JOURNAL THE Vol. 266, No. July 25, OF of pp. S. Inc. U. A ...THE JOURNAL OF BIOLOGICAL CHEMISTRY (0 1991 by The American Society for Biochemistry and Molecular Biology, Inc. Vol. 266,

T H E J O U R N A L OF BIOLOGICAL CHEMISTRY (0 1991 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 266, No. 21, Issue of July 25, pp. 13828-13833, 1991 Printed in U. S. A.

Epidermal Growth Factor (EGF) Induces Oligomerization of Soluble, Extracellular, Ligand-binding Domain of EGF Receptor A LOW RESOLUTION PROJECTION STRUCTURE OF THE LIGAND-BINDING DOMAIN*

(Received for publication, July 16, 1990)

Irit Lax$, Alok K. Mitrag, Chris Raveran, David R. Hurwitzll, Menachem Rubinstein$, Axel UllrichII , Robert M. Stroudg, and Joseph SchlessingerS From the $.Department of Pharmacology, New York University Medical Center, New York, New York 10016, 7Rorer Central Research, Incorporated, King of Prussia, Pennsylvania 19406, 11 Max Planck Institut fur Biochemie, 8033 Martinsried bei Munchen, Federal Republic of Germany, and the $Department of Biochemistry and Biophysics, University of California School of

”

Medicine, San Francisco, California 94143-0448

Ligand-induced oligomerization is a universal phe- nomenon among growth factor receptors. Although the mechanism involved is yet to be defined, much evidence indicates that receptor oligomerization plays a crucial role in receptor activation and signal transduction. Here we show that epidermal growth factor (EGF) is able to stimulate the oligomerization of a recombinant, soluble, extracellular ligand-binding domain of EGF receptor. Covalent cross-linking experiments, analysis by sodium dodecyl sulfate-gel electrophoresis, size exclusion chromatography, and electron microscopy demonstrate that receptor dimers, trimers and larger multimers are formed in response to EGF. This estab- lishes that receptor oligomerization is an intrinsic property of the extracellular ligand-binding domain of EGF receptor. Ligand-induced conformational change in the extracellular domain will stimulate receptor- receptor interactions. This may bring about the allo- steric change involved in signal transduction from the extracellular domain across the plasma membrane, re- sulting in the activation of the cytoplasmic kinase domain. Electron microscopic images of individual extracellular ligand-binding domains appear as clusters of four similarly-sized stain-excluding areas arranged around a central, relatively less stain-excluded area. This suggests that the extracellular ligand-binding domain is structurally composed of four separate domains.

The cell membrane receptor for epidermal growth factor (EGF)’ belongs to the family of growth factor receptors which possess intrinsic protein tyrosine kinase activity (1-3). The binding of EGF to the extracellular ligand-binding domain of the receptor activates its cytoplasmic tyrosine kinase, result-

* This research was supported by Grant GM24485 from the Na- tional Institutes of Health (to R. M. S.) and grants from Rorer Central Research and the Human Frontier Science Program (to J. S.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. ’ The abbreviations used are: EGF, epidermal growth factor; EGFR, epidermal growth factor receptor; sEGFR, soluble epidermal growth factor receptor; SPA, scintillation proximity assay; Hepes, 4-(hydrox- yethy1)piperazineethanesulfonic acid; PMSF, phenylmethylsulfonyl fluoride; SDS, sodium dodecyl sulfate; PAGE, polyacrylamide gel electrophoresis; DSS, disuccinimidyl suberate; CHO, Chinese hamster ovary.

ing in rapid autophosphorylation as well as the phosphoryla- tion of various cellular substrates (1-3). The kinase activity of EGFR is essential for signal transduction as kinase-negative EGFR mutants fail to elicit any EGF response (4-8). It is well established that the binding of EGF to EGFR causes rapid receptor oligomerization both in uitro and in intact cells (9-17). Receptor oligomerization plays an important role in the underlying mechanism involved in the EGF-induced activation of the tyrosine kinase activity and subsequent receptor autophosphorylation (14-19). However, the kinase activity of EGFR can also be stimulated by ligand-independent mech- anisms, which may not involve receptor oligomerization (20, 21).

Interesting questions remaining to be answered include: what is the mechanism involved in EGF-induced receptor oligomerization and what are the structural elements essential for this process to occur? As receptor oligomerization is intimately associated with kinase activation, the unraveling of the mechanism of this process will have important impli- cations concerning our understanding of the mechanism of action of a number of transmembrane signaling molecules with similar structural topologies. The mechanism of EGFR oligomerization is particularly intriguing, as it has been shown that each receptor molecule has a single binding site for EGF and EGF binds to a single EGFR (22). Therefore EGF- induced receptor oligomerization must involve receptor-receptor interactions that are stabilized by ligand binding (9). This is in contrast to platelet-derived growth factor receptors in which receptor dimerization is mediated by the various di- meric and therefore bivalent forms of platelet-derived growth factor (23-27).

In this report we show that the extracellular domain of EGF receptor is endowed with the capacity to undergo EGF- dependent oligomerization leading to the appearance of receptor dimers, trimers, and even higher oligomerization states. We describe the two-dimensional projection structure of the extracellular ligand-binding domain determined from single- particle averaging of electron images of a preferred orientation. In this view the molecule displays an approximate 4-fold stain-excluding area, suggesting that the extracellular ligand- binding portion of EGFR is composed of four separate domains.

MATERIALS AND METHODS

Preparation of EGF Receptor Construct-The construct encoding the soluble, extracellular ligand-binding domain of EGF receptor (sEGFR) denoted HERXCD was prepared by digestion of CVN HERC (28-30) with SacI. A 3124-base pair fragment containing a

13828

EGF Oligomerization of EGFR Ligand-binding Domain 13829 portion of HER was subcloned into M13 and mutated with primer 5' GGGCCTAAGATCTAGTAAATCGCCACTGGG 3'. The last amino acid residue of sEGFR is Ser-621 (28). The mutated construct was cut with BsmI to yield a 1357-base pair fragment containing the mutated region. This fragment replaced the corresponding fragment in CNV HER. Following transfection, selection, and amplification with methotrexate, the Chinese hamster ovary (CHO) cells were grown in medium composed of Dulbecco's modified Eagle's medium/ F12 (1:l) containing 5% dialyzed serum by immunoaffinity and anion exchange chromatographies.

Purification of sEGFR-Recombinant sEGFR was purified from conditioned medium in two steps. The first step was affinity chromatography with monoclonal anti-EGF receptor (mAbl08) immobi- lized on cyanogen bromide-activated Sepharose beads (Pharmacia LKB Biotechnology Inc.). The bound sEGFR was washed extensively with 500 ml of 10 mM Hepes, pH 7.2, 500 mM NaCl, 5% glycerol, followed by 500 ml of 10 mM Hepes, pH 7.2, 100 mM NaC1. The sEGFR was eluted of the column using 250 ml of Actisep, pH 7.5 (Sterogene Bioseporation, Inc., Acadia, CA), and dialyzed for 24-48 h against 10 mM Hepes, 100 mM NaCl, with two changes of buffer. After the elution buffer was dialyzed away, the sEGFR was concentrated using an Amicon stir cell (350 ml) and an Amicon 76 YM30 membrane. The second step of purification was accomplished by using anion exchange chromatography (Mono Q). The bound sEGFR was eluted from the Mono Q column with 0-200 mM NaCl gradient, and the eluted fractions were analyzed on a 4-12% SDS-PAGE Tris/ glycine gradient gel (Novex, Encinitas, CA). The fractions which contain the purified sEGFR were pooled and concentrated using Amicon Centricon 30. Purified sEGFR was stored at 4 "C.

"'I-EGF Binding Experiments Using Scintillation Promixity Assay (SPA)-The binding affinity of sEGFR for Iz5I-EGF was determined by SPA (31). SPA beads, PVT-RI (Amersham Corp.), are fluoromi- crospheres coated with a monoclonal antibody, R1, directed against the receptor extracellular domain. R1 does not compete with EGF for binding to the receptor. In this assay, "'1-EGF bound to sEGFR coupled to PVT-RI beads generates luminescence while free '"1-EGF does not (31). Hence, using the SPA method, the amount of bound I2'II-EGF can be determined without physically separating bound from unbound radiolabeled ligand.

Binding assays were performed by either native EGF dilution or by a method in which "'I-EGF was directly applied. In the native EGF dilution method PVT-RI beads (50 pl), sEGFR (6.5 nM), "'I- EGF (0.5 nM, 100 pCi/pg) and nonradioactive EGF ranging from 10 to 500 nM were incubated in 200 p1 of 20 mM Hepes (pH 7.3), 0.1% bovine serum albumin, overnight at room temperature. Nonspecific binding was determined in triplicate in the presence of excess of native EGF (2 p ~ ) . The direct method was performed similarly except that increasing concentrations (2.5-1600 nM) of '"I-EGF were em- ployed. Nonspecific binding was determined a t each concentration of "'1-EGF by diluting with 100-fold excess native EGF. All points were determined in duplicate. Luminescence was determined using a Beck- man LS7000 scintillation counter with the window set for full range detection of "H. Following conversion of bound luminescence counts t o bound y counts, binding affinity was determined by Scatchard analysis.

Covalent Cross-linking Experiments-Purified sEGFR (5-20 p ~ ) was incubated with EGF (10-30 p ~ ) in 20 mM Hepes, pH 7.5, 150 mM NaC1, for 1 h at room temperature. The covalent cross-linking agent disuccinimidyl suberate (DSS) was added in a final concentration of 0.25 mM for 30 more min. An aliquot (30 pl) was mixed with two volumes of sample buffer, boiled for 4 min, and analyzed by SDS- PAGE (4-12%). Another aliquot (10 pl) was mixed with Tris-HC1 buffer, pH 7.5, to a final concentration of 0.5 M, left for 1 h and then analyzed by size exclusion chromatography on a TSKG4000SW column (0.7 X 60 cm, TOSOH Corp., Japan).

Preparation of Samples for Electron Microscopy-A 5-pl sample (1- 10 pg/ml protein concentration) was applied to a 400-mesh copper grid covered with parlodian and overlaid with a carbon film that was rendered hydrophilic by glow-discharge in air. The sample was allowed to settle for 2 min, washed with 2 drops of distilled water, stained with uranyl formate prepared according to Williams (32) for 20 s, and finally blotted by touching the edge of the grid with filter paper. The grids were air-dried and examined in an EM400 electron microscope (Phillips Electronic Instruments, Eindhoven, Holland) using an accelerating voltage of 80 kV. Micrographs were recorded (33) at 111,200 X magnification, calibrated by using the 173.5 A spacing of (010) planes in negatively stained images of beef liver catalase, on Kodak film 4489 (Eastman Kodak), developed for 4 min

in a solution of 2 parts Dl9 (Eastman Kodak) to 1 part distilled water.

Image Analyses-Alignment of the images of single particles was carried out by correlation-function-based rotational and translational alignment using the SPIDER software package (34). Micrographs were digitized by scanning on a flatbed micro-densitometer (model 1010M, Perkin Elmer) with 50-pm aperture and step size, corresponding to 4.5 A on the specimen, and displayed on a Parallax 1280 display processor (Parallax Graphics, Sunnyvale, CA). Separate image files for the smallest isolated particles, interpreted as the monomer of sEGFR, were created. Examination of the calculated one-dimensional angular autocorrelation functions for a total of 97 particles showed a predominance of pseudo-4-fold character in the images. Sixty such particles that displayed peaks 90 f 20" apart in the calculated angular autocorrelation functions were selected. The images were low-passed filtered to a limiting highest resolution of 26 A and aligned both rotationally and translationally by correlation methods (35) in two stages of three cycles each. In the first stage, the reference was a particle that visually best displayed the 4-fold character, and the images were rotationally aligned with respect to this image by calcu- lating one-dimensional cross-correlations from -180" to 180" around rings a t chosen radii in the images. The optimal values of the radii were decided based on the rotational alignment of two typical images. The rotated images were translationally aligned to the reference by applying shifts that maximized the cross-correlation functions. In the second stage, the rotationally and translationally shifted imaged were added and averaged together to produce an image that served as the reference and the alignment procedure repeated. This second alignment-refinement cycle was expected to reduce bias in the alignment because of the choice of the particular reference in the first step. A scale factor was applied prior to the averaging that made the average density in each image the same. The final cumulative rotational and translational shifts were applied to the unfiltered images to arrive a t the set of 60 mutually aligned images. These aligned images were again scaled by multiplying with a scale factor which made the average density in each image the same. The overall average of the aligned images of the 60 particles, the standard deviation between these aligned images, and two subset averages of independent sets of 30 randomly chosen aligned images, for quantifying variations in the images, were calculated. The density values a(i, j ) for the map describing the standard deviation in the overall average was given by the following equation.

u ( i , j ) = d 7 c b m ( i , ; ) - P ( i , j ) ) ' N - 1 (1)

where p"(i , j ) and p ( i , j ) for pixel (i, j ) are the density values for the mth image and the averaged map, respectively, and N is the number of images averaged. The averaging was carried out after multiplying the densities in each scaled-aligned image with a weight that was equal to the correlation coefficient for the array of pixel densities in the given image to those in the reference, that were contained within a circular mask of diameter 72 A.

The Fourier transforms of the two subset averages of the independent sets of 30 scaled-aligned images were used to arrive a t a measure of the resolution of the overall average. For this purpose, the mean amplitude-weighted phase residual A0 for the resolution shell s = SI to s = SI given by the following equation (36, 37) was calculated.

-

Jr" (2) c (IF11 + IF?I).(8, - 82)'

c (IF11 + IF2213

AO(s,, sa) = "="I

> = s,

Here I F I I and 1F21 are the amplitudes and 81 and O2 the phases of the Fourier transform components a t a given resolution for the two averages. A0 = 0" for images that are in perfect agreement and equals in theory 104" for two completely uncorrelated images. The resolution a t which A8 = 45" indicates a resolution less than equal or to which there is significant agreement between the Fourier components.

RESULTS AND DISCUSSION

In order to apply quantitative biophysical analyses to define the molecular interactions involved in ligand binding specific- ity of EGF receptor and the mechanism of the subsequent

13830 EGF Oligomerization of EGFR Ligand-binding Domain

activation, we have generated a recombinant, soluble, extracellular ligand-binding domain of human EGFR (sEGFR). CHO cells were transfected with a mammalian expression vector, which directs the synthesis of the extracellular domain of human EGFR (29). Following selection with neomycin and amplification with methotrexate, the CHO cells produced and secreted into the medium supernatant approximately 4 mg/ liter of sEGFR. The recombinant sEGFR migrated on SDS gels with an apparent M , of 105,000 (Fig. 1). sEGFR is glycosylated and upon removal of sugars with deglycosylating enzymes a protein core of 68,000 daltons remains. sEGFR was purified using affinity chromatography with monoclonal anti- EGF receptor antibodies followed by anion exchange (Mono Q ) chromatography (Fig. 1 and "Materials and Methods"). The binding affinity of sEGFR for ""I-EGF was determined using a novel SPA (see "Materials and Methods" and Ref. 31) and Scatchard analysis of the binding data (Fig. 2). The dissociation constant Kd of ""I-EGF toward sEGFR is approximately 2.5 X 10" M. This value is 3-5-fold higher than the Kc, of '""IEGF toward the detergent-solubilized EGFR (38). The binding of ""I-EGF to recombinant sEGFR was specific, as another growth factor, acidic fibroblast growth factor, did not interfere with the binding of ""I-EGF to sEGFR. Moreover, the binding of ""I-EGF to sEGFR was inhibited by a monoclonal antibody against EGFR, mAb96, which specifically blocks the binding of ""I-EGF to native

A B C

kDa

116 - a 'CrU

84- e .

FIG. 1. Generation of recombinant, soluble, extracellular domain of EGF receptor (sEGFR) in CHO cells. Coomassie Rlue- stained preparation of affinity-purified sEGFR isolated from conditioned medium of transfected cells is shown. sEGFR was purified by affinitypurification usinganti-EGFRmonoclonal antibody (mAbl0R) and by anion exchange chromatography using a Mono Q fast pressure liquid chromatography column. Lanes R and C show peak fractions eluted from the Mono Q column using 0-250 mM NaCl gradient. Lone A shows molecular weight standards.

1 .s

N z

8 L i

x 1

. U 5 0.5 0 m

n

r

400

Flee (nM)

0 1 2 3

Bound (nM)

FIG. 2. Binding of '""IEGF and Scatchard plot of binding results. Binding was determined by SPA. Each point represents the average of two determinations.

EGF - + - -I- DSS - - ++

B A B C D E F m I '4 1 -I"

FIG. 3. Analysis of sEGFR oligomerization by SDS-PAGE following covalent cross-linking. A, purified sRGFR (20 pM) was incubated with EGF (30 p ~ ) for 90 min a t room temperature in 20 mM Hepes buffer, pH 7.4, 150 mM NaCl and subsequently with DSS for 1 h. Samples were analyzed by SDS-gel electrophoresis and stained with Coomassie Blue. R, Covalent cross-linking of sEGFR with EGF was done as in A. For increased sensitivity similar SDS gel runs were stained with silver stain. These analyses show various oligomerization states: I , monomers: 11, dimers; I l l , trimers; and IV, tetramers.

272K134K 67K45K i t 1 i M O N O M E R ( 1 O Z K )

Ve(ml)

FIG. 4. Analysis of sEGFR oligomerization by size exclusion chromatography. DSS-cross-linked complex of sEGFR and EGF was prepared (see Fig. 3 for details). Cross-linking was terminated by addition of Tris-HCI buffer and aliquot (10 P I ) was analyzed by chromatography on a TSKG4000SW column. The column was pre- equilibrated and eluted with a 150 mM NaCI, 20 mM Hepes, pH 7.5, buffer at a flow rate of 0.5 ml/min. The column was calibrated with molecular weight markers as indicated.

cell surface EGFR (data not shown). We have previously described experiments utilizing a solu-

ble covalent cross-linking agent to demonstrate that EGF induces receptor dimerization in vitro and in living cells (17). Hence, a similar approach was used to determine whether sEGFR aggregates upon binding of EGF. EGF and sEGFR were incubated together and subsequently treated with the covalent cross-linking agent DSS in order to render EGF- induced oligomer formation irreversible. The products of this reaction can thus be analyzed by SDS-gel electrophoresis, size exclusion chromatography, and electron microscopy. Fig. 3 shows that in the absence of either EGF or DSS essentially

EGF Oligomerization of EGFR Ligand-binding Domain 13831

FIG. 5 . Morphologies of uranyl formate-stained sEGFR. a, images of sEGFR alone; h, images of sEGFR treated with EGF and DSS; c-e, galleries of images of sEGFR particles in various oligomerized states c, monomers; d, dimers; e, trimers and larger oligomers. All samples were stored at 4 "C for several days prior$o preparation of EM grids. Bar, 1000 A.

a

FIG. 6. Aligned images of sEGFR monomers. A gallery of digitized images of 60 selected EGFR monomers, in the preferred orientation after rotational and translational alignment (see "Mate- rials and Methods"). This figure was created using the software package PRISM (43) developed for the Parallax 1280 display processor.

monomers of sEGFR were detected. However, EGF in the presence of DSS induced covalently linked receptor dimer, trimer, and a small amount of tetramer formation. Addition of different concentrations of EGF to the reaction mixture indicated that EGF-induced oligomerization was saturable a t full receptor occupancy. EGF-induced receptor dimers and trimers were already detected at an EGF concentration of 1.25 pM, which occupies only 5-10% of the available receptors. Quantitation with either immunoblotting analysis with anti- EGFR antibodies or by density scanning of various receptor forms indicated that approximately 16 and 13% of sEGFR molecules, respectively, were trapped in the form of dimers or

b

trimers in the presence of the covalent cross-linking agent. Dimers were also seen clearly in the size exclusion chromatography under nondenaturing conditions (Fig. 4). SDS- PAGE analysis of fractions corresponding to the dimer peak (apparent M , 207,000) gave a major band corresponding to band ZZ in Fig. 3 while monomers peak gave a band corresponding to band I. It is noteworthy that the covalent cross- linking experiments underestimate the extent of EGF-induced oligomerization of sEGFR because of the low efficiency of the covalent cross-linking reaction. Control experiments with either acidic fibroblast growth factor or bovine serum albumin indicated that EGF-induced oligomerization of sEGFR was EGF-specific.

A consistent picture emerged from the inspection of sEGFR morphologies visualized by electron microscopy. Fig. 5a shows that in the absence of EGF, monomers and small amount of dimers of sEGFR were observed at sEGFR concentrations of 1-10 pg/ml used in sample preparation for microscopy. Es- sentially similar distribution of particle sizes were observed (data not shown) when sEGFR were treated with DSS. In the same concentration range, however, in the presence of EGF and DSS, dimers, trimers, and larger multimers of sEGFR were observed to be the prevalent forms of receptors (Fig. 5b). While it is necessary to use DSS in order to detect oligomerization in SDS gels, it is possible to observe EGF-induced receptor oligomers by electron microscopy without DSS treat- ment (data not shown). Evidently, the forces that hold the receptors together are strong enough to withstand staining and electron microscopy.

In the images of the unliganded, recombinant sEGFR, particle sizes increase incrementally. Many of the smallest particles, interpreted as monomers, display a preferred orientation as they lie on the support film and in the predominant view appear as clusters of four, similarly sized stain- excluding areas arranged around a central less stain-excluding area. Fig. 6 shows a gallery of the final rotationally and translationally aligned images of 60 selected EGFR particles. Fig. 7A, in the form of contour plot and gray-level display,

13832 EGF Oligomerization of EGFR Ligand-binding Domain

m F-l

D

I I

FIG. 7. Averaged image of sEGFR monomers in the predominant orientation. A, the average of 60 aligned EGFR images shown in Fig. 6 after scaling. The bold, higher density contours enclose stain- excluding mass and the dotted, lower density contours represent stain.

shows the overall average of these 60 aligned images after scaling. Similar illustrations for two independent averages of subsets of 30 randomly chosen particles are shown in Fig. 7, B and C. Fig. 7 0 shows the standard deviation associated with each pixel element of the overall average.

The recombinant sEGFR molecule in the preferred orientation has an overall four-lobed shape with dimensions as indicated in Fig. 7A. This averaged image shows four peaks of stain-excluding areas. The nearest neighbor peaks are arranged 82-109" apart around the center and are 15-18 A distant from each other. Fig. 8 is a plot, as a function of resolution, of the calculated weighted phase residual (see "Materials and Methods") for the transforms of the averages of two independent subsets of images (Fig. 7, B and C). As can be seen from this figure, the weighted phase residual Teaches a value of 45" for Fourier terms corresponding to 21.5 A resolution and increases with increasing resolution. In the nomenclature of Henderson et al. (39), a phase residual of 45" corresponds to an IQ - 7 (on a scale where IQ = 1 corresponds to perfect phase correspondence and I& - 14 to random phasing) or to a figure of merit of -0.67. This indicates that higher resolution Fourier components in the images are in- creasingly contaminated by noise. The limiting resolvtion of the averaged map in Fig. 7A was chosen to be 21.5 A below which there is significant agreement between the phases of the transforms of the subset averages.

In the two independent averages of subsets of images (Fig. 7, I? and C) the four-lobet shape is preserved and the dimensions agree to within -2 A between the centers of the lobes. The differences between the two maps in Fig. 7, B and C, in terms of the variability of the positions and the strengths of the peaks, e.g. peaks 1 and 3, together with the standard deviation for the overall average (Fig. 7 0 ) establish the expected level of variation in the density map of Fig. 7A. The variations arise from residual errors in the alignment, stain artifacts, and systematic differences due to possible tilting of molecules on the grid or to different conformational states in the structure. The four similar lobes suggest that sEGFR is composed of four separate, similarly sized domains. This is not inconsistent with the observation of four domains with internal sequence homology in the extracellular portion of EGFR (40-42). Thus we propose that the four homologous domains in the sequence constitute the four main lobes in the averaged image of sEGFR (Fig. 7A). This view of the sEGFR could be like the view of the whole membrane-bound receptor projected onto the membrane plane; however, it also could be a side view of the particle viewed parallel to the membrane, since we have not yet imaged membrane-bound receptor.

The shaded area in Fig. 7A representing the stain-excludipg mass in this predominant view encloses an area of 1900 A'. The recombinant sEGFR includes 621 amino acids (68 kDa) and oligosaccharides and migrates on SDS gels with an apparent molecular mass of 105 kDa. Assuming a normal partial specific volume for this glycosylated recombinant pfotein of about 0.78 ml/gm, the expected volume is 135,000 A', Thus the structure may consist of four domains about 71 A long parallel to this predominant viewing direction. However, pre- liminary images of baculovirus-produced sEGFR, which are less glycosylated (90 kDa), show particles of size very similar to those of the CHO-produced sEGFR, suggesting that the

Average density = 1.615 (optical density units). Positions of the four peaks and the dimensions ofsthe particle are indicated. The shaded area encloses an area of 1900 A'. R and C, averages of two independent sets of 30 randomly chosen aligned images. The contour intervals are the same as in D. The map of the standard deviation at each pixel of the overall averaged image overlaid with the averaged image. Average density = 0.035 (optical density units).

EGF Oligomerization of EGFR Ligand-binding Domain 13833

Resolution in A"

FIG. 8. Variation of weighted phase residual as a function of resolution. A plot of calculated phase residual computed from the Fourier terms for the transforms of the averages of two independent subsets of images (Fig. 7, B and C) as a function of resolution (see "Materials and Methods"). The phase residual reaches a value of 45" at 21.5 A resolution as indicated, which represents the chosen nominal resolution of the averaged image (Fig. 7 A ) .

oligosaccharides may sequester the negative stain and so not contribute to stain-excluding mass. Tkus the stain-excluding four-domain structure would be -44 A thick if protein were the only stain-excluding mass, surrounding by oligosaccharides. A quantitative analysis of tilted images (in progress) is required to arrive at the three-dimensional shape.

On the basis of these experiments we conclude that receptor oligomerization is an intrinsic property of the extracellular domain of EGFR. The extracellular domain of EGFR is endowed with at least two functions: binding of EGF and oligomerization. The oligomerization observed with the extracellular domain alone is likely to reflect a role of this domain in the process of EGF-induced oligomerization of the native receptor, observed both in vitro and in living cells. I t is noteworthy, however, that in response to EGF, intact and native EGF receptors do not form oligomers larger than dimers (6-9). I t is possible that for the intact EGFR (which contains in addition to the extracellular domain, a single transmembrane domain and a large cytoplasmic domain), more restrictive and limited receptor-receptor interactions are allowed. Alternatively or in addition, constrained by association, the cytoplasmic domain of EGFR may dictate cer- tain conformational constraints on the extracellular domain inhibiting the formation of oligomers larger than dimers. These constraints could be released upon separation of the extracellular domain from the transmembrane and cytoplasmic domains. Moreover, on the basis of our finding that the EGF-induced oligomerization is a property of the extracellular domain alone, we propose that the function of EGFR begins with the association mediated by EGF binding, which does not require signaling across the membrane.

REFERENCES

2. Carpenter, G., and Cohen, S. (1990) J. Biol. Chem. 2 6 5 , 7709-7712 1. Hunter, T., and Cooper, J. A. (1985) Annu. Reu. Biochem. 54,897-930

3. Ullrich, A., and Schlessinger, J. (1990) Cell 6 1 , 203-212 4. Honegger, A. M., Dull, T. J., Felder, S., Van Obberghen, E., Bellot, F.,

5. Honegger, A. M., Szapary, D., Schmidt, A,, Lyall, R., Van Obberghen, E., Szapary, D., Schmidt, A,, and Schlessinger, J. (1987) Cell 51,199-209

Dull, T. J., Ullrich, A,, and Schlessinger, J. (1987) Mol. Cell. Biol. 7 , 4568-4571

6. Chen. S. W.. Lazar. S. C.. Poenie. M.. Tsien. R. Y.. Gill. G.. and Rosenfeld.

8. Moolenaar, W.. H., Bierman, A. J., Tilly, B. C., K., Honegger, A. M., Ullrich, ,

7 , 707-710 9. Schlessinger, J. (1988) Trends Biochem. Sci. 13 , 443-447

10. Schlessinger, J., Schechter, Y., Willingham, M. C., and Pastan, I . (1978)

11. Zidovetzki. R.. Yarden. Y.. Schlessincer. J.. and Jovin. T. (1981) Proc. Natl. Proc. Natl. Acad. Sci. U. S. A. 7 5 , 2659-2663

Acad. Sci. U . S. A . 78,6981-6985- ' '

Medicine, pp. 23-45, Pitman, London

, . ,

12. Yarden, Y., and Schlessinger, J. (1985) in Growth Factors in Biology and

13. Fanger, B. D., Austin, K. S., Eearp, S. H., and Cidlowski, J. A. (1986)

14. Yarden, Y., and Schlessinger, J. (1987) Biochemistry 2 6 , 1434-1442 15. Yarden, Y., and Schlessinger, J. (1987) Biochemistry 2 6 , 1443-1451 16. Bani-Schnetzler, M., and Pilch, P. F. (1987) Proc. Natl. Acad. Sci. U. S. A .

17. Cachet, C., Kashles, O., Chambaz, E. M., Borrello, I., King, C. R., and

18. Honegger, A. M., Kris, R., Ullrich, A,, and Schlessinger, J. (1989) Proc.

19. Honegger, A. M., Schmidt, A,, Ullrich, A,, and Schlessinger, J. (1990) Mol.

20. Koland, J. G., and Cerione, E. A. (1988) J. Biol. Chem. 2 6 3 , 2230-2237 21. Northwood, I. C., and Davis, R. J. (1988) J. Biol. Chem. 2 6 3 , 7450-7453 22. Weber, W., Bertics, P. J., and Gill, G. N. (1984) J. Biol. Chem. 259,14631-

23. Hart, C. E., Forstrom, J. W., Kelly, J. D., Seifert, R. K., Smith, R. A,, Ress, 14636

R., Murray, M. J., and Bowen-Pope, D. F. (1988) Science 240 , 1529- 1531

24. Heldin, C. H., Backstrom, G., Ostman, A,, Mannacher, A,, Ronnstrand, L., Rubin, K., Nister, M., and Westermark, B. (1988) EMBO J. 7 , 1387-

25. Seifert, R. J., Hart, C. E., Phillips, P. E., Forstrom, J. W., Ross, R., Murray, 1393

26. Heldin, C.-H., Ernlund, A,, Rorsman, C., and Ronnstrand, L. (1989) J . M. J., and Bowen-Pope, D. F. (1989) J. Biol. Chem. 284,8771-8778

27. Hammacher, A,, Mellstrom, K., Heldin, C. H., and Westermark, B. (1989) Biol. Chem. 264,8905-8912

28. Ullrich, A., Coussens, L., Hayflick, J. S., Dull, T. J., Gray, A,, Tam, A. W., EMBO J. 8 , 2489-2495

Lee, J., Yarden, Y., Libermann, T. A., Schlessinger, J., Downward, J., Mayes, E. L. V., Whittle, N., Waterfield, M. D., and Seehurg, P. H.

29. Livneh, E., Prywes, R., Kashles, O., Reiss, N., Sasson, I., Mory, Y., Ullrich, (1984) Nature 309,418-425

30. Greenfield, C., Hils, I., Waterfield, M. D., Federwisch, M., Wollmer, A,, A., and Schlessinger, J. (1986) J. Biol. Chem. 261,12490-12497

31. Bosworth, N., and Towers, P. (1989) Nature 341 , 167-168 Blundell, T. L., and McDonald, N. (1989) EMBO J. 8,4115-4123

32. Williams, R. C. (1981) J. Mol. Biol. 150 , 399-408 33. Unwin, P. N. (1975) J. Mol. Biol. 9 8 , 235-242 34. Frank, J., Shimkin, B., and Dowse, H. (1981) Ultramicroscopy 6 , 343-358 35. Frank, J., Verschoor, A., and Wagenknecht, T. (1985) in New Methodologies

in Studies of Protein Configuration (Wu, T. T., ed) pp, 36-89, Van Nostrand Reinhold, New York

Biochemistry 2 5 , 6414-6420

8 4 , 7832-7836

Schlessinger, J. (1988) J. Biol. Chem. 263,3290-3295

Natl. Acad. Sci. L! S. A. 86,925-929

Cell. Biol. 10 , 4035-4044

36. Unwin, P. N. T., and Klug, A. (1974) J. Mol. Biol. 8 7 , 641-656 37. Wagenknecht, T., Grassucci, R., and Frank, J. (1988) J. Mol. Biol. 199 ,

38. Yarden, Y., Harari, I., and Schlessinger, J. (1985) J. Biol. Chem. 2 6 0 , 315- 137-147

319 39.

40.

41.

42.

43.

Henderson, R., Baldwin, J. M., Ceska, T. A., Zemlin, F., Beckmann, E.,

Lax. I.. Bureess. W. H.. Bellot. F.. Ullrich. A,. Schlessincer. J.. and Givol. and Downing, K. H. (1990) J . Mol. Biol. 213,899-929

D: (1988)"Moi Cell. siol. 8 , 1831-1834 Bajaj, M., Waterfield, M. D., Schlessinger, J., Taylor, W. R., and Blundel,

T. (1987) Biochem. Biophys. Acta 916,220-226 Lax, I., Bellot, F., Hawk, R., Ullrich, A., Givol, D., and Schlessinger, J.

(1989) EMBO J . 8,421-427 Chen, H., Sedat, J., and Agard, D. (1990) in Handbook ofBiological Confocal

Microscopy (Pawley, J., ed) pp. 141-150, Plenum Publishing Carp., New York

, I - I ~ , ~~~ ~ ~ ~~I

JOURNAL THE Vol. 266, No. July 25, OF of pp. S. Inc. U. A ...THE JOURNAL OF BIOLOGICAL CHEMISTRY (0 1991 by The American Society for Biochemistry and Molecular Biology, Inc. Vol. 266,

Documents