Mutation, Evolution, and Natural Selection Http://www.youtube.com/watch?v=ZK6YP1Smbxk DNA is found in the nucleus of the cell
Jun 27, 2015
Mutation, Evolution, and Natural Selection
Http://www.youtube.com/watch?v=ZK6YP1Smbxk
DNA is found in the nucleus of the cell
While the copying of DNA is a very accurate process, what happens
when a mistake is made?
Mutation A mutation = change in gene sequence.Some mutations are harmful to survivalSome mutations are beneficial to survival=
adaptation
Harmful Beneficial
Types of ErrorsIncorrect pairing of nucleotide baseOnly changes one codon so only one amino acid protein is changed
Delete/ Add entire pairChanges every codon after the mistake so many amino acid proteins are changed
VC: DNA Mutation
Original:
TACGGGGGCGTAACCACAACTHere is the other side (copy).
1) Find the error:ATGCGCCCGCATTGGTGTTGAATGCGCCCGCATTGGTGTTGA2) Write the new RNA
3) Form the new codons (you can draw lines on RNA code above to separate)4) Translate into the new amino acids
AUGCGCCCGCATTGGTGTTGA
Methionine-Arginine-proline-histadine-
tryptophan-cysteine-stop
What’s the difference from the original (example B on your worksheet)?
Methionine-Arginine-proline-histadine-tryptophan-cysteine-stop
B: TACCGGATGCCAGATCAAATCHere is the other side. Find the error:
AT_GCCTACGGTCTAGTTTAG
How does mutations work?DNA is very accurate when making copies of itself,
however, sometimes it makes a mistake.
Here’s a DNA sequenceAGCCCTTATAGGCTCWhat are the corresponding base pairs?TCGGGAATATCCGAGNow when it’s being copied it replaces the T with a U.
Rewrite the your answer with U’s instead of T’s.UCGGGAAUAUCCGAGWhat amino acids will this be coded for?Serine, Glycine, Isoleucine, Serine, Glutamic Acid
The Mutation Here’s our original DNA sequenceAGCCCTTATAGGCTCATCCCTTATAGGCTC we replaced the G with a TNow what are the corresponding base pairs?TAGGGAATATCCGAGNow when it’s being copied it replaces the T with a
U. Rewrite the your answer with U’s instead of T’s.UAGGGAAUAUCCGAGWhat amino acids will this be coded for?Stop, Glycine, Isoleucine, Serine, Glutamic Acid You can see how replacing 1 base will change
everything!
Who was Charles Darwin?•British scientist that in 1859 published The Origin of Species
•Stated that all life today came from a common ancestor•Change from one to many is called evolution•This happens by a process called natural selection.• http://www.youtube.com/watch?v=nMgLF8n4DnA
Voyage of H.M.S. Beagle, 1831 - 1836
90 feet of ship, 74 people living together for 5 years...
Darwin
Galapagos
Evolution the change in the inherited traits
(passed on from parents to offspring) of a population over many generations. These traits could be:
physical (teeth shape) chemical (ability to use sun for energy) behavioral (run fast).
This change is caused by mutations in the genes.
http://www.youtube.com/watch?v=yVqJ_mQazik
PHYSICAL: This moth mimics an owl’s eyes
CHEMICAL: this orchid smells like a female bee
BEHAVIORAL: This monkey is using tools to get food
Common Ancestor-We did not come from monkeys, we just had a common ancestor
Theories on LifeTheory of EvolutionScienceBased on evidence
CreationismReligionBased on faith
Adaptationthe evolutionary process where a population becomes better suited to its environment.This process takes many generations.
A feature which is especially important for an organism's survival.
For example, the adaptation of horses' teeth to the grinding of grassFlat teeth (due to genetic mutation) chew
grass better
How does Evolution Work?Natural Selection- survival of the fittest
Organisms best suited to their environment
Natural selection is the result of four features of living systems:
1) variation – differences in the population because of genetic mutation
2) inheritance - parents pass on their genetic mutations to their offspring
3) selection - some organisms reproduce more (fittest) than others
4) time – happens over time, takes many generations
There are 2 variations of the beetles, green and red.
The birds prefer eating the green beetles.
Over generations the red beetles increase in population because they are not eaten by the birds.
More survive to produce more offspring.
Over time the red beetles have been selected over the green beetles
Generations later….
So what happens to the birds now?
INCORRECT MODEL OF EVOLUTION: BASED ON NEED
Change through use and disuse
Why does this not work?
Natural Selection’s Explanation
Ancestors had different neck lengths
Through natural selection, longer necks survived and passed on their genes.
Eventually all giraffes had long necks.
http://www.youtube.com/watch?v=sCEeefdaRcw
ONE Ancestor Many Varieties
• What are the different types?
•What could cause all the variety?
Common Ancestor-We did not come from monkeys, we just had a common ancestor
EFFECTS OF ISOLATION