Neuroendocrine control of appetite in Atlantic halibut (Hippoglossus hippoglossus): Changes during metamorphosis and effects of feeding

Page 1

Comparative Biochemistry and Physiology, Part A 183 (2015) 116–125

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part A

j ourna l homepage: www.e lsev ie r .com/ locate /cbpa

Neuroendocrine control of appetite in Atlantic halibut(Hippoglossus hippoglossus): Changes during metamorphosisand effects of feeding

Ana S. Gomes a,⁎, Ann-Elise Olderbakk Jordal a, Kjetil Olsen a, Torstein Harboe b,Deborah M. Power c, Ivar Rønnestad a

a Department of Biology, University of Bergen, PO Box 7803, Bergen NO-5020, Norwayb Institute of Marine Research, Austevoll Aquaculture Research Station, Storebø NO-5392, Norwayc Comparative and Molecular Endocrinology Group, Centre for Marine Sciences (CCMAR), University of Algarve, Campus de Gambelas, Faro 8005-139, Portugal

⁎ Corresponding author. Tel.: +47 55 58 22 29.E-mail address: [email protected] (A.S. Gomes).

http://dx.doi.org/10.1016/j.cbpa.2015.01.0091095-6433/© 2015 Elsevier Inc. All rights reserved.

a b s t r a c t

a r t i c l e i n f o

Article history:Received 18 September 2014Received in revised form 18 December 2014Accepted 15 January 2015Available online 23 January 2015

Keywords:AppetiteAtlantic halibutCARTFast–refeed challengeGhrelinNPYOntogenyPOMC-CPYY

Hormones and neuropeptides play a crucial role in the appetite control system of vertebrates, yet few studies havefocused on their importance during early teleost development. In this study,we analysed the expression patterns ofthe appetite-controlling factors ghrelin, neuropeptide Y (NPY), peptide YY (PYY), pro-opiomelanocortin (POMC-C),and cocaine-amphetamine-related transcript (CART) by quantitative PCR. Transcript expressionwas investigated inresponse to feeding in developing Atlantic halibut larvae: before (premetamorphic stage 5) and during metamor-phosis (stages 8 and 9B), and also in response to a fast–refeed challenge.We show that ghrelin transcript expressionincreased in synchrony with stomach development, while CART was significantly reduced during larval develop-ment. PYYwas up-regulated 1 and 3 h after feeding in stage 5. Transcript abundance of other appetite-controllingfactors did not change in response to feeding. Fasting–refeeding trials (majority of larvae in metamorphosingstage 7) revealed a down-regulation of POMC-C 30 min after refeeding, while ghrelin, PYY and NPY transcriptexpression increased 2, 4 and 5 h after refeeding, respectively. In summary, transcripts for key appetite-controlling factors were detected early during development in Atlantic halibut and their emergence was not cor-related with metamorphosis, with the exception of ghrelin. Our results suggest that PYY may mediate satietyearly in larval development. The differing response times of POMC-C, ghrelin, PYY and NPY to ameal are intrigu-ing and require further exploration to understand the role of each player in appetite control.

© 2015 Elsevier Inc. All rights reserved.

1. Introduction

Successful food ingestion determines growth, survival and quality offish larvae, both inwild and farmed conditions. In vertebrates, food intakeis controlled by blood nutrient levels combinedwith a range of signallingfactors that either stimulate (orexigenic) or inhibit (anorexigenic)appetite. Signalling factors include hormones and neuropeptidesproduced and released in the central nervous system, particularly in thehypothalamus (Demski and Northcutt, 1983) and in peripheral organs,e.g., the gastrointestinal (GI) tract, adipose tissue, liver and pancreas.The physiological mechanisms that control appetite are relatively wellconserved among vertebrates, and many of the mammalian neuropep-tides and hormones involved in appetite regulation have also beenfound in teleosts (Kulczykowska and Sánchez Vázquez, 2010; Lin et al.,2000; Volkoff, 2006; Volkoff et al., 2005; Volkoff et al., 2009). However,the N26,000 teleost species (Nelson, 2006) show a large diversity infeeding habits that also has resulted in variations of GI tract structure.

For altricial-gastric species, a crucial change during development isthe remodelling of the GI tract during metamorphosis and the appear-ance of a functional stomach, capable of an adult mode of monogastricdigestion (Darias et al., 2007; Douglas et al., 1999; Gomes et al., 2014;Murray et al., 2006; Yúfera et al., 2012). During larval stages, the GItract has a lower processing capacity, including lower digestibility forproteins (Rønnestad et al., 2007) and probably less developed systemscontrolling gut transit time and ingestion rate (Rønnestad et al., 2013).The systems controlling food intake in early developmental stages arepoorly described and relatively few studies exist in fish larvae (Kortneret al., 2011a,b; Rønnestad et al., 2013).

Satiety and hunger induced signals from the GI tract (including thestomach, if present) have a major impact on appetite and feed intake.Studies on rainbow trout (Oncorhynchus mykiss) have revealed thatappetite returnedwhen 80–90% of the stomach content had been trans-ferred downstream into the proximal gut (Grove et al., 1978). Ghrelin,mainly produced in the stomach, is the only orexigenic hormone origi-nating from the GI tract in mammals and influences both digestion andfeeding behaviour (Date et al., 2000; Nakazato et al., 2001). Typically,there are high ghrelin plasma levels prior to a meal and a rapid decline

Page 2

Fig. 1. Dissection methodology. Schematic drawing of the dissection technique applied toAtlantic halibut larva. The dashed lines indicate where the dissection cuts were performedto obtain the five tissues used in this study: brain (including the surrounding tissues),eyes, gills, GI tract and muscle (with the skin).

117A.S. Gomes et al. / Comparative Biochemistry and Physiology, Part A 183 (2015) 116–125

once eating has commenced; hence the term “hunger hormone”(Higgins et al., 2007). Ghrelin has been isolated in several teleost species(Kawakoshi et al., 2007; Murashita et al., 2009b; Olsson et al., 2008;Terova et al., 2008; Xu and Volkoff, 2009), including the Atlantic halibut(Hippoglossus hippoglossus) (Manning et al., 2008). However, its physi-ological function in appetite control (orexigenic or anorexigenic factor)in teleosts is still unclear and appears to be species-specific (Jonsson,2013). The role of gastric ghrelin in appetite control during early devel-opment related to when the stomach becomes fully functional is stilllimited (Gomes et al., 2014).

Central signals arising in the hypothalamus are crucial for thecontrol of food intake, and this brain area produces orexigenic factors,such as neuropeptide Y (NPY), and anorexigenic factors like cocaine–amphetamine-regulated transcript (CART), pro-opiomelanocortin(POMC) and peptide YY (PYY). The role of these neuropeptides in appe-tite control in larval fish is largely unexplored. The NPY gene is well-conserved in vertebrates, and in mammals the peptide provides one ofthe strongest orexigenic signals (Cerda-Reverter et al., 2003; Larhammar,1996; Volkoff et al., 2009), while in teleosts the importance for appetitecontrol seems to be species-specific (Aldegunde and Mancebo, 2006;Kehoe and Volkoff, 2007; López-Patiño et al., 1999; MacDonald andVolkoff, 2009a; Narnaware and Peter, 2001; Narnaware et al., 2000;Silverstein et al., 1998; Silverstein and Plisetskaya, 2000; Valen et al.,2011). In Atlantic cod (Gadus morhua), it has been shown that mRNAexpression of NPY is modulated throughout development and by diet(Kortner et al., 2011a; Kortner et al., 2011b). PYY is a member ofthe NPY protein family and is an anorexigenic factor in mammals(Larhammar, 1996; Ueno et al., 2008) as well as in goldfish (Carassiusauratus) (Gonzalez and Unniappan, 2010), but not in Atlantic salmon(Salmo salar), suggesting that its function in appetite regulation mayvary between teleost species (Murashita et al., 2009b; Valen et al.,2011).

CART is a potent anorexigenic peptide inmammals (Kristensen et al.,1998; Kuhar et al., 2002; Vrang et al., 2000) and is a short- and long-term appetite regulator in goldfish and Atlantic cod (Kehoe and Volkoff,2007; Volkoff and Peter, 2001). In cod larvae, CART mRNA levels seemto be directly influenced by the feeding regime (Kortner et al., 2011b).POMC is a precursor of several molecules and is post-transcriptionallycleaved into melanocortins, including α-, β- and γ-melanocyte-stimulating hormones (MSHs) and adrenocorticotropic hormone(ACTH) (Schauer et al., 1994). Inmammals,MSHs are involved in appetiteregulation (Cone, 1999). In pleuronectiformes, as well as in other teleostspecies, three POMC genes (POMC-A, POMC-B and POMC-C) have beenidentified, as a result of duplication events (Takahashi et al., 2005); how-ever, their functions remain unclear.

This study explored the role of the neuropeptides NPY, PYY, CART,POMC-C and ghrelin in appetite control in fish larvae, using Atlantichalibut as themodel species. This species is of high interest for the aqua-culture industry, yet several technical challenges remain for its industrialproduction, many of them related to appetite, food intake and functionalproperties of the GI tract. This species has inherent advantages for re-search due to the existence of a well-validated staging scheme as wellas a slow development that favours collection of well-defined develop-mental stages. Furthermore, the relatively large size allows collection ofspecific tissues. This is extremely important in gene expression analysis,particularly for genes involved in the appetite control system that in-volves cross-talk between at least two discrete tissues, e.g., the brainand the GI tract. In addition, the transparent larval stages permitted thevisual inspection of feed intake. Quantitative real-time PCR (qPCR) wasused to assess developmental stage-specific transcript abundance ofNPY, PYY, CART, POMC-C and ghrelin in Atlantic halibut. The responsive-ness of target hormones/neuropeptides to feeding in premetamorphicstage 5, and metamorphosing stages 8 and 9B Atlantic halibut (Gomeset al., 2014; Sæle et al., 2004), was established, and a fast–refeedchallenge was used to assess the impact of feeding in greater detail in49 days post-first feeding (dpff) larvae.

2. Materials and methods

2.1. Larval rearing

Atlantic halibut larvae were reared at the Institute of MarineResearch (IMR, Austevoll, Norway). The incubation of egg and yolk saclarvae was performed at 6 °C following protocols of Mangor-Jensenet al. (1998) and Harboe et al. (1994), respectively. Larvae were trans-ferred to first feeding tanks at approximately 265 degree-days afterhatching (Harboe and Mangor-Jensen, 1998). Larvae were reared inconical cylindrical tanks (height: 1 m; diameter: 1.5 m; water depth:87 cm)with a continuouswater flow (startedwith 1 Lmin−1 and gradu-ally increased to 5 L min−1) (Harboe et al., 1998). Continuous daylightwas used throughout the experiment. Water temperature 12.2 °C ± 0.7(mean ± SD) was measured on a daily basis. The Atlantic halibut larvaewere fed twice daily (10:00 and 20:00) with live Artemia (Olsen et al.,1999) enriched with commercial products according to standard rearingprocedures.

2.2. Experimental design and sampling

To determine the tissue distribution of the target genes in Atlantichalibut larvae, the brain (including the surrounding tissues, see Fig. 1for more detail), gills, eyes, muscle (including the skin) and GI tractwere dissected out of five individuals collected at 49 dpff (Fig. 1).

To study the ontogeny and response to feeding onmRNA expressionof ghrelin, NPY, PYY, POMC-C and CART through post-embryonic devel-opment, three metamorphic stages were chosen: 5 — premetamorphic(bilaterally symmetrical and transparent larvae); 8 — proclimax meta-morphosis (transition to asymmetry starts, larvae are relatively largesize and have started to tilt to one side); and 9B— climaxmetamorpho-sis (eye migration is advanced and reaches the midline, distinctive skinpigment patterns emerge and the larvae rest occasionally on the bottomof the tank) (Fig. 2A). The classification of developmental stages wasbased on myotome height (MH) and standard length (SL), accordingto a modified version of Sæle et al. (2004). Samples for the selectedstages (n = 6 per stage) were collected prior to their morning feedingand 1 h and 3 h after the morning feeding.

For themain feeding trial (Fig. 2B),metamorphosing Atlantic halibutlarvae at 47 dpff were randomly transferred and acclimatized to the

Page 3

Fig. 2. Experimental design. A) Development scheme of Atlantic halibut larvae. Scale is indicated in days post-first feeding (dpff). Metamorphosis period is indicated in black. For theontogeny study, halibut larvaewere collected at stage 5 (5 dpff), stage 8 (36 dpff) and stage 9B (50 dpff), indicated by green triangles. At each time point larvaewere sampled before feed-ing, and at 1 and2h after feeding. B) Twoexperimental groupswith larvae at 47 dpffwere stocked in triplicate tanks: Fed group (FED) and fasted group (FAST). C) Experimental time scale:larvae were acclimated (fasted) for 44 h before sampling. Atlantic halibut larvae of 49 dpff (n= 3)were sampled from each tank at the time points indicated (h) by a green triangle. (Forinterpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

118 A.S. Gomes et al. / Comparative Biochemistry and Physiology, Part A 183 (2015) 116–125

experimental circuit that consisted of six seawater tanks (n = 35 pertank) with water temperature 11.7 °C ± 0.1 (mean ± SD), O2 concen-tration 8.9mg L−1 andwater flow0.2 Lmin−1. During the 44 h acclima-tion period, all tanks were fasted (Fig. 2C) to ensure that no Artemiawasleft in the GI tract. The experimental setup consisted of triplicate tanksand two groups: FAST, which were fasted throughout the whole exper-iment; and FED, which were fed one meal after 44 h fasting. A total ofthree halibut larvae from each tank were sampled at each samplingpoint (1.5 and 0.5 h before feeding and 1, 2, 3, 4, 5, 6 h after feeding;all times relate to feeding time in the FED group — see Fig. 2C) for atotal duration of 8 h. For the FAST and FED groups, the brain andthe GI tract were collected following the same procedure used fortissue sampling (Fig. 1). For sampling, Atlantic halibut larvae wereeuthanized with a lethal dose of MS-222 (Tricaine methanesulfonate,Sigma-Aldrich, St. Louis, USA). Photos of individual larva were takenusing a Leica DFC295 camera for subsequent categorization of develop-mental stages (Sæle et al., 2004). The collected tissues were rapidlytransferred to RNA later (LifeTechnologies, Carlsbad, USA) and storedat−80 °C.

All the experiments in this study were approved by an ethicalcommittee (Approval no. 2679; IMR Austevoll, Norway) and wereperformed according to guidelines of the Norwegian Animal ResearchAuthority (NARA).

2.3. Cloning and sequence analysis

Total RNA was isolated from the brain of Atlantic halibut larvae(30 dpff; full gut) and stomach of juveniles (147.7± 15.1 g wetweight;23.4 ± 1.1 cm total length) using TRI Reagent (Sigma, St. Louis, USA)

according to the manufacturer's instructions. cDNA was synthesizedfrom 2 μg of total RNA using SuperScript III First-Strand Synthesis systemfor RT-PCR kit (Invitrogen, Carlsbad, USA) with Oligo (dT)20 primersaccording to the manufacturer's protocol.

Transcript fragments of NPY, PYY, CART, POMC-C and ghrelin(GenBank: EF493849) were amplified using the gene-specific primersas listed in Table 1. For NPY, a PCR homology-cloning approach wasusedwithprimers designed against the conservedN- andC-terminal re-gions of the Japanese flounder (Paralichthys olivaceus; GenBank:AB055211.1) homologue gene. PYY was cloned taking a comparativehomology approach using the Japanese flounder homologue gene(GenBank: AB055212.1). Amplifications were performed using GOTaqDNA polymerase (Promega, Madison, USA) according to themanufacturer's protocol, and the following thermal programme wasused: 94 °C for 2 min; 40 cycles of 94 °C for 1 min, 55 °C for 30 s, 72 °Cfor 30 s; and a final step at 72 °C for 10 min. For POMC-C degenerateprimers were designed using the CODEHOP application (Rose et al.,1998) and based on the alignment of all teleost POMC sequences avail-able in the NCBI database. The parameters for the PCR were as follows:94 °C for 10 min; 25 cycles of 94 °C for 30 s, 55 °C for 30 s, 72 °C for30 s; and a final step at 72 °C for 10 min. CART primers were designedagainst the conserved N- and C-terminal regions of the Winterflounder (Pseudopleuronectes americanus; GenBank: FJ379291.1)homologue gene. PCR parameters were as follows: 94 °C for 10 min;35 cycles of 94 °C for 30 s, 58 °C for 30 s, 72 °C for 1 min; and a finalstep at 72 °C for 10 min. Both reactions used Dynazyme II Hot Start(New England Biolabs, Ipswich, USA). All amplifications were carriedout in a Gene Amp PCR system 2700 (Applied Biosystems)thermocycler. The amplified PCR products were resolved on 1% agarose

Page 4

Table 1Sequence of the specific primers used for cloning and qPCR gene expression analysis. Primer sequences, amplicon sizes and qPCR efficiency are shown.

Gene GenBank accession no. Sequence (5′ → 3′) Amplicon (bp) Efficiency (%)

CloningGhrelin EF493849 F: TTAACACTCTATGTCCCTTCATCA 899

R: GTCAGTTGATGCTTTATTTTTACCACCNPY KF924248 F: ATGCATCCTAACTTGGTGAGCTG 308

R: TGCAATATTCACCACAATGATGGGTCAPYYa,b KM575932 F: GAGAGGTGCCTCGGACAGTGA 227 91.0

R: GATGTAGTGTCTTAGTGCAGAGTACART KM575931 F: ATGGAGAGTTCCGAGGAGCTG 276

R: TCATAAGCACTTCAGCAGGAAGPOMC-C KF947068 F: GCGGCGGCCCGTnaargtntwya 269

R: GGCTTCATGAAGCCGccrtwnckytt

qPCReEF1A EU561357 F: CGAGAAGTTCGAGAAGGAAGCT 60 99.4

R: ACCCAGGCGTACTTGAAGGAGhrelin F: GGCTGCTGGTTGTTCTACTCTG 154

R: TCCTCGGTGGGTTGATTCTG 95.9NPY F: GCCCTGAGACACTACATCAACCT 68 99.8

R: AGAATCTCAGGACTGGACCTCTTCCARTc F: GAGAGTTCCGAGGAGCTGAG 123 95.1

R: TTTCGACTGAAGCTTCTCCAPOMC-C F: GGGCTCCTCTGAGGTCGGCT 84 99.5

R: TGGTTCAGGTCGCCCCTCGT

a The same pair of primers were used for both cloning and qPCR.b Kurokawa and Suzuki (2002).c MacDonald and Volkoff (2009a).

119A.S. Gomes et al. / Comparative Biochemistry and Physiology, Part A 183 (2015) 116–125

gel, purified using QIAquick Gel Extraction Kit (Qiagen, Hilden,Germany) and cloned into the pGem-T easy vector system I (Promega,Madison, USA) using the manufacturer's protocol. Sequencing wasperformed at the University of Bergen Sequencing Facility (Bergen,Norway). To confirm sequence identity tBLASTx (http://blast.ncbi.nlm.nih.gov/Blast.cgi) analysis against the GenBank database wasperformed. Multiple sequence alignments of the deduced amino acidsequence of Atlantic halibut NPY, PYY, POMC-C and CART were doneusing ClustalX (Gonnet series matrix, Gap opening penalty 10, Gapextension 0.2) (Thompson et al., 1997) and displayed in GeneDoc(Nicholas et al., 1997) (Supplementary Files 2–5). The complete codingsequence of the cloned NPY (308 bp) and CART (276 bp)was submittedto GenBank under the accession numbers KF924248 and KM575931,respectively. The cDNA fragments obtained for POMC-C (269 bp) andPYY (227 bp) were deposited in GenBank with the accession numbersKF947068 and KM575932, respectively.

2.4. Quantitative real-time PCR assays

Total RNA was isolated from Atlantic halibut larval tissues asdescribed above. An additional step to eliminate genomic DNA contam-ination was implemented using TURBO DNA-free (LifeTechnologies,Austin, USA) according to the manufacturer's protocol. DNase-treatedtotal RNA integrity was assessed randomly on 25% of the samplesusing an Agilent 2100 Bioanalyzer (Agilent Technologies). cDNA wassynthesized as described in the section above.

For expression pattern analysis, specific primers were designed indifferent exons of each target genes (Table 1). Atlantic halibut elongationfactor 1 alpha (eEF1A1, GenBank: EU561357) was used as the internalreference gene (Infante et al., 2008). Relative gene quantification wasperformed using the Mean Normalized Expression (MNE) method ofthe Q-Gene application (Muller et al., 2002; Simon, 2003). The assay effi-ciency was determined using a 10-fold cDNA pool dilution series rangingfrom 200 to 0.02 ng, using iQ SYBR Green supermix (Bio-Rad, California,USA) in a 25 μL final reaction volume. For the ontogeny experiment reac-tions were performed in duplicate and for the satiety experiment intriplicate, using the following PCR conditions: 95 °C for 3 min; 50 cyclesof 95 °C for 30 s, 58 °C for 30 s and 72 °C for 30 s, using a CFX 96™Real Time System (Bio-Rad). Melting curve analysis over a range of 45

to 95 °C (increment of 0.5 °C for 4 s) allowed detection of primer dimersand/or nonspecific products.

2.5. Statistical analysis

The mRNA expression levels are presented as the mean ± SEM.All experimental groups were tested for normality (Shapiro–WilkW-test) and homogeneity of variance (Levene's F-test). Data waslog-transformed to compensate for variance heterogeneity and lack ofnormality. Statistical significance of relative gene expression betweenstages and periprandial response within the same stage was analysedusing Kruskal–Wallis ranked ANOVA. For the experimental groupsFAST and FED, Whitney U-test (Wilcoxon test) was used to determinesignificant differences between treatment groups at each time point,and Kruskal–Wallis ranked ANOVA was performed in order to identifychanges caused by time alone within each treatment group. Statisticalanalyses were conducted in R and significance was considered atp b 0.05.

3. Results

3.1. Tissue distribution

The tissue expression pattern of the selected signalling peptides wasanalyzed in the brain, eye, gills, GI tract andmuscle by qPCR (Fig. 3). Theexpression of ghrelinwasmainly found in theGI tract andmuscle,whiletraces of expression were observed in the brain, eye and gills. NPYmRNA expression was mainly observed in the eye, brain and muscle,and very low levels were found in the gills and GI tract. PYY, POMC-Cand CART were predominantly expressed in the brain, but low levelsof expression were also found in the peripheral tissues.

3.2. Ontogeny

The temporal expressionprofile of the selected genes during ontogenywas studied in the developmental stages 5, 8 and 9B (n = 6, Fig. 4).The expression of all target genes was observed in the early develop-mental stage 5 (5 dpff). Ghrelin mRNA levels significantly increaseduntil stage 9B. NPY, PYY and POMC-CmRNA levels was not significantly

Page 5

Fig. 3. Tissue distribution. Mean normalized expression (MNE) of ghrelin, NPY, PYY, POMC-C and CART mRNA in the brain, eye, gills, GI tract and muscle from Atlantic halibut larvae at49 dpff. Results are presented as mean ± SEM of the normalized expression (using the reference gene eEF1A1; n = 5 for all tissues).

120 A.S. Gomes et al. / Comparative Biochemistry and Physiology, Part A 183 (2015) 116–125

different between the developmental stages analysed. CART significantlydecreased from stage 5 to stages 8 and 9B (Fig. 4).

3.3. Effects of food intake

The effects of feeding onmRNA expression levels of NPY, PYY, CART,POMC-C and ghrelinwere also established for developmental stages 5, 8and 9B (Fig. 4). For PYY at stage 5, a significant gene expression increasewas observed 3 h after initiation of feeding. For the other target genes,there was no significant response in expression levels to feeding.

A more in-depth study of the effect of a nutrient status (fasting andrefeeding) was performed in Atlantic halibut at 49 dpff (Fig. 2). The 108larvae used in this experiment were at different developmental stages,7, 8 and 9A despite their common age (Supplementary File 1). Themajority of larvae were at the prometamorphic stage 7 (initiation ofmetamorphosis).

NPY, PYY, CART and POMC-C gene expression levels were analysedin the brain, while ghrelin expression was studied in the GI tract(Fig. 5). No significant differences in NPY, PYY, CART, POMC-C andghrelin transcript abundance were found between any time pointswithin the FAST or FED groups. Ghrelin was significantly higher in theFED group 2 h after feeding compared to the FAST group. Also, PYY

and NPY transcripts were significantly more abundant in the FEDgroup compared to the FAST group at 4 and 5 h post-feeding, respec-tively. POMC-C transcript expression was significantly more abundantin the FAST group compared to the FED group 30 min after feeding.For CART, no significant differences were observed in the transcriptabundance at any time point between the FED and FAST groups.

4. Discussion

Fish larvae are often considered as “feedingmachines” because theyare able to ingest food at rates above their own weight on a daily basis(Barahona-Fernandes and Conan, 1981; Govoni et al., 1986; Parra andYúfera, 2001; Rønnestad et al., 2013), suggesting that they are constantlyhungry and motivated to feed. However, it is still unclear to what extentfish larvae have a system that functionally controls food ingestion, diges-tion and satiety. We found that the neuropeptides PYY, POMC-C andCART, all involved in appetite control in mammals, are present and pre-dominantly expressed in the brain of Atlantic halibut larvae early duringtheir development, and that PYYmay be one of themediators of satiety infirst feeding halibut larvae. The presence of PYY, POMC-C and CART in thebrain of Atlantic halibut larvae is in agreement with what has beenobserved for adult teleost species, where a role of these neuropeptides

Page 6

Fig. 4. Ontogenetic and periprandial mRNA expression of the selected genes in Atlantic halibut larvae at stages 5, 8 and 9B. Ghrelin was analysed in the GI tract and NPY, PYY, POMC-C andCART were analysed in the brain. The mRNA expression of the selected genes was analysed before feeding, and 1 h and 3 h after feeding. Results are shown as mean ± SEM of thenormalized expression (MNE), using the reference gene eEF1A1 (n = 6). Asterisks indicate statistically significant difference (Kruskal–Wallis ranked ANOVA, p b 0.05).

121A.S. Gomes et al. / Comparative Biochemistry and Physiology, Part A 183 (2015) 116–125

in appetite control has been proposed (Glavas et al., 2008; Kehoe andVolkoff, 2007; Murashita et al., 2009a; Takahashi et al., 2009; Uenoet al., 2008; Volkoff and Peter, 2001). NPY, an important orexigenic factorin adult fish (Volkoff et al., 2005; Volkoff et al., 2009), was abundantlyexpressed in the Atlantic halibut larval brain, as reported for severaladult fish species (Cerda-Reverter et al., 2000; Kehoe and Volkoff, 2007;MacDonald and Volkoff, 2009a, b; Murashita et al., 2009a), consistentwith NPY's role in feeding control (Narnaware et al., 2000). High ex-pression levels of NPY mRNA were also found in the muscle and eyeof Atlantic halibut larvae. The presence of NPY in the muscular tissueof Atlantic halibut is in agreement with previous results in other adultfish species (Liang et al., 2007; MacDonald and Volkoff, 2009b) and isconsistent with its role as a neurotransmitter and a mediator of neuro-genic angiogenesis in the skeletal muscles (Zukowska and Feuerstein,2006). The highest levels of NPY expression were detected in the eye

of Atlantic halibut larvae, pointing to an important physiologicalrole in this organ. NPY has previously been detected in the eye of severalteleost species (Chen et al., 2005; Kurokawa and Suzuki, 2002;Murashitaet al., 2009a; Sundström et al., 2008), and it has been shown that ismainly expressed in the retina of the gilthead seabream (Sparus aurata)(Pirone et al., 2008). Similar findings have been reported in mammalsand birds, and it has been suggested that NPY modulates neurotrans-mitter release in the retina (Bruun and Ehinger, 1993). Further studiesare required to establish the function of NPY in the eye of Atlantichalibut larvae and also to explore its function in appetite control.

The transition of Atlantic halibut from larva-to-juvenile ismarked bya rapid and extensive remodelling of the GI tract, which graduallydevelops from a coiled tube into a segmented and differentiated adultorgan. The stomach development ismost pronounced duringmetamor-phic climax, stage 9 (Gomes et al., 2014; Luizi et al., 1999; Murray et al.,

Page 7

Fig. 5. Periprandial mRNA expression of selected genes in Atlantic halibut larvae at 49 dpff. Results for ghrelin (analysed in the GI tract), and NPY, PYY, POMC-C and CART (analysed in thebrain) mRNA transcripts are shown asmean± SEM of the normalized expression (MNE), using the reference gene eEF1A1 (n= 6). Mean values with an asterisk (*) are significantly dif-ferent (Kruskal–Wallis ranked ANOVA, p b 0.05).

122 A.S. Gomes et al. / Comparative Biochemistry and Physiology, Part A 183 (2015) 116–125

2006; Power et al., 2008). In the present study, we observed that thelevels of ghrelin expression increased abruptly and synchronouslywith the emergence of the stomach as previously described (Gomeset al., 2014; Manning et al., 2008). The preceding observations and thetissue distribution analysis support the notion that also in Atlantichalibut the stomach is the major site of ghrelin production (Date et al.,2000; Xu and Volkoff, 2009). High levels of ghrelin have also beendetected in the brain of several other teleost species (reviewed in:Jonsson (2013)), as well as in birds and mammals (Castaneda et al.,2010; Kaiya et al., 2009). However, in the brain of developing Atlantichalibut, ghrelin was a low abundance transcript, confirming the previ-ous observations of Manning et al. (2008). It remains to be establishedif adult Atlantic halibut have higher levels of ghrelin transcripts in the

brain. The expression levels reported for other adult teleosts (reviewedin: Jonsson (2013) and Unniappan and Peter (2005)) suggest thatghrelin transcript expression in the brain may be species-specific.

While ontogeny has a clear strong effect on ghrelin transcript abun-dance, no effectwas observed for the neuropeptides,with the exceptionof CART. These observations suggest that the expression profiles of NPY,PYYandPOMC-C in the brain of Atlantic halibut larvae are independent ofmetamorphosis. CART mRNA expression decreased significantly at theinitiation of halibut metamorphosis (from stage 5 to stages 8 and 9B),opposite to increased expression prior to initiation of metamorphosis incod larvae (Herbing, 2001; Kortner et al., 2011b). The differences inCART expression between Atlantic halibut and cod larvae are intriguingandmay be a result of several factors: the use of whole cod larvae versus

Page 8

123A.S. Gomes et al. / Comparative Biochemistry and Physiology, Part A 183 (2015) 116–125

halibut brain, the differences in developmental rate, the absence of aclear-cut metamorphosis in cod and the prolonged stomach develop-ment (Kamisaka and Rønnestad, 2011; Kvale et al., 2007).

During Atlantic halibut metamorphic climax, the stomach acquiresits gastric proteolytic capacity and its reservoir function is established(Gomes et al., 2014). These twomajor functions of the stomach increasethe efficiency of protein digestion and the gut transit time. However,does the development of a fully functional gut–brain feedback systemalso occur during metamorphic climax? The high expression of ghrelinin the GI tract during climax of metamorphosis could indicate that aghrelin-dependent feedback mechanism may become active at this de-velopmental stage, yet no significant changes in transcript abundancewere observed in response to food intake in Atlantic halibut larvae.This contrasts with what has been described in other adult teleostspecies (Jonsson, 2013) and suggests that ghrelin's role in appetitecontrol may not be relevant before the juvenile/adult stage. Furtherstudies will be required to substantiate this hypothesis. In summary,the variation in ghrelin response may reflect development- and alsospecies-specific differences in energy metabolism and resistance tostarvation.

Of all the neuropeptides analysed in Atlantic halibut larvae, PYY wasthe only one that significantly responded to food intake early in devel-opment in both experiments. This suggests that PYY act as an importantanorexigenic factor in response to food intake in Atlantic halibut larvae,as it does in mammals (Broberger, 2005; Valassi et al., 2008) and adultgoldfish (Gonzalez and Unniappan, 2010). The role of PYY in teleostsappetite control however seems to be ambiguous and may be age-specific and/or species-specific, as previous results in adult Atlanticsalmon have indicated (Murashita et al., 2009b; Valen et al., 2011).

When Atlantic halibut larvae were subject to food deprivation andrefeeding, NPY transcript abundance only changed 5 h after refeedingin the FED group, a much later response than observed in adult goldfish(Narnaware and Peter, 2001). In addition, NPY mRNA levels respondimmediately to feeding in adult teleost species, such as Atlantic cod(Kehoe and Volkoff, 2007), Atlantic salmon (Valen et al., 2011) andcatfish (Ictalurus punctatus) (Peterson et al., 2012). The delayed NPY re-sponse to feeding in Atlantic halibut larvaemay suggest that NPY plays aminor role in the short-term regulation of food intake in larval stages. Inaddition, recent RNA-seq studies performed on whole cod larvaeshowed no change in NPY mRNA levels through development, fromfirst feeding until juvenile stage (Rønnestad et al., unpublished results).These findings suggest that the role of NPY in larval appetite control isprobably still not fully developed, and if it is related to feeding strategiesremains to be established.

POMC-C transcripts were significantly more abundant in the FASTgroup half an hour after feeding, while no difference was observed inthe subsequent hours. This suggests that itmay be a short-term appetitecontrol response in Atlantic halibut larvae. In contrast, no differenceswere observed for POMC-C gene expression between fasted and fedadult Barfin flounder (Verasper moseri) (Takahashi et al., 2005). On theother hand, in rainbow trout (Leder and Silverstein, 2006) and Atlanticsalmon (Valen et al., 2011), two other POMC genes, POMC-A andPOMC-B, respectively, respond to feeding. Therefore, the response ofPOMC to feeding seems to be both species-specific and subtype-specific. In the present study of Atlantic halibut larvae, only POMC-Cwas available. Future studies will therefore need to include all POMCgenes and explore comprehensively their role in appetite control.

CARThas beendescribed to be involved in both long- and short-termappetite controls in various teleost species (Kehoe and Volkoff, 2007;Murashita et al., 2009a; Peterson et al., 2012; Valen et al., 2011;Volkoff and Peter, 2001). In the present study, CART mRNA expressionlevels did not change in response to food intake in Atlantic halibutlarvae. This aligns with studies in other pleuronectiformes species,such as adult winter flounder (MacDonald and Volkoff, 2009a). CARTmay therefore play a minor role in the control of appetite and feedingfor these species, and it may have other physiological functions.

The results of the present study indicate that satiety signals may below or non-existent in Atlantic halibut larvae. This hypothesis issupported by the lack of a fully developed functional stomach prior tometamorphosis (Gomes et al., 2014) and the late appearance of the im-portant satiety signal cholecystokinin in the gut prior to initiation ofmetamorphosis (Kamisaka et al., 2001). The intensive larval rearingconditions found in aquaculture provide abundant prey availability,often in combination with continuous light. This may result in continu-ous ingestion of prey and consequently reduced time for digestion, lessefficient nutrient absorption and potentially increase the loss of nutri-ents in faeces. From an evolutionary perspective, fish larvae have devel-oped to cope with their ecological conditions, where they encounterpatches of planktonic prey in lower concentrations and availability isless continuous than in aquaculture. Gut transit times of ingested foodis an important aspect for digestive efficiency (Rønnestad et al., 2007)and feeding regimes involving distinct meals may allow more time fordigestion. This strategy, together with the control of light conditions,has contributed to overcome some deformities in halibut fry produc-tion, such as the lack of eye migration (Harboe et al., 2009). Overall, inaddition to the limited digestive capacity, satiation signals from thedigestive system to the brain may be absent, particularly in altricial-gastric species due to the lack of a fully developed and functional stomachprior to metamorphosis.

5. Conclusion

In summary, only ghrelin and CART mRNA expression levels signifi-cantly changed during metamorphosis in Atlantic halibut. GhrelinmRNA expression increased synchronously with stomach differentiationduring metamorphosis but did not appear to be modified by a feedingchallenge. The neuropeptides NPY, PYY, POMC-C and CART are presentfrom the start of exogenous feeding in Atlantic halibut larvae, and CARTexpression decreased at the initiation of metamorphosis. The responseof NPY, PYY, POMC-C and CART to food deprivation and refeeding inhalibut larvae did not appear to be coordinated and a consistent expres-sion pattern to explain their contribution to appetite control in earlylarvae was lacking. More research into the ontogeny of appetite controlin teleost fish larvae with different digestive tract morphologies andfeeding strategies is required to better understand this process. It re-mains to be established whether developing fish larvae have theirown specific system of appetite regulation adapted to their feedingecology, or if the basic system of appetite regulation is “hard wired”and larvae possess a rudimentary, still developing regulatory system.Nonetheless, the overall differences in neuropeptide expression profilesbetween the three developmental stages of Atlantic halibut may reflectdifferences in feeding strategies (continuous feeding and batch, mealbased feeding) and may indicate changes in the relative importance ofdifferent elements in the appetite control loop. In addition, the presentresults revealed that PYY is a good candidate for a satiety mediator indeveloping Atlantic halibut larvae. Larval rearing regimes and feedingprotocols in hatcheries will benefit from a better understanding of thephysiological processes involved in appetite control in larval stages.

Supplementary data to this article can be found online at http://dx.doi.org/10.1016/j.cbpa.2015.01.009.

Acknowledgements

This project was supported by the European Community FP7(LIFECYCLE; No. 222719), the Research Council of Norway (Gut feeling;No. 190019) and the University of Bergen. The authors thank Dr. R.Tillner for the help during the fast–refeed experimental setup; ProfessorH. Kryvi for assistance during dissections and for drawing Fig. 1; Ragnfridand Margaret for halibut larvae feeding assistance; T. Kalananthanfor technical assistance; Dr. S. Wang for technical assistance duringNPY cloning; and Dr. F. Zimmermann for the help with R scripts andcomments.

Page 9

124 A.S. Gomes et al. / Comparative Biochemistry and Physiology, Part A 183 (2015) 116–125

References

Aldegunde, M., Mancebo, M., 2006. Effects of neuropeptide Y on food intake and brainbiogenic amines in the rainbow trout (Oncorhynchus mykiss). Peptides 27, 719–727.

Barahona-Fernandes, M.H., Conan, G., 1981. Daily food intake of reared larvae of theEuropean seabass (Dicentrarchus labrax L.) statistical analysis and modelling. ICESSymposium on the Early Life History of Fish, Woods Holepp. 9–12.

Broberger, C., 2005. Brain regulation of food intake and appetite:molecules and networks.J. Intern. Med. 258, 301–327.

Bruun, A., Ehinger, B., 1993. NPY-induced neurotransmitter release from the rabbit andchicken retina. Acta Ophthalmol. 71, 590–596.

Castaneda, T.R., Tong, J., Datta, R., Culler, M., Tschop, M.H., 2010. Ghrelin in the regulationof body weight and metabolism. Front. Neuroendocrinol. 31, 44–60.

Cerda-Reverter, J.M., Anglade, I., Martinez-Rodriguez, G., Mazurais, D., Munoz-Cueto, J.A.,Carrillo, M., Kah, O., Zanuy, S., 2000. Characterization of neuropeptide Y expression inthe brain of a perciform fish, the sea bass (Dicentrarchus labrax). J. Chem. Neuroanat.19, 197–210.

Cerda-Reverter, J.M., Schioth, H.B., Peter, R.E., 2003. The central melanocortin systemregulates food intake in goldfish. Regul. Pept. 115, 101–113.

Chen, R., Li, W., Lin, H., 2005. cDNA cloning and mRNA expression of neuropeptide Y inorange spotted grouper, Epinephelus coioides. Comp. Biochem. Physiol. B: Biochem.Mol. Biol. 142, 79–89.

Cone, R.D., 1999. The central melanocortin system and energy homeostasis. TrendsEndocrinol. Metab. 10, 211–216.

Darias, M.J., Murray, H.M., Gallant, J.W., Douglas, S.E., Yúfera, M., Martínez-Rodríguez, G.,2007. Ontogeny of pepsinogen and gastric proton pump expression in red porgy(Pagrus pagrus): determination of stomach functionality. Aquaculture 270, 369–378.

Date, Y., Kojima, M., Hosoda, H., Sawaguchi, A., Mondal, M.S., Suganuma, T., Matsukura, S.,Kangawa, K., Nakazato, M., 2000. Ghrelin, a novel growth hormone-releasing acylatedpeptide, is synthesized in a distinct endocrine cell type in the gastrointestinal tracts ofrats and humans. Endocrinology 141, 4255–4261.

Demski, L.S., Northcutt, R.G., 1983. The terminal nerve: a new chemosensory system invertebrates? Science 220, 435–437.

Douglas, S.E., Gawlicka, A., Mandla, S., Gallant, J.W., 1999. Ontogeny of the stomach inwinter flounder: characterization and expression of the pepsinogen and protonpump genes and determination of pepsin activity. J. Fish Biol. 55, 897–915.

Glavas, M.M., Grayson, B.E., Allen, S.E., Copp, D.R., Smith, M.S., Cowley, M.A., Grove, K.L.,2008. Characterization of brainstem peptide YY (PYY) neurons. J. Comp. Neurol. 506,194–210.

Gomes, A., Kamisaka, Y., Harboe, T., Power, D., Ronnestad, I., 2014. Functional modifica-tions associated with gastrointestinal tract organogenesis during metamorphosis inAtlantic halibut (Hippoglossus hippoglossus). BMC Dev. Biol. 14, 11.

Gonzalez, R., Unniappan, S., 2010. Molecular characterization, appetite regulatory effects andfeeding related changes of peptide YY in goldfish. Gen. Comp. Endocrinol. 166, 273–279.

Govoni, J., Boehlert, G., Watanabe, Y., 1986. The physiology of digestion in fish larvae.Environ. Biol. Fish 16, 59–77.

Grove, D.J., Loizides, L.G., Nott, J., 1978. Satiation amount, frequency of feeding and gastricemptying rate in Salmo gairdneri. J. Fish Biol. 12, 507–516.

Harboe, T., Mangor-Jensen, A., 1998. Time of first feeding of Atlantic halibut, Hippoglossushippoglossus L., larvae. Aquacult. Res. 29, 913–918.

Harboe, T., Tuene, S., Mangor-Jensen, A., Rabben, H., Huse, I., 1994. Design and operationof an incubator for yolk-sac larvae of Atlantic halibut. Prog. Fish Cult. 56, 188–193.

Harboe, T., Mangor-Jensen, A., Naas, K.E., Næss, T., 1998. A tank design for first feeding ofAtlantic halibut, Hippoglossus hippoglossus L., larvae. Aquacult. Res. 29, 919–923.

Harboe, T., Mangor-Jensen, A., Moren, M., Hamre, K., Rønnestad, I., 2009. Control of lightcondition affects the feeding regime and enables successful eye migration in Atlantichalibut juveniles. Aquaculture 290, 250–255.

Herbing, I.H.v., 2001. Development of feeding structures in larval fish with different lifehistories: winter flounder and Atlantic cod. J. Fish Biol. 59, 767–782.

Higgins, S.C., Gueorguiev, M., Korbonits, M., 2007. Ghrelin, the peripheral hungerhormone. Ann. Med. 39, 116–136.

Infante, C., Matsuoka,M.P., Asensio, E., Canavate, J.P., Reith, M., Manchado, M., 2008. Selec-tion of housekeeping genes for gene expression studies in larvae from flatfish usingreal-time PCR. BMC Mol. Biol. 9, 28.

Jonsson, E., 2013. The role of ghrelin in energy balance regulation in fish. Gen. Comp.Endocrinol. 187, 79–85.

Kaiya, H., Furuse, M., Miyazato, M., Kangawa, K., 2009. Current knowledge of the roles ofghrelin in regulating food intake and energy balance in birds. Gen. Comp. Endocrinol.163, 33–38.

Kamisaka, Y., Rønnestad, I., 2011. Reconstructed 3D models of digestive organs of devel-oping Atlantic cod (Gadus morhua) larvae. Mar. Biol. 158, 233–243.

Kamisaka, Y., Totland, G.K., Tagawa, M., Kurokawa, T., Suzuki, T., Tanaka, M., Rønnestad, I.,2001. Ontogeny of cholecystokinin-immunoreactive cells in the digestive tract ofAtlantic halibut, Hippoglossus hippoglossus, larvae. Gen. Comp. Endocrinol. 123,31–37.

Kawakoshi, A., Kaiya, H., Riley, L.G., Hirano, T., Grau, E.G., Miyazato, M., Hosoda, H.,Kangawa, K., 2007. Identification of a ghrelin-like peptide in two species ofshark, Sphyrna lewini and Carcharhinus melanopterus. Gen. Comp. Endocrinol. 151,259–268.

Kehoe, A.S., Volkoff, H., 2007. Cloning and characterization of neuropeptide Y (NPY) andcocaine and amphetamine regulated transcript (CART) in Atlantic cod (Gadusmorhua). Comp. Biochem. Physiol. A Mol. Integr. Physiol. 146, 451–461.

Kortner, T.M., Overrein, I., Øie, G., Kjørsvik, E., Arukwe, A., 2011a. The influence of dietaryconstituents on the molecular ontogeny of digestive capability and effects on growthand appetite in Atlantic cod larvae (Gadus morhua). Aquaculture 315, 114–120.

Kortner, T.M., Overrein, I., Oie, G., Kjorsvik, E., Bardal, T., Wold, P.A., Arukwe, A., 2011b.Molecular ontogenesis of digestive capability and associated endocrine control inAtlantic cod (Gadus morhua) larvae. Comp. Biochem. Physiol. A Mol. Integr. Physiol.160, 190–199.

Kristensen, P., Judge, M.E., Thim, L., Ribel, U., Christjansen, K.N., Wulff, B.S., Clausen, J.T.,Jensen, P.B., Madsen, O.D., Vrang, N., Larsen, P.J., Hastrup, S., 1998. HypothalamicCART is a new anorectic peptide regulated by leptin. Nature 393, 72–76.

Kuhar, M.J., Adams, S., Dominguez, G., Jaworski, J., Balkan, B., 2002. CART peptides. Neuro-peptides 36, 1–8.

Kulczykowska, E., Sánchez Vázquez, F.J., 2010. Neurohormonal regulation of feed intakeand response to nutrients in fish: aspects of feeding rhythm and stress. Aquacult.Res. 41, 654–667.

Kurokawa, T., Suzuki, T., 2002. Development of neuropeptide Y-related peptides in the di-gestive organs during the larval stage of Japanese flounder, Paralichthys olivaceus.Gen. Comp. Endocrinol. 126, 30–38.

Kvale, A., Mangor-Jensen, A., Moren, M., Espe, M., Hamre, K., 2007. Development andcharacterisation of some intestinal enzymes in Atlantic cod (Gadus morhua L.) andAtlantic halibut (Hippoglossus hippoglossus L.) larvae. Aquaculture 264, 457–468.

Larhammar, D., 1996. Evolution of neuropeptide Y, peptide YY and pancreatic polypeptide.Regul. Pept. 62, 1–11.

Leder, E.H., Silverstein, J.T., 2006. The pro-opiomelanocortin genes in rainbow trout(Oncorhynchus mykiss): duplications, splice variants, and differential expression.J. Endocrinol. 188, 355–363.

Liang, X.-F., Li, G.-Z., Yao, W., Cheong, L.-W., Liao, W.-Q., 2007. Molecular characterizationof neuropeptide Y gene in Chinese perch, an acanthomorph fish. Comp. Biochem.Physiol. B: Biochem. Mol. Biol. 148, 55–64.

Lin, X., Volkoff, H., Narnaware, Y., Bernier, N.J., Peyon, P., Peter, R.E., 2000. Brain regulationof feeding behavior and food intake in fish. Comp. Biochem. Physiol. A Mol. Integr.Physiol. 126, 415–434.

López-Patiño, M.A., Guijarro, A.I., Isorna, E., Delgado, M.J., Alonso-Bedate, M., de Pedro, N.,1999. Neuropeptide Y has a stimulatory action on feeding behavior in goldfish(Carassius auratus). Eur. J. Pharmacol. 377, 147–153.

Luizi, F.S., Gara, B., Shields, R.J., Bromage, N.R., 1999. Further description of the develop-ment of the digestive organs in Atlantic halibut (Hippoglossus hippoglossus) larvae,with notes on differential absorption of copepod and Artemia prey. Aquaculture176, 101–116.

MacDonald, E., Volkoff, H., 2009a. Cloning, distribution and effects of season and nutri-tional status on the expression of neuropeptide Y (NPY), cocaine and amphetamineregulated transcript (CART) and cholecystokinin (CCK) in winter flounder(Pseudopleuronectes americanus). Horm. Behav. 56, 58–65.

MacDonald, E., Volkoff, H., 2009b. Neuropeptide Y (NPY), cocaine- and amphetamine-regulated transcript (CART) and cholecystokinin (CCK) in winter skate (Raja ocellata):cDNA cloning, tissue distribution and mRNA expression responses to fasting. Gen.Comp. Endocrinol. 161, 252–261.

Mangor-Jensen, A., Harboe, T., Henno, J.S., Troland, R., 1998. Design and operation of Atlantichalibut, Hippoglossus hippoglossus L., egg incubators. Aquacult. Res. 29, 887–892.

Manning, A.J., Murray, H.M., Gallant, J.W., Matsuoka, M.P., Radford, E., Douglas, S.E., 2008.Ontogenetic and tissue-specific expression of preproghrelin in the Atlantic halibut,Hippoglossus hippoglossus L. J. Endocrinol. 196, 181–192.

Muller, P.Y., Janovjak, H., Miserez, A.R., Dobbie, Z., 2002. Processing of gene expressiondata generated by quantitative real-time RT-PCR. Biotechniques 32, 1372–1374(1376, 1378–1379).

Murashita, K., Kurokawa, T., Ebbesson, L.O.E., Stefansson, S.O., Rønnestad, I., 2009a. Char-acterization, tissue distribution, and regulation of agouti-related protein (AgRP),cocaine- and amphetamine-regulated transcript (CART) and neuropeptide Y (NPY)in Atlantic salmon (Salmo salar). Gen. Comp. Endocrinol. 162, 160–171.

Murashita, K., Kurokawa, T., Nilsen, T.O., Rønnestad, I., 2009b. Ghrelin, cholecystokinin, andpeptide YY in Atlantic salmon (Salmo salar): molecular cloning and tissue expression.Gen. Comp. Endocrinol. 160, 223–235.

Murray, H.M., Gallant, J.W., Johnson, S.C., Douglas, S.E., 2006. Cloning and expressionanalysis of three digestive enzymes from Atlantic halibut (Hippoglossus hippoglossus)during early development: predicting gastrointestinal functionality. Aquaculture 252,394–408.

Nakazato, M., Murakami, N., Date, Y., Kojima, M., Matsuo, H., Kangawa, K., Matsukura, S.,2001. A role for ghrelin in the central regulation of feeding. Nature 409, 194–198.

Narnaware, Y.K., Peter, R.E., 2001. Effects of food deprivation and refeeding on neuropep-tide Y (NPY) mRNA levels in goldfish. Comp. Biochem. Physiol. B: Biochem. Mol. Biol.129, 633–637.

Narnaware, Y.K., Peyon, P.P., Lin, X., Peter, R.E., 2000. Regulation of food intake by neuro-peptide Y in goldfish. Am. J. Physiol. Regul. Integr. Comp. Physiol. 279, R1025–R1034.

Nelson, J.S., 2006. Fishes of the World. 4th ed. John Wiley and Sons, Hoboken, NJ.Nicholas, K.B., Nicholas, H.B.J., Deerfield, D.W., 1997. GeneDoc: analysis and visualization

of genetic variation. EMBNEW.NEWS 4, 14.Olsen, Y., Evjemo, J.O., Olsen, A., 1999. Status of the cultivation technology for production of

Atlantic halibut (Hippoglossus hippoglossus) juveniles in Norway/Europe. Aquaculture176, 3–13.

Olsson, C., Holbrook, J.D., Bompadre, G., Jonsson, E., Hoyle, C.H., Sanger, G.J., Holmgren, S.,Andrews, P.L., 2008. Identification of genes for the ghrelin andmotilin receptors and anovel related gene in fish, and stimulation of intestinal motility in zebrafish (Daniorerio) by ghrelin and motilin. Gen. Comp. Endocrinol. 155, 217–226.

Parra, G., Yúfera, M., 2001. Comparative energetics during early development of twomarine fish species, Solea senegalensis (Kaup) and Sparus aurata (L.). J. Exp. Biol. 204,2175–2183.

Peterson, B.C., Waldbieser, G.C., Riley Jr., L.G., Upton, K.R., Kobayashi, Y., Small, B.C., 2012.Pre- and postprandial changes in orexigenic and anorexigenic factors in channelcatfish (Ictalurus punctatus). Gen. Comp. Endocrinol. 176, 231–239.

Page 10

125A.S. Gomes et al. / Comparative Biochemistry and Physiology, Part A 183 (2015) 116–125

Pirone, A., Lenzi, C., Marroni, P., Betti, L., Mascia, G., Giannaccini, G., Lucacchini, A., Fabiani,O., 2008. Neuropeptide Y in the brain and retina of the adult teleost giltheadseabream (Sparus aurata L.). Anat. Histol. Embryol. 37, 231–240.

Power, D.M., Einarsdóttir, I.E., Pittman, K., Sweeney, G.E., Hildahl, J., Campinho, M.A.,Silva, N., Sæle, Ø., Galay-Burgos, M., Smáradóttir, H., Björnsson, B.T., 2008. Themolecular and endocrine basis of flatfish metamorphosis. Rev. Fish. Sci. 16,95–111.

Rønnestad, I., Kamisaka, Y., Conceição, L.E.C., Morais, S., Tonheim, S.K., 2007. Digestivephysiology of marine fish larvae: hormonal control and processing capacity for pro-teins, peptides and amino acids. Aquaculture 268, 82–97.

Rønnestad, I., Yúfera, M., Ueberschär, B., Ribeiro, L., Sæle, Ø., Boglione, C., 2013. Feedingbehaviour and digestive physiology in larval fish: current knowledge, and gaps andbottlenecks in research. Rev. Aquac. 5, S59–S98.

Rose, T.M., Schultz, E.R., Henikoff, J.G., Pietrokovski, S., McCallum, C.M., Henikoff, S., 1998.Consensus-degenerate hybrid oligonucleotide primers for amplification of distantlyrelated sequences. Nucleic Acids Res. 26, 1628–1635.

Sæle, Ø., Solbakken, J.S., Watanabe, K., Hamre, K., Power, D., Pittman, K., 2004. Staging ofAtlantic halibut (Hippoglossus hippoglossus L.) from first feeding through metamor-phosis, including cranial ossification independent of eye migration. Aquaculture239, 445–465.

Schauer, E., Trautinger, F., Köck, A., Schwarz, A., Bhardwaj, R., Simon, M., Ansel, J.C.,Schwarz, T., Luger, T.A., 1994. Proopiomelanocortin-derived peptides are synthesizedand released by human keratinocytes. J. Clin. Invest. 93, 2258–2262.

Silverstein, J.T., Plisetskaya, E.M., 2000. The effects of NPY and insulin on food intake reg-ulation in fish. Am. Zool. 40, 296–308.

Silverstein, J.T., Breininger, J., Baskin, D.G., Plisetskaya, E.M., 1998. Neuropeptide Y-like geneexpression in the salmon brain increases with fasting. Gen. Comp. Endocrinol. 110,157–165.

Simon, P., 2003. Q-Gene: processing quantitative real-time RT-PCR data. Bioinformatics19, 1439–1440.

Sundström, G., Larsson, T.A., Brenner, S., Venkatesh, B., Larhammar, D., 2008. Evolution ofthe neuropeptide Y family: New genes by chromosome duplications in early verte-brates and in teleost fishes. Gen. Comp. Endocrinol. 155, 705–716.

Takahashi, A., Amano, M., Itoh, T., Yasuda, A., Yamanome, T., Amemiya, Y., Sasaki, K., Sakai,M., Yamamori, K., Kawauchi, H., 2005. Nucleotide sequence and expression of threesubtypes of proopiomelanocortin mRNA in barfin flounder. Gen. Comp. Endocrinol.141, 291–303.

Takahashi, A., Kobayashi, Y., Amano, M., Yamanome, T., 2009. Structural and functionaldiversity of proopiomelanocortin in fish with special reference to barfin flounder.Peptides 30, 1374–1382.

Terova, G., Rimoldi, S., Bernardini, G., Gornati, R., Saroglia, M., 2008. Sea bass ghrelin:molecular cloning and mRNA quantification during fasting and refeeding. Gen.Comp. Endocrinol. 155, 341–351.

Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. TheCLUSTAL_X windows interface: flexible strategies for multiple sequence alignmentaided by quality analysis tools. Nucleic Acids Res. 25, 4876–4882.

Ueno, H., Yamaguchi, H., Mizuta, M., Nakazato, M., 2008. The role of PYY in feeding regu-lation. Regul. Pept. 145, 12–16.

Unniappan, S., Peter, R.E., 2005. Structure, distribution and physiological functions ofghrelin in fish. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 140, 396–408.

Valassi, E., Scacchi, M., Cavagnini, F., 2008. Neuroendocrine control of food intake. Nutr.Metab. Cardiovasc. Dis. 18, 158–168.

Valen, R., Jordal, A.E.O., Murashita, K., Rønnestad, I., 2011. Postprandial effects on appetite-related neuropeptide expression in the brain of Atlantic salmon, Salmo salar. Gen.Comp. Endocrinol. 171, 359–366.

Volkoff, H., 2006. The role of neuropeptide Y, orexins, cocaine and amphetamine-relatedtranscript, cholecystokinin, amylin and leptin in the regulation of feeding in fish.Comp. Biochem. Physiol. A Mol. Integr. Physiol. 144, 325–331.

Volkoff, H., Peter, R.E., 2001. Characterization of two forms of cocaine- and amphetamine-regulated transcript (CART) peptide precursors in goldfish: molecular cloning anddistribution, modulation of expression by nutritional status, and interactions withleptin. Endocrinology 142, 5076–5088.

Volkoff, H., Canosa, L.F., Unniappan, S., Cerda-Reverter, J.M., Bernier, N.J., Kelly, S.P., Peter,R.E., 2005. Neuropeptides and the control of food intake in fish. Gen. Comp.Endocrinol. 142, 3–19.

Volkoff, H., Xu, M., MacDonald, E., Hoskins, L., 2009. Aspects of the hormonal regulation ofappetite in fish with emphasis on goldfish, Atlantic cod and winter flounder: notes onactions and responses to nutritional, environmental and reproductive changes. Comp.Biochem. Physiol. A Mol. Integr. Physiol. 153, 8–12.

Vrang, N., Larsen, P.J., Kristensen, P., Tang-Christensen, M., 2000. Central administration ofcocaine–amphetamine-regulated transcript activates hypothalamic neuroendocrineneurons in the rat. Endocrinology 141, 794–801.

Xu, M., Volkoff, H., 2009. Molecular characterization of ghrelin and gastrin-releasing pep-tide in Atlantic cod (Gadus morhua): cloning, localization, developmental profile androle in food intake regulation. Gen. Comp. Endocrinol. 160, 250–258.

Yúfera, M., Moyano, F.J., Astola, A., Pousão-Ferreira, P., Martínez-Rodríguez, G., 2012.Acidic digestion in a teleost: postprandial and circadian pattern of gastric pH, pepsinactivity, and pepsinogen and proton pump mRNAs expression. PLoS ONE 7, e33687.

Zukowska, Z., Feuerstein, G.Z., 2006. The NPY Family of Peptides in Immune Disorders, In-flammation, Angiogenesis, and Cancer. Springer London, Limited.