LATG Chapters 8 & 9 Molecular Biology and Genetics
Dec 31, 2015
LATGChapters 8 & 9
Molecular Biology and Genetics
Molecular Biology
• …is the study of biology at the molecular level
• …focuses specifically on DNA, RNA, and protein
• …is a tool used to study genetics
Some Definitions
• Genetics …is the study of how genes interact (with each other AND their environment) to produce the inherited characteristics that we see every day
• Genome …the entire collection of genes an organism has.
More Definitions:
• Genotype = the genetic makeup of an organism– Every person (every mouse, every cow) has two
copies of each gene, one from each parent• “Homozygous normal” = two normal copies (aka
Wildtype)• “Heterozygote” = one normal & one abnormal copy• “Homozygous abnormal” = two abnormal copies (in
transgenics, aka “Knock-Out”
There’s still more...
• Phenotype = the physical features of an organism (i.e., tall/short; red/white etc)
• Mutation = any change in the DNA of a gene
• Genetic Engineering...is the term used to describe the manipulation of the genetic make-up of an organism
Where is your DNA located?
Chromosomes from a human female
Where is your DNA?
• DNA is in the nucleus of the cell, on structures called chromosomes.
• Chromosomes are made of genes
• Genes are made of DNA
Structure of DNA• DNA is a long string (polymer) of 4 bases• These bases universal!
– A = Adenosine– T = Thymine– C = Cytosine– G = Guanine
• The order (sequence) of the bases is what makes one gene different from another gene.
DNA Structure, cont’d
• A -- T• C -- G• GATTCC CTAAGG• DNA exists as a double helix
(twisted ladder)• Each rung of the ladder is a base
pair
How do cells transmit their genetic information?
• Replication = the process by which a cell duplicates its DNA.
• When a cell divides,one copy gets passed onto the new cell
How do cells interpret the information in the DNA?
• Transcription: the process by which the DNA code is “read”.– DNA is transcribed into RNA in the nucleus
Transcription
• RNA has 4 bases:
• Adenine A=U
• Guanine G=C
• Cytosine
• Uracil*** (Uracil is used instead of Thymine)
• Unlike DNA, RNA is single-stranded
Translation
• Occurs outside the nucleus, via ribosomes
• RNA is “read” in groups of three bases called “codons.”
• Each codon corresponds to an amino acid
Information Flow in the Cell
Techniques
• Extraction of DNA
• Restriction Digestion
• PCR
• Electrophoresis
• Southern blotting
Extraction of DNA
• Enzymes “digest” cell walls and release DNA into solution
• Add phenol to remove proteins
• Spin to separate DNA from proteins
• Add ethanol
Restriction enzymes
• These are enzymes that cut (digest) DNA at specific sites (sequences).
• Examples:– Eco RI only cuts the sequence …
GAATTC…– Pst 1 only cuts the sequence …CTGCAG
• Because everyone’s DNA is comprised of the same 4 nucleotides (A,T, C, G), you can attach one species to another...
Cloning (using RE)
Mouse Bacteria
CGAAGGAATTCCGTAG TGATTGAATTCTTAACGCTTCCTTAAGGCATC ACTAACTTAAGAATTG
+ Eco R1
CGAAG AATTCCGTAG TGATTG AATTCTTAACGCTTCTTAA GGCATC ACTAACTTAA GAATTG
+ ligase (another enzyme that attaches the m/c)
CGAAG AATTCTTAAC GCTTCTTAAGAATTG
Polymerase Chain Reaction (PCR)
• Based on the fact that A=T and C=G• Need only a tiny bit of DNA• ***Must know some of the sequence of the
gene of interest• Three simple steps: heat, add primers etc,
cool solution so bases will bind, repeat!• Can amplify a piece of DNA a million-fold!
PCR
Detection of DNA
• Use agarose gels
• Gel acts like a filter: DNA separates by size
• Stain the gel with a dye to make the DNA to make it fluoresce under UV light.
Blotting
• Southern Blot – DNA cut with enzymes– transferred to membrane– hybridized to probe that is specific to gene
of interest– exposed to film– if gene is present, you will see a band on
the film
Types of Blots
• Southern blotting -- DNA
• Northern blotting -- RNA
• Western blotting -- protein
Genetic Engineering of Mice– Two types
• Transgenic - a gene is added via pronuclear injection
– This is used to “overexpress” a gene– ex: Alzheimer’s and Beta-amyloid
• Targeted Mutation (aka “KO”) - a gene altered then added to the genome using ES cells
– This is used to delete a gene– ex: ERKO--estrogen receptor KO mice
Transgenic mice
• Created through pronuclear injection
• Need 4 groups of mice– superovulated females– stud males– vasectomized males– pseudopregnant females
The Mice• Superovulated females --given hormone
injections to make them release more eggs than usual (30-60)
• Stud Males --are mated with the s.o.females so that a lot of embryos are produced
• Pseudopregnant females --a female is mated to a sterile male so that her body will produce hormones that prepare it for pregnancy
Procedure
Transgenic Mice
• Transgene can integrate ANYWHERE in the mouse genome.
• Integrates in 1-several hundred copies• Must screen pups (PCR) to determine
which pup have the transgene, and will pass it on.
• Must observe transgenic mice carefully to observe phenotype
Phenotype
• Depends on the gene you’re overexpressing
• Sometimes it’s obvious, sometimes it’s not.
• Must observe these mice carefully
Knockout Mice
• Knockout mice --a gene is deleted
• Similar to transgenic mice, must carefully observe for phenotype
• Need the same 4 groups of mice, plus ES cells
• ES cells = embryonic stem cells– totipotent
Embryonic Stem Cells
• Are from the inner cell mass of a blastocyst
• can develop into any part of the body
• “totipotent”
KnockOut Mice• Culture ES cells from white (129) mice
and target gene using electric current
• Mate black mice; insert “white” ES cells into black blastocyst
• Pups = chimeras (black and white)
• Mate chimera to black mouse.
• If white pups are produced, targeted gene has been passed on!
Transgenic Animals and You
• You are very important!!
• These mice are expensive/time-consuming to make
• You must carefully observe the animals for phenotype changes– strange gait, spinning, too fat, too thin,
scaly skin…
Good Luck!