Mitochondrial DNA variability in four Italian donkey breeds (Equus asinus) M.C. Cozzi 1, P. Valiati 1, R. Cherchi 2, M.G. Strillacci 1, A.Corona 2, G.

Mitochondrial DNA variability in four Italian donkey breeds

(Equus asinus)

M.C. Cozzi1, P. Valiati1, R. Cherchi2, M.G. Strillacci1,

A.Corona2, G. Pertica1, B. Gandolfi1, M. Polli1, M.

Longeri1,

L. Guidobono Cavalchini1

1DSA - Dipartimento di Scienze Animali – Sezione di Zootecnica Veterinaria – Milano2 ERA - Ente di Ricerca in Agricoltura Sardegna - Ozieri

Nuove acquisizioni in materia di IppologiaNew findings in equine practice

 Druento, 31 ottobre 2008

IntroductionIntroduction

Italian donkey breeds had suffered a substantial decrease in population size due to mechanization of agriculture during the last Century.

Most donkey populations have declined to levels considered as endangered by FAO with a high risk of extinction in a short time period.

For a long time this animal was essentially ignored under a research point of view but the interest of researchers was recently renewed for several reasons.

Furthermore, the interest in donkeys productions is increased. Particularly, in the use of donkey's milk for human nutrition as a valid alternative to cow's milk in case of allergy and to the pet therapy, or “onotherapy”.

Efforts to increase the existing donkey population are being carried out as a consequence of the development of these productions.

IntroductionIntroduction

The aim of this work was to study mitochondrial DNA genetic variability in 4

Italian donkey breeds.

Material and methodsMaterial and methodsBlood samples from 91 donkeys were

collected.

>X97337CCCCAAGGACTATCAAGGAAGAAGCTCTAGCTCCACCATCAACACCCAAAGCTGAAATTCTACTTAAACTATTCCTTGATTTCCTCCCCTAAACGACAGCAATTCATCCTCATGTGCTATGTCAGTATTAAAATACACCCCCGCACAACACCATATCAGCTCAACATACAATACTCTATTAATACCCTATGTACATCGTGCATTAAATTGTTCACCCCATGAATAATAAGCATGTACATAATATTATTTATCTTACATGAGTACATCATATTATTGATCGTACATACCCCATCCAAGTCAAATCATTTCCAGCCAACACGCATATCACCACCCATATTCCACGAGCTTAATCACCAAGCCGCGGGAAATCAGCAATCCCTCCAATTACGTGTCCCAATCCTCGCTCCGGGCCCATCTAAACTGTGGGGGTTTCTACGGTGAAACTATACCTGGCATCTGGTTCTTTCTTCAGGGCCATT

>X97337CCCCAAGGACTATCAAGGAAGAAGCTCTAGCTCCACCATCAACACCCAAAGCTGAAATTCTACTTAAACTATTCCTTGATTTCCTCCCCTAAACGACAGCAATTCATCCTCATGTGCTATGTCAGTATTAAAATACACCCCCGCACAACACCATATCAGCTCAACATACAATACTCTATTAATACCCTATGTACATCGTGCATTAAATTGTTCACCCCATGAATAATAAGCATGTACATAATATTATTTATCTTACATGAGTACATCATATTATTGATCGTACATACCCCATCCAAGTCAAATCATTTCCAGCCAACACGCATATCACCACCCATATTCCACGAGCTTAATCACCAAGCCGCGGGAAATCAGCAATCCCTCCAATTACGTGTCCCAATCCTCGCTCCGGGCCCATCTAAACTGTGGGGGTTTCTACGGTGAAACTATACCTGGCATCTGGTTCTTTCTTCAGGGCCATT

The mitochondrial DNA (mtDNA) of donkey was extracted using standard procedure.

Specific primers were used to amplify a 478 bp fragment of the mtDNA between sites 15385 to 15862 according to the donkey reference sequence GeneBank #X97337.

Material and methodsMaterial and methods

Sequences were determined by ABI PRISM® 310 Genetic Analyser and were analyzed using specific software.

Material and methodsMaterial and methods

PCR products were purified and sequenced using Big Dye Terminator (Applied Biosystems).

Material and methodsMaterial and methods

CLUSTALX version 1.8

DnaSP version 4.2

Haplotype diversity (hd), nucleotide diversity (), average number of nucleotide differences (k) and Fu’s Fs statistic.

NETWORK version 4.5.0.1

Median-Joining Network and mismatch analysis.

MEGA version 4.0

Genetic distances by the Kimura-two parameter method and haplotypes phylogenetic tree by Neighbor-Joining algorithm.

Statistical analysesStatistical analyses

Breed N nPolymorphic

sitesParsimony

informative sitesSingleton

sites

ASD 28 4 17 17 0

RAD 6 4 4 4 0

ROD 8 5 18 17 1

SAD 49 6 19 19 0

4 breeds

91 10 20 19 1

Table 1 – Sample size (N), number of haplotypes (n), polymorphic sites, parsimony informative and non informative sites.

10 haplotypes were identified in the analyzed populations, ranged from 4 (RAD and ASD) and 6 (SAD).

20 polymorphic sites were detected, 19 of them were phylogenetically informative and one was singleton (Tab. 1).

Results and discussionResults and discussion

Table 3 – Position of substitution sites and haplotypes identified on the 4 Italian breeds.

All the haplotypes were shared among breeds, but haplotype H1 (ROD), H7 and H10 (SAD) (Tab. 3).

Results and discussionResults and discussion

BreedHaplotype

diversity (hd) s.d.

Nucleotide diversity (π) s.d.

Average number of nucleotide diversity

(k)

ASD 0,638±0,069 0,0147±0,0025 7,024

RAD 0,867±0,017 0,0046±0,0009 2,200

ROD 0,786±0,151 0,0204±0,0032 9,750

SAD 0,711±0,048 0,0188±0,0010 8,961

4 breeds 0,822±0,020 0,0174±0,0010 8,315Table 2 – Molecular diversity indices with standard deviations (s.d.) for

breeds and across the four breeds.

The nucleotide diversity (π) value representing the breed genetic diversity and ranged from 0,0046 (RAD) e 0,0204 (ROD), average value 0,0174.

The haplotype diversity (hd) value ranged from 0,638 ASD and 0,867 ROD, average value 0,822, and the average number of nucleotide differences k=8,315.

All the molecular indices indicate a sufficient variability between breed (Tab. 2).

Results and discussionResults and discussion

Figure 2 – Mismatch distribution of the 91

mtDNA donkey sequences.

Results and discussionResults and discussion

The mismatch analysis and Fu’s Fs statistic were used to investigate the demographic expansion of donkey populations.

Figure 2 showed a bimodal distribution. Pairwise differences ranged from 0 to 18. A major pick was present at 1 mutational difference and a secondary one at 17 differences. The value for Fu’s Fs statistic was 8,441 probability 0,001.

As reported in other species, the bimodal distribution separate by a large time interval obtained, it could represent a two times temporal expansion of Italian donkey populations, out of a common ancestral population.

Figure 3 - Median joining network of 10 mtDNA haplotypes identified on 4 donkey breeds. The area of the circle is proportional to sample

frequency.

BA

SAD RAD RODASD X97337

H07

H06

H05

H03H0

1H04

H08

H09

H10

H03

In figure 3 the Median-Joining Network on 91 donkey mtDNA sequences was shown. Two haplogroups A and B separated from 12 nucleotide substitutions were found.

The two haplogroups include haplotypes that differ from each other by few mutations: 1 to 5 mutations haplogroup A, 1 to 3 mutation haplogroup B.

Results and discussionResults and discussion

0.001

0.001

Figure 4 – Neighbor-Joining tree constructed on the bases of Kimura

two parameter distances by donkey mtDNA haplotypes

Results and discussionResults and discussion

In figure 4 the phylogenetic tree constructed using genetic distances between mtDNA sequences of Italian donkey breeds was depicted.

Two different clusters/haplogroups were defined.

These haplogroups comprise haplotypes where common origins are assumed since they share characteristic mutations to slow evolution.

Figure 5 – Neighbor-Joining tree constructed on the bases of Kimura two parameter distances by Italian donkey mtDNA haplotypes, domestic donkey mtDNA haplotypes, African and Asian Wild Donkeys.

genetic variability was found in the analyzed breeds;

3 typical haplotypes were identified: 2 in Sardinian donkey and 1 in Romagnolo donkey;

two different haplogroups A and B clustered (ancestral haplotype diversification );

in a worldwide contest, two main clusters were found: one referred to haplogroup B clustered with Equus asinus asinus sequences and a second one, referred to haplogroup A closely related to Equus asinus somaliensis.

genetic variability was found in the analyzed breeds;

3 typical haplotypes were identified: 2 in Sardinian donkey and 1 in Romagnolo donkey;

two different haplogroups A and B clustered (ancestral haplotype diversification );

in a worldwide contest, two main clusters were found: one referred to haplogroup B clustered with Equus asinus asinus sequences and a second one, referred to haplogroup A closely related to Equus asinus somaliensis.

ConclusionConclusion

In conclusion, our study on mtDNA of four Italian donkey breeds have been evidenced:In conclusion, our study on mtDNA of four Italian donkey breeds have been evidenced: