1 Mass Spectrometric Analysis of DNA and RNA: Alternatives to Traditional Sequencing Mark Marzinke, PhD Johns Hopkins University School of Medicine • Utility of DNA in the Clinical Lab – Cancer (heterogeneous) – Pathogen Identification – Personalized Medicine (PGx; germline) • Mass Spectrometric Platforms – Ibis – Sequenom – High Resolution Accurate Mass • Considerations – MALDI v. ESI • New Frontier Outline drains bile from liver to intestine with storage in gallbladder * * * * Mohseni and Park. J Clin Invest. 2010; 120(8):2655–2658 • Signaling pathway mutations are observed in various cancers – Lung adenocarcinoma – Colorectal carcinoma – Breast carcinoma • Mutations are seen with varying frequencies • Heterogeneous: cancer cells may have the mutation, normal cells may not • Mutation detection can direct/predict drug therapeutic responses – EGFR mAbs (panitumumab, cetuximab) – TKIs (erlotinib, gefitinib) – Herceptin (mAb targeting HER2/neu) – Downstream Inhibitors (everolimus) Molecular Indicators of Cancer
13
Embed
Mass Spectrometric Analysis of DNA and RNA: Alternatives ...
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
1
Mass Spectrometric Analysis of DNA and RNA: Alternatives to Traditional
Sequencing
Mark Marzinke, PhD
Johns Hopkins University
School of Medicine
• Utility of DNA in the Clinical Lab– Cancer (heterogeneous)
– Pathogen Identification
– Personalized Medicine (PGx; germline)
• Mass Spectrometric Platforms– Ibis
– Sequenom
– High Resolution Accurate Mass
• Considerations– MALDI v. ESI
• New Frontier
Outline
drains bile from liver to intestine with storage in gallbladder
*
*
**
Mohseni and Park. J Clin Invest. 2010; 120(8):2655–2658
• Signaling pathway mutations are observed in various cancers
– Lung adenocarcinoma
– Colorectal carcinoma
– Breast carcinoma
• Mutations are seen with varying frequencies
• Heterogeneous: cancer cells may have the mutation, normal cells may not
• Mutation detection can direct/predict drug therapeutic responses
– EGFR mAbs (panitumumab, cetuximab)
– TKIs (erlotinib, gefitinib)
– Herceptin (mAb targeting HER2/neu)
– Downstream Inhibitors (everolimus)
Molecular Indicators of Cancer
2
Role of Molecular Techniques in Predicting Treatment Responses
• Bacterial pathogen that is resistant to β-lactam antibiotics and cephalosporins
• Hospital- and community-associated MRSA strains
– Strains have different genetic lineages
– Common strain in US (CA-MRSA300)
• Need to identify rapidly because infection can cause:
– Sepsis
– Toxic shock syndrome
– Necrotizing pneumonia
• Lab Diagnosis of MRSA
– Microbiology cultures (~48 h)
– Antibiotic Sensitivity
– Mass Spectrometry
– Molecular Analysis/PCR www.google.com
3
Pharmacogenetics (PGx) Testing: Impact and Targets
Drug Response
Dose Management
Clinical Diagnosis
Drug Interactions
Adherence
Genetic Variation
• Identification of DNA variants that correlate with differential phenotypic expression
– Gene insertions/deletions
– Duplications
– Single nucleotide polymorphisms (SNPs)
– Haplotypes
• Genetic variation can influence Pharmacokinetics (body effect on drug) and Pharmacodynamics (drug effect on body)
– Absorption
– Transport
– Metabolism
– Elimination
Pharmacogenetics (PGx) Testing: Impact and Targets
• Identification of DNA variants that correlate with differential phenotypic expression
– Gene insertions/deletions
– Duplications
– Single nucleotide polymorphisms (SNPs)
– Haplotypes
• Genetic variation can influence Pharmacokinetics (body effect on drug) and Pharmacodynamics (drug effect on body)
– Absorption
– Transport
– Metabolism
– Elimination
Pharmacogenetics (PGx) Testing: Impact and Targets
PGx Targets Used Clinically
Gene Target Drugs
TPMT Azathioprine
UGT1A1 Irinotecan
CYPs (2D6, 2C9, 2C19)
SSRIs,analgesics,
antiarryhtmics, etc.
VKORC1CYP2C9
Warfarin
4
Genotype-Phenotype Relationship: Drug Metabolism
Meyer. Nat Rev Genetics. 2004; 5:669‐676
• Phenotypic assessment of cytochrome P450 (CYP2D6) ability
– Ratio of urinary debrisoquine (parent) to 4-OH-debrisoquine (metabolite) as an indicator of CYP2D6 activity
• CYP polymorphism frequency is influenced by ethnicity and gender
– CYP2D6 is non-functional in 7% of Caucasians (Meyer, Lancet. 2000; 356)
– CYP2D6 increased activity in ~ 30% East African populations
• CYPs are involved in the metabolism of >75% of drugs
– Antidepressants (62% efficacy; Spear et al.,
Trends Mol Med. 2001; 7: 201-206)
– Schizophrenia (60% efficacy)
– Antiarrhythmics (60% efficacy)
– Analgesics (80% efficacy)
Genotype-Phenotype Relationship: Drug Metabolism
Meyer. Nat Rev Genetics. 2004; 5:669‐676
• Phenotypic assessment of cytochrome P450 (CYP2D6) ability
– Ratio of urinary debrisoquine (parent) to 4-OH-debrisoquine (metabolite) as an indicator of CYP2D6 activity
• CYP polymorphism frequency is influenced by ethnicity and gender
– CYP2D6 is non-functional in 7% of Caucasians (Meyer, Lancet. 2000; 356)
– CYP2D6 increased activity in ~ 30% East African populations
• CYPs are involved in the metabolism of >75% of drugs
– Antidepressants (62% efficacy; Spear et al.,
Trends Mol Med. 2001; 7: 201-206)
– Schizophrenia (60% efficacy)
– Antiarrhythmics (60% efficacy)
– Analgesics (80% efficacy)
Phenotype-Genotype Relationship: A Real World Application
CYP2D6 Characterized Polymorphisms
Allele NT MutationFunction/Activity
Metabolizer
*1 WT normal Extensive
*2A1584 C>G2850 C>T
normal Extensive
*2 2850 C>T normal Extensive
*3 2549 A>del non-functional Poor
*41846 G>A100 C>T
non-functional Poor
*5 Gene Deletion non-functional Poor
*6 1707 T>del non-functional Poor
*7 2935 A>C non-functional Poor
*8 1758 G>T non-functional Poor
*9 2613-2615 del AAG decreased Intermediate
*10 100 C>T decreased Intermediate
*12 124 G>T non-functional Poor
*14 1758 G>A non-functional Poor
*172580 C>T 1023 C>T
decreased Intermediate
*412850 C>T2988 G>A
decreased Intermediate
Jordan Nature Reviews Cancer 2007; 7, 46–53
• Tamoxifen is an Estrogen Receptor (ER) antagonist to suppress breast cancer cell proliferation
– CYP2D6 mediates the hepatic biotransformation of tamoxifen to more potent metabolites (direct: 4OH-tamoxifen; indirect: endoxifene; Desta et al., J Pharmacol Exp Ther 2004;310:1062–75).
The Ibis T5000 Biosensor: Global Pathogenic Identification
• Global nucleic acid extraction from a biological specimen (ie. Blood, sputum)• PCR amplification using broad-range primers • Online desalting of PCR mixtures (which contain Mg2+ and EDTA)• Electrospray ionization of all amplicons• Identification of amplicon (i.e. pathogen) through database matching
Ecker et al. JALA. 2006; 341‐351
The Ibis T5000 Biosensor: Global Pathogenic Identification
Ecker et al. JALA. 2006; 341‐351
8
The Ibis T5000 Biosensor: Exploitation of Mass Accuracy
Ecker et al. Nature Reviews Microbiol. 2008; 6: 553‐558
The Ibis T5000 Biosensor: Exploitation of Mass Accuracy
Ecker et al. JALA. 2006; 341‐351
• Mass accuracy limits the base composition possibilities of each DNA strand
• Exploitation of complementarity between strands to further limit possibilities for identification
The Ibis T5000 Biosensor: Limitations
• Lack of detection of amplicons with compensating SNPs (CT and TC in the same amplicon)
• Sensitivity– Baseline noise of mass spectrometric analyzer may prevent identification of low
abundant pathogens/mutations
• Limited PCR amplicon size– Mass measurement deviations is proportional to analyte mass – Increase in spectral patterns multiple charge states– Larger the mass, the increased frequency for misclassifications
• Large-scale multiplexing – 1-2 PCR reactions/sample well
• Database requirement– Amplicon/pathogen identification is only as good as your library
• Translation to the Clinical Lab– Research Use Only
9
Sequenom: MALDI-TOF based identification of allelic mutations
Gabriel et al., Current Protocols in Human Genetics. 2009
Sequenom: The MALDI-TOF Principle
Ed. Clarke, Contemporary Practice in Clinical Chemistry, 2nd
Edition; AACC Press
Sequenom: Detection Schema
Fumagali et al. BMC Cancer. 2010; 10 (1)
10
Sequenom: EGFR L858R SNP Analysis
Brevet et al. J Mol Diagn. 2009; 12 (2): 169‐176
• Identified from FFPE lung tissue– Mutation positive via mutation-
specific IHC
– Negative via PCR fragment analysis
Sequenom: Limit of Discrimination (Sensitivity)
Arcila et al. J Mol Diagn. 2011; 13 (1): 64‐73
• KRAS G37T sensitivity studies
• Can identify a mutation at dilutions as low as 2.5%
• Starting material: 20 ngDNA isolated from FFPE colorectal tissue
• Analyzed using mutation-specific primers (single nucleotide extension)
• Sensitivity– Baseline noise of mass spectrometric analyzer may prevent identification of low
abundant pathogens/mutations
• Specificity– Presence of adducts can cause mass shift overlaps with SNP mutations– Increase in spectral patterns multiple charge states– Larger the mass, the increased frequency for misclassifications
• Approach– Single base pair extension – Prior knowledge of mutation at onset
• Multiplexing – Increased mass signals– Trade-off between throughput and sensitivity
• Translation to the Clinical Lab– Research Use Only
High-Resolution Mass Accurate Identification of DNA Mutations
www.thermoscientific.com
• Ions are detected via mass-to charge-specific oscillations around two electrodes within an electric field
• Can take PCR products and run on mass-spec (following desalting)
12
LTQ-Orbitrap Analysis of PCR products
Manduzio et al. Rap. CommMass Spec. 2010; 10: 3501‐3509
Orbitrap Detection of a 20-mer primer
z MI: freeDNA
‐1 6031.020275
‐2 3015.510138
‐3 2010.340092
‐4 1507.755069
‐5 1206.204055
‐6 1005.170046
• PIK3Ca Forward Primer: ACTTTAGTGACTCGTCCTCA
• Identification of oligonucleotide primers at -4 and -5 charge states
High Resolution Mass Spectrometry: Limitations
• Sensitivity– No consistent data re: limit of discrimination (~5-10%?)
• Specificity– Presence of adducts can cause mass shift overlaps with SNP mutations
– Increase in spectral patterns multiple charge states
• Approach– PCR product desalting is a requirement
• Reversed phase, ion pairing HPLC shown success (Manduzio et al., Anal Biochem2010; 398: 272-278)
• Interpretation– Not software-directed; need to calculate monoisotopic masses for