Investigations of ABA Insensitive Revertants · insensitive, and have been designated _insemitive _reveflmts of gral. Genetic analysis reveaied that ire mutants suppress eral dominantly,

Investigations of ABA Insensitive Revertants of eral

in Arabidopsis thaliana

Sara Feriel Sarkar

A thesis submitted in conforrnity with the requirements for the degree of Master of Science

Graduate Department of Botany in the

University of Toronto

O Copyright by Sara Feriel Sarkar, 1999

National Library 1+1 of,,, Bibliotheque nationale du Canada

Acquisitions and Acquisitions et Bibliographie Services services bibliographiques

395 Wellington Street 395. nie Wellington ûîtawaON K l A W O(tawaON K l A W canada CaMda

The author has granted a non- exclusive licence allowing the National Libmy of Canada to reproduce, loan, distniute or seil copies of this thesis in microform, paper or electronic formats.

L'auteur a accordé une licence non exclusive permettant à la Bibliothèque nationale du Canada de reproduire, prêter, disûi'buer ou vendre des copies de cette thèse sous la fonne de microfiche/film, de reproduction sur papier ou sur format électronique.

The author retains ownership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protège cette thèse. thesis nor substantial extracts fkom it Ni la thèse ni des extraits substantiels may be printed or otherwise de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son permission. autorisation.

Investigations of ABA Insensitive Revertants of erul

Master of Science 1999

Sara Feriel Sarkar

Department of Botany

University of Toronto

Abstract A screen for suppressors of the ABA eral supersensitive mutant in Arabidopsis thaliana

had previously been perforrned in an effort to identifj. targets of the ERAl famesyl

transferase and to identiQ downstream components of the ERAl ABA-dependent

s i g n a h g pathway . Out of 124 lines that retested, eight suppressors of eral are ABA-

insensitive, and have been designated _insemitive _reveflmts of gral. Genetic analysis

reveaied that ire mutants suppress eral dominantly, but their insenkitive phenotype is

recessive. ire mutants represent three complementation groups, one of which is a new

mutation in the seed-specific AB13 transcription factor that has previously been shown to

mediate ABA responses during seed development In addition to the seed supersensitivity

of eral. ire mutants suppress adult phenotypes of eral. including.drought toIerance. This

is the first demonstration that AB13 has a genetic role outside of the seed.

Abbreviations ABA

AB1

o c

DNA

EDTA

EMS

F1

F2

FTase

g

GA

GGTase

kb

Ler

Ml

M2

MES

MC011 ++

RNA

SDS

S S C

TAE

clE

PM

UV

abscisic acid

abscisic acid insensitive

degrees Centigrade

deoxyribonucleic acid

ethylenediaminetetraacetic acid

ethylmechanesuifonic acid

first filial generation

second f ~ a l generation

farnes y 1 tram ferase

force due to gravity

gibberellic acid

gerany lgerany ltransferase

kilobase(s)

Landsberg erecta ecotype

EMS mutagenized seed, fmt generation

EMS mutagenized seed, second generation

rnorpholinoethanesuIfonic acid

Meyerow itz Columbia ecotype

ribonucleic acid

sodium dodecylsulfate

sodium chlonde/sodium citrate solution

Tridace tateEDTA solution

microeinstein

micromolar

ultraviolet light

Table of Contents .......... ......................................................................................................................... Abstract .. - i

Abbreviations ........................................................................................................................... M List of Figures .................................................................. ................................................... v List of Tables ........................................................................................................................... vi

.................................................................................................. Abscisic Acid Signalling 2 ........................................................ ..................................... Pseudorevertant Analysis . . . 9

Materials and Methods,.-.. .....- 1 3 Growth Conditions ................................................................................................................ 3

........................................................................................ Suppressor screen of era 1 1 4 ......................................................................... Determination of Hormone sensitivii 1 4

......................................... Genetic Analyçis ................................................................. 1 4 Mapping ............................................................................................................................ 1 5 Seed Fatty Acid Composition ........................... .... ......................................... 1 9 Whole Plant Measurements ....................................................................................... 1 9

................................................................................................................. Molecular Biology 19 ................................................................................. Dessication Toleranœ Measurement -21

Results 2 3 ................................ ............................................................ Suppressor screen of era 7 .. 23 . . . .......................................................................................... ABA Insensitivity of ire mutants 23

ire mutants are Dominant for Suppression of era 1, but Recesive for ABA insensnivity ................................................................................................................................................ 30

.................................................................. ire mutants faIl into 3 complementation groups 36 .............................................................. .....*...................-....... 1 3-0404 is an allele of AB13 .- 36

Seed Fatty Acid Composition of iremutants ...................................................................... 41 .......................................................................................................... Expression of AtEm6 41

1 3-2202 Maps to Chromosome III .............................................. ... ............................... 46 ...................................................... ab& 1 and abi5 , but not abi4 are Epistatic to era 1-3 46

........................................................ ire mutants Suppress era 1 Vegetative Phenotypes 53

abi3. abi4 and abi5 seed epistasis with era 7 ................................................................... 64 era 7 affects al1 ire mutants. abi3 and abiQ ........................................................................... 66 ire mutants are Dominant Suppressors of era 1 .............................................................. 66 Maternaf Effects of ire mutants ............................................................................................ -69 ire suppression of era 1 adult phenotypes ......................................................................... 70

............................................................................................................... abi3 is an ire mutant 71

List of Figures

Figure

Schematic of the suppressor screen of eral

Dose response vs germination frequency of ire mutants

AtEm6 Northern analysis of ire mutants

Position of Iesion of di3-20

M o l e plant phenotypes of ire mutants

Branching patterns of ire mutants

Infiorescence architecture of ire mutants

Drought tolerance of 13-0404 (abi3-20)

List of Tables

Table

Primers used for sequencing of abi.3-20

Resistance of eral-2 and erul-3 suppressors to ABA

F2 segregation analysis of ire mutants crossed to the parent, erul-3

F2 segregation analysis of ire mutants crossed to wild-type, MCol

Cornplernentation analysis of ire mutants

Allelisrn tests of ire mutants with a.i.3, abi4 and d i 5

Fatty acid composition of ire mutants

Mapping of ire 13-2202

Epistatic analysis bet-ween eral-3 and abi3, abi4 and d i 5

Quantitation of branching of ire mutants

Introduction Hormones have been defmed as chernical controilers which are synthesised locally but act

at a distance and whose concentration defrnes the degree of command (Jacobs, 1979). Plant

hormones are therefore not true hormones, since they do not fit these two critena: they may act

over long distances but have also been known to act cell-autonomously and their concentration

does not always correlate to the degree of the effect king controlled. The only unifjhg concept of

plant hormones is that they c m affect physiological processes at extremely low concentrations.

Five classical plant hormones have been defmed by their eEects on plant development or

physiology, for example auxin is involved in apical dominance, mot growth, vascularization,

gravitropism and embryogenesis. This definition has also been misleadhg shce it is becoming

increasingly obvious that there are many more plant hormones than once believed (the cwrent tally

is 9) and that hormones do not entirely control a process but rather just aspects of a process

(Trewavas, 1991). Thus one hormone. in exquisite concert with other hormones, minerais,

metabolites and environmental factors such as Light, temperature and pH control a process. This

multiplicity of control factors is desirable for a plant since it makes for reliablity of a response

which may ofien be irreversible. Therein lies the challenge for plant biologists: how to dissect a

multi-faceted process, which is analogous to deciphering a spider's web.

The traditional approach has been to link hormone concentration with effect. This has been

effective in detexmining the possible sites of plant hormone action, but does not provide clear

answers as to their mode of action. Experiments involving the application of exogenous hormones

have k e n performed in the hopes of recapitulating a process thought to be controiied by the

hormone, but this has not provided any clarification, since there are concems of sequestration,

uptake and hormone sensitivity of different tissues (Bonetta and McCourt. 1998).

Another approach has k e n the genetic approach. This usually involves screening for

mutants which respond abnomally to exogenously applied hormone. This has yielded many

interesting mutants in some hormone signalling pathways, thereby allowing the systematic

dissection of a pathway. Perhaps the most successful example of this approach has been the

genetic dissection of the ethylene response in Arabidopsis. Mutant isolation has Ied to the

identification of numerous signahg components including the ethylene receptor, intermediaie

relays and ethylene responsive transcription factors and has thus provided a clear h e w o r k of the

ethylene response pathway (Woeste and Kieber, 1998). Screening for hormone insensitive mutants

has been successful in the case of ethyiene signailing, but has not been as trïumphant in the case of

other hormones. In these cases one possible problem has ken experimental design. These screens

are usualiy peiformed at concentrations of hormone much higher than endogenous levels, and

assume that signalling is occurring as it would at endogenous concentrations. At these saturating

concentrations the signalling system may very weli respond differently to the hormone. Sensitivity

is defined as the change in physiological response induced by a change in concentration.

Assuming that the response of the process can be saturated like any other dose response, the

maximal sensitivity will occur before saturation, in this case, at Iow concentrations of hormone.

Sensitivity takes into account all factors influencing the process, and is therefore a m e measure of

performance (Trewavas, 199 1)-

With these concerns in mind. new genetic screens need to be developed which more

accurately refelct the in vivo response system. Sensitizing screens for ABA action have

demonstrated that low exogenous hormone concentrations do enrich for different classes of

response mutants than insensitizing screens (Cutler et al-, 1996). This thesis provides a description

of mutants obtained from a screen performed at a low concentration of abscisic acid (ABA), close

to endogenous levels. in order to further elucidate the factors involved in ABA signalling.

Abscisic Acid Signalling ABA is a plant hormone implicated in promoting seed dormancy and development, as weil

as in transpiration and osrnotic stress responses. Genetic analyses have identified either ABA

biosynthetic or response genes and support a role of ABA in the above processes. ABA induced

responses have been categorized into fast (4 mins) and slow (>30 mins) responses, as

exempli fied by seed development and s tomat al closure respec tively . It has been hypo thesised that

there are therefore at least two separate ABA response pathways (Zeevaart and Creelman, 1988).

Physiological Investigations of ABA Action

Fast responses have mainly been studied at the physiological level, since these responses

are not thought to involve de novo gene expression. It is thought that either de novo ABA synthesis

or redistribution of ABA in guard cells leads to stomatai closure (Zeevaart and Creelman_ 1988)-

ABA may work in conjunction with a caZi-dependent pathway to effect stomaîal closure (Man et

ai., 1994).

Slow responses have b e n characterized by searching for genes that are upregulated by

increased concentrations of ABA. Many ABA-inducible genes have a consensus ABA-regulated

(ABRE) cis-acting promoter sequence. The EmBpl transcription factor of wheat binds to this

sequence upstream of the ABA-inducible wheat Eml gene, which is expressed during

embryogenesis (Guiltinan et al.. 1990) and this binding is aided by Vpl, another transcription

factor which mediates ABA-dependent and independent responses (Hill et al., 1996), and a 14-3-3

protein (Schultz et al., 1998). VP 1 was onginally identified in a mutant screen in maize for

embryos that showed a viviparous germination phenotype (Neill et al.. 1986; Robertson, 1955).

VP1 is not ABA-induced, and so the exact link of VPI and Eml to ABA has not been established.

Additionaliy, unlike Em 1. not al1 ABA-inducible genes contain ABRE boxes. suggesting that there

are other factors at play (Bray, 1993).

A large body of work has accumulated linking ABA with responses to environmental

stresses. Much of this work has k e n centred around the relationship of ABA to cold and drought

tolerance. Like Ernl, sorne genes that are drought-inducible are also induced by ABA (Bray, 1993;

Urao. 1996), one class of which are the Late Embryogenesis Abundaot (LEA) proteuis. Because

these are also expressed dunng seed development (Goldberg et al., 1989). one possible role of

these proteins is to protect cellular components during water-deficit conditions (Dure, 1993).

ABA Ieveis also increase during cold acclimation, leading to the hypothesis that ABA may

regulate this process (Zeevaart and Creelman, 1988). Arabidopsis plants treated with ABA are

tolerant of freezing, and many cold responsive genes are induced by ABA (Lang et al., 1989).

Thus, ABA is implicated in these processes, but no direct link between stress induction and ABA

signai transduction has been made.

Genetic Anaiysis of ABA Signalling

ABA-Deficient Mutants

AE3A deficient mutants have been used to understand the role of abscisic acid in several

plant species including tomato and Arabidopsis (Davies, 1995). These mutants have implicated

ABA in water stress relations and seed germination. Mutants defective in the accumulation of

AB A, abal mutants, were isolated as suppresson of a gibbereliin auxouophic mutant, gal

(Koomneef et al., 1982). The abal phenotypes supported roles for ABA in stomatal regulation

and seed dormancy, since mutants were wilty and non-dormant. Severe aileles of abal reduce

rneasurable ABA by 90% compared to wild-type. Recently, mutants in two other genes ABA2 and

ABA3 which were isolated by germination on GA inhibitors, have been shown to be

p henotypically sirniiar to abal mutants (Leon-Kloosterziel et al., 1 996). S tudies with aba2 have

shown this mutant to be defective in the dehydration-hduced accumulation of probe, which is

mediated by increased levels of ABA during drought stress (Nambara et al., 1998).

The abal mutant has k e n useful in detennining the spatial and temporal quirements for

ABA during seed dormancy induction. It was shown that in the developing seed, there are 2 peaks

of ABA concentration, one due to materna1 effects and another embryonic (Karssen et al., 1983).

The embryonic peak only was shown to be critical for dormancy, since neither matemal ABA nor

exogenous ABA could rescue the reduced dormancy phenotype of aba homozygous mutants. In

contrast, dormancy developed in wüd-type embryos even if the matemal tissue was homozygous

for the abal mutation. Matemal ABA may be required for normal seed development.

In tobacco, seed concentrations of ABA were dramatically reduced by the transgenic

expression of an ABA-specific antibody that sequesters free ABA (Philiïps et ai., 1997). These

mutants were phenotypicaiiy similar to abi.3-6 as well as to the relatedfics3 and lecl mutants.

These Iatter two genes appear to play essential roles in cotyledon identity in Arabidopsis. That

immunomodulation of endogenous ABA levels causes novel phenotypes in cornparison to ABA

auxotrophs suggests that aba biosynthetic mutants may be le*. In summary, ABA deficient

mutants have been useful in determining some roles of ABA but have not been able to provide any

clues as to how ABA functions.

ABA Insenstitive Mutants

Abil and Abi2 Mutants

These were isolated as mutants that could germinate on a concentdion of ABA that

inhibited wild-type germination (Koornneef et al., 1984). In addition to the reduced dormancy and

adult wiltiness seen in aba mutants, these dominant mutations cause seeds to be insensitive to

exogenous ABA. Their phenotypes suggested that they are involved in both fast and slow

responses to ABA in that seed domancy, stomatal regdation and ABA induced gene expression

are ail reduced in these mutants. Both of these genes have k e n cioned and shown to encode type

2C serine-threonine phosphatases (Leung et al., 1994; Leung et al.. 1997). Interestingly, ail ABA

insensitive mutant alleies of these two genes are due to the same base pair substitution suggesthg a

very limited range of mechanisms to conferring ABA insensitivity at these two loci. At present,

mutations in AB11 and Ai312 are thought to be dominant negative, since the mutant forms are not

gain-of-function mutations and have low phosphatase activity. AB11 and ABE may have paitialiy

overlapping functions, but are not redundant since ABU controls only a subset of ABIldependent

responses and ABA-dependent morphological and molecuiar responses to drought and cold are

impaired in Abil but not Abi2 (Gilrnour and Thornashow, 1991; Gosti et al., 1995; Vartanian et al.,

1994).

ab3 mutants

abi3-l was found as a mutant insensitive to exogenously appiied ABA at the level of seed

germination (Koornneef et al., 1984). Aside fiom reduced seed donnancy, this allele showed no

other obvious seed or vegetative phenotypes. Subsequently, more severe alleles have been found-

abi3-6, a deletion diele, and the most severe AB13 d e l e to date, was isolated by screening for

insensitivity to the gîbbereUin biosynthetic inhibitor, uniconazol (Nambara et al., 1994). This is an

example of isolahg hormone mutants without having to use large amounts of hormone outside of

the range of high sensitivity to hormone. Like Abil and Abi2 mutants, abi3 have reduced seed

donnancy, but thus far their effects have been limited to the seed.

Unlike Abil, Abi2 and aba mutants, severe abi3 mutants have other seed-specifïc defects

since seeds remain green, do not accumulate certain seed storage reserves, and are severely

dessication intolerant (Narnbara et al., 1994). The relative allelic strengths of ab3 mutants is

reflected b y their dessication intolerance in the series: WT> abi3-l>cr6i3-4>abi3-5>abi3-6

(Ooms et al., 1993). The AB13 pene was isolated by positional cloning, and found to encode a

transcriptionai regulator with homology to VP 1 in maize, which has been studied intensely. Some,

but not ali phenotypes of VP 1 and ABU are the same: both are highly non-dormant aithough obi.3-

6 is not viviparous, and some vpl mutants, unlike abcl-6 also lack anthocyanins in their seed coats

(Carson et al., 1997). There are 4 regions of homology between ABD and VP1, which are the

acidic N-terrninal A 1 domain, and three basic regions designated as B 1, B2 and B3 in order h m

the N-terminus. The B3 region has the highest homology between Vp 1 and AbU and other B3

domain proteins and is composed of 120 amino acids, of which 12 are invariant (Suzuki et

al., 1997). Vpl can activate uanscnption from 2 distinct types of ciselements: Sph-elements iike

that of the C 1 anthocyanin gene of rnaize, and G-boxes Like that of nce and wheat Eml genes. VP1

can also function as both a repressor and an activator, as evidenced by repression of a-amylase

gene in aleurone ceiis, and by the activation of Eml (Hoecker et al., 1995). Vpl is modular in

nature and different domains may be required for the activation of Sph and G-box coupled genes.

Work is stili under way to determine which regions of Vpl bind to which cis-elements, and which

regions of Vp 1 are responsible for repressor and activator fiinctions. Mutations in the B3 domain

block expression of the Sph-coupled Cl gene but do not prevent seed maturation or block the

repressor function of Vp 1 (Hoecker et al,, 1995). The B3 domain by itself can bind to the Sph-

element of C 1. The role of ABA in the action of VPl and AB13 is stiii unclear. AB13 has been

postulated to be a developmental factor which renders cells comptent to respond to ABA or it may

act as a shared component in both ABA signal transduction and seed maturation (Bonetta and

McCourt, 1998).

Epistatic Interactions Between ABA mutants

abal and abi3-I mutants by thernselves are not defective in seed morphology but the

double mutant is green and dessication intolerant like the severe abi3-6. Thus, a lack of ABA

magnifies a defect in ABD. Does ABA have a direct role in seed development?

fus3 was isolated as a non-dormant mutant which retained sensitivity to ABA, showing that

dormancy is mediated by ABA-independent as weli as ABA-dependent factors (Keith et al., 1994).

FUS3 mutants like AB13 mutants are dessication intolerant. However, the fus3 mutation results in

leaf-like CO tyledons, similar to the lecl mutant. FUS3 also encodes a VP 1/ABI3-like B3 -domain

transcription factor (Luerssen et al., 1998).

The genetic relationships between ABA insensitive mutants and FUS3 and LEC1 have k e n

investigated by constructing double mutants (Parcy et al.. 1997). In these studies, Abil fus3 is

more dessication intolerant than abi3 fus3 suggesting that ABII and FUS3 are additive and may

fûnction in different pathways, while AB13 and FUS3 may be involved in similar pathways. This is

supported by studies which argue that FUS3 and LEC1 act upstream of and activate the expression

of AB13 (Parcy et al., 19%).

Double mutants were made between different ABA-insensitive aileles to see whether they

could enhance each other. Enhancement would indicate an additive efflect, while non-enhancement

would indicate that components are in the same pathway (Finkelstein, 1994). These results are not

very concf usive, since such epistatic anaiysis should involve the use of nul1 aileles, and the

phenotypes assayed should be distinct. Interestingly, no combination of weak abi mutants resuIts

in a phenotype iike the severe abi3-6 or the immunomodulation of ABA.

Conflicting results as to whether abi3 and abil are in similar pathways were provided by

constitutively expressing AB13 (Parcy and Giraudat, 1997). These plants were able to accumulate

SSP proteins in response to ABA, but this effect was blocked by the abil mutation, suggesting that

ABIl acts genetically downstream of ABU. However, overexpressing ABU in an AbiI

background restores sensitivity of guard celis to ABA, suggesting that AB13 is downstream of

ABIl. Thus, the epistatic relationship of the two still remains to be clarified.

The eral Supersensitive Mutant

eral was isolated as a mutant that is supersensitive to ABA (Cutler et al., 1996). The

concentration of ABA used is at least tenfold lower than that used in insensitivïty xreens, and is

therefore closer to the sensitive range before saturation by exogenous ABA used in some of the

ABA-insensitive screens. This screen was intrinsicdy sensitive, since the signalling pathway was

selected for a better and not a worse response. The mutant eral seeds are hyperdomant, consistent

with the proposed role of ABA in promoting seed dormancy. They are supersensitive at 0.3 p M

ABA. Guard cells do not open fully and appear to show increased closure sensitivity to applied

AB A (Pei et al., 1998). This vegetative phenotype is also consistent with a proposed role for ABA

as suggested by ABA auxotrophic and abil and abi2 mutants. Unexpectedly with respect to ABA

regulated processes. eral mutants show defects in adult plant development. eral-3 siliques are

curved, apical dominance seerns to be increased, it bolts and grows slowly, it has premanirely

opened flower buds and sometimes fasciates @. Bonetta. pers. Comm). Moreover, cytological

examinations have shown eral mutants have a bigger meristem than wild-type. Some of these

phenotypes are enhanced in short day conditions. suggesting a role of light in these processes. The

ERAl wild-type gene has been shown to encode the B-subunit of a farnesyl transferase. This

enzyme. which has been studied in yeast and animal ceiis, has been shown that as a heterodimer

with the a subunit, ad& a lipophilic 15 carbon-chain to target proteins containing a C-terminal -

CAAX motif, where C is a cysteine, A is an aiiphatic residue, and X can be a variety of amino acids

(Schafer and Rine, 1992). Plant B subunits of farnesyltransferases have an acidic domain not

found in yeast or mammalian counterparts, and cannot substitute for yeast B subunits without the

plant a subunit. This implies that although the function is conserved, the manner in which it is

carried out may differ. Interestingly, in yeast the a subunit is shared with the B subunit of

geranylgeranyl transferases, which aiso transfer a lipophilic group to proteins with a sequence

sirnilar to the -CAAX. It has k e n shown that there may be some redundancy of these two

enzymes, with FTases recognizing GGTase targets, and vice versa. GGTases can also sometimes

transfer farnesyl groups as weU as geranylgeranyl lipid groups (Trueblood et al., 1993).

The ABA-sensitized background of eral mutants provides a useful genetic background to

develop new ABA sensitivity screens. The ABA sensitivity of the eral deletion allele could be

suppressed by second site mutations elsewhere in the genome. Such a screen may not ody

uncover new genes involved in ABA signalling, but may also identify targets of the ERAl faf~lesyl

transferase. This thesis involves the use of suppressor analysis of eral.

Pseudorevertant Analysis Once a mutant has k e n isolated, cloned and phenotypicaliy characte~ed, the next question

is how it interacts within a given developmental pathway. Recombinant DNA methods such as the

yeast 2-hybnd or phage display systems or biochernicd techniques such as affinity columns can

be used to detect protein interactions between a gene of interest and its potential target. The

inevitable problem is that one dways detects false positives with these systems, because they are

inherently arti ficial. The y do not accuratel y reflec t the intricate genetic, phy siologicd and

environment-sensitive balances of a Living plant.

Pseudoreversion is the reversion of a mutant phenotype back to the wild-type and this

genetic analysis is a powerful tool in uncovering a developmental pathway. Weli before the advent

of the aforementioned techniques for detecting interactions between gene products,

pseudoreversion analysis was used to dissect sequentiaiiy acting genes in developmental pathways

in bacteria (Jarvik and Botstein, 1973) and yeast (Moir and Botstein, 1982). Psuedorevertants are

also useful to idenrifv new mutations in known genes as weli as identifjring new genes.

Pseudoreversion readily occurs with many mutants and c m occur in four ways. The first is by

intragenic suppression, where a second mutation in a mutant gene can compensate for the original

mutation, and uius restore wiid-type function. If searching for genetic interactors, intragenic

suppression is undesireable, and so deletion mutants are suppressed in the hope of reversion

occurring in either of the two remaining ways. The second type of suppressors is bypass

reversions, which occur when there is a compensating mutation in a gene involved in a pathway

parailel to the one containhg the suppressed gene. The bypass mutation causes the wild-type

phenotype to be expressed by the activation of another developmental pathway distinct fiom the

original one k i n g studied. Possible molecular rasons for this include the suppressor gene king

highly homologous to the suppressed gene, or that it may be a gain-of- function mutation which

activates a new compensating pathway. Bypass mutations should by their very nature of activating

a parallel pathway, suppress al1 de les (except for dominant gain-of-function aileles) of the

pseudoreverted gene, and is therefore gene-specific and aliele non-specific. The third and most

usefiil type of pseudorevertants are interaction suppressors. These are mutations which occur in

genes coding for proteins that interact directly with the suppressed gene product. These mutations

compensate for the lack of functioning of the suppressed gene by causing conformational changes

causing activation of the devefopmental pathway in question. Thus, interaction mutations are gene-

specific and allele-specific. The fourth type of suppressor is a mutation in a gene downstream of

suppressed gene which has the opposite effect on the pathway as the suppressed gene. For

example, if the suppressed gene when wild-type, acts as a positive reguiator of the pathway, then

suppressing a loss of function allele of it would identify factors that act negatively when wild-type.

Once a suppressor mutant is isolated, it c m then be distinguished as one of these four types of

suppressors using genetic tests: mapping would determine if it were intragenic; if it suppressed ail

aileles of a given gene it would suggest that it was a bypass mutation, and if it did not then it would

be an interaction suppressor or a downstream suppressor.

Once a suppressor of a given gene has been found, the normal function of it needs to be

determined. However, since by defintion its phenotype is wild-type and always relative to the

suppressed gene, it is difficult to isolate it. The solution for this problem in bactena and yeast

(Jarvik and Botstein, 1973) has been to select for suppressors which in addition to the suppression

phenotype also have a phenotype of their own which exists independently of the suppressed gene.

Ln the study of P22 morphogenesis, suppressors of a cold sensitive (CS) mutation were selected,

and some of these were dso found to be temperature sensitive (Ts) (Jarvik and Botstein, 1973).

These Sup/Ts mutants were easily geneticaily analysed by virtue of the recessive Ts phenotype,

which could be used to select for homozygotes and for the isolated suppressor mutations and also

used in complementation tests. In a similar study of yeast ceii division cycle (cdc), suppressors of

a CS mutation were themselves Ts (Jarvik and Botstein, 1973). The Sup/Ts mutants were recessive

for temperature-sensitivity, but dominant for suppression.

Dominant interaction suppressors with a phenotype of their own are intriguing, because

these are probably very specific to the pathway of the gene king suppressed. Dominance of a

suppressor indicates that the flux of the entire pathway c m be changed simply by changing the

amount of the suppressor by 50%. By analogy to the activated Ras screen used by Rubin in

Drosophila (Karim et al., 1996), eral c m be considered a "sensitized" background. Rubin used

an allele of Ras whose expression was constitutive and restrîcted to the eye causing a rough eye

phenotype, which is non-lethal to the fly. Thus, the RadMapK pathway was constitutively active.

In order to isolate components of this pathway that may be essential and therefore Lethal when

homozygous, he reasoned that screening in this constitutively active and sensitized background

should detect critical components of the pathway in which a twofold reduction (ie mutation of one

copy) would alter the signalhg efficiency and thereby visibly modify the rough eye phenotype.

That is, dominant suppressors of a sensitized pathway should reptesent factors cnticd to that

pathw ay .

Therefore, the reasons for searching for pseudorevertants of eral are: 1) To idenw

possible targets of famesyl transferase; 2) To assess whether eral is specific to ABA signalling; if

it is. then suppressing its seed phenotype should also suppress its adult phenotypes; 3) To take

advantage of the Iow concentration of exogenous ABA needed for selection which is closer to

endogenous concentrations; this may select for a new spectnim of mutants involved in maximal

sensing of the hormone.

Materials and Methods

Growth Conditions AU seeds used were in a Meyerowia Columbia (MCol) background. MCol was used as the

wild-type. In experiments involving mutants from other ecotypes, the appropriate wild-type, usually

Landsberg erecta, was used. Seeds were surface sterilized by irnrnersing in 95% ethanol for 15-20

minutes, removing the ethanol and vacuum drying for 10 minutes to remove the ethanol.

Seeds were imbibed on Petri plates containing 0.8% agar supplemented with l.lg/L

Murashige and Skoog (MS) basal culture salts (Sigma Chemicals) buffered with 50mM

morpholinoethanesulphonic acid (MES) (Sigrna Chemicals) pH5.7 and chilied at 4OC for 4 days

to break dormancy. These were then moved to growth shelves at room temperature and illurninated

with approxirnately 200 pE m-2 s- lof iight. Germination was scored d e r 4 days. Abscisic acid

(ABA) was added to the agar at appropriate concentrations from a lOmM stock in methanol, which

was good for 2 weeks.

In cases where selection was not necessary, d e r sterilization seeds were dispersed and

chilied in 1 rnL of 0.2% agar (Sigma Chemicais) in Eppendorf tubes.

Seedlings from plates or seeds in 0.2% agar were transferred to a standard autoclaved soi1

medium containing equal parts of vermiculite. perlite and sphagnum and sanuated with 1gL of a

20-20-20 standard nutrient solution in water.

Plants were usually grown in continuous light. For branching measurements a long day

cycle (16 hour light) was implemented. In di cases illumlliation was at 200 pE m-2 s-1 at 220C

and 50% relative humidity.

Suppressor screen of eral This screen was performed by Dario Bonetta 15 000 erai-2 seeds were mutagenized with

0.25% EMS and 20 000 eral-3 seeds were mutagenized in 0.2% EMS for 16 hours and

immersed in distilled water over the course of 7 hours. Seeds were then chilled at 4 OC for 4 days,

and planted in pools of 30-350 seeds per pot for a total of 27 pools of eral-2 and 30 pools of

eral-3 (Figure 1). M 2 seed was hamested from each pool. 500 seeds per pool were screened on

0.3m ABA agar plates. 202 putative suppressors were picked as germinators afier 2 days and

transferred to soil. M3 seed was hanrested per M2 plant and retested on 0.3 pM ABA by chilling

for 4 days and scoring germination after 2 days. 197 iines retested- Two-thirds of these were

suppressors of eral-3, and the rest were suppressors of eral-2. That there were twofold more

suppressors of eral-3 than eral-2 was due to the higher and thus more toxic concentration of

EMS used to mutagenize eral-2 in addition to the lower number of eral-2 seeds mutagenized.

Determination of Hormone sensitivity ABA was used in Petri plates at appropriate concentrations ranging fkom 0-50pM. Seeds

were steriiized and plated and scored, imbibed and chilled at 4oC for 4 days at which time they

were pIaced on a growth shelf to dlow germination to occur- Germination was scored as the

number of seediings that had green, expanded cotyledons as compared to control plates.

Genetic Analysis In al1 F2 tests, 150-350 seeds were analysed.

Backcrosses to wild-type

Suppressor lines were backcrossed to MCol once. F2 seed was analysed to determine:

1) whether the suppressor mutations were single (standard mendelian ratios)

2) whether they suppressed eral in a dominant or recessive manner, as determhed by germination

ratios on 0.4w ABA. Dominant suppression would be indicated by a ratio of 15: 1 whüe

recessive suppression would be represented by a 13:3 ratio.

3) whether the ABA insensitivity observed in some h e s was dominant or recessive, as determineci

by germination ratios on 3pM ABA. Recessive insensitivity would be indicated by 1:3 ratio, while

dominant insensitivity would show up as a 3: 1 ratio.

Backcross to parent

Suppressor M4 Lines were crossed to eral-2 or era 1-3, depending on which was the parent,

to determine whether it suppressed eral in a dominant or recessive rnanner.

Ailelism Tests

Complemen ta tion

Suppressor M4 lines were reciprocaily crossed to each other to determine whether they were

aiielic to each other. Instead of the usuai testing of FI. lines were tested for alleiism at the F2 stage.

Non-complementation would then be indicated by 100% germination on 0.4pM and 3p.M ABA.

Cross to abi 3, abi4 and ab5

Suppressor M4 iines were crossed to abi3-l. abi4 and abi5 to test for aüelism. Again,

because of the few F1 seed avaiiable, F2 seed were analysed on MS and 3pM ABA plates.

Mapping Suppressor lines were crossed to Ler for SSLP mapping (Beii and Ecker. 1994). Lines 13-

2202 and 13-2903 were mapped by selecting for F2 seeds which germinated on 3pM ABA. DNA

was extracted from these seedlings and subsequently used in PCR reactions with SSLP rnapping

primers. Table1 shows the mapping pnmers used. PCR conditions were 94OC 3 mins for 1 cycle,

followed by 40 cycles at 9 4 ' ~ 30 secs, 54OC 30 secs, 70°C 30 secs and 1 cycle at 7 0 ' ~ for 3 mins.

Table 1

Primers used for sequencing of a6i3-20.

The abi.3-20 gene was divided into 2 regions, each of which were sequenced independently. F' indicates forward prïmers R' indicates reverse pnmers

f Primer Name 1 Direction 1 Seauence (5'.....,..... 3') 1

AB13-P2 -13-6JG AB 13-7 JG ABI3-208

F ' F' F'

I

ABI3- 1 R' ABD-ZR'

CATGCCGCCAACCTCGC GCTTC'ITGGGCTATA CAACAAGATCCATTTCA

F '

Primer Name ABI3-211

1 ABI3-P6 I

1 F' 1 CTGATTATGATGCTAACAT 1

GATGGAGAATAACAGTG

R' R'

GACGATTGCGTTGACAGGAG 1

GCCAATACATCCAGGTCCCT ABI3-257

CGTTGGCCGCCACATGCAAG CAGGTTTGGTCGGACGGTGG

Direction

F' CAATGGGCTCCAAGAAGGT GCCGGCAGGRAGACATGC AAGGTTCAATGTTTGTGTA

SS2' AB 13-P4 ABI3-P5

R'

Sequence (5' ........... 3') AACGCATGGCGAGACAGAGG

F' F' F'

b

ABD-210 I R'

ABI3-F7 ABI3-4R' ABI3-3R' ABI3-212

F' R' R' R'

TTGTTGTGGACGCATA CGTACCGGTGTTCTCGAGGA

I

GGAAAGCAAAGGCTACAAGA TGCACGAGAAGTGGCACACT

Seed Fatty Acid Composition 50 mg of seed were weighed into 50 rnL screw cap Pyrex tubes. 1mL of I 1 .SN HCl: 1

CH30H was added- These were microwaved on power 5 for 2 mins at which point the tubes were

cooled briefly and vortexed, This was repeated twice but microwaved for just 1 min- 100 pL of

78nmol C-15, 0-5 mL of ddH,O and 1mL of hexane were added and the contents vonexed for 2-

3mins. They were then centrifuged for 10 mins at 2000 rpm. 0,5mL of the supernatant containing

the seed fatty acids were placed in GC tubes and subjected to GC andysis. The raw data was then

converted to percentage of total fatty acids-

Whole Plant Measurements Branching

Plants were measured when they begm to senesce, which in long day conditions was at 5

weeks of age. The number and length of stems, and paraclades on the main stem, were measured.

At this time, plants were also placed into sheet protectors and photocopied to obtain a silhouette.

Rosette and cauline leaf number

Plants in short day conditions at the age of 70 days were used for this. In order to keep

track, leaves counted were marked with a permanent marker.

Molecular Biology Sequencing Strategy of abi3-20

The AB13 gene was divided into 2 regions, 1 and 2. Forward and reverse PCR primers were

synthesised for eac h of these regions. For region 1, primers ABI3-SS 1 ' and ABU-2 10 were used,

and for region 2, ABU-2 1 1 and ABU-2 12 were used to PCR fragments of L -64 kb and 1.59 kb

respectively. The PCR conditions for aU reactions were 1 cycle at 9S°C for 3 minutes, foiiowed by

950C for L minute, 56OC for 1 minute and 700C for 1.5 minutes for 30 cycles. and then 700C for

5 minutes. 1 % agarose gel fragments containing these bands were punfied using the Qiaquick Gel

Purifkation Kit (Qiagen), and the DNA was resuspended in 30pL of ddH20. Fragment

concentrations were gel quantitated and checked that they worked as effective templates in a PCR

reaction involving one sequencing primer and one of the reverse primers iisted above. First pass

sequencing was at the DNA Sequencing Facility at York University and second pass sequencing

was at the DNA Sequencing Lnb at Queen's University.

Northern Analysis

RNA was isolated frorn seeds by grinding 50mg in 500pL of Extraction Buffer (1M Tris

pH9.0, 1% SDS) and 5ûûp.L of phenol with a mortar and pestie for 10 minutes. The emulsion was

transferred to an Eppendorf tube and vortexed until ail samples were ground. This was then

centrifuged at 13 000 rpm for 3 minutes, the supematant extracted and mixed with an equal volume

of phenol:chlorofonn (1: 1 mixture v/v), centdüged and re-extracted. This was repeated twice. To

250pL of supematant, 200 pL of 4M LiCl was added, mixed and RNA was precipitated at 40C

overnight. Samples were centrifuged at 13 OOOrprn for 20 minutes, the pellet

was rinsed with 2M LiCl followed by 70% ethanol. The peiiet was resuspended in 30 pi, of

ddH20, centrifuged for 20 minutes at 15 000 rpm and the supernatant was kept.

Northern analysis was performed üsing standard methods (Sambrook et ai., 1989). RNA

was denatured with formanide and fomaldehyde, ethidium broMde was added to the samples

which were electrophoresed on a denaturing fomaldehyde 1.1 % agarose gel in lx 3-(N-

morpholino)propanesulfonic acid (MOPS) (Sigma Chemicals) buffer. Quantitation and equal

loading of RNA was by visualizing the amounts in the gel by UV illumination. The RNA was then

capillary transferred to Hybond N+ niuoceiiulose (Pharmacia Bi0tech)i.n 1 OxSSC after

denaturation of the gel in 0.05N NaOH. RNA was crossiinked to the membrane by exposing to

W light. Blots were probed using non-radioactively labeiied DNA and washed under stringent

conditions. The probe was labeiied and detected using the Ambion BrightStar kit according to the

manu facturers instructions.

Southern Analysis

DNA was extracted by grinding 1 4 fresh or frozen young green leaves (or one seedling) in

an Eppendorf tube, then adding 250pL of DNA Extraction Buffer (2% CTAB

(hexadecyl trimethy laznmoniumbromide) (Sigma Chemicals), 1 -4M NaCI, 0.02M EDTA, 0.1 M

Tris pH8.0 + 1pL B-mercaptoethanoV250pL)- The samples were incubated at 60°C for 30

minutes, cooled to r o m temperature, and then 250 pL of cMorofom:isoa~lalcohol(1: 1 v/v) was

added, vortexed and the mixture centrifuged for 5 minutes at 13 000 rpm. The supernatant was

collected. 0.75~ volume of isopropanol was added, and the DNA was allowed to precipitate at m m

temperature for 20 minutes. DNA precipitation was standard. The mixture was centrifuged, the

pellet rinsed in 70% ethano1,dried in a vacuum centrihige for 2 minutes and resuspended in 15 & of ddH20.

Southern andysis was according to Maniatis et al. DNA was digested with EcoRland

electrophoresed on a 1% agarose gel. The DNA was d e p u ~ a t e d by soakùig the gel in 0.25N HCI,

then denatured in 1.5M NaCI, 0.5N NaOH followed by neutraikation with 1M Tris pH7.4, 1 SM

NaCI. Capillary transfer to Hybond N+ was done in 20xSSC. Both radio- and non radio-labelled

probes were used to hybridize to the blots.

Dessication Tolerance Measurement The method is after Pei et al 1998. Three lines were used: MCol, eral-3 and abi3-20 eral-3.

AU seeds were chilled for 1 week. eral-3 was planted 1 week ahead of MCol and 8 days ahead of

abi3-20. Pots of 9 mm in diameter were filled with 8 lg of Pro-& that had been wetted and

supplernented with 1g/L 20-20-20 nutrient salts. Aluminum foi1 squares (15 cm x 15 cm) were cut

and punctured through the centre with a pencil. These were used to cover the pots and secured with

a mbber band. Seeds were planted into these holes and grown in constant light. They were thinned

to 1 plant per pot. Plants were selected which were at the sarne developmental stage and had the

same number of rosette leaves. Just before bolting, at about three weeks of age. irrigation was

ceased, and at least six of each plant were weighed at the same t h e over the course of 20 days.

Controls of at Ieast one irrigated plant of each line, and pots with no plants were used to determine

the growth rate over the time malysed andthe rate of water loss from the soi1 alone. After 20 days,

all pots were dessicated completely in an oven at 500C for 1 week, and weighed again to detennine

the combined weight of soil, pot and plant. The plant weight was determined by subtracting the

weight of the dessicated control pot and soil alone. Water loss was calculated as a percentage of

total water loss.

RESULTS

Suppressor Screen of eral Mter initial identification as diagrammed in Figure 1, the suppressor lines were then plated

on a gradient of concentrations of ABA to determine the degree of suppression of eral. 15-30

seeds per Line were analysed. Concentrations of 0.3,0.6 and 1.2m ABA were used by D.

Bonetta Wild-type germination is permitted at concentrations of ABA lower than 1.2w ABA. A

line is considered to be insensitive to ABA if it germinates on a concentration higher than chis, and

usually 3p.M ABA is the standard concentration used to test for insensitivity. Of those that could

tolerate up to 1.2pM ABA, 1 determined whether any were insensitive to ABA by plating these on

3pM ABA. Table 2 shows 124 suppressor lines and the highest concentration of ABA on which

each line can germinate. Eight lines that suppressed eral-3 at 0.3p.M ABA are also insensitive to

ABA at 3pM ABA. These lines were chosen to continue further work on because they had a

phenotype that was distinct from the eral parent but also distinct fiom the wild-type, narnely their

insensitivity to ABA, which was useful for the purposes of subsequent genetic analysis. This

group was termed "ire" for ABA insensitive ~ver tants of gral.

ABA Insensitivity of ire mutants To compare the germination patterns of ire mutants with known ABA response mutants and

wild-type, germination assays of ire mutants were performed on concentrations of ABA ranging

from O to 3pM ABA (Figure 2). The germination Frequency of Abil-l and abi3-l are not 100%

on Oph4 ABA. For Abil-I seed, this may reflect seed age, since this particular seed lot was three

years old. However, the abi3-l seed used was l e s than one year old, Because the mutation in the

ABD gene reduces dessication tolerance, the 84% germination rate may reflect the dessication

intolerance of the seed lot. One suppressor, 13-0404, also exhibits to the same extent as abi3-1,

this incomplete germination on MS, suggesting that it may be dessication intolerant.

Figure 1 Schematic of the suppressor screen of eral

MI seed

eral seed are mutagenized (Ml)

?!!!!El fm?7 Ml seed planted in pools

M2 seed

4 M2 seed harvested in pools

Plated on 0.3pM ABA

Germinators planted

M3 seed 1. arvested fkom individual plants

M3 seed retested on 0.3pM ABA

Table 2

Resistance of era 1-2 and eral-3 suppressors to ABA.

The ability of eral suppressor M3 seeds to gemiinate on concentrations of ABA ranging from

0.3pM to 3p.M was tested, and resistance was defmed as a germination fiequency of 125%.

Suppressor lines and the highest AB A concentration on which they can genninate shown.

Suppressor hes in bold have k e n designated ABA-insensitive revertants of wl( ire) .

Resists [ABA] UM 1.2 1.2 , 1.2

1.2

Suppressor

13-1 5 0 8 13-1 601 13-1 6 0 2

-1.2 13-1 6 0 6

Resists [ABAI ciM 1.2 1.2 1.2

Suppressor

MCd era 1-2 era 1-3

12-031 O 12-031 5 12-0702 12-0704 12-0721 12-0809 12-081 O 12-081 2 12-081 3 12-090 1

-12-O903 12-0904 12-1 305 12-1 705 12-1706 12-2002 12-2004 12-2005 12-201 3 12-201 6 12-2017 12-2202 12-2206 12-2207 - ,

12-2603 12-261 3 12-2615 12-2616 12-261 7 12-271 3 12-OC1 0 12-OC1 1 12-OF02 12-OF05 12-OF07 12-OF09

Resists [ABA] PM 1.2 c0.3 c0.3

12-01 05 12-01 12

13-1 6 0 7 11.2 13-1701 10.9 1

13-1 7 0 4 10.9 1

13-1 7 0 7 10.9

Su ppressor

13-0301 13-0304 13-010s

0.9 1.2 0.9 0.9 O -9 0.1 5 1.2 0.9 1-2 1.2 1.2 1.2 1.2 0.6 0.9 1.2 ,

0.3 0.6 1.2 0.6 1.2 1.2 1.2 0.9

13-1708 13-21 0 2 13-21 0 3 13-21 0 6 1 3 - 2 2 0 1 .

1 3 - 2 2 0 2 13-2203 13-2205 13-2206 13-240 1 13-2402 13-2404 13-2407 13-2603 13-2604 13-2605 13-2606 13-2608 13-2609 13-2610 13-261 1 13-2613 13-2614 13-2701 13-2702 13-2801 13-2802

1.2

11.2 1

0-9 ,

1.2 ,

1.2 1

3 . 0 3 .0 1.2 1.2 ,

0.9 1.2 1.2 1.2 0.9 1.2 1.2 0.9 0.9 1.2 0.9 1.2 0.9 O -6 0.9 J

1.2 1.2 1.2 O .6

1 3 - 0 3 0 5 13-0306 1 3 - 0 4 0 1 1 3 - 0 4 0 2 1 3 - 0 4 0 3 1 3 - 0 4 0 4 13-0406 13-0602 13-0603 13-0604 13-0605 13-0607 13-0608 13-0609 13-0702 13-0707 13-07 0 8 13-0709 13-1 O01 13-1 0 0 3 13-1 0 0 4 13-1 005 13-1 0 0 6 13-1 0 0 7

3 . 0 0.9 3 . 0 3 . 0

. 3 , 0 3 . 0 1.2 1.2 0-6 1.2 1.2 1.2 1.2 1.2 1.2 1.2 1.2 0 -9 1.2 0 -9 0.9 1.9 1.2 1.2

13-0107

13-2901 0.9 A

0.9 1 -2 0.6 1.2 1.2

11-2

1.2 0.9

1.2 1.2 1.2 1.2 1.2 0.9

13-2902 1 3 - 2 9 0 3 13-2904 13-3003

13-1 0 0 8 13-1010 13-1101 13-1 102 13-1 1 0 4 13-1 1 0 7

0.3 3 . 0 1.2 1.2

1.2 1.2 1.2 1.2 1.2 1.2

13-3004 10.6 13-OC07 11.2

13-1 108 11.2 13-1 2 0 2 11.2 13-1 301 11.2 13-1 305 13-1 306 13-1 405

1.2 1 -2 1.2

13-1 5 0 2 ,1 .2 13-1 5 0 2 10.9

Figure 2 ABA dose response vs germination frequency of ire mutants.

* MCol

eral-2 - era 1 -3 - abil-1 - abi3-1 - 13-0305 - 13-0401

-- 13-0402 - 13-0403 -t- 13-0404 - 13-2202

13-2903

0.0 0.5 1 .O 1 .S 2.0 2.5 3 .O 3.5 Concentration of ABA (pM)

Wild-type germination decreases rapidiy between 0.6 ph4 and 1.2 pM ABA, and is

completely inhibited at 1.8 pM ABA. eral-2 and eral-3 curves are shifted to the left of MCol,

and germination is completely inhibited at 0.6p.M ABA. Abil-l and abi3-l germination is not

affected by ABA, and thus the curves are shifted to the nght of MCol. The responses of iines 13-

0305, 13-0402, 13-0403 and 13-0404 are similar to the Abil-I and abL3-l curves, as they do not

respond to AE3A at least up to a concentration of 3pM. 13-0401,13-2202 and 13-2903 are

inhibited by and therefore respond to ABA, since their curves are not completely flat but dope

downwards by 3pM ABA. in this assay, 13-2202 is the rnost responsive to ABA.

ire Mutants are Dominant for Suppression of eral, but Recessive for ABA Insensitivity

For the foiiowing results sections, ire mutants were intercrossed, crossed to eral-3 and

MCol, and to other ABA insensitive mutants. F2 segregation anaysis was used, as F1 seed was

often few in number. FI seed was germinated on MS plates to m o ~ t o r their viablity, and the

seedlings transferred to soil. F2 seed was harvested from separate F1 plants, and stored at least 1

week post-harvesting before analysis. For these analyses, two phenotypes were assayed based on

different concentrations of ABA. The fmt was the suppression of eral-3, which was scored by the

germination frequency on 0.3 or 0.4 p M ABA. The second was the insensitivity to ABA which

was defined as the ability to germinate on 3 p M ABA.

Crosses to eral

F2 seeds were stedized, then chilied and irnbibed for 4 days on MS, 0 . 3 w ABA and 3 @

ABA plates, and moved to iiluminated germination shelves. Germination was scored after 4-5 days.

As the results of the suppression analysis on 0.3pM ABA show in Table 3a, suppression of eral

was controiled by a single dorninantiy acting gene in each of the lines tested. In the case of 13-

0404, the number of non-gemiinated eral seeds (tçlee) was lower than the 1/4 expected for

simple Mendelian inheritance. This suggested that the F1 maternal mutant d e l e of 13-0404

partiaily masked expression of the supersensitive phenotype expected of M (++/ee).

The ASA insensitivity test of Fm seeds on 3pM AE3A (Table 3b) dso cornes short of the

expected 1/4 germination frequency in 13-0404. Furthemore, the other 3 mutants tested also show

a reduction of the recessive class, suggesting that fiil1 expression of ABA insensitivity was king

masked perhaps by the homozygous embryonic eral-3 mutation. Although not testeci, it appears

that the 13-0404 suppressor mutation dominantiy and matemally affects the supersensitive

phenotype of eral-3 homozygotes. However, the 13-0404 homozygous mutant seed was affected

by homozygous embryonicaüy acting eral-3. No such maternal suppression effect was seen with

13-0403. 13-2202 and 13-2903 mutations, which dominantly suppress era 1-3. However, like with

13-0404, eml-3 also seerns to impinge upon the hornozygous recessive expression of these

mutations.

Crosses to MCol

Harvesting, preparation and plating of F2 seeds was as for the crosses to eral-3. On 0.4pM

ABA, 2 lines, 13-0404 and one non-insensitive line, 12-08 12, show the 15/16 germination

frequency expected for dominant suppression of eral (Table 4a). Four lines, 13-0305, 13-042,

13-0403 and 13-220 1 do not segregate supersensitive seed, suggesting a dominant maternai effect

on eral-3 expression of either the suppressor mutations or both suppressor and eral-3 mutations.

On 3jM ABA, 13-0305 and 13-0403 conferred ABA insensitivity in a homozygous

recessive marner (Table 4b). 13-0402 conferred ABA insensitivity semi-dominantly. 13-0404

seemed to confer insensitivity recessively, but this insensitivity was affected by the genetic state of

ERA 1. 13-220 1 and 13-2903 may confer insensitivity recessiveIy, but this expression may also

have been masked by eral-3.

Table 3

F2 segregation analysis of ù e mutants crossed to the parent, eral-3

a) F2 progeny were assayed for germination on 0.3pM ABA, on which eral does not germinate.

b) F2 progeny were assayed for germination on 3 pM AB A, on which oniy AB A-insensitive lines germuiate.

Mutant 1 Ratio of Geminated 1 Segregation Pattern 1 ~2 for 3: 1 1

127:45 1 Dominant 1 0.16 I 1 134404 [ 172:32 1 ~ominant 1 9.44 I 1 13-2202 1 18758 1 Dominant 1 0.23 1 1 13-2903 1 150:45 1 Dominant 1 0.38 1

25:220 1 Recessive 1 21.45 I 1

Ratio of Non- germinated to

genninated seeds

30:209 Recessive 1 12.63 I 22:2 15 1 Recessive 1 25.00 1

Segregation pattern

33:204 1 Recessive 1 20.60 1

~2 for 1:3

Table 4

F2 segregation analysis of ire crosses to Md-type Mc01

a) F2 progeny were assayed for germînation on 0.4m ABA on which eral does not germinate

b) F2 progeny were assayed for germination on 3p.M ABA on which only ABA-insensitive iines germinate

Mutant 1 Ratio of germinated: 1 Sepgaiion pattem 1 x2

Matemal Dominant - Matemal Dominant 1 -

m I 1 13-0403 1 2273 1 Matemal Dominant 1 - 1

1 13-2201 ( 316:O 1 Matemal Dominant 1 - I 1

1 28 1/299 1 28 1:28 1 Dominant 1 0.032 1

Mutant Ratio of germinatedmon- fierminated seed

68:215 86:68 47: 120

Semi-dominant Recessive (1:3) 0.67 Recessive (1:3) 1 0.2

1

ire Mutants Fa11 into 3 Complementation Groups ire M5 lines were intercrossed and the F2 seed plated on MS and 3p.M ABA. 100%

germination on 3pM would indicate that the genes were allelic, since it was determined h m the

backcrosses that AB A insensitivity was inherited recessively. There appears to be at least 3 distinct

complementation groups, group 1: 13-0402, 13-0403 and 13-0404, groupII: 13-2202 and group

III: 13-2903 (Table 5). Because 13-0305 was not crossed in aü combinations, it was not assigneci

to a grouping.

13-0404 is an Allele of AB13 Crosses to abi3-1, d i 4 and abi5

From previous double mutant analysis of eralAbil, it was known that eral was epistatic to

Abil (Sarah Cooney, MSc thesis). and therefore Abil was not expected to be isolated as a

suppressor of eral. This was cofimed for the ire mutants by determinhg if any of the mutants

contained the Abil or Abi2 polymorphism. In aii cases, the AB11 and AB12 genes tested wild-type

(data not shown).

Partial alielism tests were performed with 3 known ABA insensitive mutants, abi3-1. abi4

and abi5 by crossing ire mutants with these mutants and observing the germination fkequency on

3p.M ABA. As in the complementation tests, 100% germination would indicate aiielism. Partial

results shown in Table 6 indicate that 13-0404 is allelic to abi3-2, and therefore from the

cornplementation tests, 13-0402, 1 3 - 0 3 and 13-0404 are also new alleles of abi3-l. 13-2202 is

not an allele of ABI3-1, AB14 or AB15 thus defining a new ABA insensitive gene, whilel3-2903 is

not allelic to abi3-l or abi4.

Table 5

Complementation Analysis of ire mutants

ire M4 lines were intercrossed and the F2 seed was assayed for the ability to germhate on 3pM ABA. A germination kquency of 100% indicated non-complementation. ire mutants faii into three distinct complementation groups.

Complementation Analysis

Table 6

Allelism tests of ire mutants with abi3, abi4 and abi.5.

d i 5

d d d d +

d d

ire

13-0305

13-0404 13-2202 13-2903

abi3-1

+ -

d d +

abi4

dd d d + +

Seed Fatty Acid Composition of ire mutants In Adidopsis seeds, storage reserves are in the form of proteins and triacylglycerols.and

synthesis of several of a number of genes involved in storage accumulation have been shown to be

ABA-inducible (Fuikeistein and Somerviile, 1990). Mutations in the ABI3 gene affect the

accumulation of eicosanoic acid (20: 1), the major storage form in seeds. This effect is not seen in

Abil or Ab2 mutant seeds, and therefore a defect in the accretion of 20: 1 is a usehl marker of

ABU action. ire mutant seed fatty acid compositions were determined and shown in Table 7. ab3

mutant levels of 20: 1 are reduced approximately fourfold compared to wild-type levels. A similar

outcorne is seen in 2 suppressor h e s , 13-0402 and 13-0404, which have approximately threefold

less 20: 1 than MCol. Interestingly, eral-3 but not eral-2 has twofold less 20: 1 than MCol. 13-

0403 also has twofold less of eicosanoic acid. This data is in agreement with the complemeatation

and alielism tests which indicate that 13-0402, 13-0403 and 13-0404 are new aüeles of ABI3.

Expression of AtEm6 As with the accumulation of eicosanoic acid, the ABA-induced expression of the late-

embryogenesis abundant protein, AtEm6 is also reduced in ab3 mutants (Fiîelstein, 1994).

However, in contrast to iipid accumulation, this LEA protein is also diminished in abi4 and ubS

mutants (Fielstein, 1994). The simïlar AtEm6 expression patterns in these three mutant

backgrounds has led to the suggestion that ABU, ABM and AB15 are in the same signalhg

pathway. In order to assess whether any ire mutants were involved in this pathway, a seed

Northem was performed using ArEM6 as a probe (Figure 3). Relative to MCol and eral-3 13-

0402, 13-0403, 13-0404 and 13-2903 al1 have less amounts of AtEm6, again supporting

complementation, allelism and fatty acid analyses which suggests that group 13-2903 may be a

mutated in either AB14 or ABIS. whereas l3-û3OS, 13-220 1 or 13-2202, because of their high level

of AtEm6 expression, are probably not defective in either of these genes.

Table 7

Fatty acid composition of ire mutants.

Genolype Mc01 Ler abi3- 1 abi3-6 era 1-2 eral-3 12-0104 13-0305 13-0401 13-0402 13-0403 13-0404 13 -220 1 13-2202 1 3-2903

Figure 3

AtEM6 Northern of ire mutants.

ire mutants were probed with the seed specific marker, AtEM6. The lower panel shows the loading of RNA stained with ethidium brornide.

Sequencing of 13-0404

Fatty acid analysis, seed storage protein analysis and aiielism tests with abi3-l showed that

13-0404 is an ailele of the AB13 gene. In order to determine the exact nature of the mutation, the

abi3 gene of 13-0404 was sequenced. The 13-0404 mutation is due to a single GC to AT

transition at base pair position 3283 in exon 6, causing a missense mutation of an uncharged

glycine residue to the basic arginine. This residue is within the B3 domain (Giraudat et al., 1992),

which is thought to be involved in DNA binding as weii as dimerkation. Figure 4 shows

diagrarnmaticaily where the mutation has occurred in the protein, and shows the salient features of

the AB13 gene and protein. This new allele of AB13 has been titled "ubi3-20 ".

13-2202 Maps to Chromosome III 13-0305, 13-2202 and 13-2903 were crossed to Ler for F2 SSLP rnapping. 13-2903 Pl did

not germinate well, and is currently king propagated. The F2 of 13-2202 crossed to Ler was

rnapped using the markers indicated in Table 8. PrelimuIary results suggest that it is on

chromosome III possibty between g47 11 and AthGAPab. AB13 and AXR2 genes lie in this region,

but 13-2202 does not appear to be a mutation in either of these, as it complements abi3-l and has a

normal response to auxin as meaured by its root sensitivity to awcin as well as its gravitropic

response (results not shown). Further rnapping is necessary.

abi3-1 and abi5, but not abi4 are Epistatic to eraI-3 Crosses of eral-3 to abi.3-1, abi4 and abiJ

Since an allele of abi3 (abi3-20) had k e n found as a suppressor of eral-3, an important question

emerged - was the suppression of eral-3 by di3 aileie speciftc? This would give clues as to the

nature of the interaction between the two genes. The abi3-1 aliele used was originaily in a

Landsberg erecta background, but 1 crossed this allele into to MCol in order to reduce

Figure 4

Position of lesion of abi3-20 which was isolated as a suppressing mutation of eraA.3

DNA

lkb

Homdogyto f i z d basic - Wl

a d i c Nuclear Targeting signal - neuw Gln & Am rich region

Table 8

Mapping of ire 13-2202.

Lines tested were individual F2 progeny of 13-2202 crossed to Ler that were insensitive to 3 p M ABA SSLP mapping primes on chromosome 3 are indicated in italics. The numbers in brackets indicate the position of the primer from the top of chromosome 3 in centimorgans. C indicates a MCol aiiele. L indicates a Ler ailele.

III- NZTI (53 -8- 75.3) CC CC , CC CC CL a CC CC

a a CC a CC CL

1

CC CL CL LL CC CL

1

m - g4711 (53.8)

CC CC cc CC CC cc CC cc

cc CC cc CC a

, CC cc CC

CL a

LL

m- pmcabi3* (38 .O)

CC cc CC

cc

cc cc -IL CC LL CC cc CC CL CL CL

LL CL

m- AthGAPa b (62.7) CC CC cc CC CC cc cc cc a cc CC CC a CC CC CC a CL CL

III- NGAI62 (30.6)

CC CC CL CC CC CC CC

CC

CL LL CC CC CC a ‘IL 'CL - .

13- 2202xLer F2 abi h e #13 #14 #15 #16 #17 #18 #19 #20 #21 #22 #23 #24 #X #26 #27 #28 a9 #30 #3 1 #32 #33

III- nga172 (1.1)

CC CC CL

CC a CC

CC

CL LL CC CC CC a

l u #34 ICL #35

Table 9

Epistatic analysis between eral-3 and abi3-IC, ah4 and abi5

a) F2 progeny were plated on 0.4pM ABA on which ABA-supersensitive lines could not genninate,

b) F2 pmgeny were plated on 3pM ABA on which ouly ABA-insensitive Illies could genninate.

Mutant Ratio of Segregation Pattern Germinated:non germinated seeds

abi3-l 145:25 Recessive suppression ( 13:3)

abi4 52:35 Epistasis (9:7)

abS 102: 18 Recessive

Segregation Pattern

Recessive ABA insensitivity Recessive AB A insensitivity Recessive ABA insensi tivity

Mutant

abi3-l

abi4

abS

- Ratio of Germinated:non germinated seeds 30:60

15:111

55: 127

complications using different ecotypes in epistatic analyses with eral-3, and designated it a b 3 4 C.

As shown in Table 9a, eral-3 crossed to abi3-lC F2 seed give a 13:3 gennination:non-

germination ratio, which is characteristic for recessive suppression. The comparable cross with 13-

0404 gives a 15: 1 ratio, characteristic of dominant suppression. Therefore, regardless of which

AB13 allele is used, the results suggest that AB13 acts genetically at or downstream of ERAI.

The F2 of the cross of abS to eral-3 aiso gives a ratio characteristic of that for recessive

suppression, suggesting this gene also acts at or downstream of ERAL.

The F2 of the cross of eral-3 to abi4 indicates that there is an epistatic relationship

between these two mutations. However, unlike abi3-1C and abi5 mutants, abi4 does not

suppress eral -3, on the other hand, eral-3 appears to affect the phenotype of abi4 mutants as the

expected number of germinators for suppression is much reduced, with a concomitant increase in

the number of non-germinators.

To further study the genetic relationships of the above mutations, seeds fiom each F2 cross

were plated on 3pM ABA (Table 9b). Plating on this concentration of ABA assesses whether the

ABA insensitivity of the homozygous abi mutants is affkcted by the presence of erai-3. Only abi4

ABA insensitivity seems to be affécted byeral-3, which corroborates the epistasis result obtained

on 0.4pM ABA.

ire Mutants Suppress eral Vegetative Phenotypes

Morphology and Time to Flowering

Figure 5 shows plants germinated and grown in shon day conditions for 75 days. MCol

has just bolted and some panclades are beginning to elongate. The eral-3 mutant is lagging

behind in growth and has not bolted at this stageThe mutant leaves are flat and slightiy yeiiower

than MCol. AU ire mutants tested are suppressed for lagging growth and indeed are even more

advanced than MCol, as paraclades and rosette cofïorescences have elongated. AU

Figure 5

Whole plant phenotypes of ire mutants

Plants were grown in short day conditions for 75 days. The inset shows 3 eral-3 plants at 100 days old.

suppressor lines are very different in appearance from eral-3 at 100 days (inset, Figure 5), at

which time the wild-type architecture is deveioped enough to compare with the ire mutants. Lines

13-040 1, l 3 W 2 , 13-0403, 13-0404 and 13-2903 have many cauline and rosette leaves. 13-220 1

and 13-2202 are smaller and not very robust in these conditions.

Branching

As shown in Table10, the number of rosette coflorescences and the number of secondary

branches on the main stem of the eral mutunt are dramatically reduced compared to wild-type.

While there is no obvious pattern with the number of secondary branches, the number of rosette

coflorescences is decreased in eral-3 from 4 in MCol to 2 in eral-3. As with other vegetative

phenotypes, these branching defects of eral-3 are suppressed by aü ire mutants examined. Figure

6 represents this pictorially using silhouettes of plants at senescence that were grown in long day

conditions.

Inflorescence Architecture

eral-3 inflorescences have more buds compared to wild-type plants and charactensticaiiy,

many young buds (approximately stage 6- 1 1 according to (Smyth et al., 1990) are not tightly

closed. but instead are slightly open (Figure 7). This phenornenon is suppressed in 13-0305, 13-

0404. 13-2202 and 13-2903. The peneuance of this is variable in 13-0305 and 13-2903, and one

bud that is prematurely opened is seen in 13-2903.

Drought Tolerance

Because ire mutants can suppress many of the vegetative phenotypes of eral mutants, it was

of interest to determine if vegetative physiological responses of eral were also suppressed by ire

mutants. eral piants lose water more slowiy under conditions of drought In part, this reduced

water loss is due to the increased sensitivity of their stomates to closing induced by ABA (Pei et

al.. 1998). One ire mumt abi3-20, was tested for its ability to suppress the drought resistant

phenotype of eral-3. As shown in Fig 8. this mutant surprisingly c m suppress this specifically

vegetative phenotype of eral-3. and indeed seems to iose water siightiy faster than does wiid-type.

This provides more evidence for a rote of AB13 outside of the seed.

Table 10

Quantitation of branching of ire mutants.

Plants were grown in long day conditions and were 5 weeks otd. Results shown are an average of at least 5 plants. See figure 6 for designation of rosette and cauline paraclades.

Figure 6

Branching patterns of ire mutants.

Photocopied siihouettes of iremutants from above at 6 weeks old. RP indicates a rosette pamclade. CP indicates a cauline paraclade.

No. of rosette No. of cauline paraclades 1 1 paraclades

- - - - -

No. of nodes with -1

Figure 7

Inflorescence architecture of ire mutants.

Apical infiorescences were shown of plants gown in constant light.

Figure 8

Drought tolerance assay of 13-0404 (abi3-20)

The rate of water loss of 13-0404 is depicted relative to that of MCol and eral-3 as percentage of soi1 water content vs tbe len,oth of treatment without water.

Discussion

The goal of signal transduction dissection is to undentand the spatial and temporal

interaction of a cascade of gene products which lead to a defined state- A typical signai

transduction pathway consists of 3 components in addition to the Ligand: the receptor, the relays,

and the effectors. These various components allow for many control points and for reversibility of

the signal (McCourt, 1999). There are slight deviations of this such as in bacterial 2-compnent

systems or the marnmalian glucocorticoid receptor, where there are no intermediate relays (Bohen

et al., 1995; Pratt and Silhavy, 1995). Developmental pathways are not simple hear ones in plants

since the "defined state" is a convergence of many signals or ligands. Nonetheless, valuable

information about developmental pathways can be gleaned fiom analysis of the genetic pathways

and the mechanical pathways. The genetic parhway is defined by epistatic interactions and gives no

information on its own as to the molecular nature of the components involved. The mechanical

pathway is defined by interactions on a molecular level, and taken alone gives linle information as

to the placement relative to other components in the pathway. However, in combination these two

sets of information provides a usehl and true picture of a developmental pathway (McCourt,

1999).

abi3, abi4 and abi5 seed epistasis with eral

Epistasis is the masking of one phentoype by another. Strictly speaking, nuU aileles only

should be used. Furthemore, each phenotype should be distinct fiom the other (Avery and

Wasserman, 1992).

abi3-1 and abi.5 are epistatic to eral. This is suggests that they act downstream of erol,

which makes sense intuitively since ABU is a transcription factor. Thus famesyl transferase which

can be thought of as negative relay acts upstream of a VPl- like transcription factor, an effector.

AB15 also acts after ERA1, and it is possible that it acts at the same level as ABD, and is perhaps

dso a transcription factor, although it rnay act before or afier ABI3. These results add credibilty to

the double mutant result between abi3-l and abi5 (Fielstein, 1994), which implies that because

they do not enhance each other's sensitivity, they can be considered in the same pathway.

Therefore taken together, these results suggest that ERA 1, ABU and ABE al1 act in the same

pathway and that Al313 and AB15 act downstream of ERA1.

Surprisingly, eral is dorninandy epistatic to abi4. AB14 is therefore not fùnctioning at the

same level as AB13 and ABIS, as previously proposed (Finkelstein, 1994) but rather functions

upstream of ERA1. This result is intriguing for two reasons. Firstly, AB14 encodes an AP2- like

transcription factor (Finkeistein et al.. 1998). Thus, an effector seems to be acting More a relay,

atypicai of a Iinear signal transduction pathway. This result suggests a 2-tiered ABA response

pathway, the fust containing ABI4, which may transcribe genes necessary for M e r responcihg

to AB A, and the second containing ERA 1 . This picture can be enlarged by cons ide~g data

indicating that eral-3 is also epistatic to abil (Sarah Cooney, MSc Thesis; Pei et al., 1998). Thus,

AB14 and AB11 may act in the first tier. Secondly, the eral-3 effect becomes dominant in the

presence of abi4. If AB14 is indeed acting upstream of ERAI, then attenuating the primary signal

such as with the leaky abi4 alleIe changes the flux through the pathway such that it is more

sensitive to ERA 1 dosage.

Finkelstein (1994) attempts to dissect the AB1 genes into additive pathways based on

whether they enhance each others insensitivity, and suggests that ABD, AB14 and ABE ail act in

the same pathway, and AB11 and AB12 act in a separate pathway. These resufts are inconclusive

because nuII mutants were not used. However, in conjunction with epistatic analysis with eral, a

picture of a genetic pathway unfolds: AM4 and AB11 rnay act before ERAl followed by AB13 and

ABE. The above results are intriguing and must be further investigated using nul1 alleles of ABD,

AB14 and ABIS.

eral affects al1 ire mutants, abi3 and abi4 This is an attractive phenomenon, since it implies a level of interaction that has not been

previously considered. In most of these cases, eral does not completely mask the insensitive

phenotypes, but certainly impinges on their expression. There are numerous scenarios that can

account for this. One possibility is that there is another farnesyl tramferase or that a

geranylgeranyltransferase may be active on ERAl targets. Similar examples of reciprocal

suppression have k e n documented in the suppression of the yeast actin actl mutant (Adams and

Botstein, 1989). Reciprocal suppression is often an indication of interaction. This phenomenon

warrants m e r investigation.

ire mutants are Dominant Suppressors of eral Suppressors restore the phenotype of a mutant to that of wild-type. Moreover, if suppressors

have phenotypes separate from those of suppression then suppressors are epistatic only when their

own phenotype as determined afier they have been isolated frorn the suppressed mutation, ~ l l i t~ks

that of the suppressed phenotype (Botstein and Maurer, 1982).

Four ire mutants 13-0304, 13-0404, 13-2202 and 13-2903 ail dominantly suppressed eral-3

as evidenced from the 3: 1 ratios obtained on 0.3pM AB A of the F2 from crosses to eral-3.

Germination hquencies on 3 p M ABA indicate that these ire mutants are.recessive for ABA

insensitivity, although the deviation €rom a perfect 1:3 ratio implies that the ABA insensitivity of ire

mutants is in turn affected by eral. eral mutants respond to minute arnounts of exogenous ABA

and are 4 tirnes more sensitive to ABA than wild-type. That ire mutants are dominant suppressors

is significant because implies that they are key components in the signalling pathway that includes

eral and of which ABA is the inducer.

Dominant mutations are stereotyped as k i n g gain of function, but in the case of a sensitized

background screen, a dominant mutation could represent a loss of function mutation (Karim et al.,

1996). This is supported by the fact that when these mutations are homozygous, the seeds are

ABA insensitive. Homozygous recessive mutations in AB13 represent loss of function deles, and

it turns out that one ire is a mutation in ABU. This supports the hypothesis that dominant

suppressors of eral are loss of function mutations. In the case of 13-0402, which is semi-

dominant for insensitivity to AB A, and does not complement the abi3 ire (13-0404), chances that it

is a loss-of-function ailele is very small, as this aiiele would have to in addition to king a dominant

ire, also be a dominant for insensitivity. AU known alleles which are dominant for insensitivity to

ABA, Abi 1 and Abi2 are thought to be dominant negative (Fhkelstein, 1994). Therefore, 13-0402

may be a dominant negative allele of ABU. All other ire mutants are most probably 1 0 s of

function alleles, although a conclusive answer can only be provided by disceming the molecdar

nature of these mutations.

The insensitivity to ABA aiso provides more clues on the nahue of the pathways. Strongly

ABA insensitive suppressors c m definitely be placed in the main artery of the response pathway.

which includes ERA1, AB15 and AB13 since not only c m one mutant copy suppress the flux of

the pathway so it is no longer supersensitive, but two mutant copies can completely disable the

pathway. By this criterion of dosage, these factors are essential for transmitting the signal. No such

defuiitive hypotheses c m be drawn from the slightly insensitive or sensitive suppressor mutants

since if they are loss-of-function mutations, then dispensing with hem does not block ABA

signailing but removal of one copy dramatically affects signaihg effciency. These loci may

represent redundant functions or encode genes that affect the signalling efficiency at certain steps

but are not essential for transmitting the signal. Alternatively. they may be leaky mutations in key

factors.

That the ire mutations are suppressors of eral insinuates they affect positive regulaton of

the signalling pathway. Since eral-3 is a deletion de le , ire mutants cannot be intragenic

suppressors. There are three possible molecular scenarios. The fmt is that the ire is a mutation

which causes the deactivation of another distinct pathway, ie a bypass suppressor. This would

mean that there is more than one ABA signalling pathway in the seed. In this scenario, the signal

strength down this other pathway would be more substantial than that of the ERAl-dependent

pathway since an ire mutation in this pathway can not only bypass the sensitizing effect of eral,

but can completely override it. A dominant bypassing ire mutation can stU be envisaged as a Ioss-

of-function mutation in a key factor in the secondary pathway. A simple test of this possibility

would be the demonstration ttiat the bypass suppressor is ailele-non specific and therefore should

suppress al1 alleles of eral. One possible candidate for a bypass suppressor could be in the B-

subunit of a plant geranylgeranyl transferase (GGTase). In yeast, the O-subunits of GGTase and

FTase share a common a-subunit and the dimeric enzymes exhibit cross cross-speciflcity (Seabra

et al., 199 1 ; Trueblood et al., 1993). Therefore. an improved GGTase which c m recognize

fmesylation targets would suppress eral. The target sequences for these enzymes are very

similar: FTase recognizes -CAAX, while GGTase recognizes this or variations of it (Armstrong et

al., 1995). This would have to be a strong gain of function mutation since to cause ABA

insensitivity, it would have to necessarily decrease the signal by geranyigeranylating al l of the

targe t.

The second possibility is that an ire gene product directly interacts with farnesyl transferase.

Famesyl transferases in yeast, Drosophiia and mammalian systems are known to have targets such

as small GTPases of the Ras superfamily, G-protein y-sub units and yeast mating factors (Casey,

1995; Hancock et al., 1989; Leevers et al., 1994; Stokoe et al., 1994). The target could therefore be

similar to these exarnples and act as a positive regulator of ABA signaliing when not farnesylated.

The ire mutation could have caused a loss-of-hinction in this component Alternatively, a single

amino acid change in the target Ras, which is usualiy farnesylated, ailows it to be recognized and

altered by GGTase thereby rescuing a R a s e mutant (Trueblood et al., 1993). By this mechanism,

a target of ERAl may become a suppressor of eral. It is also possible that the suppressor

identifies a farnesylated component involved in the reception of ABA. To date, a large nurnber of

potential candidates for ERAl targets have been identified in siiico by s e a r c h g the Arobidopstr

thalima database for proteins which have a -CAAX box. Interestingly, one of these targets, DNAJ,

which has been shown to be farnesylated in plants, is also used to stabilize the glucocorticoid

receptor signalling pathway in animal ceiis (Fink, 1999; Zhu et al., 1993).

A third possibility is that IRE gene products act downstream of ERA1. Usuaüy suppressors

of a sensitized mutation identiQ factors geneticaiiy downstream of the original mutant protein. For

example, in the activated Ras suppressor screen, mutations in genes that function downstream of

Ras were obtained like Ra€, Mek and MapK (Karim et al., 1996).

Genetic tests are necessary to distinguish between these different pssibilities. Crossing to

different alleles of ERA1 wodd d e t e d n e the aüele specificity of the suppressors- If a suppressor

is allele-specific, then it is a bonafide signaiiing component, and possibly an interaçtor with ERAL.

This is unlikely since eral-3 is a deletion allele: this test is more pertinent to suppression of

missense mutations. Bypass suppressors are aiiele-non specific. Of special interest would be

crossing them to an ERA 1 gain-of-function allele since bonujide suppressors should have the

opposite effect, that is they should enhance this effect. Another test would be to cross to different

mutants that cause supersensitivity. This would pinpoint where in the pathway a suppressor is

acting as weU as defining whether ERA mutants Iie in the same pathway for exarnple, if an ire

mutation suppressed eral and era3, then these could be definitively placed in the same pathway.

Maternal Efiects of ire mutants Maternal effects have k e n documented for three ABA response mutants, Abil, Abi2 and

abi3 (FinkeIstein, 1994). In developing seeds there are 2 peaks of ABA synthesis, an early one at

14 days afier pollination that is matemally denved, and a later one at 16 days after pollination that

is embryonically synthesised and is responsible for the induction of dormancy (Karssen et al.,

1983). The purpose of the matemal peak of ABA remains unknown although it has been

dernonstrated to be necessary for AB13 function (Kmmneef et al., 1983). Putative matemal effects

of ire mutants may be related to perception of this maternai ABA, and reciprocal crosses with

ABA-deficient mutants must be made in order to more fully understand whether these abnormal

ratios are in fact due to matemal effects.

ire suppression of eral adult phenotypes Branches are initiated in leaf axils, and are clonally derived fiom the adaxial side of the subtending

leaf (McComell and Barton, 1998). Axillary buds are formed in a basipetal wave upon the

transition of the shoot apicai meristem (SAM) to an inflorescence rneristem 0 (Hempel and

Feldman, 1994). The initiation of these menstems is thought to be controlled by inhibitory signals

from the S A M , termed apical dominance, together with the distribution of growth substances and

cornpetition for mutrients (Schmitz and Theres, 1999). The ir;voIvement of hormones in lateral bud

formation is implicated by both physiologicai and genetic experiments. Classic experiments

involving the inhibition of secondary bud outgrowth due to the decapitation of the main stem by

the apical addition of auxin was a clear demonstration of the role of auxin as a potentiai negative

regulator of branch development (Thimann and Skoog, 1934). Moreover, mutants resistant to

auxin lack apical dominance (Estelie and Somerville, 1987; Maher and Martindale, 1980; Wilson et

al., 1990). Recently, other factors which rnay or may not be hormone dependent have been

identified in lateral branching, such as the lateral suppressor gene of tomato (Schumacher et al.,

1999) which is defective in a VHIID domain protein, sirnilar to GAI and RGA of Arabidopsis.

eral mutants are phenotypically similar to the revoluta mutant of Arabidopsis, which also

has a reduced number of rosette paraclades (Taiben et al., 1995). The mechanism by which this

reduction occurs is unknown. Because bud outgrowth involves the formation of new cells and is a

photosynthetic sink, possible mechanisms may entail the partitioning of nutrient or growth factors

or differential ce11 cycling due to developmentai cues. In Piswn safivum. he homolog of ERAl is

expressed in growing parts the plant, such as the junctions between stems and leaves, r w t tips and

shoot apices, and is repressed by light and sugar, arguing that expression of this FTase rnay have a

role in nutrient allocation (Zhou et al., 1997). A role for ABA in nutrient allocation is dso

suggested by studies with the prl 1 mutant of Arabidopsis which is hypersensitive not only to

sugars but also to several hormones including ABA (Nemeth et ai., 1998). That the branching

phenotype is suppressed by ire mutants means that they dong with ERAl are involved in bud

formation and outgrowth, and that ABA may be involved in this.

eral have flower buds which are prematurely opened but close again as the bud gets older.

This is due to a differential growth rate of sepals and the rest of the flower, which evenhiaiiy

catches up suggesting that coordinate growth of the flower structure is disrupted in eral mutants.

Further support for uncoordinated growth cornes from the edarged meristem defects seen in eral

grown in short days. Furthemore, the curved silique of eral mutants are due to a disorganized

growth of the normally file-ordered division pattern of the epidermis. Their curved nature means

that growth is occurring on one side differently fiom the other. In al1 of these cases, ire mutants

suppress the cell growth defects.

ire mutants suppress a range of eral phenotypes. Defects in eral aie many in number (D.

Bonetta, unpubl). As in many hormone mutants, it is diff~cult to pinpoint what molecular process is

causing the defect. eral farnesylates proteins, but what is the nature of the target and what

processes are they involved in? Evidence is accumulating that farnesylation is required for normal

cell cycling (Du et al., 1999). The common element of some of the vegetative phenotypes of eral

mutants is that they are defective in processes that involve cellcycling. ire mutants suppress al l of

these phenotypes suggesting that ABA may influence the coordination of cell cycling via ERA1.

That revertants suppress these varied phenotypes of eral argues that ERA1 is specific to ABA

signalling, and that AE3A plays an inhibitory role in celi-cyciing consistent with earlier studies on

ABA (Zeevaart and Creehan, 1988).

abi3 is an ire mutant That three ire mutations are in the AB13 transcription factor reveals two intriguing

phenomena. The fmt is that 2 different point mutations in the 8 3 domain can suppress eral in

different ways, one dominantly and one recessively.The second is that ABU which is supposedly

seed-specific, when mutated affects adult structures.

The obi3 -1 mutation causes a substitution of an aspanate residue for an asparagine at

amino acid position 580 (Giraudat et al., 1992). obi3-20 reported here is a nonsonservative

substitution of a glycine to an arginine at position 669. There is evidence that conservative

substitutions do not cause distortion of protein 3-dimensional structures, a postdate used as the

basis for alanine scanning mutagenesis in yeast (Wertman et ai., 1992). Therefore that abi3-20 can

suppress eral-3 dominantly may reflect the severity of a non-conservative amino acid substitution.

It suggests that specific amino acids and not just the entire region are important for functioning.

This is supported by the quantitative range of phenotypes of different aiieles of ABU: abi3-3, a

severe EMS allele, genninates more quickly on 2@l ABA than ubi.3-I (Nambara et al., 1992).

abi.3-3, abi3 -4 (G417-*stop), abi3-3 and &i3-6 (O.75kb deletion) are a i i more insensitive to ABA

than is abi3-I (Nambara et al., 1994; Ooms et al., 1993). Also, it is known that alleles of AB13

contribute to a pathway in a dosage sensitive mamer since abi3-6 is dorninantly insensitive to

uniconazol, an inhibitor of GA synthesis, but recessively insensitive to ABA (Nambara et al.,

1994). That abi3-20 suppresses eral -3 dorninantly suggests that it is a more severe d e l e than

abi3- 1.

The abi3-20 mutation is located in the B3 domain of the AB13 gene. which is thought to bind

cooperatively to Sph DNA elements (Suzuki et al., 1997). In VP1, defects in the B3 domain Iead to

AB A-independent abnormalities, sugges ting that other parts of this transcription factor are

necessary for mediating interactions with ABA responsive genes such as Eml, and implying that

the B3 domain mediates developmental processes (Carson et al-, 1997). This is consistent with

ABU king involved in mediating developmental States as an instructive factor (Bonetta and

McCourt, 1998).

Secondly, abi3-20 affects not only seed phenotypes but also vegetative phenotypes of eral.

This is surprising since no definitive rote of ABU outside of the seed has been shown (Giraudat et

al., 1992; Parcy et al., 1994). When ectopicaiiy expressed, AB13 c m affect vegetative phenotypes

(Parcy and Giraudat, 1997), but this misexpression was under artificial conditions and is most

likely not relevant to the in planta situation. However, this does indicate that ABU is sufficient for

ABA signalling. Two possible ways in which ABU can be interacting with ERAl are: 1) ABU is

expressed outside of the seed, but to very low levels that are difficult to detect; 2) Epigenetic effects

are occumng in the seed, which are "remembered" by the aduit plant.

If ABD is expressed outside of the seed then it is involved in branching, since it suppresses

the reduced paraclade phenotype of eral-3. Perhaps it affects the celi cycle or nutrient aliocation,

analogous to its role in the seed, where it is thought to change the cornpetence of ceils to respond

to ABA. Evidence that ABA is works by Iimiting the availablity of energy and nutrients is

accumulating (Garciarrubio et al., 1997) and AB13 may be involved in mediating the distribution of

resources.

The results imply that in eral-3, ABU rnay be functioning to d u c e branching. One way of

testing this hypothesis would be to check whether there is ectopic expression of AB13 in eral-3

plants. This would also imply that ERA1 rnay inhibit, aibeit indirectly, ABI3, and this rnay account

for the inability to detect AB13 since ERA L is expressed in adult tissue. .

Epigenetic effects in which signals occurring in the seed affect vegetative phenotypes have

been documented. Length of seed chilling affects the tirne to flowering of the adult plant (Sheldon

et al., 1999). The mechanism by which this occurs is not clear, but may involve DNA methylaîion

(Fîiegan et al., 1998). Protein modifications such as the acetylation of histones as weil as

chromatin silencing also confer epigenetic information (Gmnstein, 1998; Photta, 1998). More

recently, there have been reports that plants can "leam" by s t o ~ g information in signailing

pathways (Kudla et ai., 1999; Trewavas, 1999).

That abU-20 can suppress eral-3 drought avoidance is intriguing. eral-3 is drought

tolerant, as measured by its ability to survive weii past wild-type plants in drought conditions.

There are several possible strategies that c m be used by a plant to avoid drought stress. Faster and

longer guard ce11 closure, a "fast" response, is one possibility, and this is one strategy adopted by

eral-3 plants (Pei et ai., 1997). However, there are also slow responses to drought stress, which

involve de novo gene transcription, such as the production of protective osmolytes, the initiation of

root gmwth and the inhibition of drought-induced senescence. The drought tolerance of eral rnay

not simply be due to its guard ce11 phenosrpe, but is most probably also due to changes in these

other "slow" responses since e ra l affects the expression of senescence induced genes (SAG - McCourt unpubl. results) which are expressed in drought stressed plants. Therefore, abU-20 may

not necessarily be intedering with stomatal closure to effect suppression of the drought tolerant

phenotype of eral-3, but rnay aECect the implementation of the aforementioned alternative

strategies. Evidence supporting this hypothesis comes from work with LEA proteins which are

expressed during seed ernbryogenesis, but are simïlar to proteins expressed during drought stress

in whole plants, and are thought to act as dessication osmoprotectants (Dure, 1993). The

expression of severai LEA proteins is disrupted or abolished in AB13 mutants (Nambara et al.,

1995; Parcy et al., 1994). Additionaiiy, LEA proteins c m be found in leaves of plants ectopically

expressing ABU that have been ABA-treated, suggesting that expression of LEA proteins are

controlled by the presence of AB13 (Parcy et al.. 1994). Also, the ATMYB2 gene is drought

inducible, but the expression of MYB homologues are disrupted in abL3-4 (Kink et al., 1998; Urao

et al., 1996). Whatever the mechanism of suppression proves to be, this is the first clear

demonstration that AB13 has genetic effects on vegetative phenotypes.

The future of this work lies in deciphering the exact nature of the relationship between AB13

and ERAI. Many questions have been raised by this work: 1) 1s ABU truly seed-specific? in situ

hybridization studies wil3 help in answering this, since aithou@ ABU-GUS lines were observed,

AB13 may be expressed at very low levels undetectable by thîs rnethod or at very specific locations

not previously assayed (Parcy et al., 1994). ABZ3-GUS Lines that have k e n crossed into eral -3

are currently k i n g observed for blue staining, since it is hypothesised that in the eral mutant,

AB13 may be acting to inhibit paraclade formation in long day conditions.

2) If ABD is seed specific, how does it affect erd-3 adult phenotypes? This question is

intriguing. AB13 targets must be identified.

Additionaily, mapping and characterization of other ire mutants as weil as non-insensitive

revertants will provide more information on ABA signalling and the role of farnesylation. Indeed,

among this latter set, there are probably mutants in targets of farnesylation, which may now either

be gain of function mutants or mutants that c m now be efficientiy gerany lgeranylated. The recent

isolation of an eral mutant in the Ler background (Nocha Van Thielen, MSc) has already been

useful in mapping of these lines which have no obvious phenotype of their own but which can be

selected for on the basis of their eral suppression. More investigation into the maternai effects of

ire mutants and into the reciprocal effects between erul and ire mutants is warranted.

The work presented here represents a new and surprising perspective on ABU plant

development, since it was previously thought to act seed specincally. The relationship beween

ERAl and other ABA mutants in ABA signalling has been investigated and c l 6 e d . Fuaher

analysis of the collection of eral revenants is sure to provide additional information and may

ultimately lead to the elucidaiion of ABA signalling pathways-

References Cited

Adams, A.E.M. and Botstein, D. (1989). dominant suppressors of yeast actin mutations that are reciprocally suppressed. Genetics 121, 675-683.

Man, A. C., Fricker, M. DI, Ward, 3. L., Beale, M. H., and Trewavas, A- J. (1994). Two transduction pathways mediate râpid effects of abscisic acid in Commelina guard cells. Plant Cell 6, 1319-1328.

Armstrong, S. A., Hannah, V. C., Goldstein, J. L., and Brown, M. S. (1995). CAAX geranylgeranyl uansferase transfers faniesyl as eficiently as geranylgeranyl to RhoB. J Bi01 Chem 270,7864-8.

Avery, L., and Wasserman, S. (1992). Ordering gene function; hte interpretation ofepistasis in regdatory hierarchies. Trends Genet, 8 , 3 12-3 16.

Beli, C. I., and Ecker, J. R (1994). Assignment of 30 microsateliite loci to the linkage map of P~abidopsis. Genomics 19, 137- 144.

Bohen. S. P., Kraiii, A., and Yamamoto, K. R. ( 1995). Hold lem and fold 'em: chaperones and signal transduction, Science 268, 1303- 1304.

Bonetta, D., and McCoun, P. (1998). Genetic Analysis of ABA signal trasduction pathways. TIPS 3,23 1-235.

Botstein, D., and Maurer, R. (1982). Genetic approaches to the analysis of microbial development. h u Rev Genet 16,6 1-83.

Bray, E. A. (1993). Molecular responses to water deficit. Plant Physiol. 103, 1035-1040.

Carson, C. B., Hattori, T., Rosenkrans, L., Vasil, V., Vasil, 1. K, Petenon, P. A., and Mc-, D. R. (1997). The quiescent/colorless alleles of viviparous 1 show that the conserved B3 domain of VPl is not essential for ABA-regulated gene expression in the seed. Plant J 12, 123 1-40.

Casey, P. J. (1995). Mechanisms of protein prenylation and role in G protein function. Biochem Soc Tram 23, 16 1-6.

Cutler, S., Ghassemian, M., Bonetta, D., Cooney. S.. and McCourt, P. (1996). A protein farnesyl transferase involved in abscisic acid signal transduction in Arabidopsis. Science 273, 123941.

Davies, P. J. (1995). Plant Hormones: Their nature, occurrence and functions., P. J. Davies, ed. (Dordrecht: Kluwer).

Du, W., Lebowitz, P.F. and Prendergast, G.C. (1999). Cell growth inhibition by famesyl transferase inhibitors is mediated by a gain-of-function geranylgeranylated RhoB. Mol- Ceil. Biol. 19, 183 1-40

Dure, L. (1993). A repeating 1 1-mer amino acid motif and plant desiccation. Plant J 3,363-369.

Estelle, M., and Somerville, C. R. (1987). Auxin-resistant mutants of Arabidopsis thdiana with an altered morphology . Molec.Gen.Genet- 206,200-2%-

Fink, A. L. (1999). Chaperone-mediated protein folding. Physiol. Rev. 79,425429.

Fielstein, R. (1994). Matemal effects govern variable dominance of two abscisic acid response mutations in Arabidopsis thaiiana. Plant Physiol. 105, 1203- 1208.

Finkelstein, R. (1994). Mutations at two new Arabidopsis response loci are similar to the abi3 mutations. Plant J. 5,765-771

Finkelstein, R., and Somerville, C. R. (1990). Three classes of abscisic acid (ABA) insemitive mutations of Arabidopsis define gens that control overlapping subsets of ABA responses. Plant Physiol- 94, 1 172- 1 179.

Fielstein, R. R., Wang, M. L., Lynch, T. J., Rao, S., and Goodman, H. M. (1998). The Arabidopsis abscisic acid response locus AB14 encodes an APETALA 2 domain protein. Plant Ce11 10, 1043-54.

Fumegan, E. J., Genger, R. K., Kovac, K. Peacock, W. J., and Demis, E. S. (1998). DNA rnethylation and the promotion of flowering by vernalization. Proc. Natl Acad. Sci. U S A 95, 5824-5829.

Garcianubio, A., Legaria, J. P., and Covarnibias, A. A. (1997). Abscisic acid inhi'bits germination of manire Arabidopsis seeds by limiting the avaiiability of energy and nutrients. Planta 203, 182-7.

Gilmour, S. J., and Thornashow, M. F. ( 199 1). Cold acclimation and cold-regulated gene expression in ABA mutants of Arabidopsis thaliana. Plant Mol Bi01 17, 1233-40.

Giraudat, J., Hauge, B. M., Valon, C., Smalle, J., Parcy, F., and Goodman, H. M. (1992). Isolation of the Arabidopsis AB13 gene by positional cloning. Plant Ceil 4, 125 1-6 1.

Goldberg, R., Barker, S. J., and Perez-Grau, L. (1989). Regulation of gene expression during plant embryogenesis. Ce1 56, 149- 160.

Gosti, F., Bertauche, N., Vartanian, N., and Giraudat, J. (1995). Abscisic aciddependent and - independent regulation of gene expression by progressive drought in Arabidopsis thaliana Mol Gen Genet 246, 10-8.

Grunstein, M. (1998). Yeast heterochromatin: regulation of its assembly and inheritance by histones. Ce11 93, 325-328-

Guiltinan, M. J., Marcotte, W. R., Jr-. and Quatrano, R. S. (1990). A plant leucine zipper protein that recognizes an abscisic acid response element- Science 250,267-7 1.

Hancock, J. F., Magee. A. 1.. Childs, J. E., and Marshall, C. J. (1989). Al1 ras proteins are polyisoprenylated but only some are palmitoylated. Celi 57, 1167-77.

Hempel, F. D., and Feldman, L. J. (1994)- Bi-directional inflorescence deveio~ment in rabi id op sis thalima Acropetd initiation of flowers and basipetal initiation of paraclades. Planta 192,276-286.

Hili, A., Nantel, A., Rock, C. D., and Quatrano, R. S. (1996). A conserved domain of the viviparous-1 gene product enhances the DNA binding activity of the bZIP protein EmBP-1 and other transcription factors. J Bi01 Chem 271,3366-74.

Hoecker, U., Vasil, 1. K. and McCarty. D. R- (1995). Integrated control of seed maturation and germination programs by activator and repressor functions of Viviparous-1 of rnaize. Genes Dev 9, 2459-69.

Jacobs, W. P. (1979). Plant hormones and plant development (New York: Cambridge University Press).

Jarvik, J., and Botstein, D. (1973). A genetic method for detennining the order of events in a biological pathway. Proc Nati Acad Sci U S A 70,2046-50.

Karim, F. D., Chang, H. C., Themen, M.. Wassarman, D. A., Laverty, T., and Rubin, G. M. (1996). A screen for genes that hinction downstream of Ras 1 dunng Drosophila eye development. Genetics 143-3 15-29.

Karssen, C. M., Brinkhoerst-van der Swan. D. L. C., Breeklmd, A. E., and Koomneef, M. (1983). Induction of donnancy during seed deveiopment by abscisic acid: studies on abscisic acid deficient genotypes of Arabidopsis thaliana. Planta 157, 158- 165.

Keith, K, Kraxni, M., Dengler, N., and McCourt. P. (1994). fusca3: A heterochronic mutation affectïng late embryo development in Arabidopsis. Plant Cell6,589-600.

Kirik, V., Kolle, K., Wohlfarth. T., Misera, S.. and Baumiein, H. (1998). Ectopic expression of a novel MYB gene modifies the architecture of the Arabidopsis inflorescence. Plant J 13,729-42.

Koornneef, M., Jorna, M. L., Brinkhoerst-van der Swan, D. L- C., and Karssen, C. M. (1982). The isolation of abscisic acid (ABA) deficient mutants by selection of induced revrtants in non- germination gibberellin sensitive lines of Arabidopsis. Theor. Appl. Genet. 61,385-393.

Koomneef, M., Reuling, G., and Karssen, C. M. (1984). The isolation andcharacterization of abscisic acid insensitive mutants in Arabisopsis thaliana Physiol. Plant. 61,377-383.

Kudla, J., Xu, Q., Harter, K., Gntissern, W., and Luan, S. (1999). Genes for calcineurin B-like proteins in Arabidopsis are differentiaily regulated by stress signais. Proc Natl Acad Sci U S A 96, 47 1 8-4723 -

Lang, V., Heino, P., and Palva. E. T. ( 1989). Low temperature acchmation and treatment with exogenous abscisic acid induce cornmon polypeptides in Arabidopsis thaiiana (L.) Heynh. Theor. Appl. Genet. 77,729-734.

Laufs, P., Grandjean, O.. Jonak, C., Kieu, K., and Traas, J. (1998). Cellular parameters of the shoot apical meristem in Arabidopsis. Plant Ce11 IO, 1375- 1389.

Leevers, S. J., Paterson, H. F., and Marshall, C . 1. (1994). Requirement for Ras in Raf activation is overcome by targeûng Raf to the plasma membrane. Nature 369-4 1 1 4 14.

Leon-Kloosterziel, K. M., Gil, M. A.' Ruijs, G. I., Jacobsen. S. E., Olszewski, N. E., Schwartz, S. H., Zeevaart, J. A., and Koomneef, M. ( 1996). Isolation and characterization of abscisic acid- deficient Arabidopsis mutants at two new loci. Plant J 10,655-61.

Leung, J., Bouvier-Durand, M., Moms, P. C., Guemer, D., Chefdor, F., and Giraudat, J. (1994). Arabidopsis ABA response gene ABII: features of a calcium-modulated protein phosphatase. Science 264, 1448-52.

Leung. J., Merlot, S ., and Giraudat, J. (1 997). The Arabidopsis ABSCISIC ACID- INSENSI"ïrvE2 (ABD) and AB1 I genes encode homoIogous protein phosphatases 2C involved in abscisic acid signal transduction. Plant Cell9,759-7 1.

Lincoln, C., Bntton, J. H., and Estelle, M. (1990). Growth and development of the axrl mutants of Arabidopsis. Plant Ce11 2, 107 1 - 1080-

Luerssen, H., Kink, V., Herrmann, P., and Misera, S. (1998). FUSCA3 encodes a protein with a conserved VPl/AB 13-like B3 domain which is of functional importance for the regulation of seed maturation in Arabidopsis thaliana PImt J. 15,755-764.

Maher, E. P., and Martindale, S. J. B. (1980). Mutants of Arabidopsis thaliana with altered responses to auxins and gravity. Biochem. Genet. 18, 1041-1053.

McCo~eI1, J. R., and Barton, M. K. ( L998). Leaf polarity and meristem formation in Arabidopsis. Development 125,2935-2942.

McCourt, P. (1999). Genetic Anidysis of Hormone signaling. Annu. Rev:Ptant Physiol. Plant Mol. Biol. 50,219-243.

Moir, D., and Botstein, D. (1982). Determination of the order of gene function in the yeast nuclear division pathway using CS and ts mutants. Genetics 100,565-77.

Nambara, E., Kawaide, H., Kamiya, Y., and Naito, S. (1998). Characterization of an Arabidopsis thaliana mutant that has a defixt in ABA accumulation: ABA-ciependent and ABA-independent accumulation of fixe arnino acids during dehydration. Plant Cell Physiol39,853-8.

Namban, E., Keith, K., iMçCourt, P., and Naito, S. (1994). Isolation of an intemal deletion mutant of the Arabidopsis AB13 gene. Plant Celi Physiol. 35,509-5 13.

Nambara, E., Keith, K., McCourt, P., and Naito, S. (1995). A regdatory role for the AB13 gene in the establishment of embryo maturation in Arabidopsis thaliana. Development 121,629-636.

Nambara, E., Naito, S., and McCourt, P. (1992). A mutant of Arabidopsis which is defective in seed development and storage protein accumulation is a new abi3 aiiele. Plant J. 2,435-441.

Neill, S. J., Horgan, R., and Parry, A. D. (1986). The carotenoid and abscisic acid content of vivparous kemels and seedlings of Zea mays. Planta 169,87-96.

Nemeth, K., Salchert, K., Pu tnoky, P., Bhalerao, R., Koncz-Kalman, Z., S tankovic-S tangeland, B., Bako, L., Mathur, J., Okresz, L., Stabel, S., Geigenberger, P., Stitt, M., Redei, G. P., Schell, J., and Koncz, C. (1998). Pleiotropic control of glucose and hormone responses by PRL1, a nuclear WD protein, in Arabidopsis. Genes Dev 12,3059-73.

Ooms, J. J. J., Leon-Kloosterziel, K. M., Bartek, D., Koornneef, M., and Karssen, M. (1993). Acquisition of desiccation tolerance and longevity in seeds of Arabidopsis thdiana A comparative study using abi3 mutants. Plant Physioi. 102, 1185- 1 191.

Parcy , F., and Giraudat, J. (1997). Interactions between the AB1 1 and the ectopically expressed AB13 gene in controlling abscisic acid responses in Arabidopsis vegetative tissues. Plant J 11,693- 702.

Parcy, F., Valon, C., Kohara, A., Misera, S., and Giraudat, J. (1997). The ABSCISIC ACID- INSENSITIVE3. FUSCA3, and LEAFY COTYLEDON1 loci act in concert to control multiple aspects of Arabidopsis seed development, Plant Cell9, 1265-77.

Parcy, F., Valon, C., Raynai, M., Gaubier-Cornella, P., Delseny, M., and Giraudat, J. (1994). Regulation of gene expression programs dunng Arabidopsis seed development: roles of the AB13 locus and of endogenous abscisic acid, Plant Cell6, 1567-82.

Pei, 2. M., Ghassemian, M-, Kwak, C. M-, McCourt, P., and Schroeder, J. 1. (1998). Role of farnesyltransferase in ABA regulation of guard cell anion channels and plant water loss. Science 282,287-90.

Pei, Z. M., Kuchitsu, Ka, Ward, J. M., Schwarz, M., and Schroeder, J. 1. (1997). Differential abscisic acid regulation of guard ce11 slow anion channels in Arabidopsis wild-type and abil and abi2 mutants. Plant Cell9,409-23.

Phillips, J., Artsaenko, O., Fiedler, U., Horstmann, C., Mock, H- P., Muntz, KI, and Conrad, U. ( 1997). Seed-specific irnrnunornodulation of abscisic acid activity induces a developmentai switch. EMS0 J. 16,4489-4496.

Pirrotta, V. (1998). Polycombing the genome: PcG, trxG, and chromatin silencing. Cell93,333- 336.

Pratt, L. A., and Silhavy, T. J. (1995). Two-component signal transduction., J. A. Hoch and T. J. Silhavy, eds.: ASM Press).

Robertson, D. S. (1955). Genetic vivipary in rnaize. Genetics 40,745-760.

Roman, G., Lubarsky, B., Kieber, J. J., Rothenberg , M., and Ecker, J. R. (1995). Genetic analysis of ethylene signal transduction in Arabidopsis thaliana: five novel mutant loci integrated into a stress response pathway, Genetics 139, 1393-1409.

Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). Molecular cloning : a laboratory manual (Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory).

Schafer, W.R. and Rine, J. (1992). Protein prenylation: genes, enzymes, targets, and functions. Annu.Rev.Genet. 30,209-237,

Schmitz, G., and Theres, K. (1999). Genetic control of branching in Arabidopsis and tomato. Curr. Op. Plant Biol. 2,51-55,

Schultz, T. F., Medina, J., Hill, A., and Quatrano, R. S. (1998). 14-3-3 proteins are part of an abscisic a c i d - W A R O U S 1 (VP 1 ) response complex in the Em promoter and interact with VPI and EmBP 1. Plant Ce11 10,837-47.

Schurnacher, K., Schmitt, T.. Rossberg, M., Schmitz, G., and Theres, K. (1999). The lateral suppressor gene of tomato encodes a new member of the VHIID protein family. Proc. Natl. Acad. Sci. USA 96,290-295.

Seabra, M. C., Reiss, Y., Casey, P. J., Brown, M. S., and Goldstein, J. L. (1991). Protein farnesyltransferase and geranylgeranyltransfense share a common alpha subunit. Cell65,429-34.

Sheldon, C. C., Bum, J. E., Ferez, P. P., Metzger, J., Edwards, J- A., Peacock. W. J., and Dennis, E. S. (1999). The FLF MADS box geoe: a repressor of flowenng in Arabidopsis regulated by vemalization and methylation. Plant Cell 11.445-458.

Smyth, D. R., Bowman, J. L., and Meyerowitz, E. M. (1990). Early flower development in Arabidopsis. Plant Ce11 2,755-767.

Stokoe, D., Macdonald, S. G., Cadwdader, IC, Symons, M., and Hancock, J. F. (1994). Activation of Raf as a result of recruitment to the plasma membrane [see comments] [published erratum appears in Science 1994 Dec 16;266(5 192): 1792-31. Science 264, 1463-7.

Suzuki, M., Kao, C. Y., and McCarty, D. R. (1997)- The conserved B3 domain of VIVIPAROUS 1 has a cooperative DNA binding activity. Plant Celi 9,799-801.

Talbert, P. B., Adler, H. T., Paris, D. W., and Cornai, L. (1995). The REVOLUTA gene is necessary for apical meristem development and for limiting ceH divisions in the leaves and stems of Arabidopsis thdiana Developrnent 121,2723-2735.

Thirnann. K V., and Skoog, F. ( 1934). On the inhibition of bud development and other functions of growth substance in Vicia faba Proc. Roy. Soc- B- I14 ,3 17-339-

Trewavas, A. (199 1). Plant ceU signal transduction.Trends Genet- 7,356-61

Trewavas, A. (1999). How plants learn. Proc Nat1 Acad Sci U S A 96,4216-4218.

Trueblood, C. E., Ohya, Y.. and Rine, J. (1993). Genetic evidence for in vivo cross-specincity of the CaaX-box protein prenyltransferases famesyltransferase and geranylgeranyltransfera~e-I in Saccharomyces cerevisiae. Mol Cell Bi01 13,4260-75.

Urao, T., Yamaguchi-Shinozaki, K. Uno, S., and Shinozaki, K. (1 996). An Arabidopsis myb homolog is induced by dehydration stress and its gene product binds to the conserved MYB recognition sequence. Plant Cell 5. 1529-39.

Vartanian, N., Marcotte, L., and Giraudat, J. (1994). Drought rhizogenesis in Arabidopsis thaliana Differential responses of hormonal mutants. Plant physiology. 104,761-767-

Wertman, K F., Drubin, D. G., and Botsrein, D. (1992). Systematic mutational analysis of the yeast ACT1 gene. Genetics 132,337-50.

Wilson, A. K., Pickett, F. B., Turner, J. C., and Estelle, M. (1990). A dominant mutation in Arabidopsis confers resistance to auxin, ethylene and abscisic acid. Mol Gen Genet 222,377-83.

Woeste, K., and Kieber, J. J. (1998). The molecular b a i s of ethylene signalling in Arabidopsis. Philos Trans R Soc Lond B Bi01 Sci 353, 143 1-8.

Zeevaart, J. A. D., and Creelrnan, R. A. (1988). Metabolism and physiology of abscisic acid. AMU. Rev. Plant Physiol. Plant Mol. Biol. 45. 1 13- 14 1.

Zhou, D., Qian, D., Cramer, C. L., and Yang, 2. ( 1997). Developmentai and environmeoral regulation of tissue- and cell-specific expression for a pea protein famesylûansferase gene in transgenic plants. Plant J 12.92 1-30.

Zhu, J. K., Bressan, R- A., and Hasegawa, P. M. (1993). Isoprenvlation of the lan nt molecular chaperone ANJl facilitates membrane association and &don & high tempe&ture. Roc Nat1 Acad Sci U S A 90,8557-6 1.