Molecular markers Non-PCR based 1 courtesy of Carol Ritland
Jan 21, 2016
Molecular markers
Non-PCR based1courtesy of Carol Ritland
Ideal properties for molecular markers
• Highly polymorphic• Codominant (2N)• Frequent in genome• Selectively neutral• Easily availability• Highly reproducibility• Easy to exchange between research
groups
2
Genetic Jargons
• Terms– Locus = portion of DNA (plural = loci)
• Not always a gene
– Allele = form that a locus can take: Mendelian• Subjective depending on resolution of
measurement– Nucleotide state difference (sequencing eg. SNPs)– Length difference (microsatellite)– Functional difference (ABO blood group)– Electrophoretic difference (allozyme)
…AGGCGTTCGCTTATGATAA……AGGCGTACGCTTATGATAA……AGGCGTTCACACACACACGCTTATGATAA…
…AGGCGTTCACACACACACACGCTTATGATAA…
3
RFLP• Restriction Fragment Length Polymorphism (Box
1.2)– Digestion of large amount (10ug) of genomic DNA
using R.E.– Run digested fragments into agarose gel– Due to different R.E. sites the fragment lengths will
differ– Require a “known” probe (0.5 to 3.0 kb)– Using Southern blot technique
– Botstein et al. Am J. Hum Genet., 1980 32:314-331
4
Griffiths et al Introduction to genetics 19965
Griffiths et al Introduction to genetics 19966
Sickle cell screening
• Single base change• RE for CTGAGG• Both parents are
carrier• Child 1 = affected• Child 2 = carrier• Child 3 = not affected• Prenatal screening
Saiki, RK; Scharf S, Faloona F, Mullis KB, Erlich HA, Arnheim N (Dec 20 1985). "Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia". Science 230 (4732): 1350–4.
7
VNTR
• Variable Nuclear Tandem Repeat• Minisatellites with repeats of 11 to 60 bp long• Using RFLP method but probing with repeat
probes (Southern Blot)• Looking for fingerprint patterns• Pending of RE used• Scoring for number of bands • Potential to have many allele in a population • Dominant marker with Mendelian inheritance• Jeffrey A. et al. 1985 Nature 314:67-73
8
VNTR
Griffiths et al Introduction to genetics 19969
10