Molecular identification of Ostreopsis cf. ovata in filter feeders and putative predators

Harmful Algae 21–22 (2013) 20–29

Molecular identification of Ostreopsis cf. ovata in filter feeders andputative predators

Michela Furlan a,1, Marta Antonioli a,1, Adriana Zingone b, Angela Sardo b, Claudia Blason a,Alberto Pallavicini a,*, Serena Fonda Umani a

a Department of Life Sciences, University of Trieste, 34127 Trieste, Italyb Stazione Zoologica Anton Dohrn, Villa Comunale, 80121 Napoli, Italy

A R T I C L E I N F O

Article history:

Received 20 April 2012

Received in revised form 20 November 2012

Accepted 20 November 2012

Keywords:

Ostreopsis

Toxicity

Real-time PCR

Mussel

Copepod

A B S T R A C T

Ostreopsis ovata Fukuyo is a benthic dinoflagellate widespread from tropical to subtropical and warm

temperate coastal areas world-wide. Since the species produces palytoxin-like substances that can

accumulate in seafood, the apparent expansion of its range in recent years represents an increasing risk

for human health. This leads to the necessity of monitoring protocols that enable the rapid detection of

the presence of this microalga in environmental samples and sea-food. We developed an identification

protocol based on real-time PCR (qPCR) to detect O. cf. ovata presence in different matrices. The protocol

was proved to be able to reveal microalgal traces in both soft tissues and intervalvar liquid of mussels

exposed to O. cf. ovata in natural and experimental conditions as well as in seawater samples. O. cf. ovata

could also be detected in mussel tissues after the end of the bloom, when it was no longer detectable in

sea water. We were able to detect O. cf. ovata in copepods fed on unialgal cultures as well. Cell density

estimates based on standard curves resulted to be comparable to direct microscopical counts. The

method is therefore suitable to ascertain the origin of palytoxin-like substances in toxic seafood. In

addition, our results confirm that mussels and other predators can actually ingest O. cf. ovata cells and act

as a vector for toxin transfer through both benthic and planktonic food webs.

� 2012 Elsevier B.V. All rights reserved.

Contents lists available at SciVerse ScienceDirect

Harmful Algae

jo u rn al h om epag e: ww w.els evier .c o m/lo cat e/ha l

1. Introduction

Ostreopsis ovata Fukuyo is a benthic dinoflagellate living mainlyepiphytically on macroalgae but often also found in planktonsamples (Aligizaki and Nikolaidis, 2006; Selina and Orlova, 2010).

O. ovata was initially detected in tropical and subtropicalciguatera-affected areas of Pacific, Altlantic and Indian Oceans andCaribbean Sea (Fukuyo, 1981; Besada et al., 1982; Chang et al.,2000; Hurbungs et al., 2001; Rhodes, 2011). During the last decade,Ostreopsis species have expanded their distribution from tropical–subtropical to temperate waters, such as the Mediterranean Sea(Aligizaki et al., 2008; Mangialajo et al., 2011; Rhodes, 2011). Thefirst report in Italian Seas dates back to 1989, when the O. ovata

species was reported along the Tyrrhenian coastline of the Lazioregion (Tognetto et al., 1995). Since the end of the 90 s, massiveblooms attributed to this species have been recorded in coastalwaters of the Tyrrhenian, Ligurian and Adriatic Seas (Sansoni et al.,2003; Simoni et al., 2004; Gallitelli et al., 2005; Barone andPrisinzano, 2007; Totti et al., 2007; Mangialajo et al., 2008).

* Corresponding author. Tel.: +39 040 5588736.

E-mail address: [email protected] (A. Pallavicini).1 These authors contributed equally to this work.

1568-9883/$ – see front matter � 2012 Elsevier B.V. All rights reserved.

http://dx.doi.org/10.1016/j.hal.2012.11.004

Additionally its presence has been reported in several other sitesalong the Italian coast (Zingone et al., 2006; Monti et al., 2007),with the exception of the sandy littorals of Emilia-Romagna andVeneto regions.

In the last few years it has been shown that O. ovata is a speciescomplex which includes strains having similar morphology butbelonging to distinct clades, based on molecular data of LSU and ITSsequences (Pin et al., 2001; Penna et al., 2005, 2010; Sato et al.,2011). At present, it has been suggested to use the name O. cf. ovata

for a number of clades including Mediterranean, Atlantic and EastAsian strains (Penna et al., 2010; Sato et al., 2011), which is appliedin this article.

O. cf. ovata (cited as O. ovata in many studies) producespalytoxin-like compounds including several types of ovatoxins andmascarenotoxins (Ciminiello et al., 2008; Guerrini et al., 2010;Ramos and Vasconcelos, 2010; Rossi et al., 2010). The species isnormally found at low concentrations in seawater, but whenoccurring at high cell density it can cause a broad range ofdeleterious impacts, including hypoxia/anoxia episodes, fish andbenthic invertebrate malformations or kills, as well as humansymptoms (Ramos and Vasconcelos, 2010). Indirect economicimpacts on fishing and aquaculture industries may also occur dueto the reduction of seafood sale, short- and long-term closure ofharvestable shellfish and fish stocks, while tourism-related

Table 1Microalgal species employed during the present study.

Species Code Origin

Alexandrium minutum AL1T Gulf of Trieste, TS (Adriatic Sea)

Alexandrium taylori AY7T Laguna di Marano, UD (Adriatic Sea)

Alexandrium tamutum A1T Gulf of Trieste, TS (Adriatic Sea)

Coolia monotis CO2 Gulf of Trieste, TS (Adriatic Sea)

Ostreopsis cf. ovata D483 Gulf of Naples, NA (Tyrrhenian Sea)

Akashiwo sanguineum GY3K2 Gulf of Trieste, TS (Adriatic Sea)

Scrippsiella trochoidea SCR2 Gulf of Trieste, TS (Adriatic Sea)

Prorocentrum minimum SWE3 Himmerfjarden Bay (Baltic Sea)

M. Furlan et al. / Harmful Algae 21–22 (2013) 20–29 21

businesses can also be affected by these blooms (Gilbert et al.,2005; Aligizaki et al., 2008; Shears and Ross, 2009; Louzao et al.,2010).

Human intoxication is a consequence of the capability of somemarine animals to bioaccumulate the toxin in their soft tissues,thus transferring it to consumers at higher trophic levels andenabling its distribution in marine food webs (Geraci et al., 1989;Anderson and White, 1992; Mebs, 1998).

Palytoxin-like compounds have been found throughout thefood web including zoanthids (Palythoa sp. and Zoanthus sp.),various sponges and corals, echinoderms, shellfish, polychaeteworms, crustaceans and fish (Aligizaki et al., 2011; Tubaro et al.,2011).

In the Mediterranean Sea, O. cf. ovata blooms have beenassociated with a number of human symptoms such asrespiratory problems, fever, conjunctivitis and skin irritations,deriving from the inhalation of marine aerosol or direct contactwith seawater containing cells or toxins (Brescianini et al., 2006;Durando et al., 2007). Despite relatively high concentrations ofpalytotoxin-like substances in mussels or sea-urchins (Aligizakiet al., 2011; Amzil et al., 2012), up to now no cases of humanintoxication have been reported from this area as a consequenceof seafood ingestion.

The expansion of O. cf. ovata blooms and their possible impactsleads to the necessity of developing new sensible and rapidprotocols allowing an early warning system for the detection ofharmful algae in fish, shellfish or water (Penna and Galluzzi, 2008).The classical approach for enumerating phytoplankton speciesrelies on direct observation by light microscopy, a time-consumingpractice that requires a high level of taxonomic experience (Godheet al., 2008; Perini et al., 2011). Taxonomy of the genus Ostreopsis ismainly based on cell size and thecal plate pattern, making speciesrecognition quite difficult since the majority of them show similarthecal plate arrangements (Aligizaki and Nikolaidis, 2006). Themolecular characterization is the only tool able to definitely solvethe taxonomical problems (Monti et al., 2007; Penna et al., 2007;Perini et al., 2011).

The polymerase chain reaction (PCR) has already beensuccessfully employed for the detection of microalgae responsibleof harmful blooms, including O. cf. ovata (Rollo et al., 1995; Pennaand Magnani, 1999; Godhe et al., 2001; Connell, 2002; Guillouet al., 2002; John et al., 2005; Penna and Galluzzi, 2008). Inparticular real-time PCR (qPCR) is becoming a new approach forHAB species detection (Bowers et al., 2000; Galluzzi et al., 2004;Nejstgaard et al., 2008; Perini et al., 2011), as it presents highersensitivity than conventional PCR (Hosoi-Tanabe and Sako, 2005).This technique is rapid, inexpensive, specific, sensitive, requires alow level of experience in microalgal taxonomy and can be appliedon numerous field samples. Traditional PCR was already applied tostudy predation exerted by organisms such as copepods, musselsor shrimps (Asahida et al., 1997; Nejstgaard et al., 2003, 2008;Galluzzi et al., 2005; Vestheim et al., 2005). Recently Perini et al.(2011) have demonstrated real-time PCR usefulness in O. cf. ovata

detection and quantification on environmental samples asmacrophytes and seawater samples, but there are no evidentstudies reporting PCR employment for O. cf. ovata detection in itsnatural predators.

In this study we developed a fast and efficient qPCR protocol toidentify and quantify O. cf. ovata presence in filter feeders andpredators that could act as vectors of palytoxin in the benthic andpelagic food webs, thus possibly leading to human intoxication dueto seafood ingestion. We selected Mytilus galloprovincialis Lamarckas a model consumer of O. cf. ovata, given its importance as aresource for molluscan production in the European aquacultureand the impacts on human health arising from a possible O. cf.ovata contamination.

Our real-time PCR-based molecular assay, designed on ITS-5.8S rDNA region, enables specific detection of very low amountsof O. cf. ovata. This method could allow cells detection at the pre-bloom level, important for the prediction of species-specificpotential bloom sites (Popels et al., 2003; Galluzzi et al., 2004;Perini et al., 2011). Moreover, the method proved to be able toidentify microalgal DNA traces in putative filter feeders andpredators possibly acting as vectors for the algal toxin through thetrophic web. It could also be used in association with toxindetection assays (HPLC, LC–MS, mouse bioassay, hemolysisneutralization, antibody detection) employed to detect bothtoxic compounds and poisoning caused by microorganisms, e.g.when some information on the presence of the species involved inthe poisoning is unclear. For example, the presence of palytoxinand of one of its analogs, 42-hydroxy-palytoxin, has beendemonstrated in the filamentous cyanobacterium Trichodesmium

spp. in New Caledonian waters, suggesting that the presence ofthese toxins in planktivorous fish could also be caused byingestion of these species rather than by Ostreopsis species only(Kerbrat et al., 2011).

2. Materials and methods

2.1. Biological samples

2.1.1. Microalgal cultures

O. cf. ovata strain D483 was isolated with a capillary pipettefrom Asparagopsis taxiformis (Delile) Trevisan de Saint-Leon(Rhodophyta) collected at the Gaiola sampling site, in the Gulfof Naples (Tyrrhenian Sea, Mediterranean Sea, 4,515,975 m N,431,392 m E, Zone 33T; Naples, Italy) in September 2008. The UTMcoordinates are referred to the WGS84 Datum.

To test the specificity of the primers, O. cf. ovata was cultivatedalong with seven other dinoflagellate microalgal species (Table 1)in BT and K/2 media, at a salinity of 32 or 36, respectively, with theexception of Prorocentrum minimum (Pavillard) Schiller (salinity 8),at 15 8C (with the exception of O. cf. ovata maintained at 20 8C),under a light:dark (L:D 14:10 h) photoperiod with a PAR of60 mE m�2 s�1. A final concentration of 0.01 M EDTA pH 8 wasadded to microalgal cultures to dissolve microalgal aggregates.Cells were centrifuged for 5 min at 800 rcf to remove thesupernatant and the pellet was maintained at �80 8C.

For the contamination experiment, O. cf. ovata was maintainedin 2-L glass bottles in K/2 medium which was refreshed every 7–10 days, at 23.0 � 0.5 8C and 100 mE m�2 s�1, with a 12:12 dark:lightphotoperiod. For culture concentration estimates, after gentleshaking about 50 mL of the culture were fixed with neutral formalin(37%), 1-mL subsample was put into a Sedgewick-Rafter countingchamber and cells were allowed to settle for 5–6 min. Cellconcentrations were estimated by averaging the cells enumeratedin 5 transects of the chamber in the light microscope at 100�magnification.

Table 2Copepod species used to evaluate the possible predation of mesozooplankton on O.

cf. ovata (in brackets is reported the number of individuals for each species) and

data obtained from qPCR assays.

Sample Copepod species composition Ct� SD

Cop_1 Copepodit (3) 32.92 � 0.14

Cop_2 Centropages sp. (3) 29.87 � 0.16

Cop_3 Centropages sp. (3) 28.41 � 0.17

Cop_4 Acartia sp. (3) 29.83 � 0.11

Cop_5 Acartia sp. (4) + Centropages sp. (1) 34.84 � 0.33

Cop_6 Acartia sp (1) + Centropages sp. (1) 33.50 � 0.35

Cop_7 Acartia sp. (1) + Centropages sp. (1) + copepodit (1) 34.46 � 0.31

Cop_8 Centropages sp. (1) + Oithona sp. (1) + copepodit (1) 29.72 � 0.29

Cop_9 Centropages sp. (1) + copepodit (2) 35.24 � 1.79

Cop_10 Acartia sp. (1) + Centropages sp. (1) + copepodit (1) 29.11 � 0.23

Cop_11 Acartia sp. (1) + copepodit (1) 37.58 � 0.25

Cop_12 Acartia sp. (1) + Corycaeus sp. (1) + copepodit (1) 36.84 � 0.48

M. Furlan et al. / Harmful Algae 21–22 (2013) 20–2922

2.1.2. Mytilus galloprovincialis

The extraction–amplification protocol was set up with mussels(M. galloprovincialis) purchased at a local market in Trieste. Thedetection method was tested on mussels from the naturalenvironment fed with O. cf. ovata or collected during and afterblooms of the toxic microalga as described below.

2.1.2.1. Mussel (M. galloprovincialis) exposed to O. cf. ovata under

laboratory conditions. Mussels were collected from the Gulf ofNaples (Tyrrhenian Sea, Mediterranean Sea) in November 2009,when the O. cf. ovata bloom had declined, and immediatelytransported to the animal rearing facility of the Stazione ZoologicaAnton Dohrn of Naples (SZN). They were maintained in open circuittanks with filtered (35 mm mesh-size net) seawater and fed with amixture of Isochrysis galbana Parke and Tetraselmis suecica (Kylin)Butcher two/three times a week until one week before the feedingexperiments.

Ten mussels of about 80 g total weight (19.53 g mussel softtissue) were placed in 1 L of O. cf. ovata culture (strain D483) ofknown concentration (1.53 � 103 cells mL�1), aerated and held at21.0 � 0.5 8C for 24 h. A control, containing only the algal culture, wasused to evaluate feeding-independent changes in the O. cf. ovata

concentration. The number of cells filtered by the mussels wasestimated as the difference between the microalgal cell abundance inthe control and experimental vessels at the end of the 24 h. Musselswere then transferred back into the open circuit tank with no foodaddition. Subsamples were collected immediately and after 1, 2, 7 and10 days of the decontamination period. Soft tissues were separatedfrom the valves and the byssus with a scalpel, weighted and stored at�20 8C until being transferred to the University of Trieste for themolecular analyses.

2.1.2.2. Environmental samples. Environmental mussels were col-lected from two different coastal locations where O. cf. ovata

blooms were reported: Gaiola (4,515,975 m N, 431,392 m E, Zone33T; Naples, Italy) and Canovella de’ Zoppoli (5,063,295 m N,399,161 m E, Zone 33T; Trieste, Italy).

Mussels from Gaiola were collected by the Regional Environ-mental Agency (ARPA Campania) in July and September 2009 inperiods of O. cf. ovata blooms. Toxin concentrations in soft tissueswere determined at the Department of Natural Substances of theUniversity Federico II of Naples. In this study, for the qPCR assays,each mussel sample was subdivided in three sub-aliquots,separately processed to verify the reproducibility and sensitivityof the protocol.

Samples from Canovella de’ Zoppoli were collected by theNational Institute of Oceanography and Experimental Geophysics(OGS-BiO) of Trieste after an O. cf. ovata bloom recorded onSeptember 29th 2009: two water samples dated September 30th(2.8 � 103 cells mL�1) and October 9th (O. cf. ovata was notdetected through microscopic observation) and six musselscollected on 9th October (microalgal cell concentration dataprovided by Cabrini, pers. comm.). Water samples were fixed withformalin. Intervalvar liquids (900 mL and 750 mL) from twomussels (CA_2 and CA_4) were individually collected andcentrifuged for 5 min at 800 rcf to remove the supernatant. Allsamples were stored at �80 8C before analysis.

2.1.3. Copepods predation on O. cf. ovata

Two preliminary experiments were performed to monitor thecopepod selectivity in grazing on O. cf. ovata. Mesozooplanktonsamples were collected offshore the NIB Laboratory of Piran(5,042,621 m N, 388,185 m E, Zone 33T; Slovenia) in June andSeptember 2009 with a 200 mm mesh plankton WP2 net. Sampleswere diluted in an incubator and transferred to the laboratoryimmediately after capture. Nine Nalgene bottles (2 L each capacity)

of 200 mm-filtered sea water were enriched with 20 mL of an O. cf.ovata culture of known concentration (500 � 103 cell L�1).Three bottles were immediately fixed with 2% buffered formal-dehyde (C0 sample). The remaining 6 bottles were incubated insitu for 24 h and represent the C24 samples without and withpredators added (12–15 copepodits of Acartia clausi Giesbrecht inJune and of Centropages sp. in September). At the end of theincubation, samples were fixed with 2% buffered formaldehydeand preserved at 4 8C until analysis. O. cf. ovata cell concentrationwas evaluated under an inverted microscope (Leitz Labovert) at320� magnification.

For evaluation of copepod predation through molecularanalysis, copepods were collected in the Gulf of Trieste, using a200 mm mesh plankton WP2 net. Species representative of thecommunity were selected under stereomicroscope Leica MZ6 with40� magnification, subdivided into 12,100 mL-glass bowls (Table 2)and incubated with 50 mL of O. cf. ovata culture (240 cells mL�1).Samples were maintained on a tilting table for 3 h. Copepods werethen recovered, cleaned from the attached O. cf. ovata cells underthe inverted microscope, rinsed, transferred in 2 mL vials and storedat �80 8C until molecular analysis.

2.2. Genomic DNA extraction

Different protocols and commercial kits were tested for thegenomic DNA extraction from microalgae and M. galloprovincialis.For this study the E.Z.N.A.1 Mollusc DNA Kit (Omega Bio-Tek) wasselected for all samples processing, since it allowed the reductionof carbohydrates, which are particularly represented in tissues oftypical predators, such as mussels (Sokolov, 2000). Mussel tissueswere homogenized to obtain a pulp, from which 40 mg were usedfor the extraction, as required by the kit protocol. Microalgal cellpellets were resuspended in lysis buffer (supplied by the kit).Extractions were performed according to the manufacturer’sinstructions. The quantification of extracted DNA was performedwith a fluorometer (QubitTM, InvitrogenTM) and a spectrophotom-eter (Ultrospec1 2000, Pharmacia Biotech). The latter instrumentwas used to read the absorbance at 260 nm and to evaluate DNApurity using absorbance at 280 nm and 230 nm. Extracts were alsochecked on 1% agarose gel in TAE 1� and stored at �20 8C.

2.3. Primer design

Initially tests were performed with O. cf. ovata specific primersdescribed by Penna et al. (2007). Subsequently, a new primer pairwas designed to meet the requirement of qPCR. The present studywas performed prior to the publication of Perini et al. (2011) whoseprimers are based on LSU region.

M. Furlan et al. / Harmful Algae 21–22 (2013) 20–29 23

The Internal Transcribed Spacer (ITS)-5.8S ribosomalDNA (rDNA) region of O. cf. ovata was selected as the targetfor the design of species-specific primers because it allows agood specificity with short amplicons required in qPCR assayand enables microalgal contamination detection with greatefficiency. ITS1-5.8S-ITS2 sequences of O. cf. ovata/O. ovata andother related dinoflagellates were recovered from the GenBankdatabase (Genetic sequence database at the National Center forBiotechnical Information, NCBI), in particular other Ostreopsis

species, like O. lenticularis Fukuyo and O. siamensis Schmidt(GenBank ID: AF218455.1; AF218456.1; AF218457.1; AF218458.1;AF218459.1; AF218460.1; AF218461.1; AF218462.1; AF218463.1;AF218464.1; AJ301643.1; AJ311520.1; AJ312944.1; AJ318461.1;AJ318462.1; AJ319871.1; AJ320179.1; AJ420005.1; AJ420006.1;AJ491311.1; AJ491312.1; AJ491313.1; AJ491332.1; AJ491333.1;AJ491334.1; AJ491335.1). Sequence alignment was performedwith the SeqMan software (Lasergene, DNASTAR, version7.0.0) and the most conserved sequences within the 5.8S-ITS2region of O. cf. ovata were chosen for primer design. Primersequences are 50GTTCTTGGGCCACCCCTAAGGA30; OVA_REV50ATAATGCATGATGTGGAGCACA30, amplifying a 75 base pair longproduct.

The specificity of the primer sequences was verified in silicousing the blastn algorithm versus the Dinophyceae (taxid: 2864)subset of Genbank (NCBI). Primer specificity was also tested invitro with end-point PCR experiments, using the genomic DNAextracted from eight microalgal species: O. cf. ovata, Alexandrium

minutum Halim, Alexandrium taylori Balech, Alexandrium tamutum

Montresor, John, Beran and Medlin, Coolia monotis Meunier,Akashiwo sanguinea (Hirasaka) Hansen and Moestrup, P. minimum

(Pavillard) Schiller and Scrippsiella trochoidea (Stein) Balech exLoeblich III (Table 1).

2.4. End-point PCR

To study primer specificity and sensitivity, end-point PCRamplifications were performed in a Mastercycler1 epgradient S(Eppendorf). Each reaction mix contained 1 ng of microalgalgenomic DNA (Table 1), 1� Reaction Buffer, 1.5 mM MgCl2,200 mM of each dNTP, 0.5 mM of each primer, 1 U Taq DNAPolymerase (InvitrogenTM). PCR thermal profile was: 94 8C for10 min, followed by 35 cycles at 94 8C for 30 s, 58 8C for 30 s, 72 8Cfor 45 s and a final extension at 72 8C for 7 min.

2.5. Real-time PCR

Real-time amplifications (qPCR) were performed in a CFX96TM

Real-Time PCR Detection System (Bio-Rad). Reaction mix wascomposed by 1� Reaction Buffer, 2.5 mM MgCl2, 200 mM of eachdNTP, 0.3 mM of each primer, 1� EvaGreenTM dye (Biotium) and1 U Taq DNA Polymerase (InvitrogenTM). PCR conditions were:94 8C for 3 min, followed by 36 cycles at 94 8C for 30 s, 58 8C for10 s, 72 8C for 20 s and at the end a melt curve from 65 8C to 95 8Cwith an increment of 0.5 8C every 0.5 s.

Real-time amplifications on natural samples or samplescontaminated in the laboratory were performed using 200 ngmussel DNA or 800 pg copepod DNA or 1 mL DNA fromintervalvar liquid and seawater samples. Each qPCR assay wasrun in triplicates and comprised also a positive control (200 pg O.

cf. ovata DNA), a negative control (200 ng of non-contaminatedmussel DNA) and a ‘No Template Control’ (NTC, deionized,filtered water) to ensure that there was no contamination in PCRreagents. Amplicons were eventually checked on 2% agarose gelin TAE 1�.

Raw amplification data were obtained from the Bio-Rad CFXManager Software (Version 1.1.308.1111) and were analyzed, to

calculate the efficiency for each PCR reaction, using the LinRegPCRsoftware (Ramakers et al., 2003; Ruijter et al., 2009).

Outliers eventually present within replicates of each samplewere detected according to Grubbs’ test with p < 0.05 (online:http://www.graphpad.com/quickcalcs/Grubbs1.cfm). Statisticalanalyses for standard curves were performed with non-parametricSpearman correlation test using the MedCalc1 Software (Version12.2.1.0) with a p < 0.0001 determining significance.

3. Results and discussion

3.1. Evaluation of primer sensibility and sensitivity

Preliminary experiments performed using primers proposed byPenna et al. (2007) presented a non-specific PCR product of shortersize (data not shown), which competed with the formation of thespecific amplicon that was 210 base pair long. Since a 50–150 basepair long amplicon is recommended in qPCR assays, we designed anew primer pair optimized to meet this requirement.

The qPCR assay is based on the choice of an appropriatemolecular marker that discriminates organisms at the desiredhierarchical level; here we selected the ITS-5.8S ribosomal DNAregion, present in high copy number in eukaryotic cells. In silico

primer specificity analysis produced a significant alignment onlywith ITS-5.8S-ITS2 sequences of O. cf. ovata (E-value 8 � 10�6,alignment score 44.1), whereas the other hits presented high E-value and low scores and percentage of coverage, confirming thatprimer sequences targeted only the desired O. cf. ovata 5.8S-ITS2region.

For in vitro control of system specificity, PCR amplificationswere performed from genomic DNA of different microalgalspecies: O. cf. ovata, A. minutum, A. taylori, A. tamutum, C. monotis,A. sanguinea, P. minimum and S. trochoidea (Fig. 1A). The newlydesigned primers amplified exclusively O. cf. ovata DNA, whereasno amplification was observed in reactions containing DNA fromother microalgae. In addition, a melt curve analysis was performedto check the exclusive presence of the specific amplicon (Ririe et al.,1997; Kubista et al., 2006). The melt curve analysis is a goodpractice to control the formation of non-specific products. EvaGreenTM binds the double-stranded DNA resulting in increasing offluorescence intensity without specificity for PCR products andprimer–dimers, the latter affecting the accuracy of the results if co-amplified with the PCR products. To distinguish these twoproducts, temperature is gradually increased from 65 to 95 8C,decreasing the dye fluorescence at a constant rate and obtaining adissociation curve. The greatest rate of change in fluorescenceresults in visible peaks, which represents the Tm of denatureddouble-stranded DNA complexes. The melting temperature is afunction of product length and base composition, consequentlydimer-primers are usually shorter than the target product anddisplay a lower melting temperature.

For the melt curve analysis, O. cf. ovata genomic DNA wasanalyzed in a qPCR assay alone and mixed with a fixed quantity ofM. galloprovincialis genomic DNA. This test was useful to verify thepossible inhibitory effect of non-specific background material onprimer annealing kinetic. In the experiment performed withprimers designed in this study (Fig. 1B), the melt curve showedonly the specific amplification product (peak at 79 8C) withoutdetection of collateral non-specific amplicon, despite the presenceof background DNA. However, PCR efficiency resulted to bereduced relative to the reaction performed with only O. cf. ovata

DNA, decreasing from 1.93 to 1.84 with a shift of the amplificationcurve (data not shown). This result suggested that mussel DNA,present in higher quantity compared to the dinoflagellate DNA,influenced primer annealing kinetic, increasing the time requiredfor target template recognition by primers. This caused a delay in

Fig. 1. (A) Analysis of primer specificity. Lanes content: 1, molecular weight marker; 2, Ostreopsis cf. ovata; 3, Alexandrium taylori; 4, Prorocentrum minimum; 5, Alexandrium

minutum; 6, Alexandrium tamutum; 7, Coolia monotis; 8, Akashiwo sanguinea; 9, Scrippsiella trochoidea; 10, negative control and (B) Melt curve chart representing amplification

product obtained using the primers designed in this study (continuous line); �d(RFU)/dT = negative first derivative of the change in relative fluorescence unit (RFU) plotted as

a function of the temperature.

M. Furlan et al. / Harmful Algae 21–22 (2013) 20–2924

the beginning of the exponential phase. Different parameters ascarbohydrate content (Sokolov, 2000) or background tissuepresence were taken into account, since they can interfere withthe amplification reaction, modifying the efficiency values, alteringthe obtained results.

Primer sensitivity was assessed by processing a known,decreasing amount of O. cf. ovata cells. Since mussel backgroundDNA shifted the amplification curve of O. cf. ovata product, weperformed two qPCR experiments. In the first experiment, usingonly microalgal cells (Fig. 2A) 1/25 of the DNA template resultingfrom 25,000, 5000, 1000, 200 and 40 cells was amplified. For thelast 4 dilutions, DNA was diluted from the ‘40 cells’ sample with 5as dilution factor, since it was difficult to isolate correctly less than8 cells. For the second experiment, decreasing quantities of O. cf.ovata cells (1000, 200, 40, 8, 1.6 cells) were added to homogenizedmollusc tissues as background and 1/150 of the extracted DNA wasused for the amplification (Fig. 2B). The DNA of the last twosamples was diluted from the ‘40 cell’ sample, considering 5 asdilution factor.

Starting quantities were converted to cells per gram of tissue(Fig. 2B), evidencing that we were able to detect microalgal DNAcorresponding to approximately 3000 cells per 100 g of tissue.Again, in presence of non-specific material, PCR efficiency resultedto be reduced from 1.92 to 1.88 with a shift of the threshold cycle(Ct) values. However, efficiency values fell within the rangesrequired for an optimal qPCR assay (E = 1.8–2.0; Ramakers et al.,2003) and there was consistency between replicates, indicatingthat this primer system allowed very precise and reproducibledetection of low amounts of microalgal DNA, also with highbackground material. Linear regression analysis resulted in a highR2 value (>0.980) indicating that the dilution factor wasmaintained through the entire analytical process, starting fromthe mixing phase to DNA extraction and amplification. Bothstandard curves resulted significant (p < 0.0001), indicating that

there is a significant relationship between Ct and startingquantities of the diluted samples.

Data demonstrate that we were able to detect an amount ofDNA equivalent to less than one algal cell even when mixed with alarge amount of background DNA, making curves and protocolsuitable for the estimation of microalgal contamination inenvironmental samples. In particular, the curve in the firstexperiment could be used to quantify O. cf. ovata content inintervalvar liquids and seawater samples (expressed as cell mL�1),which did not have high background DNA, whereas the secondcould be employed for mussel soft tissues analysis (expressed ascells g�1).

3.2. Quantitative analysis of O. cf. ovata filtered by mussels in

controlled conditions

The mussels exposed to O. cf. ovata cultures filtered a totalnumber of 1.02 � 106 microalgal cells, corresponding to5.2 � 104 cells g�1 of soft animal tissue. The mussels were thensubjected to a decontamination treatment and samples of their softtissue collected at different times were analyzed with qPCR toassess at what extent the method could detect O. cf. ovata presencein the molluscs. An amount of 200 ng of DNA extracted fromcontaminated mussel tissues was used in each assay. Amplificationefficiency was 1.89 (R2 = 0.997). To evaluate the decontaminationtrend, we calculated relative quantity (RQ) using the formula

RQ ¼ EðCtS0 �CtSÞ (1)

where E is the PCR efficiency, CtS0 the Ct value of the chosenreference sample and CtS the Ct value of the considered sample. Weconsidered the sample collected immediately after 24 h exposureto O. cf. ovata, not subjected to decontamination, as the referenceone.

Fig. 2. Linear regression lines (used also as standard curves) obtained from the amplification data of decreasing DNA amount of microalgal cells without (A) and with (B)

exogenous DNA (from mussel). The straight line equations and linear regression values (R2) are boxed. Labels in (A) indicate estimated cell number used in a single PCR

reaction; in (B) quantities are indicated as cells g�1 of tissue.

M. Furlan et al. / Harmful Algae 21–22 (2013) 20–29 25

Results (Table 3) confirmed the capability of our protocol todetect microalgal traces in mussel soft tissues. Since mussels weresubjected to different decontamination times, they were expectedto show a continuous increase in Ct values, with the lowest onecorresponding to the ‘0 day’ sample and the highest for the‘10 days’, and a corresponding decrease in relative quantity values,as a consequence of the decrease in microalgal DNA amount.Values reported in Table 3 confirm the expected trend, despitesome variability possibly due to different amounts of microalgalcells retained in the animals, and show that even after 10 days ofdecontamination O. cf. ovata DNA traces were still detectable inmussel tissues. From the quantitative point of view the conversionof DNA to cell abundance at time 0 yielded a value that was about50% of the cells filtered by the animals (microscopical count). This

Table 3Data obtained from a qPCR assay on samples exposed to O. cf. ovata in controlled condit

with Eq. (1), considering the sample subjected to no detoxification as reference one.

Detoxification time Ct� SD

0 day 30.87 � 0.24

1 day 31.31 � 0.19

2 days 33.56 � 0.11

7 days 33.12 � 0.18

10 days 35.99 � 0.32

difference could be due to technical problems, e.g. mussel tissueswere found to be rather degraded after sample transfer fromNaples to Trieste. In addition, part of the filtered cells could havebeen subsequently released by the mussels as pseudofaeces, whichwere often observed in experimental conditions.

3.3. Quantitative analysis of O. cf. ovata cells filtered by mussels

collected from Gaiola (Naples)

An amount of 200 ng DNA extracted from the three sub-aliquotsobtained from contaminated mussels was used in each qPCRreaction. Amplification efficiency showed values always higherthan 1.82 (R2 > 0.997) with standard deviations ranging from 0.01to 0.10. No aspecific-product formation was revealed from the

ions. Ct values are means of values obtained from each replicate; RQ was calculated

RQ � SD O. cf. ovata cell

concentration (cells g�1)

1.00 � 0.15 2.19 � 104

0.75 � 0.09 5.39 � 103

0.18 � 0.01 8.61 � 102

0.24 � 0.03 1.52 � 103

0.04 � 0.01 1.95 � 102

M. Furlan et al. / Harmful Algae 21–22 (2013) 20–2926

amplicons in melting curve analysis. This protocol demonstratesthat great reproducibility was obtained from extraction andamplification of several aliquots of the same sample (p < 0.05).

Results of qPCR were converted to cell concentrationsconsidering the curve reported in Fig. 2B and the Ct mean valueof samples (Gaiola 29/07/2009 32.68 � 0.15; Gaiola 10/09/200933.65 � 0.20). The samples dated 29/07/2009 and 10/09/2009contained a quantity of microalgal DNA comparable to 1.08 � 103

and 0.58 � 103 cells g�1 respectively, the former containing almost adouble amount of O. cf. ovata DNA as compared to the latter. In thesame samples, ovatoxin a content was estimated to be 116.07 and55 ng g�1, respectively (Fattorusso and Ciminiello, manuscript inpreparation). It is intriguing that, through qPCR analysis, the ratiobetween cell numbers (1.88) was very similar to the ratio calculatedbetween the toxin content (2.11) in the two samples exposed to O. cf.ovata in their natural habitat. Toxin quantifications in O. cf. ovata

cultures were performed in different studies (Ciminiello et al., 2008;Guerrini et al., 2010; Pezzolesi et al., 2012; Vanucci et al., 2012; Scalcoet al., 2012) and it has shown that ovatoxin a concentration per cellvaries considerably among strains as well as in different growthphases. Considering the highest cited toxin amount for Tyrrhenianstrains, 32.7 pg cell�1 (Guerrini et al., 2010) and the above mentionedcell numbers estimated from DNA content, only 30.4% and 34.5% ofthe expected cell quantity, in respect to the estimated ovatoxin a

amount were detected in the sample of 29/07/2009 and 10/09/2009,respectively.

This discrepancy probably reflects the different fate of DNA andtoxins in mussels, the former being degraded quicker than thelatter, which presumably accumulates over time in the molluscs.

3.4. Quantitative analysis of O. cf. ovata cells predated by mussels

collected from Canovella de’ Zoppoli (Trieste)

An amount of 200 ng DNA extracted from contaminatedmussels tissues and 1 mL of DNA extracted from intervalvar liquidand water sample was used in qPCR reaction. Amplificationefficiency was higher than 1.84 (R2 = 0.997) for mussels and higherthan 1.94 (R2 = 0.999) for water and intervalvar liquids. Interest-ingly, O. cf. ovata DNA was still detectable both in soft tissues andintervalvar liquids of mussels collected 10 days after the decline ofthe microalgal bloom (Table 4), corresponding to results obtainedfrom qPCR analysis performed on mussels contaminated underlaboratory conditions. By contrast, no microalgal DNA traces werefound in water sample collected on the same day (CA_Water_30/9),

Table 4Data obtained from a qPCR assay on samples collected from Canovella de’ Zoppoli. Ct

values are means of values obtained from each replicate; O. cf. ovata cell

concentration was calculated using the curve reported in Fig. 2A for intervalvar

liquids and water samples and the one reported in Fig. 2B for mussels; n.d.: not

detected.

Sample Collection date Ct� SD O. cf. ovata cell

concentration

(cells g�1)

CA_1 9/10/2009 32.51 � 0.19 4.18 � 103

CA_2 9/10/2009 34.09 � 0.14 1.38 � 103

CA_3 9/10/2009 32.44 � 0.06 2.30 � 103

CA_4 9/10/2009 32.92 � 0.18 1.09 � 103

CA_5 9/10/2009 35.35 � 0.20 0.40 � 103

CA_6 9/10/2009 32.24 � 0.14 3.20 � 103

Sample Collection date Ct� SD O. cf. ovata cell

concentration

(cells mL�1)

CA_LI_2 9/10/2009 32.07 � 0.33 6.10

CA_LI_4 9/10/2009 30.92 � 0.21 16.23

CA_Water_30/9 30/09/2009 20.17 � 0.18 2.32 � 103

CA_Water_9/10 9/10/2009 n.d. –

in agreement with microscopical observations (Cabrini, pers.comm.). Digestion of microalgal cells seems not to be immediate.

Aligizaki et al. (2008) registered toxicity in shellfish samples upto 2–3 weeks after Ostreopsis spp. was no longer detected onmacrophytes and in the water column. Our data confirmed that O.

cf. ovata can be retained in mussels and in their intervalvar liquidafter the end of the bloom, further explaining their toxicity also inabsence of cells in the environment (Aligizaki et al., 2008). Musselscould act as a vector for toxin transfer within the marine food web.Some shellfish are able to depurate toxins at rapid rates, whereasother can retain it for months continuing to bioaccumulate (Ramosand Vasconcelos, 2010). This presence inside predator tissues evenafter the end of the bloom could allow possible toxin sequestrationthrough food webs. Toxin can be transferred into the tissues ofmussel predators such as lobsters, gastropods, crabs, seastars orflatworms (Robles et al., 1990; Hunt and Scheibling, 1998; Saier,2001; O’Connor and Newman, 2003; Morton and Harper, 2008),leading to its biomagnification. It may then reach higher trophiclevels, causing kills or intoxication of marine organisms andhumans.

As mentioned above, cell quantification in water samples,obtained applying real-time PCR-based protocol, was comparablewith microscopical observations, in agreement with analysis doneon other dinoflagellates (i.e. O. siamensis, A. minutum andAlexandrium catenella (Whedon and Kofoid) Balech) (Galluzziet al., 2004; Hosoi-Tanabe and Sako, 2005; Penna et al., 2007;Perini et al., 2011). In sample CA_Water_30/9, based on qPCRresults, we estimated 2.32 � 103 cells mL�1, which is comparableto results from direct counts (2.8 � 103 O. cf. ovata cells mL�1;Cabrini, pers. comm.). No microalgal cells were detectable insamples CA_Water_9/10 through either counts, nor amplificationassays. These results indicate that the molecular approach used inour study allows an accurate determination of microalgal cellconcentration, producing estimates of the same order of magni-tude as those obtained from direct counts. In addition, theconsistency of results of molecular analysis as compared withmicroscopic analyses suggests that the standard curves obtainedfrom cells isolated from the Gulf of Naples work equally well forTyrrhenian and Northern Adriatic seas. Furthermore, the primerpair presented in this study works equally for the O. cf. ovata/O.

ovata species-complex sequences present in GenBank. In contrastthe primers are only partially covered in the new clades Ostreopsis

sp. 1 and 2 (part of the O. ovata species-complex), recentlydiscovered along Japanese coasts (Sato et al., 2011).

3.5. Mesozooplankton grazing experiments

Preliminary experiments were performed to monitor thecopepod selectivity in grazing on O. cf. ovata, feeding copepodswith natural phytoplankton communities enriched with O. cf.ovata. These experiments showed contrasting results. In June 2009the decreased microalgal abundance in the sample containingmesozooplankton compared to the control (C0) indicated grazingactivity on O. cf. ovata (Fig. 3A). Contrary to these results, inSeptember 2009 no grazing activity on O. cf. ovata was shown byCentropages spp. (Fig. 3B). In fact, O. cf. ovata concentration washigher in samples with predators as compared to C0, samplessuggesting a possible stimulatory effect of predators on microalgalgrowth. Contrasting results could be explained by possibledifferences in available food composition in the two seawatersamples enriched with O. cf. ovata. Copepods could choose otheravailable prey, in seawater enriched with O. cf. ovata cultures,despite the presence of the same concentration of the toxic alga.Indeed, copepods are not indiscriminate feeders and it has beenshown that factors as prey size, concentration or motility caninfluence ingestion rates (Jakobsen et al., 2005).

Fig. 3. Grazing activity on O. cf. ovata by copepods. (A) Samples collected in June

2009 in Piran (Slovenia) and (B) Grazing activity on O. cf. ovata in samples collected

in September 2009 in Piran (Slovenia). Bars represent O. cf. ovata concentration at

the beginning (C0) and at the end of the experiments (C24) with and without the

selected mesozooplankton species. (A: Acartia clausi; B: Centropages sp.)

M. Furlan et al. / Harmful Algae 21–22 (2013) 20–29 27

Due to the contrasting results obtained with natural samples,we performed another experiment using exclusively O. cf. ovata

culture to assess predation of different copepod species throughqPCR assays, using 800 pg of copepod extracted DNA were used inqPCR reaction. Amplification efficiency was 1.89 (R2 = 0.998) andmicroalgal traces were detected in all samples with good efficiencyand reproducibility (Table 2), with the exception of Cop_9 sample,which showed a high standard deviation. No amplification wasdetected in NTC reactions.

Microalgal DNA amounts varied among samples, with no clearrelationship with copepod species composition. Differences couldbe due to the presence of microalgal cell aggregates observed insome samples, possibly reducing copepod predation. In theexperiment with natural phytoplankton samples predators couldgraze on other preys in addition to O. cf. ovata. Instead, using onlythe O. cf. ovata culture, copepods were forced to ingest the toxicmicroalga, in some cases appearing dead after just 3 h ofincubation and covered with microalgal cell aggregates at theend of the experiment. However, some specimens survived,showing a lower sensitivity to microalgal toxicity.

Despite the observed mortality, our experiments indicate thatcopepods can feed on O. cf. ovata. As these crustaceans dominatebiomass in marine plankton are key preys for marine animals ofhigher trophic levels and perform daily and seasonal migrations(Nejstgaard et al., 2003), they could act as vectors for palytoxin inthe pelagic environments and food webs.

4. Conclusions

Since O. cf. ovata and related taxa are found globally, they maybecome a risk to human health in highly populated areas, due toboth toxin accumulation in commercial seafood and exposure totoxic aerosol (Mangialajo et al., 2008). Moreover, Simoni et al.(2004) suggested a potential accumulation of the toxins produced,for example through the Mediterranean trophic web, which was

confirmed by the finding of toxin molecules in marine inverte-brates (Aligizaki et al., 2008, 2011).

Our study revealed that real-time PCR is a useful tool for theanalysis of environmental samples (seawater, mussel soft tissueand intervalvar liquid, copepods) to detect and quantify O. cf. ovata

cells. The protocol set up in this study revealed to be able to amplifyvery low amounts of O. cf. ovata DNA, maintaining a goodamplification efficiency and reproducibility in qPCR. Our experi-ments confirmed the capability of this approach to identify thepresence of microalgal DNA traces equivalent to quantities as lowas 3000 O. cf. ovata cells per 100 g of mussel homogenate.

Cell quantification obtained applying amplification protocolresulted to be comparable with microscopical observations. Inwater samples, we were able to detect the same cell amountobtained through direct counts, demonstrating that the molecularapproach allows a precise determination of microalgal species,while not requiring the same high level of expertise necessary fortaxonomic identification. By applying such a protocol in monitor-ing programs, the presence of toxic microalgae could be detected atthe pre-bloom level, before they reach massive biomass. Thiswould help prediction of potential bloom sites (Galluzzi et al.,2004) and allow countermeasures to avoid the forced closure ofmussel farms or recreational areas, thereby protecting both thehealth of consumers and the profitability of farms. Moreover, ourdata indicate that mussels and copepods could be vectors for toxinsentering in the food web. In particular, mussels retain microalgaltraces in their soft tissues even after the bloom decline, makingtoxin available for transfer to other organisms for a longer time.Finally, our protocol could be applied in research projects aimed atidentifying other O. cf. ovata consumers that could ingest it andtransfer its toxins along the food web of coastal ecosystems.

Acknowledgements

We thank Dr. A. Beran and Dr. M. Monti of the National Instituteof Oceanography and Experimental Geophysics (OGS-BiO) ofTrieste for microalgal cultures, Dr. L. De Maio and S. Capone(ARPA Campania) for mussels collected from Gaiola (Naples), Prof.E. Fattorusso and P. Ciminiello (Federico II University of Naples) forovatoxin a data and Dr. M. Cabrini of National Institute ofOceanography and Experimental Geophysics (OGS-BiO, Trieste) forsamples collected from Canovella de’ Zoppoli (Trieste) and celldensity data. Finally, thanks to Dr. M. Scocchi and Dr. M. Gerdol forthe kind help provided during the manuscript revision.

This work was supported by the ISPRA National Project‘‘Ostreopsis ovata e Ostreopsis spp.: nuovi rischi di tossicitamicroalgale nei mari italiani’’, funded by the Italian Ministery ofEnvironment and by Regione Friuli Venezia Giulia, DirezioneCentrale Risorse Agricole, Naturali, Forestali e Montagna, L.R. 26/2005 prot. RAF/9/7.15/47174.[SS]

References

Aligizaki, K., Nikolaidis, G., 2006. The presence of the potentially toxic generaOstreopsis and Coolia (Dinophyceae) in the North Aegean Sea, Greece. HarmfulAlgae 5 (6), 717–730.

Aligizaki, K., Katikou, P., Nikolaidis, G., Panou, A., 2008. First episode of shellfishcontamination by palytoxin-like compounds from Ostreopsis species (AegeanSea, Greece). Toxicon 51 (3), 418–427.

Aligizaki, K., Katikou, P., Milandri, A., Diogene, J., 2011. Occurrence of palytoxin-group toxins in seafood and future strategies to complement the present state ofthe art. Toxicon 57, 390–399.

Anderson, D.M., White, A.W., 1992. Marine biotoxins at the top of the food chain.Oceanus 35 (3), 55–61.

Amzil, Z., Sibat, M., Chomerat, N., Grossel, H., Marco-Miralles, F., Lemee, R., Nezan, E.,Sechet, V., 2012. Ovatoxin-a and palytoxin accumulation in seafood in relationto Ostreopsis cf. ovata blooms on the French Mediterranean coast. Marine Drugs10, 477–496.

Asahida, T., Yamashita, Y., Kobayashi, T., 1997. Identification of consumed stoneflounder, Kareius bicoloratus (Basilewsky), from the stomach contents of sand

M. Furlan et al. / Harmful Algae 21–22 (2013) 20–2928

shrimp, Crangon affinis (De Haan) using mitochondrial DNA analysis. Journal ofExperimental Marine Biology and Ecology 217 (2), 153–163.

Barone, R., Prisinzano, A., 2007. Peculiarita comportamentale del dinoflagellatoOstreopsis ovata Fukuyo (Dinophyceae): la strategia del ragno. NaturalistaSiciliano S. IV 30 (3–4), 401–418.

Besada, E.G., Loeblich, L.A., Loeblich, A.R., 1982. Observations on tropical, benthicdinoflagellates from ciguateric endemic areas: Coolia, Gambierdiscus, andOstreopsis. Bulletin of Marine Science 32 (3), 723–735.

Bowers, H.A., Tengs, T., Glasgow, H.B.J., Burkholder, J.M., Rublee, P.A., Oldach, D.W.,2000. Development of real-time PCR assays for rapid detection of Pfiesteriapiscicida and related dinoflagellates. Applied and Environment Microbiology 66(11), 4641–4648.

Brescianini, C., Grillo, C., Melchiorre, N., Bertolotto, R., Ferrari, A., Vivaldi, B., Icardi,G., Gramaccioni, L., Funari, E., Scardala, S., 2006. Ostreopsis ovata algal bloomsaffecting human health in Genoa, Italy, 2005 and 2006. Eurosurveillance 11(36).

Chang, F.H., Shimizu, Y., Hay, B., Stewart, R., Mackay, G., Tasker, R., 2000. Threerecently recorded Ostreopsis spp. (Dinophyceae) in New Zealand: temporal andregional distribution in the upper North Island from 1995 to 1997. New ZealandJournal of Marine and Freshwater Research 34 (1), 29–39.

Ciminiello, P., Dell’Aversano, C., Fattorusso, E., Forino, M., Tartaglione, L., Grillo, C.,Melchiorre, N., 2008. Putative palytoxin and its new analogue, ovatoxin-a, inOstreopsis ovata collected along the Ligurian coast during the 2006 toxicoutbreak. American Society for Mass Spectrometry 19 (1), 111–120.

Connell, L., 2002. Rapid identification of marine algae (Raphidophyceae) usingthree-primer PCR amplification of nuclear internal transcribed spacer (ITS)regions from fresh and archived material. Phycologia 41 (1), 15–21.

Durando, P., Ansaldi, F., Oreste, P., Moscatelli, P., Marensi, L., Grillo, C., Gasparini, R.,Icardi, G., 2007. Ostreopsis ovata and human health: epidemiological and clinicalfeatures of respiratory syndrome outbreaks from a two-year syndromic sur-veillance, 2005–2006, in north-west Italy. Eurosurveillance 12. (23).

Fukuyo, Y., 1981. Taxonomical study on benthic dinoflagellates collected incoral reefs. Bulletin of the Japanese Society for the Science of Fish 47 (8),967–978.

Gallitelli, M., Ungaro, N., Addante, L.M., Procacci, V., Silveri, N.G., Sabba, C., 2005.Respiratory illness as a reaction to tropical algal blooms occurring in a temper-ate climate. Journal of the American Medical Association 293 (21), 2599–2600.

Galluzzi, L., Penna, A., Bertozzini, E., Vila, M., Garces, E., Magnani, M., 2004.Development of a real-time PCR assay for rapid detection and quantificationof Alexandrium minutum (a dinoflagellate). Applied and Environmental Micro-biology 70 (2), 1199–1206.

Galluzzi, L., Penna, A., Bertozzini, E., Giacobbe, M.G., Vila, M., Garces, E., Prioli, S.,Magnani, M., 2005. Development of a qualitative PCR method for the Alexan-drium spp. (Dinophyceae) detection in contaminated mussels (Mytilus gallo-provincialis). Harmful Algae 4 (6), 973–983.

Geraci, J.R., Anderson, D.M., Timperi, R.J., Aubin, D.J.S., Early, G.A., Prescott, J.H.,Mayo, C.A., 1989. Humpback whales (Megaptera novaeangliae) fatally poisonedby dinoflagellate toxin. Canadian Journal of Fisheries and Aquatic Sciences 46(11), 1895–1898.

Gilbert, P.M., Anderson, D.M., Gentien, P., Graneli, E., Sellner, K.G., 2005. The globalcomplex phenomena of harmful algal blooms. Oceanography 18 (2), 136–147.

Godhe, A., Otta, S.K., Rehnstam-Holm, A.-S., Karunasagar, I., Karunasagar, I., 2001.Polymerase chain reaction in detection of Gymnodium mikimotoi and Alexan-drium minutum in field samples from southwest India. Marine Biotechnology 3(2), 152–162.

Godhe, A., Asplund, M.E., Harnstrom, K., Saravanan, V., Tyagi, A., Karunasagar, I.,2008. Quantification of diatom and dinoflagellate biomasses in coastal marineseawater samples by real-time PCR. Applied and Environment Microbiology 74(23), 7174–7182.

Guerrini, F., Pezzolesi, L., Feller, A., Riccardi, M., Ciminiello, P., Dell’Aversano., C.,Tartaglione, L., Dello Iacovo, E., Fattorusso, E., Forino, M., Pistocchi, R., 2010.Comparative growth and toxic profile of cultured Ostreopsis ovata from theTyrrhenian and Adriatic Seas. Toxicon 55 (2–3), 1–10.

Guillou, L., Nezan, E., Cueff, V., Erard-Le Denn, E., Cambon-Bonavita, M.A., Gentien,P., Barbier, G., 2002. Genetic diversity and molecular detection of three toxicdinoflagellate genera (Alexandrium, Dinophysis, and Karenia) from French coasts.Protistologica 153 (3), 223–238.

Hosoi-Tanabe, S., Sako, Y., 2005. Species-specific detection and quantification oftoxic marine dinoflagellates Alexandrium tamarense and A. catenella by real-timePCR assay. Marine Biotechnology 7 (5), 506–514.

Hunt, H.L., Scheibling, R.E., 1998. Effects of whelk (Nucella lapillus (L.)) predation onmussel (Mytilus trossulus (Gould), M. edulis (L.)) assemblages in tidepools and onemergent rock on a wave-exposed rocky shore in Nova Scotia, Canada. Journalof Experimental Marine Biology and Ecology 226 (1), 87–113.

Hurbungs, M.D., Jayabalan, N., Chineah, V., 2001. Seasonal Distribution of Poten-tially Toxic Benthic Dinoflagellates in the Lagoon of Trou aux Biches, Mauritius.AMAS Food and Agricultural Research Council, Reduit, Mauritius.

Jakobsen, H.H., Halvorsen, E., Hansen, B.W., Visser, A.W., 2005. Effects of preymotility and concentration on feeding in Acartia tonsa and Temora longicornis:the importance of feeding modes. Journal of Plankton Research 27 (8), 775–785.

John, U., Medlin, L.K., Groben, R., 2005. Development of specific rRNA probes todistinguish between geographic clades of the Alexandrium tamarense speciescomplex. Journal of Plankton Research 27 (2), 199–204.

Kerbrat, A.S., Amzil, Z., Pawlowiez, R., Golubic, S., Sibat, M., Darius, H.T., Chinain, M.,Laurent, D., 2011. First evidence of palytoxin and 42-hydroxy-palytoxin in themarine cyanobacterium Trichodesmium. Marine Drugs 9 (4), 543–560.

Kubista, M., Andrade, J.M., Bengtsson, M., Forootan, A., Jonak, J., Lind, K., Sindelka, R.,Sjoback, R., Sjogreen, B., Strombom, L., Stahlberg, A., Zoric, N., 2006. The real-time polymerase chain reaction. Molecular Aspects of Medicine 27 (2–3), 95–125.

Louzao, M.C., Espina, B., Cagide, E., Ares, I.R., Alfonso, A., Vieytes, M.R., Botana, L.M.,2010. Cytotoxic effect of palytoxin on mussel. Toxicon 56 (5), 842–847.

Mangialajo, L., Bertolotto, R., Cattaneo-Vietti, R., Chiantore, M., Grillo, C., Lemee, R.,Melchiorre, N., Moretto, P., Povero, P., Ruggieri, N., 2008. The toxic benthicdinoflagellate Ostreopsis ovata: quantification of proliferation along the coast-line of Genoa, Italy. Marine Pollutution Bulletin 56 (6), 1209–1214.

Mangialajo, L., Ganzin, N., Accoroni, S., Asnaghi, V., Blanfune, A., Cabrini, M.,Cattaneo-Vietti, R., Chavanon, F., Chiantore, M., Cohu, S., Costa, E., Fornasaro,D., Grossel, H., Marco-Miralles, F., Maso, M., Rene, A., Rossi, A.M., MontserratSala, M., Thibaut, T., Totti, C., Vila, M., Lemee, R., 2011. Trends in Ostreopsisproliferation along the Northern Mediterranean coasts. Toxicon 57, 408–420.

Mebs, D., 1998. Occurrence and sequestration of toxins in food chain. Toxicon 36(11), 1519–1522.

Monti, M., Minocci, M., Beran, A., Ivesa, L., 2007. First record of Ostreopsis cf. ovata onmacroalgae in the Northern Adriatic Sea. Marine Pollutution Bulletin 54 (5),598–601.

Morton, B., Harper, E.M., 2008. Predation upon Mytilus galloprovincialis (Mollusca:Bivalvia: Mytilidae) by juvenile Carcinus maenas (Crustacea: Decapoda) usingmandibular chipping. Journal of the Marine Biological Association of the UnitedKingdom 88 (03), 563–568.

Nejstgaard, L.C., Frischer, M.E., Raule, C.L., Gruebel, R., Kohlberg, K.E., Verity, P.G.,2003. Molecular detection of algal prey in copepod guts and fecal pellets.Limnology and Oceanography: Methods 1, 29–38.

Nejstgaard, J., Frischer, M., Simonelli, P., Troedsson, C., Brakel, M., Adiyaman, F.,Sazhin, A., Artigas, L., 2008. Quantitative PCR to estimate copepod feeding.Marine Biology 153 (4), 565–577.

O’Connor, W.A., Newman, L.J., 2003. Predation of cultured mussels, Mytilus gallo-provincialis, by stylochid flatworms, Imogine mcgrathi, from Twofold Bay, NewSouth Wales, Australia. Asian Fisheries Science 16 (2), 133–140.

Penna, A., Magnani, M., 1999. Identification of Alexandrium (Dinophyceae)species using PCR and rDNA-targeted probes. Journal of Phycology 35 (3),615–621.

Penna, A., Vila, M., Fraga, S., Giacobbe, M.G., Andreoni, F., Riobo, P., Vernesi, C., 2005.Characterization of Ostreopsis and Coolia (Dinophyceae) isolates in the westernMediterranean Sea based on morphology, toxicity and internal transcribedspacer 5.8S rDNA sequences. Journal of Phycology 41 (1), 212–245.

Penna, A., Bertozzini, E., Battocchi, C., Galluzzi, L., Giacobbe, M.G., Vila, M., Garces, E.,Luglio, A., Magnani, M., 2007. Monitoring of HAB species in the MediterraneanSea through molecular methods. Journal of Plankton Research 29 (1), 19–38.

Penna, A., Galluzzi, L., 2008. PCR techniques as diagnostic tools for theidentification and enumeration of toxic marine phytoplankton. In: Evangelista,V., Barsanti, L., Frassanito, A.M., Passarelli, V., Gualtieri, P. (Eds.), Algal toxins:nature, occurrence, effect and detection. Springer Netherlands, Dordrecht, pp.261–283.

Penna, A., Fraga, S., Batocchi, C., Casabianca, S., Giacobbe, M.G., Riobo, P., Vernesi, C.,2010. A phylogeographical study of the toxic benthic dinoflagellate genusOstreopsis Schmidt. Journal of Biogeography 37 (5), 830–841.

Perini, F., Casabianca, A., Battocchi, C., Accoroni, S., Totti, C., Penna, A., 2011. Newapproach using the Real-Time PCR method for estimation of the toxic marinedinoflagellate Ostreopsis cf. ovata in marine environment. PLoS One 6 (3),e17699.

Pezzolesi, L., Guerrini, F., Ciminiello, P., Dell’Aversano, C., Dello Iacovo, E., Fattorusso,E., Forino, M., Tartaglione, L., Pistocchi, R., 2012. Influence of temperature andsalinity on Ostreopsis cf. ovata growth and evaluation of toxin content throughHR LC–MS and biological assays. Water Research 46 (1), 82–92.

Pin, C.L., Teen, P.L., Ahmad, A., Usup, G., 2001. Genetic diversity of Ostreopsis ovata(Dinophyceae) from Malaysia. Marine Biotechnology 3 (3), 246–255.

Popels, L.C., Cary, S.C., Hutchins, D.A., Forbes, R., Pustizzi, F., Gobler, C.J., Coyne, K.J.,2003. The use of quantitative polymerase chain reaction for the detection andenumeration of the harmful alga Aureococcus anophagefferens in environmentalsamples along the United States East Coast. Limnology and Oceanography:Methods 1, 92–102.

Ramakers, C., Ruijter, J.M., Lekanne Deprez, R.H., Moorman, A.F.M., 2003. Assump-tion-free analysis of quantitative real-time polymerase chain reaction (PCR)data. Neuroscience Letters 339 (1), 62–66.

Ramos, V., Vasconcelos, V., 2010. Palytoxin and analogs: biological and ecologicaleffects. Marine Drugs 8 (7), 2021–2037.

Rhodes, L., 2011. World-wide occurrence of the toxic dinoflagellate genus OstreopsisSchmidt. Toxicon 57 (3), 400–407.

Ririe, K.M., Rasmussen, R.P., Wittwer, C.T., 1997. Product differentiation by analysisof DNA melting curves during the polymerase chain reaction. Analytical Bio-chemistry 245 (2), 154–160.

Robles, C., Sweetnam, D., Eminike, J., 1990. Lobster predation on mussels: shore-level differences in prey vulnerability and predator preference. Ecology 71 (4),1564–1577.

Rollo, F., Sassaroli, S., Boni, L., Marota, L., 1995. Molecular typing of the red-tidedinoflagellate Gonyaulax polyedra in phytoplankton suspensions. Aquatic Mi-crobial Ecology 9 (1), 55–61.

Rossi, R., Castellano, V., Scalco, E., Serpe, L., Zingone, A., Soprano, V., 2010. Newpalytoxin-like molecules in Mediterranean Ostreopsis cf. ovata (dinoflagellates)and in Palythoa tubercolosa deteced by liquid chromatography-electrosprayionization time-of-flight mass spectrometry. Toxicon 56 (8), 1381–1387.

M. Furlan et al. / Harmful Algae 21–22 (2013) 20–29 29

Ruijter, J.M., Ramakers, C., Hoogaars, W.M.H., Karlen, Y., Bakker, O., van den Hoff,M.J.B., Moorman, A.F.M., 2009. Amplification efficiency: linking baseline andbias in the analysis of quantitative PCR data. Nucleic Acids Research 37 (6), e45.

Saier, B., 2001. Direct and indirect effects of seastars Asterias rubens on mussel beds(Mytilus edulis) in the Wadden Sea. Journal of Sea Research 46 (1), 29–42.

Sansoni, G., Borghini, B., Camici, G., Casotti, M., Righini, P., Rustighi, C., 2003.Fioriture algali di Ostreopsis ovata (Gonyaulacales: Dinophyceae): un problemaemergente. Biologia Ambientale 17 (1), 17–23.

Sato, S., Nishimura, T., Uehara, K., Sakanari, H., Tawong, W., Hariganeya, N., Smith, K.,Rhodes, L., Yasumoto, T., Taira, Y., Suda, S., Yamaguchi, H., Adachi, M., 2011.Phylogeography of Ostreopsis along West Pacific Coast, with Special Referenceto a Novel Clade from Japan. PLoS One 6 (12), e27983.

Scalco, E., Brunet, C., Marino, F., Rossi, R., Soprano, V., Zingone, A., Montresor, M.,2012. Growth and toxicity responses of Mediterranean Ostreopsis cf. ovata toseasonal irradiance and temperature conditions. Harmful Algae 17, 25–34.

Selina, M.S., Orlova, T.Y., 2010. First occurrence of the genus Ostreopsis (Dinophy-ceae) in the Sea of Japan. Botanica Marina 53 (3), 243–249.

Shears, N.T., Ross, P.M., 2009. Blooms of benthic dinoflagellates of the genusOstreopsis; an increasing and ecologically important phenomenon on temperatereefs in New Zealand and worldwide. Harmful Algae 8 (6), 916–925.

Simoni, F., Di Paolo, C., Gori, L., Lepri, L., 2004. Further investigation on blooms ofOstreopsis ovata, Coolia monotis, Prorocentrum lima, on the macroalgae of

artificial and natural reefs in the Northern Tyrrhenian Sea. Harmful Algae News26, 5–7.

Sokolov, E.P., 2000. An improved method for DNA isolation from mucopolysac-charide-rich molluscan tissues. Journal of Molluscan Studies 66 (4), 573–575.

Tognetto, L., Bellato, S., Moro, I., Andreoli, C., 1995. Occurence of Ostreopsis ovata(Dinophyceae) in the Tyrrhenian Sea during summer 1994. Botanica Marina 38(1–6), 291–295.

Totti, C., Cucchiari, E., Romagnoli, T., Penna, A., 2007. Bloom of Ostreopsis ovata onthe Conero Riviera (NW Adriatic Sea). Harmful Algal News 33, 12–13.

Tubaro, A., Durando, P., Del Favero, G., Ansaldi, F., Icardo, G., Deeds, J.R., Sosa, S.,2011. Case definitions for human poisonings postulated to palytoxin exposure.Toxicon 57 (3), 478–495.

Vanucci, S., Pezzolesi, L., Pistocchi, R., Ciminiello, P., Dell’Aversano, C., Dello Iacovo,E., Fattorusso, E., Tartaglione, L., Guerrini, F., 2012. Nitrogen and phosphoruslimitation effects on cell growth, biovolume, and toxin production in Ostreopsiscf. ovata. Harmful Algae 15, 78–90.

Vestheim, H., Edvardsen, B., Kaartvedt, S., 2005. Assessing feeding of a carnivorouscopepod using species-specific PCR. Marine Biology 147 (2), 381–385.

Zingone, A., Siano, R., D’Alelio, D., Sarno, D., 2006. Potentially toxic and harmfulmicroalgae from coastal waters of the Campania region (Tyrrhenian Sea,Mediterranean Sea). Harmful Algae 5 (3), 321–337.