPhosphate, pH 8.2, 300 mM NaCl, 1x Roche complete EDTA-free protease inhibitor, 10 mM β-mercaptoethanol, 0.5 ug/ml leupeptin, 0.5 ug/ml pepstatin. The protein was refolded bound on a Qiagen nickel column. R-domain was loaded onto a Q Sepharose column in 20 mM Tris pH 8.5 1 mM EDTA, 5% glycerol, 1 mM DTT, 100 mM NaCl. The protein eluted in a broad peak from 0.25 to 0.35 M NaCl on a 15 column volume gradient from 0.1 to 0.7 M NaCl. The protein was then purified on a Sephacryl 300 column equilibrated in 20 mM Tris pH 8.0, 100 mM NaCl, 1 mM EDTA, 5% glycerol, 1 mM DTT. The protein was quantified using Bradford’s assay with BSA as a standard. Recombinant XFX∆C baculovirus was constructed by subcloning a DNA fragment containing amino acid residues 1 - 371 from the full length XFX construct (545 residues total) into the baculovirus transfer vector pFastBacTM (Gibco Life Technologies). XFX∆C was expressed in High FiveTM or Sf9 insect cells and harvested ~65 hours post-infection. Cells from 1 L of insect cell culture were pelleted at 1600 x g and resuspended in 20 ml of cell lysis buffer (as above except using 0.5% Igepal, instead of NP40). The cell suspension was incubated on ice for twenty minutes, sonicated (3 x 15 sec, 50% duty, setting 3, Branson Sonifier 250), and clarified by ultracentrifugation at 110,000 x g for 20 minutes. The supernatant was filtered through 5 µm and 0.8 µm filters, and the salt concentration was adjusted to 100 mM NaCl. The supernatant was then applied to a 40 ml phosphocellulose column (Whatman P-11) equilibrated in Buffer A (25 mM HEPES-KOH, pH 7.8, 10% glycerol, 1 mM EDTA, 0.1% Igepal, 1 mM DTT, 0.1 mM PMSF, 0.5 µg/ml leupeptin, 0.5 µg/ml pepstatin) containing 150 mM KCl. XFX∆C eluted at approximately 350 mM KCl on a 6 column volume gradient of 150 mM to 1 M KCl. XFX∆C-containing fractions were then dialysed to 50 mM KCl in Buffer C (20 mM Tris, pH 7.5, 1 mM EDTA, 10% glycerol, 0.2 % Igepal, 1 mM DTT, 0.1 mM PMSF, 0.5 µg/ml leupeptin, 0.5 µg/ml pepstatin, 1 µg/ml aprotinin), and applied to a 10 ml SP-Sepharose column (Pharmacia Biosciences). XFX∆C eluted at approximately 200 mM KCl on a 15 column volume gradient of 50 mM to 700 mM KCl. XFX∆C-containing fractions were then dialysed to 25 mM KCl in Buffer C at pH 8.5, and applied to a 10 ml Q-Sepharose column (Pharmacia Biosciences). XFX∆C then eluted at approximately 50 mM KCl on a 15 column volume gradient of 25 mM to 700 mM KCl in Buffer C at pH 8.5. Peak fractions were diluted 1:1 with Buffer D (25 mM Hepes-KOH, pH 7.0, 10% glycerol, 1 mM EDTA, 0.1% Igepal, 1 mM DTT, 0.1 mM PMSF, 0.5 µg/ml leupeptin, 0.5 µg/ml pepstatin, 1 µg/ml aprotinin), and applied to a 10 ml Heparin column (Sterogene) equilibrated in Buffer D containing 100 mM KCl. XFX∆C eluted at approximately 400 mM KCl on a 15 column volume gradient of 100 mM to 700 mM KCl. XFX∆C-containing fractions were then concentrated to at least 200 µg/ml as determined by BCA assay, and then diluted with 1:1 with glycerol before storage at -80°C. CSB cDNA as a construct in pFastBacTM with an N-terminal His tag and a C-terminal HA tag was a generous gift from J. Hoeijmakers. The protein was expressed in High FiveTM insect cells and purified to greater than 95% homogeneity by heparin, nickel, and Q sepharose chromatography essentially as described (Citterio et al., 1998). Protein concentration was estimated from comparison with BSA on a Coomassie stained PAGE gel. Specific activity of different preparations varied. Human RNAPII was purified from HeLa cell nuclei essentially as described (Maldonado et al.,

4

1996). Protein concentration was estimated from comparison with BSA on a Coomassie stained PAGE gel by NIH image software. TFIIH holocomplex was affinity purified by a previously described method (LeRoy et al., 1998) with the following modifications. The nuclear extract of 300 liters HeLa S3 cells (300 ml at 6-8 mg/ml) was fractionated as described for purification of RNAPII (Maldonado et al., 1996). The 0.5 M KCl step from the phosphocellulose column in this protocol was dialyzed for three hours against buffer C (20 mM Tris pH 7.9, 0.5 mM EDTA, 10 mM β-mercaptoethanol, 10% glycerol, 1 mM PefablocSC) with 80 mM KCl and was applied to a 4 ml Poros HQ column (substituted for the DEAE-cellulose column) pre-equilibrated in buffer C). The column was washed with 80 mM KCl in buffer C and eluted with 0.4 M KCl and 1 M KCl. The TFIIH fraction (0.4 M KCl step) was dialyzed in Buffer C with 80 mM KCl and applied to a 3.3 ml DEAE 5PW column (Tosoh Bioscience). TFIIH was eluted with a linear gradient from 0.1 to 0.6 M KCl in 20 column volumes. Fractions containing TFIIH holocomplex were determined by Western analysis. TFIIH eluted from 0.15 to 0.18 M KCl. TFIIH-containing fractions were incubated with 250 µl protein G agarose beads (Roche) coupled to mAB 3G4 (Chile Bios). The beads were washed in a 2 ml disposable column with 100 column volumes 0.4 M KCl in buffer D (25 mM HEPES pH 7.9, 0.2 mM EDTA, 12.5 mM MgCl2, 10% glycerol, 1 mM PefablocSC, 0.3% NP40), followed by 50 column volumes of 0.1 M KCl in buffer D. TFIIH holoenzyme was eluted with a 25 amino acid peptide encoding residues 242-261 from the XPB subunit of TFIIH and bracketed at the NH2-end and the COOH-end by three K residues to promote the solubility of the peptide (LeRoy et al., 1998) in 0.1 M KCl Buffer D at 4 mg/ml. The peptide was added to the column at RT and incubated for 20 min with a minimal amount of mixing. The elution was collected and additional peptide in buffer D added. Elution was repeated three times. The protein concentration was estimated by quantitating the bands in comparison to known standards on an SDS PAGE gel stained by SYPRO Ruby (Invitrogen) on a TYPHOON imaging system (GE Healthcare). Coimmunoprecipitation Assays

For XPG and RNAPII coimmunoprecipitation from HeLa cells, nuclei from 2.3 liters of HeLa cells were prepared as described (Maldonado et al., 1996). All subsequent steps were done at 4°C. Nuclei were diluted 1:6 with immunoprecipitation buffer (50 mM Tris pH 7.5, 150 mM potassium glutamate, 0.5% NP-40, 1x Roche tablets without EDTA, 1 mM PMSF, 1 µg/ml leupeptin, 1 µg/ml pepstatin A) and incubated with 1 mg/ml DNase I for 30 min on a rotator. EDTA (1 mM final) was added, and the nuclei were clarified by centrifugation at 15,000 x g for 15 min. The supernatant was then pre-cleared with 150 µl Immunopure A/G Beads (Pierce) and 15 µg mouse IgG for 1 hour. The beads were removed by centrifugation and 5 µg of immunoprecipitating antibody as denoted was added overnight. Immunocomplexes were precipitated with Immunopure A/G beads (40 ul) pre-incubated with 1 mg/ml BSA. Beads were washed three times with 1 ml wash buffer (same as above except with 120 mM potassium glutamate). Immuoprecipitates were separated on a 7% SDS PAGE gel. Proteins were detected by Western analysis using ECL Advance (Amersham) with 8H7 Ab (XPG) or the Li-Cor Odyssey Infrared Imaging System with sc899 Ab (RNAPII).

5

For immunoprecipitation of purified XPG (300 ng) and RNAPII (5 µg) or of XPG (600 ng), XFX (1 µg) and TFIIH (1.6 µg) proteins were mixed in 750 µl 20 mM HEPES pH 7.8, 100 mM potassium glutamate, 0.1% NP-40, 1 mM EDTA, 1x Roche protease inhibitors, 0.1 mM DTT overnight and immunoprecipitated with 5 µg mouse IgG, XPG Ab 8H7, or RNAPII Ab sc899 and A/G Immunopure Agarose beads (Pierce). Beads were washed three times and immunoprecipitates were separated by SDS-PAGE and transferred to nitrocellulose. Proteins were detected by Western analysis using the Li-Cor Odyssey System or the SuperSignal chemiluminescent detection kit (Pierce). Far Western Assays Far Western analysis was performed as previously described (Wiederhold et al., 2004), with the following modifications. Full length and truncation constructs of XPG were separated by SDS-PAGE (4-16% precast gels, BioRad), transferred to nitrocellulose, and probed with purified double-tagged CSB that was detected by Western analysis using an α-HA antibody.

6

Figure S1. Sequences for DNA and RNA/DNA Substrates DNA sequences are in plain font while RNA sequences are in bold. In the RNA/DNA hybrid substrate for promoterless transcription initiation that was used for stalling the polymerase by nucleotide deprivation, the arrowhead indicates the first A in the template strand. In the RNA/DNA hybrid substrate that was used for stalling the polymerase with a cis-Pt lesion, the unique GTG sequence is indicated with a Pt marker.

7

Figure S2. XPG and CSB Interaction with RNAPII Initiated on a C-Tailed Substrate (A) For the promoter-less transcription system in which transcription is initiated on a C-tailed template, the DNA substrate was prepared by annealing 5′-ATCGAATTCGGTTATGCGTTGTTCCATACAACCTCCTTACTACATTAATCTAACACTC

8

TTATACATTACCC(C18)-3′ and the complementary oligonucleotide 5′-GGGTAATGTATAAGAGTGTTAGATTAATGTAGTAAGGAGGTTGTATGGAACAACGCATAACCGAATTCGAT-3′. (B) Denaturing gel showing transcription reaction products. One pmol of the annealed C-tailed substrate was incubated with 300 ng of RNAP II at 30°C for 30 min in a 20 µl mixture containing 12 mM HEPES-KOH pH 7.9, 0.12 mM EDTA, 12% glycerol, 60 mM KCl, 1 mM DTT, 8.25 mM MgCl2, 150 µg BSA, 10 U RNasinTM, 50 ng poly [dI:dC], 0.05% nonidet P-40, 250 µM each of ATP and GTP, 10 µM UTP and 2 µCi [α-32P]UTP. CTP (250 µM) was added or not to the run-off and stalled reactions, respectively. (C) Autoradiogram of labeled transcribed RNA showing interaction of transcribing RNAPII with XPG and CSB. The transcription reaction mixture was incubated for 15 min with CSB (300 ng; 89 nM) and/or XPG (450 ng; 168 nM) and loaded onto a 4% native PAGE containing 1% glycerol and 2 mM MgCl2. The gels were dried and visualized by autoradiography. Position of RNAPII identified by labeled RNA. (D) Autoradiogram of labeled template DNA showing interaction of transcribing RNAPII with XPG and CSB and lack of non-specific interaction by XPG and CSB to DNA template. Assays were done as described in (B) and (C) except template DNA strand was labeled.

9

Figure S3. Quantification of XPG Binding to DNA

(A) Quantification of EMSA gel of text Figure 3B showing extent of DNA binding by XPG at different concentrations to different sized DNA bubbles. (B) Plot of total XPG concentration relative to DNA shifted (%) in the absence of poly [dI:dC] shows 50% binding at approximately 10 nM. (C) Affinity of XPG for 10 nt DNA bubble shown as a Hill plot (Creighton, 1993) of the EMSA results in (B). The Kd calculated from the first nine data points is 10.3 nM.

10

Figure S4. Representative Polyethylenimine-Cellulose Thin-Layer Chromatography Plates Used for CSB ATPase Calculations in Text Figures 5C and 5E CSB (5 nM) was incubated with 10 nt bubble-containing DNA and [γ-32P]-ATP in the absence or presence of an equimolar concentration of XPG. Released phosphate was separated from ATP on thin layer chromatography plates developed in 0.75 M KH2PO4. Plates were scanned using a PhosphorImager SI. Supplemental References

Citterio, E., Rademakers, S., van der Horst, G.T., van Gool, A.J., Hoeijmakers, J.H., and Vermeulen, W. (1998). Biochemical and biological characterization of wild-type and ATPase-deficient Cockayne syndrome B repair protein. J Biol Chem 273, 11844-11851.

Creighton, T. E. (1993). Proteins (New York, W.H. Freeman and Company).

Evans, E., Fellows, J., Coffer, A., and Wood, R.D. (1997). Open complex formation around a lesion during nucleotide excision repair provides a structure for cleavage by human XPG protein. EMBO J 16, 625-638.

Hosfield, D.J., Mol, C.D., Shen, B., and Tainer, J.A. (1998). Structure of the DNA repair and replication endonuclease and exonuclease FEN-1: coupling DNA and PCNA binding to FEN-1 activity. Cell 95, 135-146.

LeRoy, G., Drapkin, R., Weis, L., and Reinberg, D. (1998). Immunoaffinity purification of the human multisubunit transcription factor IIH. J Biol Chem 273, 7134-7140.

11

Maldonado, E., Drapkin, R., and Reinberg, D. (1996). Purification of human RNA polymerase II and general transcription factors. Methods Enzymol 274, 72-100.

Wiederhold, L., Leppard, J.B., Kedar, P., Karimi-Busheri, F., Rasouli-Nia, A., Weinfeld, M., Tomkinson, A.E., Izumi, T., Prasad, R., Wilson, S.H., et al. (2004). AP endonuclease-independent DNA base excision repair in human cells. Mol Cell 15, 209-220.