Microbiology World Issue 11

Microbiology World Issue 11 May – June 2015 ISSN 2350 - 8774

www.microbiologyworld.com www.facebook.com/MicrobiologyWorld ~ 1 ~

http://www.microbiologyworld.com/

http://www.facebook.com/MicrobiologyWorld



Chief Editor

Mr. Sagar Aryal

(Founder)

Ambassador, iversity

M.Sc. Medical Microbiology

St. Xavier’s College, Nepal

Editors

Mr. Saumyadip Sarkar

ELSEVIER Student Ambassador South Asia 2013

Ph.D Scholar (Human Genetics), India

Mr. Avishekh Gautam

Ph.D Scholar

Hallym University, South Korea

Mr. Manish Thapaliya

Ph.D Scholar, China

Mr. Hasnain Nangyal

M.Phil.

Department of Botany, Hazara University, Pakistan

Mr. Sunil Pandey

ELSEVIER Student Ambassador South Asia 2014

B.Sc. Medical Microbiology

Nobel College, Kathmandu, Nepal





Table of Content

Title Page No.

Role and Significance Lactic acid bacteria in Food 4-6

Soil Bacteria Live on Wine Grapes 7

Detection of Extended Spectrum Beta Lactamase

(ESBL) Multidrug Resistant Escherichia coli Isolated

from Urine Specimen of Urinary Tract Infections 8-18

The Mystery of Brain Leading to Confusion of Thoughts 19-20

When Biology meets Engineering: Renewable fuel from

Hijacked E. coli Bacteria could go Mainstream 22-24

Role of PGPR in Sustainable Agriculture 25-28

Determining the probiotic potential of cholesterol-

reducing Lactobacillus 29-31





Role and Significance Lactic acid bacteria in

Food

Madiha Basit1

1 Department of Microbiology, Government College University, Faisalabad. Pakistan.

Corresponding Email: [email protected]

Introduction

Lactic acid bacteria are mainly divided

into two groups; Homo-fermentative

lactic acid bacteria which produce two

molecules of lactic acid from one

molecule of glucose and hetero-

fermentative lactic acid bacteria which

produces lactic acid, CO2 and ethanol

from one molecule of glucose.

Pediococcus spp., Streptococcus spp.

and Lactococcus spp. are homo-

fermentative while Leuconostoc spp.

and Bifidobacterium spp. are hetero-

fermentative. Some species of Lactobacillus are homo-fermentative and some are hetero-

fermentative.

Use of Lactic acid bacteria

Lactic acid bacteria are used due to its fermentative ability as well as their health and nutritional

benefits. Originally lactic acid bacteria are isolated from grains, green plants, dairy and meat

products, fermenting vegetables and the mucosal surfaces of animals and have commercial

applications as starter cultures in dairy, meat, vegetable and alcoholic beverages industries. It

Figure 1: Role of lactic acid bacteria



mailto:[email protected]



produces various compounds such as organic acids, diacetyl, hydrogen peroxide, and

bacteriocins or bactericidal proteins during lactic fermentations.

Lactic acid bacteria and their products give distinctive flavors, textures and aromas, preventing

from spoilage, extending the shelf-life of food product and inhibit the pathogenic organisms.

In yogurt, Lb. delbrueckii subsp. Bulgaricus, S. thermophiles are used. Lb. casei, Lb.

acidophilus, Lb. rhamnosus, B. lactis are used in fermented, probiotic milk while Lb. lactis

subsp. lactis, Lb. lactis subsp. Cremoris are used in cheese. Lb. sakei, Lb. curvatus,

Pedicoccus spp., Streptococcus spp. and Leuconostoc spp. are used in fermented meat

products. Lb. plantarum is used in fermentation of sauerkraut.

Antimicrobial activity of lactic acid bacteria

Lactic acid bacteria have antimicrobial activity due to metabolites produced during the

fermentation process. Organic acids such as lactic, acetic and propionic acids produced in this

process which is unfavorable for the growth of many pathogenic and spoilage microorganisms.

They inhibit both gram-positive and gram-negative bacteria as well as yeast and moulds. Acids

exert their antimicrobial effect by interfering with the maintenance of cell membrane potential,

inhibiting active transport of nutrients, reducing intracellular pH and inhibiting a variety of

metabolic functions. Hydrogen peroxide is produced in the hetero0fermentative pathway which

has strong oxidizing effect on membrane lipids and cellular proteins.

Bacteriocins are ribosomally synthesized antimicrobial compounds. These are produced by

many members of the lactic acid bacteria. The target of bacteriocins is the cytoplasmic

membrane. Because of LPS of the outer membrane of Gram-negative bacteria, these are only

active against Gram-positive bacteria. Important targets of bacteriocine are Clostridium spp.,

Staphylococcus spp., Enterococcus spp., Bacillus spp. and Listeria monocytogenes.

Heath benefits of lactic acid bacteria

Lactic acid bacteria have various health benefits such as they improve the digestion and have

beneficial effect in lactose intolerance. In normal persons, β-glactosidase is produced which





convert the lactose into glucose and glactose. In the absence of this enzyme the lactose is not

digested and passes to the colon. Here it is attacked by the lactose-fermenting organisms and

produce abdominal discomfort, flatulence and diarrhea. When lactase-deficient individuals take

milk in a fermented form such as yogurt then adverse effects are less severe or absent. Foods

exposed to lactic acid bacteria are broken down and pre-digested. So, the nutrients are

more readily available for absorption and improves the biological value of foods.

Lactic acid bacteria also stimulate the immune system by activating the macrophages and

lymphocytes, improving the levels of IgA and production of gamma interferon. Vitamin B12 is

also produced by lactic acid bacteria which are essential to blood-cell formation & DNA

synthesis. L. acidophilus competes effectively against Heliobacter pylori for attachment sites.

So, it provides protection against ulcers. Also reduces the levels of colon enzymes that convert

pro-carcinogens to carcinogens by taking up nitrites and by reducing the levels of secondary

bile salts. L. acidophilus has hypo-cholesterolemic effects, can take up cholesterol in the

presence of bile or cholesterol can precipitate with free bile salts in the presence of L.

acidophilus.

Conclusion

Due to the flavor, texture, aroma formation, antimicrobial activity and various health benefits, the

lactic acid bacteria are widely used in food products.

References

Jay, J. M., Loessner, M. J., & Golden, D. A. (2005). Modern Food Microbiology (7th ed.). New

York: Springer.

Adams, M. R., & Moss, M. O. (2008). Food Microbiology (3rd ed.). UK: The Royal Society of

Chemistry.

Lee, B. H. (2015). Fundamentals of Food biotechnology (2nd ed.). UK: John Wiley & Sons Ltd.





Soil Bacteria Live on Wine Grapes

Dr. Bireshwar Bera1

1 Assistant Professor, Department of Zoology, St. Joseph’s College, Darjeeling- 734104, West

Bengal, India

The earthiness of Merlot may have to do with

grapevine-dwelling microbiota

The fruits, flowers, and leaves on Merlot

grapevines harbor bacterial taxa present in

the surrounding soil, according to a study

published this week (March 24) in mBio.

Researchers suspect bacterial communities

specific to a vine’s location may affect the

flavor of wine made from those grapes.

“Where you grow that particular grapevine is the most important characteristic shaping which

bacteria will colonize the plant,” study coauthor Jack Gilbert, a microbial ecologist at Argonne

National Laboratory, said in a press release.

The idea of “terroir”—that the land shapes a wine’s qualities—is an old one, but Gilbert said that

the microbiome is not usually included as one of the influencing factors. “From the wine

industry’s perspective, terroir comes from the plant’s physiology, the chemical nature of the

grapes, and the yeast that do the fermenting work,” he said. “We don’t have evidence that

bacteria are specifically contributing to terroir, but our next step is to figure out how those

bacteria are affecting the chemistry of the plant.”

Hat tip: Science News.



http://mbio.asm.org/content/6/2/e02527-14

https://www.asm.org/index.php/asm-newsroom2/92-news-room/press-releases/93430-a-vineyard-s-soil-microbes-shape-the-grapes-microbial-community

https://www.sciencenews.org/blog/science-ticker/vineyards-soil-influences-microbiome-grapevine



Detection of Extended Spectrum Beta Lactamase

(ESBL) Multidrug Resistant Escherichia coli

Isolated from Urine Specimen of Urinary Tract

Infections

Ranjutha Valiappan1

1 Faculty of Biomedical and Health Sciences, University Selangor (Unisel), Shah Alam

Campus, Jalan Zircon A7/A, Section 7, Shah Alam, Selangor Darul Ehsan, Malaysia.

Abstract

The prominence of extended-spectrum β-lactamase (ESBL) in manufacturing of E. coli with high

virulence factor showing the prevalence of MDR among E. coli isolates is rising. This lead to the

increasing in occurrence of community and nosocomial acquired infections which are caused by

UPEC. This incidence must have considered seriously because it causing to an increase in

morbidity and mortality. A very less quantity or number of E. coli resistance gene is capable to

cause for parenchymatous urinary attacks. Therefore, this detection and systematic observation

of the similarities genomic studies are emanated to identify E. coli resistance gene causing for

the existing of urinary tract infections and by that can determine physiopathology of the

infection. This studies became very beneficial in order to improve our necessary understanding

on MDR mechanism which is encoded by UPEC and as well as in the designing of more

intended drugs.

Introduction

Multidrug resistance (MDR) in bacteria is increasing to the level where multidrug resistance

bacteria threaten the effective prevention and treatment. The standard treatments become

ineffective, so infections continue increase the risk of spread to other by having the quality to

withstand the attack from antibacterial drugs. And this lead to an increasing range of infections





caused by bacteria. MDR was defined as acquired non-susceptibility to at least one agent in

three or more antimicrobial categories. For the definition of MDR, non-susceptibility refers to

either it resistant, intermediate or can also obtained from in vitro antimicrobial susceptibility

testing. The purpose of this definition can aid in reference, clinical and as well in public health

microbiology laboratories into grading various antimicrobial resistant profiles by using a common

terminology (Magiorakos et al., 2012). The seriousness of MDR bacteria related to the amount

of antibiotics and effectiveness of the used. Patients with the infections that caused by the MDR

bacteria are basically at the higher risk of worse clinical outcomes and death. As in WHO’s 2014

report on global Surveillance of Antimicrobial resistance reveals that antibiotic resistance is

happening right now across all over the world and it is no longer to be prediction. That is the

reason why it came to common place to hear about MDR bacteria. High regulation of MDR

leads to common infections, such as urinary tract infection, pneumonia, bloodstream infections.

Those are found in all regions of the world

(http://www.who.int/drugresistance/documents/surveillancereport/en).

The Multidrug Resistant Organisms (MDROs) can be classified into five group. The main

MDROs are extended spectrum β-lactamase (ESBL) Enterobacteriaceae which are related to

antimicrobial resistance. ESBL’s are enzymes that is developed too many antibiotics mainly in

β-Lactam family. Continue with second group is Methicillin-Resistant Staphylococcus Aureus

(MRSA). Third group is Carbapenemases that involving with enzymes as well where they are

ESBL’s with versatile hydrolytic capacities that inactivate β-lactam antibiotics and the use of

carbapenems increasing with the spread of ESBL’s which causes for the increasing in

development of carbapenemases. Other that included also Vancomycin Resistant Enterococci

(VRE) and Clostridium difficile. Clostridium difficile is occurring because of the ability to produce

greater quantities of toxin A and B.

β-lactam antimicrobial agents display the most general treatment for the infections by bacteria

and it persists to be the well known which causes to show resistance to β-lactam antibiotics

between Gram negative bacteria internationally. As the bacterial strains continue exposure to a

massive amount of β-lactam, has triggered active and continue in the production and also



http://www.who.int/drugresistance/documents/surveillancereport/en



mutation of β-lactamases. These conditions lead to the increasing of their activity to the extent

even towards the β-lactam antibiotics that is newly developed. This is due to the enzymes which

make them resistance to the antibiotic and the enzymes known as extended spectrum β-

lactamases (ESBLs) that is produced by certain bacteria or germs (Pitout & Laupland, 2008).

Hence the cure for these multiple drug resistant bacteria became major scientific concern as the

occurrence of ESBL producing bacteria is complicate in overcome them because of a range of

reasons, they are very hard to detect as well as reporting. Lately, a major raise in the

occurrence of infections that related to ESBL has been experimental all over the global (Bakshi

et al., 2013).

Materials and methods

Bacteria sample

Total 50 isolates of E.coli bacterial were collecting.

Antibiotics susceptibility testing

Antibiotic susceptibility test is performed on the Mueller Hinton Agar (MHA) on all isolates by

disc diffusion technique by Kirby Bauer based on the Clinical Laboratory Standard Institutions

(CLSI) guidelines. The following antibiotic disks were used, ampicillin (10 μg), piperacillin (100

μg), cefoperazone (75 μg), cefoxitin (30 μg), ceftazidime (30 μg), cefotaxime (30 μg),

ceftriaxone (30 μg), cefepime (30 μg), aztreonam (30 μg), imipenem (10 μg), amikacin (30 μg),

gentamicin (10 μg), ciprofloxacin (30 μg), ofloxacin (5 μg), norfloxacin (10 μg), and nitrofurantoin

(300 μg).

E.coli ATCC 35218 will be used as positive control in the AST. Interpretation by measuring the

diameter of zone of inhibition and recorded in millimeters with the help of sliding calipers and

organism was labeled as sensitive, resistant, or intermediate as per CLSI 2012 guidelines

(Table 1).





Table 1: Zone diameter interpretative criteria for E. coli

ANTIBIOTIC DISC SENSITIVE INTERMEDIATE RESISTANT

Penicillins

Ampicillin ≥17 14–16 ≤13

Piperacillin ≥21 18–20 ≤17

Cephems (Parenteral)

Cefoperazone ≥21 16–20 ≤15

Cefoxitin ≥18 15–17 ≤14

Ceftazidime ≥21 18–20 ≤17

Cefotaxime ≥26 23–25 ≤22

Ceftriaxone ≥23 20–22 ≤19

Cefepime ≥18 15–17 ≤14

Monobactam

Aztreonam ≥21 18–20 ≤17

Carbapenem

Imipenen ≥23 20–22 ≤19

Aminoglycosides

Gentamicin ≥15 13–14 ≤12

Amikacin ≥17 15–16 ≤14

Flouroquinolones

Ciprofloxacin ≥21 16–20 ≤15

Ofloxacin ≥16 13–15 ≤12

Norfloxacin ≥17 13–16 ≤12

Nitrofuran

Nitrofurantoin ≥17 15–16 ≤14





E.coli identification by Serotyping

Serotyping is carrying out on E.coli isolates. Strains which is motile but that did not react with O

or H antiserum were classified as nontypable (nt) means O(nt) and H(nt), respectively (Brown Z

et al., 2013).

Detection of MDR- ESBL E.coli by PCR

Preparation of genomic DNA

The genomic DNA is isolated from the bacteria cells using a loopful colony are suspended in

100µl of sterile distilled water into the 1.5ml Eppendorf tube and vortex the tube for about 5 – 10

second. Than the tube is floated in boiling water for approximately 10 minutes and next placed

about 5 minutes on the chilled ice. Centrifuge the tube at 12000 rpm for 2 minutes. Remove the

supernatant and used directly as template DNA for the PCR mixture (Massoud et al., 2007). The

purified DNA is stored at -20 ̊ C if not going to run with PCR mixture at the time.

The Concentration of DNA is predictable by measuring the absorbance at 260nm, adjusting the

measurement of A260 for turbidity (measured by absorbance at 320nm), multiplying by the

dilution factor, and using the relationship that an A260 of

1.0 = 50µg/ml pure dsDNA.

Concentration (µg/ml) = (A260 reading – A320 reading) × dilution factor × 50µg/ml

Total yield is obtained by multiplying the DNA concentration by the final total purified sample

volume.

DNA yield (µg) = DNA concentration × total sample volume (ml)

(Promega Corporation, http://www.promega.com/pubhub)



http://www.promega.com/pubhub



Oligonucleotides for ESBL gene

The primer sequences for the detection of extended-spectrum β-lactamase gene in E.coli are

adopted from the previous studies (El-mohammady et al., 2015).

Table 2. Polymerase chain reaction (PCR) primer sequences for the detection of extended-

spectrum β-lactamases gene in E.coli.

Table 2: Polymerase chain reaction (PCR) primer sequences for the detection of

extended-spectrum β-lactamases gene in E.coli.

Target gene Oligonucleotide primer sequences (5’ to 3’) Amplicon size (bp)

blaTEM-1F

blaTEM-1R

blaSHV-1F

blaSHV-1R

blaOXA-1F

blaOXA-1R

blaCTX-M-1F

blaCTX-M-1R

CAGCGGTAAGATCCTTGAGA

ACTCCCCGTCGTGTAGATAA

GGCCGCGTAGGCATGATAGA

CCCGGCGATTTGCTGATTTC

AATGGCACCAGATTCAACTT

CTTGGCTTTTATGCTTGATG

GAAGGTCATCAAGAAGGTGCG

GCATTGCCACGCTTTTCATAG

643

714

599

560

Detection of targeted gene by PCR

The purified bacterial DNA is than take for the detection of targeted gene via uniplex

polymerase chain reaction (PCR). Table 2 below shows the primers to be use for the detection.

The amplification of PCR in a 50µl, the extracted DNA is added with mixture which is containing

50 pmol primers, 0.25Mm deoxyribonucleotide, 1.5Mm MgCl2, Taq reaction buffer and 0.2U

Taq DNA polymerase of Nexpro brand. Thermocycler are used to perform the amplification

which coordinates with cyclic parameters. Amplification conditions incorporated 30 cycles which





is begin with denaturation at 95 ̊ C for 30 sec follow by annealing for 1 min at 55 ̊ C than with

amplification at 72 ̊ C for 1 min as well and this follow by a final extension step at 72 ̊C for about

5 to 15 min (El-mohammady et al., 2015).

Gel documention

The amplified DNA is than separated with 1.5% agarose gel and visualize by staining with

GelRed as substitution for ethidium bromide (El-mohammady et al., 2015).

Expected outcome

Figure above show PCR amplified fragments blaTEM (on left of the ladder and blaSHV

(on right of the ladder)

Acknowledgments

I wish to thank my supervisor Mdm.Norhatiah binti Md Lias and co-supervisor Ms.Rozila Alias.

Also Laboratory Halal University Selangor for giving me space to carry out my entire project.





References

1. Alhashash, F., Weston, V., Diggle, M., & McNally, A. (2013). Multidrug-resistant

Escherichia coli bacteremia. Emerging Infectious Diseases, 19(10), 1699–1701.

doi:10.3201/eid1910.130309

2. Amin, M., Mehdinejad, M., & Pourdangchi, Z. (2009). Study of bacteria isolated from

urinary tract infections and determination of their susceptibility to antibiotics, 2, 118–123.

3. Bakshi, R., Walia, G., & Jain, S. (2013). Prevalence of extended spectrum β -

Lactamases in multidrug resistant strains of gram negative Bacilli, 1(February), 558–560.

4. Benton, B., Breukink, E., Visscher, I., Debaboy, D., Lunde, C., Janc, J., Mammen, M.,

Humphrey, P., 2007. Telavancin inhibits peptidoglycan biosynthesis through preferential

targeting of transglycosylation: evidence for a multivalent interaction between telavancin

and lipid II. Int . J. Antimicrob. Agents 29,51-52.

5. Bien, J., Sokolova, O., & Bozko, P. (2012). Role of uropathogenic escherichia coli

virulence factors in development of urinary tract infection and kidney damage.

International Journal of Nephrology, 2012. doi:10.1155/2012/681473

6. Brown Z, Selke S, Zeh J, K. J. (2013). Journal Medicine ©, 337(14), 509–515.

7. Bush, K. (2001). New b -Lactamases in Gram-Negative Bacteria : Diversity and Impact

on the Selection of Antimicrobial Therapy, 32, 1085–1089. doi:10.1086/319610

8. Bush, K., Jacoby, G.A., Medeiros, A.A., 1995. A functional classification scheme for

beta-lactamases and its correlation with molecular structure. Antimicrob. Agents

Chemother. 39,1211-1233.

9. Datta, N., Kontomichalou, P., 1965. Penicillinase synthesis controlled by infectious R

factor in Enterobacteriaceae. Nature 208, 239-241.

10. Dubois, S.K., Marriott, M.S., Amyes, S.G., 1995. TEM and SHV derived extended-

spectrum beta-lactamases: relationship between selection, structure and function. J.

antimicrob. Chemother. 35,7-22.

11. El-mohammady, H., Khalek, R. A., & Ghenghesh, K. S. (2015). Multidrug resistance and

extended-spectrum b -lactamases genes among Escherichia coli from patients with

urinary tract infections in Northwestern Libya, 1, 1–7.





12. Finer, G., & Landau, D. (2004). Pathogenesis of urinary tract infections with normal

female anatomy. Lancet Infectious Diseases, 4(10), 631–635. doi:10.1016/S1473-

3099(04)01147-8

13. Hu, Y. Y., Cai, J. C., Zhou, H. W., Chi, D., Zhang, X. F., Chen, W. L., … Chen, G. X.

(2013). Molecular typing of CTX-M-Producing Escherichia coli isolates from

environmental water, swine feces, specimens from healthy humans, and human

patients. Applied and Environmental Microbiology, 79(19), 5988–5996.

doi:10.1128/AEM.01740-13

14. Johnson, T. J., & Nolan, L. K. (2009). Pathogenomics of the virulence plasmids of

Escherichia coli. Microbiology and Molecular Biology Reviews : MMBR, 73(4), 750–774.

doi:10.1128/MMBR.00015-09

15. Kaper, J. B., Nataro, J. P., & Mobley, H. L. (2004). Pathogenic Escherichia coli. Nature

Reviews. Microbiology, 2(February), 123–140. doi:10.1038/nrmicro818.

16. Livermore, D.M., 1995. Beta-lactamases in laboratory and clinical resistance. Clin.

Microb. Rev. 8,557-584.

17. Magiorakos, a. P., Srinivasan, a., Carey, R. B., Carmeli, Y., Falagas, M. E., Giske, C. G.,

… Monnet, D. L. (2012). Multidrug-resistant, extensively drug-resistant and pandrug-

resistant bacteria: An international expert proposal for interim standard definitions for

acquired resistance. Clinical Microbiology and Infection, 18(3), 268–281.

doi:10.1111/j.1469-0691.2011.03570.x

18. Marrs, C. F., Zhang, L., & Foxman, B. (2005). Escherichia coli mediated urinary tract

infections: Are there distinct uropathogenic E. coli (UPEC) pathotypes? FEMS

Microbiology Letters, 252(2), 183–190. doi:10.1016/j.femsle.2005.08.028

19. Massoud, B. Z., Sherbini, E. A. El, Rizk, N. G., & Arafa, S. A. (2007). Characterization of

Uropathogenic Escherichia coli Strains Isolated from Community Acquired and Hospital

Acquired Infections in Alexandria, 16(3), 513–520.

20. Paterson, D.L., Bonomo, R.A., 2005. Extended-spectrum betalactamases; a clinical

update. Clin. Microbiol. Rev. 18,657-686.





21. Philippon, L.N., Naas, T ., Bouthors, A.T., Barakett, V., Nordmann, P., 1997. OXA-18, a

class D clavulanic acid-inhibited extendedspectrum beta lactamases from Pseudomonas

aeruginosa. Antimicrob. Agents Chemother. 41, 2188-2195.

22. Pitout, J. D. D., & Laupland, K. B. (2008). Extended-spectrum beta-lactamase-producing

Enterobacteriaceae: an emerging public-health concern. The Lancet. Infectious

Diseases, 8(March), 159–166. doi:10.1016/S1473-3099(08)70041-0

23. Rupp, M. E., & Fey, P. D. (2003). Extended spectrum beta-lactamase (ESBL)-producing

Enterobacteriaceae: considerations for diagnosis, prevention and drug treatment. Drugs,

63(4), 353–365. doi:10.2165/00003495-200363040-00002

24. Shaikh, S., Fatima, J., & Shakil, S. (2015). Antibiotic resistance and extended spectrum

beta-lactamases : Types , epidemiology and treatment. Saudi Journal of Biological

Sciences, 22(1), 90–101. doi:10.1016/j.sjbs.2014.08.002

25. Soto, S. M., Smithson, a., Horcajada, J. P., Martinez, J. a., Mensa, J. P., & Vila, J.

(2006). Implication of biofilm formation in the persistence of urinary tract infection caused

by uropathogenic Escherichia coli. European Society of Clinical Infectious Diseases,

12(10), 1034–1036. doi:10.1111/j.1469-0691.2006.01543.x

26. Soughakoff, W., Goussard, S., Courvalin, P., 1988. TEM-3 betalactamaseswhich

hydrolyzes broad-spectrum cephalosporins is derived from the TEM-2 penicillinases by

two amino acid substitutions. FEMS Microbiol. Let. 56,343-348.

27. Stamm, W. E. (1982). Recent developments in the diagnosis and treatment of urinary

tract infections. The Western Journal of Medicine, 137(3), 213–20. Retrieved from

http://www.ncbi.nlm.nih.gov/pubmed/6755913.

28. Stamm, W. E., & Norrby, S. R. (2001). Urinary tract infections: disease panorama and

challenges. The Journal of Infectious Diseases, 183 Suppl , S1–S4. doi:10.1086/318850.

29. Straus, S.K., Hancock, R.E.W., 2006. Mode of action of the new antibiotic for gram-

positive pathogens daptomycin: comparison with cationic antimicrobial peptides and

lipopeptide. Biochim. Biophys. Acta 1758,1215-1223.

30. Strohl, W.R., 1997. BiotechAntibiotics. Marcel Dekker Inc., New York, USA.





31. Thenmozhi, S., Moorthy, K., Sureshkumar, B. T., & Suresh, M. (2014). Antibiotic

Resistance Mechanism of ESBL Producing Enterobacteriaceae in Clinical Field : A

Review, 2(3), 207–226.

32. Tzouvelekis, L.S., Bonomo, R.A. 1999. SHV-type b-lactamases. Curr. Pharm. Des. 5,

847-864.

33. Weldhagen, G.F., Poirel, L., Nordmann, P., 2003. Ambler class A extended-spectrum

beta-lactamases in Pseudomonas aeruginosa: novel developments and clinical impact.

Antimicrob. Agents Chemother. 47,2385-2392.





The Mystery of Brain Leading to Confusion

of Thoughts

Radha Govind Neha Nidhi

The foggy night in subconscious dreams with the chaos wrapped,strong imaginations

mesmerized with some unusual sounds ,disturbed the patient in scare.He got up so frightened

and in the moment in a high fever.He couldn’t realize was it a dreams,the past memory long

back or was that a future self imagination.The brain neurons left him unanswered,trembled and

confused.He couldn’t do anything but left with an interrogative,frightened,perspiring teary face.

It is really difficult to understand the emotion

difference between the past memory running

in the neurons and the future imaginations.It

was previously considered that the frontal

lobe of brain is solely responsible for high

level decisions,thoughts and imaginations

but the fMRI scan demonstrated that many

other areas are responsible for the activities

like memory recapitulation and the self

imaginations .Moreover the fMRI scan

pictures of these two activities were found to

be similar.The neurons carrying frequent information in blood tremendous speed in the game of

the same parts of brain ,then what leads the brain to understand the differences in the thoughts

hovering around in the brain every flash of seconds?

Brain being the most intricate,complicated and powerful part the fundamental core of the

nervous system is responsible for both lower order functions and the higher order

functions.Mankind’s interest in unlocking the mysteries of the brain could be seen even





thousands of years ago.When Herophilus,the first known anatomist posited that the brain was

the seat of intelligence Aristotle,on the other hand ,posited that the brain’s function was to cool

blood.

Magnetic resonance imaging(MRI) uses radio waves and a strong magnetic field to identify

regions of the brain where blood vessels are expanding,chemical changes taking place or

extra oxygen is being delivered.These are indications that a particular part of the brain is

processing information and giving commands .As a patient performs a particular tasks the

metabolism increases in the brain area responsible for that task ,changing the signal in the MRI

image .So by performing specific tasks that correspond to different functions,scientists can

locate the part of the brain that governs that function.

The thoughts which comes as a part of our thinking or some imaginations is sometimes

undifferentiated from the past memories in the subconscious mind in sleep and we often get

scared getting confused and many a times taking it as something happening real to us at that

moment.It’s the game of the same areas of brain which play to provide us thoughts and ideas

through tremendously fast neurotransmitters.

Researchers say besides furthering their understanding of the brain- the finding may help

research into amnesia, a curious psychiatric phenomenon.In addition to not being able to

remember the past,most people who suffer from amnesia cannot envision or visualize what

they’ll be doing in the future – even the next day.The mystery of understanding the mysterious

brain has only remained a mystery still awaites to be resolved in the long future .when it would

still leave us with the confusion that these trials we did were our memories or is it just an

imagination !!!









When Biology meets Engineering:

Renewable fuel from Hijacked E. coli Bacteria

could go Mainstream

Lester C. Recio

People need energy. A world without energy is unimaginable. For giving us the access of

electricity in our homes, powering up our vehicles that provide transportation, manufacturing

goods and giving services—we can say at this point, energy is indeed getting identical to our

one of the biggest necessities, the food we eat.

However, the world runs into a big plot twist.

We are getting hungrier and hungrier for

energy and the energy resources we have,

specifically, the fossil fuels such as coal, oil

and natural gas are finite and are getting

depleted. The conflict may arise while

competing for the last remaining fossil fuels in

the near future.

At this point, scientists are currently looking for the methods by which we could have replaced

the massive use of nonrenewable energy sources to renewable energy sources for a vast and

inexhaustible energy supply, for a more reliable and resilient energy system, and for less global

warming emission.

Some of these methods are already applied, but these are yet to be considered as mainstream.

Converting renewable energy into electricity is one thing; converting it into fuel is another.





A team of researchers from Imperial College London in London and Turku University in Finland

has successfully hijacked a common intestinal bacterium, Escherichia coli (E. coli) to produce

renewable propane. This diverse group of bacteria which normally lives in the intestines and

helps the human body to break down and digest food we eat, is commonly known for causing

food poisoning symptoms when ingested.

In searching for a renewable fuel process that could be economically sustainable, they focused

on propane, a component of liquid petroleum gas for it was became a target for several

reasons, and in fact, it’s a gas that they could easily separate the finished product. The

microbes that produced the propane would be left behind and the fuel will escape as a gas.

There’s no need for messy separation.

Propane derived from fossil fuels is already produced as a by-product during natural gas

processing and petroleum refining, but these are finite resources, unlike in Propane produced

by E. coli bacteria are renewable sources.

The researchers can only produce small amount of propane for the moment, but, if the

development can be scaled up to a commercially viable process, it could become a sustainable

alternative to fossil fuels. Researchers said it could be ready for commercial production within

ten years.

According to the researcher Patrik Jones, the lead author of the study from Turku University,

renewable propane is not created through natural reactions—no organisms naturally produce

propane in the way humans breathe out CO2 or trees exhale oxygen. They therefore turned to

synthetic biology, where Biology meets Engineering, to make this occurrence possible.

They chose E. coli because it is easy to engineer and also of its ability to produce fatty acids,

where in fact, Biofuels are consist of long chain fatty acids that are usually derived from

vegetable oils or animal fats, but the bacterium’s ability to make fatty acids wasn’t merely

enough to make the propane. In this case, the scientists had to design a propane biosynthetic

pathway that does not exist in E. coli. To do so, they had to take genes from multiple bacteria:





Bacteroides fragilis, Mycobacterium marinum, Bacillus subtilis, and Prochlorococcus marinus

and engineer them into the E. coli that it finally tricked the bacteria into making propane instead

of cell membranes.

“Although we have only produced tiny amounts so far, the fuel we have produced is ready to be

used in an engine straight away,” researcher Jones, said in his statement.

“This opens up possibilities for future sustainable production of renewable fuels that at first

could complement, and thereafter replace fossil fuels like diesel, petrol, natural gas and jet fuel,”

he said. The discovery is one step closer to his goal, which is able to use the genetically

engineered system to convert solar energy into propane-like fuel.

“At the moment, we don’t have a full grasp of exactly how the fuel molecules are made, so we

are now trying to find out exactly how this process unfolds… I hope that over the next five to ten

years we will be able to achieve commercially viable processes that will sustainably fuel our

energy demands,” he said.

The researchers published their study in the journal Nature Communications.

Facts based on Patrik Jones’ How we tricked E. coli bacteria into making renewable propane

Photo Credit: Ap Photo/Pa-Adam Butler





Role of PGPR in Sustainable Agriculture

Meenu

Assistant professor, Department of Agriculture, Baba Farid College, Bathinda, Punjab, India.

Corresponding E.mail: [email protected]

Sustainable agriculture plays an inevitable role worldwide as it offers the potential to meet our

future agricultural needs which our conventional agriculture system is unable to do. It is an act

of farming using principles of ecology, the study of relationships between organisms and their

environment. It is an integrated system of plant and animal production practices having a site-

specific application that will last over the long term. PGPRs (Plant growth-promoting

rhizobacteria) offer a great and attractive alternative that contains the possibility of developing

more sustainable approaches to agriculture.

Kloepper and Schroth coined the term PGPR for the first time to describe the microbial

population in the rhizosphere which is beneficial, colonize plant roots and shows plant growth

promotion activity. PGPR are naturally occurring soil bacteria that aggressively colonize plant

roots and benefit plants by influencing the growth, yield and nutrient uptake. Various species of

bacteria like Pseudomonas, Azospirillum, Azotobacter, Alcaligenes, Klebsiella, Enterobacter,

Burkholderia, Bacillus and Serratia have been reported as PGPRs. They help in increased

supply of phosphorus, sulphur, iron and copper; produce plant hormones; enhance other

beneficial bacteria or fungi; control fungal and bacterial diseases and help in controlling insect

pests.

Increasing concern about the natural environment demands a developed strategy for its

maintenance. So our scientists are developing much research interest in PGPR. To date, an

increasing number of PGPR have been commercialized for various crops such as for

suppression of plant disease (Bioprotectants), improved nutrient acquisition (Biofertilizers), or

phytohormone production (Biostimulants). PGPR can act as excellent model systems which can



mailto:[email protected]



provide the biotechnologist with novel genetic constituents and bioactive chemicals having

diverse uses in agriculture and environmental sustainability.

Ideal characters for microbes to be considered as PGPR

1. They must be efficient enough to colonize rhizosphere.

2. They must survive, multiply and compete with other microbiota present in the vicinity of

plant roots.

3. They must promote plant growth.

Various Mechanisms followed by PGPR

Direct mechanisms

1. Production of stimulatory bacterial volatiles and phytohormones.

2. Lowering of the ethylene level in plants.

3. Improvement of the plant nutrient status by biological nitrogen fixation and liberation of

phosphates and micronutrients from insoluble sources.

4. Siderophores produced by some PGPR scavenge heavy metal micronutrients in the

rhizosphere (e.g. iron). Plants commonly excrete soluble organic compounds (chelators and

phytosiderophores) which bind Fe+3 and reduced it to Fe+2 which are immediately absorbed

through root surface.

Indirect mechanisms

1. PGPR as biocontrol agents reducing various plant diseases when they stimulate other

beneficial symbioses and protect the plant by degrading xenobiotics in contaminated

soils.

2. Mitigation of abiotic stresses like drought, salt and fertility stress by PGPR through

stimulation of disease resistance mechanism i.e. Induced Systemic Resistance (ISR).

Antibiotic production by PGPR releases compounds that prevent the growth of the pathogens.

For eg. Pseudomonas fluorescens CHA0, the GacS/GacA system is essential for the production

of antibiotic compounds against plant pathogens.





Commercial Use of PGPR in Agriculture

Several criteria must be followed for the commercial development of PGPR: effectiveness

against target organisms, quality control, production costs, inoculum formulation, product safety

and value of crops to be treated. The following table 1 represents commercialized PGPR as

biocontrol agents with their brand name.

Future prospects

PGPR have spectacular role in sustainable agriculture. Their productive efficiency can be

further enhanced with the optimization and acclimatization according to the prevailing soil

Figure 1: Basic Mechanism involved in plant growth promotion by rhizobacteria





conditions. In future, they are expected to replace the chemical fertilizers, pesticides and

artificial growth regulators which have numerous side-effects to sustainable agriculture.

References

1. Ahemad, M. & Kibret, M. 2014 Mechanisms and applications of plant growth promoting

rhizobacteria: Current perspective. J. King Saud Uni. Sci. 26, 1-20.

2. Akhtar, A., Hisamuddin, Robab, M. I., Abbasi & Sharf, R. 2012 Plant growth promoting

Rhizobacteria: An overview. J. Nat. Prod. Plant Resour. 2, 19-31.

3. http://en.wikipedia.org/wiki/Sustainable_agriculture

4. Nandal, M. & Hooda, R. 2013 Plant growth promoting rhizobacteria: A review article. Int.

J. Curr. Res. 5, 3863-3871.



http://en.wikipedia.org/wiki/Sustainable_agriculture



Determining the probiotic potential of

cholesterol-reducing Lactobacillus

Abhishek Negi

Corresponding E-mail: [email protected]

Excess cholesterol is associated with cardiovascular diseases (CVD), an important cause of

mortality worldwide. Current CVD therapeutic measures, lifestyle and dietary interventions, and

pharmaceutical agents for regulating cholesterol levels are inadequate. Probiotic bacteria have

demonstrated potential to lower cholesterol levels by different mechanisms, including bile salt

hydrolase activity, production of compounds that inhibit enzymes such as 3-hydroxy-3-

methylglutaryl coenzyme A, and cholesterol assimilation. Probiotics are living microorganisms

that, upon ingestion in high amounts, exert health effects beyond inherent basic nutrition. Many

patients prefer nondrug treatments for hyperlipidemia for many reasons, including the adverse

effects of antilipid drugs, contraindications to drugs or personal preference for natural or

alternative therapies.

So a study was done to evaluate the probiotic potential of lactic acid bacteria (LAB) isolated

from traditionally fermented south Indian koozh and gherkin (cucumber). A total of 51 LAB

strains were isolated, among which four were identified as Lactobacillus spp. and three as

Weissella spp. All isolated Lactobacillus and Weissella strains were capable of surviving under

low pH and bile salt conditions. GI9 and FKI21 were able to survive at pH 2.0 and 0.50% bile

salt for 3 h without losing their viability. All LAB strains were able to deconjugate bile salt. Higher

deconjugation was observed in the presence of sodium glycocholate (P < 0.05). GI9

(58.08 μg/ml) and FKI21 (56.25 μg/ml) exhibited maximum cholesterol reduction with bile salts.

16S rRNA sequencing confirmed GI9 and FKI21 as Lactobacillus crispatus and Weissella

koreensis, respectively.





A similar research on cholesterol assimilation was investigated in culture media and under

simulated intestinal conditions. The best cholesterol assimilator was L. plantarum ATCC 14917

(15.18 ± 0.55 mg/1010 cfu) in MRS broth. L. reuteri NCIMB 701089 assimilated over 67%

(2254.70 ± 63.33 mg/1010 cfu) of cholesterol, the most of all the strains, under intestinal

conditions. This work demonstrates that probiotic bacteria can assimilate cholesterol under

intestinal conditions, with L. reuteri NCIMB 701089 showing great potential as a CVD

therapeutic.

Schematic representation of probiotic cholesterol assimilation mechanism

(a) Cholesterol absorption by the intestinal enterocytes increases cardiovascular disease

risks.

(b) Probiotic administration enhances cholesterol assimilation, leading to the excretion of

nonmetabolized cholesterol and other lipid molecules decreasing cardiovascular disease

risks.

If organisms located in the intestine can assimilate some of the cholesterol ingested in the diet

and make it unavailable for absorption into the blood. The cholesterol-lowering effect of

probiotics has been partly attributed to their ability to bind cholesterol in the small intestine.





Probiotic bacteria are advantageous as they are naturally found in foods such as yoghurt, are

inexpensive, and are generally regarded as safe. Finally, Cholesterol assimilation by probiotic

bacteria in the gastrointestinal tract would allow for the reduction of cholesterol absorption by

enterocytes and excretion of the cholesterol from the host, as depicted in Figure.

References

1. http://www.ncbi.nlm.nih.gov/pubmed/25839996

2. http://www.hindawi.com/journals/bmri/2014/380316/



http://www.ncbi.nlm.nih.gov/pubmed/25839996

http://www.hindawi.com/journals/bmri/2014/380316/



You can also send your articles to

[email protected]

Selected ones will be published in

our next issue of July-Aug 2015.

Thanks,

Sagar Aryal

Editor-In-Chief

Microbiology World



Microbiology World Issue 11

Documents