Rapid Detection of Watermelon Viruses by Reverse ......ORIGINAL ARTICLE Rapid Detection of Watermelon Viruses by Reverse Transcription Loop-Mediated Isothermal Amplification Lei Zhao1,2,

ORIGINAL ARTICLE

Rapid Detection of Watermelon Viruses by Reverse TranscriptionLoop-Mediated Isothermal AmplificationLei Zhao1,2, Yang Liu1,2, Yunfeng Wu1,2 and Xingan Hao1,2

1 College of Plant Protection, State Key Laboratory of Crop Stress Biology for Arid Areas, Key Laboratory of Crop Pest Integrated Pest Management

on Crop in Northwestern Loess Plateau, Ministry of Agriculture, Northwest A&F University, Yangling 712100, China

2 Key Laboratory of Plant Protection Resources and Pest Management, Ministry of Education, Northwest A&F University, Yangling 712100, China

Keywords

detection, RT-LAMP, watermelon virus

Correspondence

Y.-F. Wu and X.-A. Hao, Northwest A&F

University, Yangling, China.

E-mails: [email protected] (Y-FW) and

[email protected] (X-AH)

Received: April 12, 2015; accepted: October

3, 2015.

doi: 10.1111/jph.12461

Abstract

In this study, a stable, sensitive and specific one-step reverse transcription

loop-mediated isothermal amplification (RT-LAMP) assay was developed

to detect three watermelon viruses. The RT-LAMP primers were designed

based on the coat protein gene sequences of the watermelon mosaic virus

(WMV) and the squash mosaic virus (SqMV), as well as the cylindrical

inclusion protein gene sequence of the zucchini yellow mosaic virus (ZYMV).

Results could be obtained within an hour at temperatures of 60–61°C. Thesensitivity of the RT-LAMP assay was 10–100 times higher than that of

the conventional RT-PCR method. In addition, RT-LAMP does not require

specialized equipment and can be performed under general experimental

conditions. This report is the first to use RT-LAMP for WMV, SqMV and

ZYMV detection. The proposed RT-LAMP method has great potential for

applications in watermelon virus detection, identification and control

strategies.

Introduction

Watermelon (Citrullus lanatus) is an economically hor-

ticultural crop widely grown in China from north

(Inner Mongolia) to south (Hainan) and from west

(Tibet) to east (Zhejiang). In China, the area for the

production of watermelon is approximately 60% of

the world total (FAOSTAT, 2003; Xu et al. 2004).

However, virus diseases significantly reduce the qual-

ity and yield of watermelons (Nameth et al. 1985).

The major viruses that infect watermelon plants in

China include the watermelon mosaic virus (WMV), zuc-

chini yellow mosaic virus (ZYMV), squash mosaic virus

(SqMV), cucumber mosaic virus (CMV) and tobacco

mosaic virus (TMV) (Ma et al. 2005; Wang et al. 2010).

Among these viruses, WMV and ZYMV are members

of the genus Potyvirus in the Potyviridae plant virus

family and induce similar foliar symptoms, including

systemic chlorosis, mosaic, severe leaf deformation,

vein banding, reduced leaf laminae and plant stunting

(Shukla et al. 1994; Zitter et al. 1996; Marc et al.

1997; Adams et al. 2011). SqMV is a member of the

genus Comovirus in the family Comoviridae, which

induces curling of leaves, mottling, vein clearing, yel-

lowish spotting, domelike swellings, and light and

dark green mottling (Freitag 1956; Zitter and Banik

1984).

Watermelons infected by viral diseases mainly show

symptoms of leaf roll, mosaic and deformation; thus,

the exact virus that causes the disease is difficult to

determine (Wang et al. 2010). Loop-mediated

isothermal amplification (LAMP) was developed to

offer a feasible method for the rapid and sensitive

detection of target genes (Notomi et al. 2000; Naga-

mine et al. 2002). This method is simple, sensitive

and specific. The result can be analysed through gel

electrophoresis or directly observed by the naked eye

(Notomi et al. 2000; Nagamine et al. 2002; Zhao et al.

2012). Numerous reports have been published on the

detection of CMV and TMV by the RT-LAMP method

(Liu et al. 2010; Peng et al. 2012; Zhao et al. 2012),

but only a few focus on WMV, SqMV and ZYMV. In

this study, we developed one-step RT-LAMP assays

for the rapid detection of WMV, SqMV and ZYMV.

J Phytopathol 164 (2016) 330–336 � 2015 Blackwell Verlag GmbH330

J Phytopathol

This work is the first to report the use of RT-LAMP for

WMV, SqMV and ZYMV detection.

Materials and Methods

Materials

A total of 30 WMV-, ZYMV- and SqMV-infected

watermelon plant leaves were collected from fields at

Yangling, Rougu and Fufeng in Shaanxi Province in

2011. After detection by RT-PCR, three single virus

samples were stored at �80°C. The viral isolates were

mechanically sap-transmitted to watermelon plants in

a growth chamber in 2012. The experiment was per-

formed with leaf samples that showed obvious symp-

toms; virus-free watermelon plants were used as

healthy controls. The clinical samples were collected

from the field in different regions of Shaanxi Province

in 2012 and 2013.

RNA extraction

Total RNA was extracted from fresh young leaf tissue

with Trizol reagent by following the manufacturer’s

instructions (Invitrogen, Carlsbad, CA, USA). The

extracted RNA was resuspended in 40 ll of RNase-

free water; the RNA concentration and quality were

detected by spectrophotometric analysis (DU Series

500UV-Vis; Beckman, Brea, CA, USA) and 2% agar-

ose gel electrophoresis. The RNA samples were stored

at �80°C until further use.

Primer design

The coat protein gene sequences of WMV and SqMV

and the cylindrical inclusion protein gene sequences

of ZYMV were the relatively conservative genes of

each complete genome sequence. Therefore, the par-

tial sequence of the representative coat protein gene

of WMV (from 9150 to 9345 bp) and SqMV (from

2081 to 2308 bp), as well as the cylindrical inclusion

protein gene sequences of ZYMV (from 4818 to

5015 bp), were selected to design primers using the

PRIMER EXPLORER software version 4.0 (Eiken Chemical

Co., Ltd., Tochigi, Japan http://primerexplorer.jp/e/

v4_manual/index.html). All the primers used in this

study are listed in Table 1. The primers for RT-PCR

were designed as described by Wang et al. (2010).

Optimization of RT-LAMP amplification and RT-PCR

The RT-LAMP reaction total volume was 25 ll,which contained 1.6 lM each of the inner primers

FIP (WMV-FIP, ZYMV-FIP, SqMV-FIP) and BIP

(WMV-BIP, ZYMV-BIP, SqMV-BIP), 0.2 lM each of

the outer primers F3 and B3, 5 mM MgSO4, 1.0 mM

dNTP mix (Promega, Madison, WI, USA), 19 Ther-

moPol buffer (20 mM Tris–HCl, 10 mM KCl, 2 mM

MgSO4, 10 mM (NH4)2SO4, and 0.1% Triton X-

100), 1.0 M betaine (Sigma-Aldrich, St. Louis, MO,

USA), 4 U RNasin, 10 U reverse transcriptase (M-

MLV RT; Promega), 10 U Bst DNA polymerase

(large fragment; New England Biolabs Inc., Beverly,

MA, USA) and 1 ll target RNA.The mixture was incubated at 60–65°C (with 1°C

intervals) for 60 min with a Loopamp real-time tur-

bidimeter (LA-230; Eiken Chemical Co., Ltd.). The

RT-LAMP products were analysed through real-time

turbidity monitoring, electrophoresis in 2% agarose

gels containing ethidium bromide (EB) and direct

visual inspection of the reaction tube under white

Table 1 Primers used in this studyVirus Primer name Sequence 50–30

WMV WMV-F3 TGAACCTTCCAACAGTTG

WMV-B3 CACCAAACCATAAAACCATTC

WMV-FIP GTTGCTCGAGTGTTAAACAAATCAAGTGGGAAAATCATTCTCAGC

WMV-BIP AACACAGTTTGAATCATGGTACAGCTAATCACACCCATCTGCTC

ZYMV ZYMV-F3 TCACCACACATGGAGTTTC

ZYMV-B3 ATGCAACCTTGTTGAGCA

ZYMV-FIP ATGAGTGGTGAAGAAAGGAGTTAGCAGTGCACAGTTAAACAGATG

ZYMV-BIP CTAATCCGCCATGATGGTAGTATGTTCTGAATCCCTGAGTTTGA

SqMV SqMV-F3 TTACAGACTTGGCTCTAGTG

SqMV-B3 AAATAACAGCATCTGGCATAT

SqMV-FIP AGAAGCGTGTGCAGAACTAATCGGCATATCGATAGAAACTTGT

SqMV-BIP GGCCTGCACGTGTTCTAAAATCATTAGAATAGCATCTTTGGTG

SqMV, squash mosaic virus; WMV, watermelon mosaic virus; ZYMV, zucchini yellow mosaic virus.

J Phytopathol 164 (2016) 330–336 � 2015 Blackwell Verlag GmbH 331

L. Zhao et al. RT-LAMP assay for watermelon viruses

light after the addition of 1 ll SYBR green I� (10009;

Invitrogen).

The RT-PCR assay for detecting the three viruses

was developed as described by Wang et al. (2010).

The RT-PCR products were analysed with 2% agarose

for gel electrophoresis.

Specificity and sensitivity comparisons of RT-LAMP

and RT-PCR

The specificity of the RT-LAMP assay was evaluated

by adding different RNA samples to the RT-LAMP

reaction. For example, to test the specificity of RT-

LAMP for the WMV virus, the RNAs of ZYMV,

SqMV, CMV and TMV were adopted as templates

for amplification. The specificity for other viruses

was tested in the same manner. The amplification

products were analysed through real-time turbidity

monitoring.

The sensitivity of the RT-LAMP assay was evaluated

and compared with that of RT-PCR using the same

templates at the same concentrations. The total RNA

was serially diluted tenfold and amplified by the two

amplification reactions, which were sequentially set-

up. The amplification products were analysed through

real-time turbidity monitoring.

Evaluation of RT-LAMP with field samples

The 70 clinical samples collected from the field were

amplified and analysed through the RT-PCR and RT-

LAMP assays. The virus-free sample was used as the

healthy control. The amplification products were

analysed through real-time turbidity monitoring. The

reaction temperature was 59°C for WMV or 61°C for

ZYMV and SqMV.

Results

Detection methods of RT-LAMP

Total RNA was extracted from each sample as

described above; the extracted RNA was used as the

template for RT-PCR and RT-LAMP. RT-PCR products

were analysed through agarose gel electrophoresis.

The virus-infected samples showed specific bands,

whereas the negative controls showed none (Fig. 1a).

When the RT-LAMP products were analysed through

agarose gel electrophoresis, the virus-infected samples

showed multiple bands, whereas the negative control

showed one band (Fig. 1b). When SYBR Green I was

added into the reaction mixtures in the tubes, the

virus-infected sample produced a green colour under

daylight compared with the brown colour of the nega-

tive control (Fig. 1c).

Influence of different temperatures in RT-LAMP

The effects of different temperatures on RT-LAMP

were tested for each primer pair. The temperature

ranged from 60 to 65°C with 1°C intervals. Results

showed that when the temperature of RT-LAMP ran-

ged from 60 to 65°C, the typical ladder-like pattern of

a RT-LAMP reaction for WMV, ZYMV and SqMV

could be observed. In the WMV detection assay, 60°Cwas chosen as the optimal reaction temperature

because its shortest amplification time was 25 min

(Fig. 2a). For the other two viruses, the optimal tem-

perature for RT-LAMP was 61°C (Fig. 2b,c).

Sensitivity and specificity of RT-LAMP and RT-PCR

To evaluate the sensitivity of the RT-LAMP assay, the

RNA was serially diluted tenfold and tested. For

WMV, the RT-PCR products could not be detected

when the RNA was diluted to 2.1 9 10�5 ng/ll

(a)

(b)

(c)

Fig. 1 Determination of watermelon mosaic virus (WMV), zucchini yel-

low mosaic virus (ZYMV) and squash mosaic virus (SqMV) by RT-PCR

and reverse transcription loop-mediated isothermal amplification (RT-

LAMP) assays. Lane M1: Marker IV, +: sample infected with different

virus (WMV, ZYMV and SqMV), �: negative control (virus-free sample).

(a) RT-PCR analysis of virus by agarose gel electrophoresis. (b) RT-LAMP

analysis of virus by agarose gel electrophoresis. (c) RT-LAMP analysis of

virus by SYBR Green I staining.

J Phytopathol 164 (2016) 330–336 � 2015 Blackwell Verlag GmbH332

RT-LAMP assay for watermelon viruses L. Zhao et al.

(Fig. 3a), but RT-LAMP products could still be

detected up to 2.1 9 10�6 ng/ll (Fig. 3b). For ZYMV,

the RT-PCR products could not be detected until the

RNA was diluted to 2.7 9 10�4 ng/ll (Fig. 4a), but

RT-LAMP products could be precisely detected when

the RNA was diluted to 2.7 9 10�5 ng/ll (Fig. 4b).

For SqMV, the RT-PCR products could be detected

when the RNA was diluted to 3.3 9 10�3 ng/ll(Fig. 5a), but RT-LAMP products could be detected

when the RNA was diluted to 3.3 9 10�4 ng/ll(Fig. 5b). These results demonstrated that the sensi-

(a)

(b)

(c)

Fig. 2 Determination of the optimal temperature for the reverse tran-

scription loop-mediated isothermal amplification (RT-LAMP) assay of

watermelon mosaic virus (a), zucchini yellow mosaic virus (b) and

squash mosaic virus (c). RT-LAMP reactions at 60–65°C (tested every

one degree).

(a)

(b)

Fig. 3 Determination of the sensitivity of the reverse transcription loop-

mediated isothermal amplification (RT-LAMP) assay for watermelon

mosaic virus. Lane M1: Marker IV; Lane 1–9: tenfold dilutions of template

RNA, 2.1 9 102–2.1 9 10�6 ng/ll, respectively; Lane 10: negative con-

trol. Agarose gel electrophoresis analysis of (a) RT-PCR and (b) RT-LAMP.

(a)

(b)

Fig. 4 Determination of the sensitivity of the reverse transcription

loop-mediated isothermal amplification (RT-LAMP) assay for zucchini yel-

low mosaic virus. Lane M1: Marker I; Lane 1–8: tenfold dilutions of tem-

plate RNA, 2.7 9 101–2.7 9 10�6 ng/ll, respectively; Lane 9: negative

control. Agarose gel electrophoresis analysis of (a) RT-PCR and (b) RT-

LAMP.

J Phytopathol 164 (2016) 330–336 � 2015 Blackwell Verlag GmbH 333

L. Zhao et al. RT-LAMP assay for watermelon viruses

tivity of the RT-LAMP assay was 10–100 times higher

than that of the conventional RT-PCR for virus

detection.

To detect the specificity of RT-LAMP, the RT-LAMP

primers of WMV, ZYMV and SqMV were used to

detect WMV, ZYMV, SqMV, TMV and CMV. Results

showed that only the corresponding viruses gave posi-

tive results (Table 2), thereby indicating that the

group of sequence-specific primers were specific for

detecting a particular virus.

Testing field samples using RT-PCR and RT-LAMP

A total of 70 field samples infected by one or more

viruses were analysed through RT-PCR and

RT-LAMP. Results showed that all the positive

samples detected by RT-PCR were also positive when

detected by RT-LAMP, but some positive

samples detected by RT-LAMP were negative for RT-

PCR. This result indicated the reliability and sensitiv-

ity of RT-LAMP. A portion of the detection results is

shown in Table 3.

Discussion

From early April to late May 2007, a continuous

drought affected Shaanxi Province in China and

induced an aphid outbreak. The aphids mainly

reduced the watermelon yield by transmitting viruses.

Some of the affected fields had no harvest at all,

which seriously decreased the enthusiasm of water-

melon farmers (Wang et al. 2010). Viral diseases are

notoriously difficult to control and have been called

‘plant cancers.’ Early virus identification is important

to prevent its transmission.

In this study, an accurate and efficient water-

melon virus detection method, RT-LAMP, was

developed. This method made the detection of

watermelon viruses much easier. Less than 1 h was

needed to obtain the detection results. This method

did not involve special instruments or a complicated

process. Moreover, the sensitivity of the RT-LAMP

assay was 10–100 times higher than that of the

conventional RT-PCR. All the primers in this study

were specific for detecting a particular virus. The

optimal reaction temperatures for the three water-

melon viruses were also determined. The use of

total RNA as the template in RT-LAMP is the cur-

rent standard; viral RNA isolation has not been per-

formed to the best of our knowledge. Given the

various differences in RNA extraction methods

between viruses and total RNA, the use of total

RNA is the most effective and direct method to

evaluate RT-LAMP. The greatest disadvantage of the

watermelon virus detection method is that the RT-

LAMP reaction can be easily contaminated. How-

ever, the pre-addition of SYBR Green I was recently

developed to significantly decrease the probability of

contamination. Another disadvantage is that the

primers for RT-LAMP are occasionally difficult to

design. Although primer design software is avail-

able, most automatically generated primers cannot

(a)

(b)

Fig. 5 Determination of the sensitivity of the reverse transcription loop-

mediated isothermal amplification (RT-LAMP) assay for squash mosaic

virus. Lane M1: Marker I; Lane 1–8: tenfold dilutions of template RNA,

3.3 9 101–3.3 9 10�6 ng/ll, respectively; Lane 9: negative control.

Agarose gel electrophoresis analysis of (a) RT-PCR and (b) RT-LAMP.

Table 2 Determination of the specificity for reverse transcription loop-

mediated isothermal amplification (RT-LAMP) assay

PrimersWMVa ZYMV SqMV

Virus EP SYBR EP SYBR EP SYBR

WMVb + + � � � �ZYMV � � + + � �SqMV � � � � + +

CMV � � � � � �TMV � � � � � �

aThe primers for RT-LAMP of WMV.bRNA template of leaf infected by WMV.

EP, the RT-LAMP amplification tested by electrophoresis; SYBR, the RT-

LAMP amplification by adding SYBR Green I; +, positive result; �, nega-

tive result; CMV, cucumber mosaic virus; SqMV, squash mosaic virus;

WMV, watermelon mosaic virus; ZYMV, zucchini yellow mosaic virus;

TMV, tobacco mosaic virus.

J Phytopathol 164 (2016) 330–336 � 2015 Blackwell Verlag GmbH334

RT-LAMP assay for watermelon viruses L. Zhao et al.

be used in experiments. In this study, we chose

three primer pairs for each virus, but none of the

seemingly well-designed primer pairs for ZYMV

could work (data not shown). Therefore, we rede-

signed the primer from the cylindrical inclusion

protein gene sequences of ZYMV. In addition, for

the sequence whose primers could not be automati-

cally designed, only the manually approach was

possible.

In conclusion, although the RT-LAMP assay has

shortcomings, its advantages far outweigh its disad-

vantages. As an efficient, fast and accurate molecular

virus detection method, RT-LAMP has great potential

for a broad range of prospective applications in virus

disease control strategies for watermelon.

Acknowledgements

This study was supported by the Special Fund for

Agro-scientific Research in the Public Interest (No.

201303028), Foundation Research Project of Shaanxi

Province (No. 2015JM3091), Basal Research Fund of

NWAFU (No. 2014YB088) and the 111 Project from

the Education Ministry of China (No. B07049).

References

Adams MJ, Zerbini FM, French R, Rabenstein F, Stenger

DC, Valkonen JPT. (2011) Family Potyviridae. In: King

AMQ, Adams MJ, Carstens EB, Lefkowits EJ. (eds).

Virus Taxonomy. Ninth Report of the International

Committee on Taxonomy of Viruses. Amsteram,

The Netherlands, Elsevier-Academic Press, pp 1069–1089.

FAOSTAT, Food and Agriculture Organization of the Uni-

ted Nations (2003). Internet Resource: http://faostat.

fao.org (verified Oct 29, 2015).

Freitag JH. (1956) Beetle transmission, host range, and

properties of squash mosaic virus. Phytopathology

46:73–81.Liu YH, Wang ZD, Qian YM, Mu JM, Shen LL, Wang FL,

Yang JG. (2010) Rapid detection of tobacco mosaic virus

using the reverse transcription loop-mediated isothermal

amplification method. Arch Virol 155:1681–1685.Ma SQ, Xu Y, Gong GY, Zhang HY, Shen HL. (2005) Anal-

ysis on the inheritance of resistance to PRSV-W and

ZYMV-CH and their linkage in watermelon. J Fruit Sci

22:731–733.Marc F, James R, McFerson DM et al. (1997) Cantaloupe

line CZW-30 containing coat protein genes of cucumber

mosaic virus, zucchini yellow mosaic virus, and water-

melon mosaic virus-2 is resistant to these three viruses

in the field. Mol Breeding 3:279–290.

Table

3Detectionoffield

sampleswithreversetranscriptionloop-m

ediatedisotherm

alamplification(RT-LAMP)assay

Samples

12

34

56

78

910

11

12

13

14

15

16

17

18

19

20

21

22

23

24

25

26

27

28

29

30

CK

WMV

RP

+�

��

+�

�+

�+

+�

+�

��

+�

+�

��

++

��

�+

�+

�RL

+�

+�

+�

�+

�+

+�

+�

��

+�

+�

��

++

�+

�+

�+

�ZYMV

RP

+�

��

�+

�+

+�

+�

��

�+

��

++

��

++

��

++

��

�RL

+�

��

�+

�+

+�

+�

��

�+

+�

++

��

++

��

++

��

�SqMV

RP

��

+�

��

+�

��

��

++

��

++

++

+�

�+

��

�+

��

�RL

��

+�

��

+�

��

��

++

��

++

++

+�

�+

��

�+

��

�

RP,RT-PCRassay;RL,RT-LAMPassay;CK:negativeco

ntrol;+,positiveresult;�,

negativeresult;SqMV,squash

mosaicvirus;WMV,waterm

elonmosaicvirus;ZYMV,zucchiniyellowmosaicvirus.

J Phytopathol 164 (2016) 330–336 � 2015 Blackwell Verlag GmbH 335

L. Zhao et al. RT-LAMP assay for watermelon viruses

Nagamine K, Hase T, Notomi T. (2002) Accelerated reac-

tion by loop-mediated isothermal amplification using

loop primers. Mol Cell Probes 16:223–229.Nameth ST, Dodds JA, Paulus AO, Kishaba A. (1985) Zuc-

chini yellow mosaic virus associated with severe diseases

of melon and watermelon in southern California desert

valleys. Plant Dis 69:785–788.Notomi T, Okayama H, Masubuchi H, Toshihiro Y, Keiko

W, Nobuyuki A, Hase T. (2000) Loop-mediated isother-

mal amplification of DNA. Nucleic Acids Res 28:E63.

Peng J, Shi MJ, Xia ZH, Huang JS, Fan ZF. (2012) Detec-

tion of cucumber mosaic virus isolates from banana by

one-step reverse transcription loop-mediated isothermal

amplification. Arch Virol 157:2213–2217.Shukla DD, Ward CW, Brunt AA. (1994) Genome struc-

ture, variation, and function. In: Shukla DD. (ed.). The

Potyviridae. Cambridge, CAB International, pp 74–112.Wang WL, Zhang H, Yu XQ, Wu YF, Zhang WB, Zhang CP.

(2010) Establishment and application of multipIex RT-

PCR for simultaneous detection of five watermelon

viruses ZYMV, WMV, TMV, SqMV and CMV. Acta Phy-

topathol Sin 40:27–32.Xu Y, Kang D, Shi Z, Shen H, Whner T. (2004) Inheritance

of resistance to zucchini yellow mosaic virus and water-

melon mosaic virus in watermelon. J Hered 95:498–502.Zhao L, Cheng JL, Hao XA, Tian XM, Wu YF. (2012) Rapid

detection of tobacco viruses by reverse transcription

loop-mediated isothermal amplification. Arch Virol

157:2291–2298.Zitter TA, Banik MT. (1984) Dept. of Plant Pathology,

Cornell University, and R. Provvidenti, Dept. of Plant

Pathology, New York State Agricultural Experiment

Station, Geneva. Virus Diseases of Cucurbits. Fact Sheet

Page: 732.40. Internet Resource: http://vegetablemdon

line.ppath.cornell.edu/factsheets/Viruses_Cucurbits.htm

(verified Oct 29, 2015).

Zitter T, Hopkins DL, Thomas CE. (1996) Diseases caused

by viruses. In: Provident R. (ed.). Compendium of

Cucurbit Diseases. St. Paul, APS Press, pp 37–45.

J Phytopathol 164 (2016) 330–336 � 2015 Blackwell Verlag GmbH336

RT-LAMP assay for watermelon viruses L. Zhao et al.