INSTITUTO NACIONAL DE PESQUISAS DA AMAZÔNIA – INPA PROGRAMA DE PÓS-GRADUAÇÃO EM GENÉTICA, CONSERVAÇÃO E BIOLOGIA EVOLUTIVA – PPG GCBEv Influência dos contaminantes ambientais Benzo[a]pireno e Roundup ® sobre Colossoma macropomum submetida à hipóxia e mudanças climáticas: respostas genéticas, fisiológicas e histológicas GRAZYELLE SEBRENSKI DA SILVA Manaus Novembro, 2016
184
Embed
INSTITUTO NACIONAL DE PESQUISAS DA AMAZÔNIA INPA … · ras e do gene hif-1 em tambaquis cronicamente expostos ao ... Histological changes C. macropomum liver exposed to normoxia
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
INSTITUTO NACIONAL DE PESQUISAS DA AMAZÔNIA – INPA PROGRAMA DE PÓS-GRADUAÇÃO EM GENÉTICA, CONSERVAÇÃO E BIOLOGIA
EVOLUTIVA – PPG GCBEv
Influência dos contaminantes ambientais Benzo[a]pireno e Roundup®
sobre Colossoma macropomum submetida à hipóxia e mudanças climáticas: respostas genéticas, fisiológicas e histológicas
GRAZYELLE SEBRENSKI DA SILVA
Manaus
Novembro, 2016
ii
GRAZYELLE SEBRENSKI DA SILVA
Influência dos contaminantes ambientais Benzo[a]pireno e Roundup®
sobre Colossoma macropomum submetida à hipóxia e mudanças climáticas: respostas genéticas, fisiológicas e histológicas Orientadora: VERA MARIA FONSECA DE ALMEIDA E VAL Agência Financiadora: INCT/ADAPTA
Tese apresentada ao Instituto Nacional de Pesquisas da Amazônia como parte dos requisitos para obtenção do título de Doutor em Genética, Conservação e Biologia Evolutiva.
* Pesquisa autorizada: CEUA/INPA, Protocolo Número 011/2013.
Manaus, Amazonas Novembro, 2016
iii
GRAZYELLE SEBRENSKI DA SILVA
Influência dos contaminantes ambientais Benzo[a]pireno e Roundup®
sobre Colossoma macropomum submetida à hipóxia e mudanças climáticas: respostas genéticas, fisiológicas e histológicas
Tese apresentada ao Programa de Pós-
Graduação em Genética, Conservação e
Biologia Evolutiva do Instituto Nacional de
Pesquisas da Amazônia, como requisito para a
obtenção do título de Doutor em Genética,
Conservação e Biologia Evolutiva.
APROVADA EM: 23 / 11 / 2016
BANCA EXAMINADORA
____________________________________________
Profa. Dr. José Fernando Marques Barcellos-UFAM
____________________________________________
Profa. Dra. Fernanda Loureiro de Almeida O’Sullivan-EMBRAPA
____________________________________________
Profa. Dra. Luciana R. Souza-Bastos-UFPR
____________________________________________
Profa. Dra. Eliana Feldberg-INPA
____________________________________________
Profa. Dr. Wuelton Marcelo-FMT
iv
FICHA CATALOGRÁFICA
S586 Silva, Grazyelle Sebrenski da
Influência dos contaminantes ambientais Benzo[a]pireno e Roundup®
sobre Colossoma macropomum submetida à hipóxia e mudanças climáticas:
respostas genéticas, fisiológicas e histológicas /Grazyelle Sebrenski da Silva . -
-- Manaus: [s.n.], 2016.
168 f.: il.
Tese (Doutorado) --- INPA, Manaus, 2016.
Orientador: Vera Maria Fonseca de Almeida e Val
Área de concentração: Genética, Conservação e Biologia evolutiva
1. Tambaqui. 2. Hipóxia. 3. Mudanças climáticas. I. Título
CDD 597.5
SINOPSE
Neste estudo foram avaliados os efeitos dos contaminantes ambientais Benzo[a]pireno e
Roundup® sobre o tambaqui (Colossoma macropomum). Primeiramente, verificou-se os
efeitos agudos do Benzo[a]pireno na expressão do oncogene ras e hif-1 e respostas
histopatológicas do fígado. A seguir, foram avaliados os efeitos do Benzo[a]pireno na
expressão do oncogene ras e do gene hif-1 em tambaquis cronicamente expostos ao
cenário extremo (A2) proposto pelo Painel Intergovernamental Sobre Mudanças Climáticas
(IPCC, 2007). Finalmente, foi avaliado o efeito agudo e conjunto da exposição ao Roundup®
mais hipóxia na expressão dos genes ras e hif-1e os efeitos histopatológicos em tambaqui.
foram obtidas a partir de regiões preservadas das sequências do NCBI, utilizando o
software BioEdit Sequence Alignment Editor versão 7.0.5.3. A partir das sequências
consenso foram desenhados primers degenerados para os genes ras e hif-1com o
auxílio do programa Oligo Explorer 1.2 ™.
Os primers degenerados foram testados por meio de gradientes de temperaturas
em PCR (Reação em cadeia da Polimerase), utilizando o PCR master mix (Promega).
Os produtos da PCR obtidos foram sequenciados no sequenciador automático ABI
3130XL, utilizando o Kit ABI PRISM® Big DyeTM Terminator Cycle Sequencing Ready
Reaction (Applied Biosystems), para a obtenção das sequências gênicas específicas
dos genes ras e hif-1 para C. macropomum.
Confecção dos oligonucleotídeos específicos para RT-PCR dos genes ras e hif-1
As sequências para os genes ras e hif-1obtidas no sequenciamento foram
validadas utilizando o programa BLAST do NCBI. Após a validação, as sequências
foram alinhadas no programa ClustalW, disponível no Software BioEdit Sequence
Alignment Editor versão 7.0.5.3 e os oligonucleotídeos específicos de C. macropomum
para q-PCR para os genes ras e hif-1 desenhados através do Software Oligo Explorer
1.2 ™.
Além dos genes alvo (ras e hif-1) utilizados no presente trabalho, também
foram utilizados genes de referência 28S (Vasquez, 2009) e ef-1 (Brandão, 2015),
obtidos com a mesma técnica. As características do primers específicos obtidos para
C. macropomum estão descritos na Tabela 2.
Real Time RT-PCR (Transcrição Reversa seguida por Reação em Cadeia da
Polimerase em Tempo Real)
Amostras de cDNA dos fígados de C. macropomum foram utilizadas para a
quantificação dos genes transcritos por real-time PCR, utilizando o equipamento Viia7
Dx da Life Technologies (Applied Biosystems). As análises foram realizadas em placas
28
de 96 poços, onde cada amostra foi lida em triplicata. As reações foram desenvolvidas
utilizando-se 1,0 μL de cDNA, 5,0 μL de SYBR® Green PCR Master Mix (Applied
Biosystems), 1,0 μL do primer forward, 1,0 μL do primer reverse e 2,0 μL de água livre
de nucleases 192 (Ambion, Life Technologies) com um volume final de 10 μL. As
condições da reação foram: um passo inicial de 95 °C por 10 minutos, seguidos por 40
ciclos de 95 °C por 15 segundos e 60 °C por 60 segundos. As reações foram realizadas
em triplicata para a detecção de possíveis erros.
A presença de um único produto específico na temperatura de “melting” foi
confirmada utilizando a curva de melting de cada primer conforme descrito na tabela 3.
A eficiência de cada primer foi calculada em uma curva de diluição seriada obtida a
partir de um pool de amostras de cDNA de C. macropomum (com concentração entre
1000 e 1 ng de cDNA; n=4). Todos os primers apresentaram eficiência de amplificação
para PCR satisfatória (entre 98 e 105%) (Tabela 2). A eficiência de amplificação de
cada primer foi calculada de acordo com Pfaffl (2001).
Quantificação relativa da expressão gênica
Para a detecção da diferença nos níveis de expressão dos genes ras e hif-1
entre as diferentes condições experimentais que os peixes foram submetidos nos
diferentes experimentos, foi utilizado o método de quantificação relativa (Pfaffl, 2001).
Este método é uma modificação do método Ct comparativo (∆Ct) baseado na
quantificação do gene de interesse em relação a genes constitutivos denominados
genes de referência e a eficiência na transcrição reversa. A razão de expressão relativa
é baseada na eficiência de amplificação e na variação do Ct do grupo controle ou
calibrador e os outros grupos de interesse em relação ao gene constitutivo denominado
gene de referência.
29
Tabela 2. Características de cada primer específico obtido para a realização dos
experimentos. Primers para os genes endógenos (28S e ef-1) e primers para os
genes alvo (ras e hif-1).
Gene
Sequência do primer (5`-3`) forward/reverse
Comprimento (bp)
Tamanho do amplicon(bp)
Tm Ef(%)*
28S-F
CGGGTTCGTTTGCGTTAC
18 150 54.5 98.19
28S-R
AAAGGGTGTCGGGTTCAGAT
20 150 56.3 98.19
ef-1F
GTTGGTGAGTTTGAGGCTGG
20 78 60.7 99.09
ef-1R
CACTCCCAGGGTGAAAGC
18 78 60.9 99.09
Ras-F
CCAGTACATGAGGACAGGAG
20 134 60.3 99.31
Ras-R
CAAGCACCATTGGCACATCG
20 134 60.3 99.31
HIF-1F a
CTTCTGAGCTCTGATGAGGC
20 98 60.1 105.24
HIF-1R a
GAAAGCACCATCAGGAAGCC
20 98 61.2 105.24
HIF-1F b
ATCAGCTACCTGCGCATG 18 133 59.3 100.69
HIF-1R b
CTCCATCCTCAGAAAGCAC 19 133 57.3 100.69
*Eficiência do primer.
(a) Par 1 para o gene Hif-1utilizado no primeiro experimento.
(b) Par 2 para o gene Hif-1utilizado no segundo e terceiro experimento.
30
3.3.5 Análises bioquímicas
Antes de todas as análises enzimáticas as amostras de fígado que estavam
mantidas em freezer -80 oC foram alíquotadas, pesadas e homogeneizadas em tampão
com pH 7,6 (20 mM de tris-base, 1 mM de EDTA, 1 mM de dithiothreitol, 500 mM de
Sucrose e150 mM de KCL) na proporção 1: 2 massa:volume para Lipoperoxidação
Lipídica (LPO), e 1:10 massa: volume para as enzimas Glutationa-S-Transferase (GST)
e Catalase (CAT).
Após a homogeneização as amostras foram centrifugadas de acordo com os
protocolos para cada enzima, sendo que para GST e CAT a centrifugação ocorreu a
9.000 rcf, por 30 min a 4 oC e para LPO 10.000 rpm, por 10 min a 4 oC. Os
sobrenadantes foram retirados e alíquotas para cada enzima foram separadas e
analisadas conforme os protocolos descritos a seguir.
Enzima de Biotransformação: Glutationa-S-Transferase
A atividade da GST no fígado foi determinada de acordo com o método descrito
por Keen et al. (1976), que utiliza o 1-cloro-2,4-dinitrobenzeno (CDNB) como substrato.
Mudanças na absorbância foram verificadas em espectrofotômetro a 340 nm e a
atividade da enzima foi expressa em nmol de CDNB conjugado. min-1. mg proteína-1
utilizando-se o coeficiente de extinção molar de 9,6 mM cm -1.
Enzima antioxidante: Catalase
A atividade da enzima catalase foi determinada pelo método estabelecido por
Beutler (1975), onde a taxa de inibição da decomposição do H2O2 foi medida na
absorbância de 240 nm em espectrofotômetro. A atividade da CAT foi expressa como
μmol H2O2. min-1 .mg proteína-1.
31
Peroxidação Lipídica das membranas (LPO)
A determinação da peroxidação lipídica foi realizada pelo método conhecido
como ensaio FOX, estabelecido por Jiang et al. (1991). O ensaio FOX corresponde à
reação química de auto oxidação de lipídios (LH) que conduz a lipoperoxidação
(LOOH). O método está baseado na oxidação do Fe (II) por LOOH em pH ácido na
presença de um pigmento complexador de Fe (III), o xilenol laranja. A formação deste
complexo foi quantificada pelo aumento da absorção em 560 nm e expressa em μM
CHP (hidroperóxido de cumeno) por mg de proteína hepática.
Quantificação da proteína hepática
A proteína total de cada amostra de fígado foi mensurada de acordo com
Bradford (1976) por espectrometria, e albumina bovina (BSA) foi utilizada como padrão.
A leitura foi realizada em 595 nm.
3.4 Análise estatística
Capítulo I
Todos os dados estão apresentados como média e ± erro padrão da média
(SEM). A expressão gênica, histopatologia e o ensaio cometa foram analisados por
meio da análise de variância, ANOVA de um fator para determinar as diferenças entre
os diferentes tratamentos com benzo[a]pireno e o controle. Quando os dados violaram
as premissas do teste ANOVA de um fator (normalidade e variância), o teste não
paramétrico de Kruskal-Wallis foi aplicado. A significância estatística foi considerada
para valores de P< 0.05. A análise estatística foi realizada utilizando o programa Sigma
Stat 3.5.
Capítulo II
Os dados estão expressos como média e ± erro padrão da média. Previamente
a distribuição e a homogeneidade dos dados foram verificadas. Os danos
apresentaram distribuição normal e passaram no teste de variância, sendo aplicado o
teste estatístico ANOVA de dois fatores seguido do teste de Tukey para múltiplas
32
comparações. Os fatores considerados foram os diferentes cenários dos microcosmos
(cenário atual e cenário extremo proposto pelo IPCC, 2007), e os diferentes
tratamentos (controle (óleo de milho), 8 e 16 mol/kg de BaP). A diferença estatística
foi considerada para valores de P< 0.05. As análises foram realizadas utilizando o
programa estatístico Sigma Stat 3.5. Outro teste estatístico realizado foi à análise dos
componentes principais (PCA) utilizando o programa Statistica.
Capitulo III
Os dados estão descritos como média ± erro padrão da média (SEM). Antes dos
testes comparativos a distribuição e homogeneidade dos dados foram verificadas.
Todos os dados foram analisados por meio to teste estatístico ANOVA de dois fatores,
seguido do teste Tukey tendo como fatores a concentração de oxigênio (normóxia e
hipóxia) e a contaminação da água ou não com Roundup®. A significância estatística
foi considerada para valores de P< 0.05. A análise estatística foi realizada utilizando o
programa Sigma Stat 3.5.
33
4. Bibliografia
Abdel-Shafy, H.I. e Mansour, M.S.M. (2016). A review on polycyclic aromatic hydrocarbons: Source, environmental impact, effect on human health and remediation. Egyptian Petroleum Research Institute Egyptian Journal of Petroleum. Egyptian Journal of Petroleum, 25: 107-123. Almeida, L.C., Lundstedt, L.M., & Moraes,G. (2006). Digestive enzyme responses of tambaqui (Colossoma macropomum) fed on different levels of protein and lipid. Aquaculture Nutrition, 12(6): 443-450. Arey, J.,e Atkinson, R. (2003). Photochemical reactions of PAHs in the atmosphere. PAHs: An Ecotoxicological Perspective, 47-63. Barbacid, M. (1987). Ras genes. Annual review of biochemistry, 56(1): 779-827. Banni, M., Negri, A., Dagnino, A., Jebali, J., Ameur, S., Boussetta, F. (2010). Acute effects of benzo[a]pyrene on digestive glande nzymatic biomarkers and DNA damage on mussel Mytilus galloprovincialis. Ecotoxicology and Environmental Safety, 73: 842-848.
Baptista, R. B., Souza-Castro, N., & Almeida-Val, V. M. F. (2016). Acute hypoxia up-regulates HIF-1α and VEGF mRNA levels in Amazon hypoxia-tolerant Oscar (Astronotus ocellatus). Fish Physiology and Biochemistry, 1-12.
Beutler, E. (1975). Red Cell Metabolism: A manual of biochemical methods. Grune & Straton, New York.
Bos, J.L. (1989). Ras oncogenes in human cancer: a review. Cancer Research, 49: 4682-4689.
Boyd, C.E. e Tucker, C.S. (1992). Water quality and pond soil analysis for aquaculture. Auburn: Auburn
University. 183p.
Bradford, M.M. (1976). A rapid and sensitive method for the quantification of microgram quantities of
protein utilizing the protein-dye binding. Analytical Biochemistry, 72:248-254.
Brandão, R.M.L. Efeitos do hormônio do crescimento recombinante bovino (rbgh lactotropin
®) na
expressão do gene igf-i e parâmetros fisiológicos em juvenis de tambaqui (Colossoma macropomum)/ Rúbia Maielli Lima Brandão. Dissertação (mestrado) Newton Lins, Manaus, 2015. Orientador: Dra.Vera Maria Fonseca de Almeida e Val. Área de concentração: Aquicultura. Braz-Mota, S., Sadauskas-Henrique, H., Duarte, R. M., Val, A. L., & Almeida-Val, V. M. (2015). Roundup
®
exposure promotes gills and liver impairments, DNA damage and inhibition of brain cholinergic activity in the Amazon teleost fish Colossoma macropomum. Chemosphere, 135: 53-60. Boutilier, R. G. (2001). Mechanisms of cell survival in hypoxia and hypothermia. Journal of Experimental Biology, 204(18): 3171-3181. Brow, B.A. (1976). Hematology: principles and procedures. 2ª ed. Philadelphia. Lea & Febiger.
Cao, Y.B., Chen, X.Q., Du, J Z., & Wang, Y.X. (2005). Molecular cloning of hypoxia-inducible factor 1 alpha from brain of scale-less carp (Gymnocypris przewalskii) in Lake Qinghai of China. Comparative Biochemichal and Physiology A, 140: 257-273.
34
Cattaneo, R., Clasen, B., Loro, V.L., de Menezes, C.C., Pretto, A., Baldisserotto, B., & de Avila, L.A. (2011). Toxicological responses of Cyprinus carpio exposed to a commercial formulation containing glyphosate. Bulletin of Environmental Contamination and Toxicology, 87(6): 597-602.
Prochilodus lineatus. Mutation Research/Genetic Toxicology and Environmental Mutagenesis, 655(1): 41-46. Çavaş, T., e Könen, S. (2007). Detection of cytogenetic and DNA damage in peripheral erythrocytes of goldfish (Carassius auratus) exposed to a glyphosate formulation using the micronucleus test and the comet assay. Mutagenesis, 22(4): 263-268. Cheng, R., Bradford, S., Barnes, D., Williams, D., Hendricks, J., & Bailey, G. (1997). Cloning, sequencing, and embryonic expression of an N-ras proto-oncogene isolated from an enriched zebrafish (Danio rerio) cDNA library. Molecular Marine Biology and Biotechnology, 6(1): 40-47.
Comte, L., Buisson, L., Daufresne, M., & Grenouillet, G. (2013). Climate‐induced changes in the
distribution of freshwater fish: observed and predicted trends. Freshwater Biology, 58(4): 625-639. Corbera, M., Hidalgo, M., Salvado, V., & Wieczorek, P. P. (2005). Determination of glyphosate and aminomethylphosphonic acid in natural water using the capillary electrophoresis combined with enrichment step. Analytica Chimica Acta, 540(1): 3-7. Corrêa, C.F., Aguiar, L.H., Lundstedt, L.M., Moraes, G. (2007). Responses of digestive enzymes of tambaqui (Colossoma macropomum) to dietary cornstarch changes and metabolic inferences. Comparative Biochemistry and Physiology, Part A, 147: 857-862. Costa, A., Coradini, D., Carrassi, A., Erdas, R., Sardella, A., & Daidone, M. G. (2001). Re: Levels of Hypoxia-Inducible Factor-1α During Breast Carcinogenesis. Journal of the National Cancer Institute, 93(15): 1175-1177. Costa, O.T.F. Efeito do pH da água sobre os parâmetros hematológicos, eletrólitos e equilíbrio ácido-base do sangue arterial de Colossoma macropomum (Characiformes, Serrasalmidae). Master Thesis, INPA: FUA, Manaus, 1995. Dalla Via, J., Thillart, G.V.D., Cattani, O., de Zwaan, A., (1994). Influence of long-term hypoxia exposure on the energy metabolism of Solea solea. II. Intermediary metabolism in blood, liver, and muscle. Marine Ecology Progress Series, 111: 17-27. Dauer, D.M. (1993). Biological criteria, environmental health and estuarine macrobenthic community structure. Marine Pollution Bulletin, 26(5): 249-257. De Boeck, G.,C.M. Wood, F.I. Iftikar, V. Matey, G.R. Scott, K. A. Sloman, M.N. Paula-Silva, V.M.F. Almeida-Val & A.L. Val. (2013). Interactions between hypoxia tolerance and food deprivation in Amazonian oscars, Astronotus ocellatus. Journal of Experimental Biology, 216: 4590–4600. Diaz, R.J. e Rosenberg, R. (2008). Spreading dead zones and consequences for marine ecosystems. Science, 21: 926-929. Dragan, F.G. Respostas fisiológicas e metabólicas do tambaqui (Colossoma macropomum, Cuvier 1818) às alterações climáticas previstas pelos diferentes cenários do IPCC para o ano de 2100 / Fernanda Garcia Dragan. --- Manaus : [s.n], 2014. xiv, 82 p. Dissertação (Mestrado) INPA, Manaus, 2015.
35
Orientador : Vera Maria Fonseca de Almeida e Val. Área de concentração: Biologia de Água Doce e Pesca Interior. Dunwoodie, S. L. (2009). The role of hypoxia in development of the Mammalian embryo. Developmental cell, 17(6): 755-773. Fong, A.T., Dashwood, R.H., Cheng, R., Mathews, C., Ford, B., Hendricks, J.D., Bailey, G.S. (1993). Carcinogenicity, metabolism and Ki-ras proto-oncogene activation by 7,12-dimethylbenz[a]anthracene in rainbow trout embryos. Carcinogenesis, 14(4): 629-635. Giesy, J.P., Dobson, S., & Solomon, K.R. (2000). Ecotoxicological risk assessment for Roundup
®
herbicide. In Reviews of Environmental Contamination and Toxicology (pp. 35-120). Springer New York. Gouveia, C., Liberato, M.L.R., DaCamara, C.C., Trigo, R.M., & Ramos, A. M. (2011). Modelling past and future wine production in the Portuguese Douro Valley. Climate Research, 48(2-3): 349-362. Grisolia, C. K. (2002). A comparison between mouse and fish micronucleus test using cyclophosphamide, mitomycin C and various pesticides. Mutation Research/Genetic Toxicology and Environmental Mutagenesis, 518(2): 145-150. Guilherme, S., Gaivão, I., Santos, M.A., Pacheco, M. (2010) European eel (Anguilla anguilla) genotoxic and pro-oxidant responses following short-term exposure to Roundup
®: a glyphosate-based herbicide.
Mutagenesis, 25(5): 523-530. Hall, M. e Grover, P.L. (1990). Polycyclic aromatic hydrocarbons: metabolism, activation and tumour initiation, in: Cooper, C.S., Grover, P.L. (Eds.), Chemical Carcinogenesis and Mutagenesis, Springer, Heidelberg, Germany, pp. 327-372. Harris, A. L. (2002). Hypoxia-a key regulatory factor in tumour growth. Nature Reviews Cancer, 2(1): 38-47. Hochachka, P.W., e Somero, G.N. (2002). Biochemical Adaptation, Mechanism and Process in Physiological Evolution. Oxford University Press. USA, New York, 480pp. Inomata, Y., Kajino, M., Sato, K., Ohara, T., Kurokawa, J.I., Ueda, H., & Akimoto, H. (2012). Emission and atmospheric transport of particulate PAHs in Northeast Asia. Environmental science & technology, 46(9): 4941-4949. Intergovernmental Panel on Climate Change (IPCC). (2007). Summary for Policymakers. In: Solomon, S.;
Qin, D.; Manning, M., Chen, Z.; Marquis, M.; Averyt, K.B.; Tignor, M.; Miller, H.L. (Eds). Climate Change 2007: The 117 Physical Science Basis. Contribution of Working Group I to the Fourth Assessment Report of the Intergovernmental Panel on Climate Change. Cambridge University Press, Cambridge, United Kingdom and New York, United States of America. p. 1-17. International Agency for Research on Cancer (IARC), (2010). Some non-heterocyclic polycyclic aromatic hydrocarbons and some related exposures, Monogr Eval Carcinog Risks Hum 92: 765-771. International Agency for Research on Cancer (IARC), (2012) .Chemical Agent sand Related Occupations: A Review of Human Carcinogens .IARC Monographs on the Evaluation of Carcinogenic Risks to Humans 100F,111-138. Jensen, F.B., Nikinmaa, M., Weber, R.E., (1993). Environmental, perturbations of oxygen transport in teleost fishes: causes, consequences and compensations. In: Rankin, J.D., Jensen, F.B. (Eds.), Fish Ecophysiology. Chapman and Hall, London, pp. 161-179.
36
Jiang, Z.Y., Woolland, A.C.S., Wolf, S.P. (1991). Lipid hydroperoxide measurement by oxidation of Fe2+ in the presence of xylenol orange-comparison with TBA assay and on iodometric method. Lipids, 26:777-860.
Jiraungkoorskul, W., Upatham, E. S., Kruatrachue, M., Sahaphong, S., Vichasri-Grams, S., & Pokethitiyook, P. (2002). Histopathological effects of Roundup, a glyphosate herbicide, on Nile tilapia (Oreochromis niloticus). Science Asia, 28: 121-127. Juhasz, A.L., e Naidu, R. (2000). Bioremediation of high molecular weight polycyclic aromatic hydrocarbons: a review of the microbial degradation of benzo [a] pyrene. International Biodeterioration & Biodegradation, 45(1): 57-88. Kampen, E.J.; Zijlstra, W.G. 1964. Standartization of haemoglobinometry. In: Boroviczény, C. G. (Ed.) Erythrocytometric Methods and their standardization. Bibliotheca Haematologica, p.68-72.
Karami, A., Christianus, A., Ishak, Z., Shamsuddin, Z.H., Masoumian, M., & Courtenay, S.C. (2012). Use of intestinal Pseudomonas aeruginosa in fish to detect the environmental pollutant benzo [a] pyrene. Journal of Hazardous Materials, 215: 108-114.
Karol, I.L., Kiselev, A.A. and Frolkis, V.A. (2011). Indices of the Factors that Form Climate Changes of Different Scales. Atmospheric and Oceanic Physics, 47(4): 415–429.
Keen, J.H.,Habig, W.H., Jakoby, W.B. 1976. Mechanism for the several activities of the glutathione S-transferase. The Journal of Biological Chemistry, 251:6183-6188.
Kobayashi, S.C., Morikawa, Y., Hayashi, M., Sofuni, T. (1995). A comparison between manual microscopic analysis and computerized image analysis in the single cell gel electrophoresis assay MMS Community, 2 pp. 103-115. Kolpin, D.W., Thurman, E.M., Lee, E.A., Meyer, M.T., Furlong, E.T., Glassmeyer, S.T., (2006). Urban contributions of glyphosate and its degradate AMPA to streams in the United States. Science of the Total Environment, 354: 191-197. Law, S. H., Wu, R. S., Ng, P. K., Richard, M. K., & Kong, R. Y. (2006). Cloning and expression analysis of two distinct HIF-alpha isoforms–gcHIF-1alpha and gcHIF-4alpha–from the hypoxia-tolerant grass carp, Ctenopharyngodon idellus. BMC Molecular Biology, 7(1): 1. Lee, J. S., Park, E. H., & Choe, J. (1998). Nucleotide Sequence of Exon 2 to 4 of the R-ras Gene in the Hermaphroditic Fish Rivulus marmoratus. DNA Sequence, 8(4): 229-234. Lutz, P. L. and Nilsson, G. E. (1997). Contrasting strategies for anoxic brain survival – glycolysis up or down. Journal of Experimental Biology, 200: 411-419. Mangold, K., Chang, Y. J., Mathews, C., Marien, K., Hendricks, J., & Bailey, G. (1991). Expression of ras genes in rainbow trout liver. Molecular Carcinogenesis, 4(2): 97-102. Marchand, J., Tanguy, A., Charrier, G., Quiniou, L., Plee-Gauthier, E., & Laroche, J. (2006). Molecular identification and expression of differentially regulated genes of the European flounder, Platichthys flesus, submitted to pesticide exposure. Marine Biotechnology, 8(3): 275-294. Marcuschi, M., Espósito, T.S., Machado, M. F., Hirata, I.Y., Machado, M. F., Silva, M.V., ... & Bezerra, R. S. (2010). Purification, characterization and substrate specificity of a trypsin from the Amazonian fish
37
tambaqui (Colossoma macropomum). Biochemical and Biophysical Research Communications, 396(3): 667-673. Martin, T.K. e Tsui, L.M. Chu. (2003). Aquatic toxicity of glyphosate-based formulations: comparison between different organisms and the effects of environmental factors. Chemosphere, 52: 1189–1197. Maxwell, P.H., Dachs, G. U., Gleadle, J. M., Nicholls, L. G., Harris, A. L., Stratford, I. J., ... & Ratcliffe, P. J. (1997). Hypoxia-inducible factor-1 modulates gene expression in solid tumors and influences both angiogenesis and tumor growth. Proceedings of the National Academy of Sciences, 94(15): 8104-8109. McMahon, G., Huber, L. J., Stegeman, J. J., & Wogan, G. N. (1988). Identification of a c-Ki-ras oncogene in a neoplasm isolated from winter flounder. Marine Environmental Research, 24(1): 345-350.
Melstrom, L.G., Salabat, M. R., Ding, X.Z., Strouch, M.J., Grippo, P. J., Mirzoeva, S., ... & Bentrem, D. J. (2011). Apigenin down-regulates the hypoxia response genes: HIF-1α, GLUT-1, and VEGF in human pancreatic cancer cells. Journal of Surgical Research, 167(2): 173-181.
Michalani, Y.J. (1980). Técnica histológica em Anatomia Patológica, com instruções para o cirurgião, enfermeira e citotécnico. São Paulo: EPU. 277.
Mirande, J.M. (2010). Phylogeny of the family Characidae (Teleostei: Characiformes): from characters to taxonomy. Neotropical Ichthyology, 8(3): 385-568. Miyazaki, D.M.Y., Machado Neto, J.G., Castagnolli, N., (2004). Toxicidade aguda de triclorfon, partion metílico e glifosato para alevinos de tambaqui (Colossoma macropormum) e tambacu (C. macropormum X Piaractus mesopotamicus). In: Anais Encontro Brasileiro de Patologistas de Organismos Aquáticos (ENBRAPOA), Laguna. Maringá: Biblioteca Setorial da UEM. 8, 203. Modesto, K.A. e Martinez, C.B.R. (2010). Roundup
® causes oxidative stress in liver and inhibits
acetylcholinesterase in muscle and brain of the fish Prochilodus lineatus. Chemosphere, 78: 294–299. Moore, M. J., Smolowitz, R., Stegeman, J. J. (1989). Cellular alterations preceding neoplasia in Pseudopleuronectes americanus from Boston Harbor. Marine Environmental Research, 28(1-4): 425-429. Navarro, C.E.K.G. e Pachaly, J.R. 1994. Manual de hematologia veterinária. São Paulo: Varela. p. 74-75.
Nemoto, N., Kodama, K., Tazawa, A., Prince Masahito, Ishikawa, T. (1986). Extensive sequence homology of the goldfish ras gene to mammalian ras genes. Differentiation, 32: 17-23. Oliveira Ribeiro, C.A., Padrós, J., Valdez Domingos, F.X. , Akaishi, F.M., Pelletier, É. (2007). Histopathological evidence of antagonistic effects of tributyltin on benzo[a]pyrene toxicity in the Arctic charr (Salvelinus alpinus). Science of the Total Environment, 372: 549-553. Oliveira, A. M. Influência da temperatura ambiental e dos cenários climáticos futuros sobre os ácidos graxos ω-3 e ω-6 e desempenho zootécnico do tambaqui (Colossoma macropomum)/Alzira Miranda de Oliveira. Manaus: AM, 2014. xi+127p. Tese (doutorado) INPA, Manaus, 2014.Orientador: Dr. Adalberto Luís Val Área de concentração: Biologia de Água Doce e Pesca Interior. Passam, F. H., Alexandrakis, M. G., Kafousi, M., Fotinou, M., Darivianaki, K., Tsirakis, G., ... & Siafakas, N. M. (2009). Histological expression of angiogenic factors: VEGF, PDGFRα, and HIF-1α in Hodgkin lymphoma. Pathology-Research and Practice, 205(1): 11-20. Perugini, M., Visciano, P., Giammarino, A., Manera, M., Di Nardo, W., Amorena, M., (2007). Polycyclic aromatic hydrocarbons in marine organisms from the Adriatic Sea, Italy. Chemosphere, 66: 1904-1910.
38
Pfaffl, M.W. (2001). A new mathematical model for relative quantification in real-time RT PCR. Nucleic Acids Research, 29(9): 2003-2007.
Poleksic, V. e Mitrovic-Tutundžic V. (1994). Fish gills as a monitor of sublethal and chronic effects of pollution. IN: Müller, R.; Lloyd, R. Sublethal and chronic effects of pollutants on freshwater fish. Oxford: Fishing News Books. 30: 339-352.
Powell, W. H., & Hahn, M. E. (2002). Identification and functional characterization of hypoxia‐inducible
factor 2α from the estuarine teleost, Fundulus heteroclitus: Interaction of HIF‐2α with two ARNT2 splice
variants. Journal of Experimental Zoology, 294(1): 17-29. Pratilas, C. A. e Solit, D.B. (2010). Targeting the mitogen-activated protein kinase pathway: physiological feedback and drug response. Clinical Cancer Research, 16(13): 3329-3334. Pryor, S.C., e Barthelmie, R.J. (2010). Climate change impacts on wind energy: a review. Renewable and Sustainable Energy Reviews, 14(1): 430-437.
Rahman, M.S. e Thomas, P. (2007). Molecular cloning, characterization and expression of two hypoxia inducible factor alpha subunits, HIF-1a and HIF-2a, in a hypoxia tolerant marine teleost, Atlantic croaker (Micropogonias undulates). Gene, 396: 273-282. Reuther, G.W. e Der, C.J. (2000). The Ras branch of small GTPases: Ras family members don’t fall far from the tree. Current Opinion in Cell Biology, 12(2): 157-165. Radovanović, M.M., Ducić, V., & Mukherjee, S. (2014). Climate changes instead of global warming. Thermal Science, 18(3): 1055-1061. Rotchell, M.J., Lee J., Chipman, J.K. a Ostrander GK (2001) Structure, expression and activation of fish ras genes. Aquatic Toxicololy, 55:1-21.
Roy, N. K., Stabile, J., Seeb, J. E., Habicht, C., & Wirgin, I. (1999). High frequency of K‐ras mutations in
pink salmon embryos experimentally exposed to Exxon valdez oil. Environmental Toxicology and Chemistry, 18(7): 1521-1528. Rytkönen, K.T., Vuori, K. A., Primmer, C.R., & Nikinmaa, M. (2007). Comparison of hypoxia-inducible factor-1 alpha in hypoxia-sensitive and hypoxia-tolerant fish species. Comparative Biochemistry and Physiology Part D: Genomics and Proteomics, 2(2): 177-186. Sadauskas-Henrique, H., Duarte, R.M., Gagnon, M.M., & Almeida-Val, V.M.F. (2017). Validation of a suite of biomarkers of fish health in the tropical bioindicator species, tambaqui (Colossoma macropomum). Ecological Indicators, 73: 443-451. Saint-Paul, U. (1984). Physiological adaptation to hypoxia of a neotropical characoid fish Colossoma macropomum, Serrasalmidae. Environmental Biology of Fishes, 11(1): 53-62. Salazar-Lugo, R., Mata, C., Oliveros, A., Rojas, L.M., Lemus, M., Rojas-Villarroel, E. (2011). Histopathological changes in gill, liver and kidney of neotropical fish Colossoma macropomum exposed to paraquat at different temperatures. Environment Toxicology Pharmacology, 3: 490-495. Sancho, E., Cerón, J.J., Ferrando, M.D. (2000). Cholinesterase activity and hematological parameters as biomarkers of sublethal molinate exposure in Anguilla anguilla. Ecotoxicology Environment Saffety, 46: 81-86.
39
Schofield, C. J., e Ratcliffe, P. J. (2004). Oxygen sensing by HIF hydroxylases. Nature Reviews Molecular Cell Biology, 5(5): 343-354. Semenza, G. L. (2003). Targeting HIF-1 for cancer therapy. Nature Reviews Cancer, 3(10): 721-732. Semenza, G.L. (1999). Regulation of mammalian O2 homeostasis by hypoxia-inducible factor 1. Annual Review of Cell and Developmental Biology, 15(1): 551-578. Silva, A.G. (2004). Alterações histopatológicas de peixes como biomarcadores da contaminação aquática. Dissertação de Mestrado. Universidade Estadual de Londrina, Paraná.
Silva, J., Freitas, T.R.O., Marinho, J.R., Speit, G., Erdtmann, B. (2000). An alkaline single-cell gel electrophoresis (comet) assay for environmental biomonitoring with native rodents. Genetic and Molecula Biology, 23(1): 241-245.
Singh, N.P.; Mccoy, M.T., Tice, R.R. & Schneider, E.L.. (1988). A simple technique for quantitation of low levels of DNA damage in individual cells. Experimental Cell Research, 175:184-191.
Sogawa, K. e Fujii-Kuriyama, Y. (1997). Ah receptor, a novel ligand-activated transcription factor. Journal of Biochemistry, 122(6): 1075-1079. Soitamo, A.J., Råbergh, C.M., Gassmann, M., Sistonen, L., & Nikinmaa, M. (2001). Characterization of a Hypoxia-inducible Factor (HIF-1α) from Rainbow Trout accumulation of protein occurs at normal venous oxygen tension. Journal of Biological Chemistry, 276(23): 19699-19705. Soñanez-Organis, J.G., Rodriguez-Armenta, M., Leal-Rubio, B., Peregrino-Uriarte, A.B., Gómez-Jiménez, S., & Yepiz-Plascencia, G. (2012). Alternative splicing generates two lactate dehydrogenase subunits differentially expressed during hypoxia via HIF-1 in the shrimp Litopenaeus vannamei. Biochimie, 94(5): 1250-1260. Terova, G., Rimoldi, S., Cora, S., Bernardini, G., Gornati, R., Saroglia, M. (2008). Acute and chronic hypoxia affects HIF-1a mRNA levels in sea bass (Dicentrarchus labrax). Aquaculture, 279: 150-159. Tishkov, A. A. (2012). Biogeographical consequences of natural and anthropogenic climate changes. Biology Bulletin Reviews, 2(2), 132-140. Treinin, M., Shliar, J., Jiang, H., Powell-Coffman, J. A., Bromberg, Z., & Horowitz, M. (2003). HIF-1 is required for heat acclimation in the nematode Caenorhabditis elegans. Physiological Genomics, 14(1): 17-24. Thompson, E. D., Burwinkel, K. E., Chava, A. K., Notch, E. G., & Mayer, G. D. (2010). Activity of Phase I and Phase II enzymes of the benzo [a] pyrene transformation pathway in zebrafish (Danio rerio) following waterborne exposure to arsenite. Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology, 152(3): 371-378. Tudoran, M.A. e Putz, M.V. 2012. Chem Bull ‘‘Politehnica” Univ (Timisoara) 57 (71): 1 Val, A.L., Gomes, K.R.M., & de Almeida-Val, V.M.F. (2015). Rapid regulation of blood parameters under acute hypoxia in the Amazonian fish Prochilodus nigricans. Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology, 184: 125-131. Val, A.L. e Honczaryk, A. (1995). Criando peixes na Amazônia. Manaus: INPA (Editor), Manaus, Brasil. p.160. Val, A.L. and Almeida-Val, V.M.F. (1995). Fishes of the Amazon and their environment: physiological and biochemical features. Heidelberg: Springer-Verlag. 244pp.
40
Val, A.L., Wood, C.M., Wilson, R.W., Gonzalez, R.J., Patrick, M.L., Bergman, H.L., & Narahara, A. (1998). Responses of an Amazonian teleost, the tambaqui (Colossoma macropomum), to low pH in extremely soft water. Physiological and Biochemical Zoology, 71(6): 658-670. Val, A.L., (1995). Oxygen transfer in fish: morphological and molecular adjustments. Brazilian Journal of Medical and Biological Research, 28: 1119-1127. Varanasi, U., Stein, J.E., Nishimoto, M., 1989. Biotransformation and disposition of polycyclic aromatic hydrocarbons (PAH) in fish, in: Varanasi, U. (Ed.), Metabolism of Polycyclic Aromatic Hydrocarbons in the Aquatic Environment, CRC, Boca Raton, FL, pp. 94-149. Vásquez, K.L. Ontogenia das enzimas digestivas do tambaqui, Colossoma macropomum (CUVIER, 1818): subsídios para a aquicultura/Katherine López Vásquez. Manaus: AM, 2009. Tese (doutorado), Manaus, 2009.Orientador: Dr. Adalberto Luís Val Área de concentração: Biotecnologia. Vincent, F., Boer, J., Pfohl-Leszkowicz, A., Cherrel, Y., Galgani, F., (1998). Two cases of ras mutation are associated with liver hyperplasia in Callionymus lyra exposed to polychlorinated biphenyls and polycyclic aromatic hydrocarbons. Molecular Carcinogenesis, 21: 121–127. Virani, N.A., Rees, B.B. (2000). Oxygen consumption, blood lactate and inter- individual variation in the gulf killifish, Fundulus grandis, during hypoxia and recovery. Comparative Biochemical and Physiology A, 126: 397-405. Wang, C.D., Zhang, F.S. (1995). Effect of enviromental oxygen deficiency on embryos and larvae of bay scallop Argopecten irradians. Chinise Journal of Oceanolgy and Limnology, 13: 362-369. Wang, G.L., Jiang, B.H., Rue, E.A., Semenza, G.L. (1995). Hypoxia-inducible factor 1 is a basic helix–loop–helix–PAS heterodimer regulated by cellular O2 tension. Proceedings of the National Academy of Science, 92: 5510-5514. Wang, G.L., Semenza, G. (1993). Characterization of hypoxia-inducible factor 1 and regulation of DNA binding activity by hypoxia. Journal of Biological Chemistry, 268: 21513-21518. Weisberg, S. B., Thompson, B., Ranasinghe, J. A., Montagne, D. E., Cadien, D. B., Dauer, D. M., …& Word, J. Q. (2008). The level of agreement among experts applying best professional judgment to assess the condition of benthic infaunal communities. Ecological Indicators, 8(4): 389-394. Wenger, R.H., Kvietikova, I., Rolfs, A., Gassmann, M., Marti, H.H. (1997). Hypoxia inducible factor-1 alpha is regulated at the post-mRNA level. Kidney International, 51: 560-563. WHO – International Programme on Chemical Safety Glyphosate, 1994. Environmental Health Criteria 159 – Glyphosate. Williams, G.M., Kroes, R., Munro, I.C. (2000). Safety evaluation and risk assessment of the herbicide Roundup and its active ingredient, glyphosate, for humans. Regulatory Toxicology and Pharmacology, 31: 11-165. Zhong, H., De Marzo, A.M., Laughner, E., et al. (1999). Over expression of hypoxia-inducible factor 1a in common human cancers and their metastasis. Cancer Research. 59: 5830-5835.
41
Capítulo I
Ras oncogene and Hypoxia-inducible factor-1 alpha (hif-1α) expression in Amazon fish
Colossoma macropomum (Cuvier, 1818) exposed to benzo[a]pyrene.
Artigo aceito pela revista Genetics and Molecular Biology
42
Title
Ras oncogene and Hypoxia-inducible factor-1 alpha (hif-1α) expression in Amazon fish
Colossoma macropomum Cuvier, 1818 exposed to benzo[a]pyrene.
Running title
Ras hif-1α gene expression in fish
Author names and affiliations
Grazyelle Sebrenski da Silva1,2, Luciana Mara Lopes Fé1, Maria de Nazaré Paula da
Silva1, Vera Maria Fonseca de Almeida e Val1
1Laboratory of Ecophysiology and Molecular Evolution (LEEM), Brazilian National
Institute for Research in the Amazon (INPA). 69067-375 André Araújo Avenue, 2936,
Petrópolis. Manaus, AM, Brazil.
2Institute of Biological Science (ICB) in Amazon Federal University (UFAM), General
chrysene (Chr) and benzo[k]fluoranthene (BkF) who consists of strong responders that
show a full bell shaped dose–response relationship over a wide dose-range and with a
strong increase of EROD activity. Lu et al. (2009) also observed a bell-shape dose
response in their study with Carassius auratus in response to PAH, indeno[1,2,3-
cd]pyrene via intraperitoneal injection at dosages of 0.1, 1.0, 2.0, 5.0 and 10.0 (or 8.0)
mg/kg. The EROD activity at the highest dosage of indeno[1,2,3-cd]pyrene (10,0mg/kg)
resulted a decrease of fold induction, and glutathione S-transferase (GST) activity had
the same behavior. Bell-shaped curves have been reported for various in vitro and in
vivo systems after exposure to PAHs (Kennedy et al., 1996, Delesclue et al., 1997).
The majority of the works with ras genes is described for human (Maertens and
Cichowski, 2014). The studies with hif-1α are not different, they describe the expression
of the gene in human solid tumors, and in metastasis (Fraga and Medeiros, 2009), or
when they study this gene in fish species they explain its behavior in hypoxia condition
without a pollutant (Rissanen et al., 2006, Rimoldi et al., 2012). Ongoing studies in our
58
laboratory combining pollutants and hypoxia exposure, and exposure to different climate
scenarios will help to respond how these genes will behave under synergistic effects.
4. Conclusion
Amazonian fish have proven to be versatile as bioindicators of environmental
pollution, using both toxicology and genotoxicity markers. In the present work, we could
observe that the species C. macropomum is sensible to the B[a]P under acute
exposure. However, further studies are necessary to understand better the behavior of
the genes ras and hif-1α on the effects of contaminant as B[a]P. Thus, the exposure of
this species to this pollutant for a longer time and along with other environmental threats
is under development. This work contributed to essential data to further understand
these genes play a significant role in cell machinery especially when a contaminant is
involved. The mechanisms related in the overexpression of ras and hif-1α genes on the
intermediary concentration of B[a]P needs further explanation.
Acknowledgments
FAPEAM and CNPq supported this study through INCT-ADAPTA. We thank
Carolina Dultra Abrahim for her assistance in comet assay analyses. Thanks are also
due to the personnel of the Functional Histology Laboratory of the Federal University of
Amazonas for their support with the preparation of histological material.
59
References
Abdel-Moneim AM, Al-Kahtani MA and Elmenshawy OM (2012) Histopathological biomarkers in gills and liver of Oreochromis niloticus from polluted wetland environments, Saudi Arabia. Chemosphere 88: 1028–1035.
Agamy E (2012) Histopathological liver alterations in juvenile rabbit fish (Siganus canaliculatus) exposed to light Arabian crude oil, dispersed oil and dispersant. Ecotoxicol Environ Saf 75:171-179.
Bailey GS Selivonchick D and Hendricks J (1987) Initiation, promotion, and inhibition of carcinogenesis in rainbow trout. Environ Health Persp 71: 147–153. Bailey GS, Williams DE and Hendricks JD (1996). Fish models for environmental carcinogenesis. Environ Health Persp 104 (Suppl 1): 5–21. Bosveld ATC, de Bie PAF, van den Brink NW, Jongepier H, Klomp AV (2002) In vitro EROD induction equivalency factors for the 10 PAHs generally monitored in risk assessment studies in The Netherlands. Chemosphere 49:75–83.
Buhler DR and Williams DE (1989) Enzymes involved in metabolism of PAH by fish and other aquatic animals: oxidative enzymes (or phase I enzymes). In: Varanasi, U. (Ed.), Metabolism of Polyciclic Aromatic Hidrocarbons in the Aquatic Environment. CRC Press, Boca Raton, pp. 151–184. Cheng R, Bradford S, Barnes D, Williams D, Hendricks J and Bailey G (1997) Cloning, sequencing and embryonic expression of an N-ras proto-oncogene isolated from an enriched zebrafish (Danio rerio) cDNA library. Mol Mar Biol Biotechnol 6; 40–47. Costa PM, Chicano-Gálvez E, López Barea J, DelValls TA and Costa MH (2010) Alterations to proteome and tissue recovery responses in fish liver caused by a short term combination treatment with cadmium and benzo[a]pyrene. Environ Pollut 158: 3338-3346. Conney, A.H., Chang, R.L. , Jerina, D.M. Wei, , S.J. (1994). Studies on the metabolism of benzo[a]pyrene and dose-dependent differences in the mutagenic profile of its ultimate carcinogenic metabolite. Drugs Metabolism Reviews. 26 ,125–163. Couch JA (1975) Histopathological effects of pesticides and related chemicals on the livers of fishes. In: Ribelin, W.E., Migaki, G. (Eds.), The Pathology of Fishes. The University of Wisconsin Press, Madison, Wisconsin, pp. 559–584. Curtis LR, Garzon CB, Arkoosh M, Collier T, Myers MS Buzitis J and Hahn ME (2011) Reduced cytochrome P4501A activity and recovery from oxidative stress during subchronic benzo[a]pyrene and benzo[e]pyrene treatment of rainbow trout. Toxicol Appl Pharmacol 254: 1–7. Dehne N and Brüne B (2009). HIF-1 in the inflammatory microenvironment. Exp Cell Biol 315:1791 – 1797. Delesclue C, Ledirac N, de Sousa G, Pralvorio M, Botta-Fridlund D, Letreut Y, Rahmani R (1997) Comparative study of CYP1A1 induction by 3-methylcholanthrene in various human hepatic and epidermal cell types. Toxicol In Vitro 11:443–450.
Fraga A, Ribeiro R and Medeiros R (2009) Revisión – OncologíaHipoxia tumoral. Papel del factor inducible por hipoxia. Actas Urol Esp 33(9): 941-951. Frenzilli G, Nigro M and Lyons BP (2009) The Comet assay for the evaluation of genotoxic impact in aquatic environments. Mutat Res 681: 80–92.
60
Fricke NF, Stentiford G, Feist SW and Lang T (2012) Liver histopathology in Baltic eelpout (Zoarces viviparus) A baseline study for use in marine environmental monitoring. Mar Environ Res 82:1-14. Gao M, Li Y, Sun Y, Long J, Kong Y, Yang S and Wang Y (2011) A common carcinogen benzo[a]pyrene causes p53 overexpression in mouse cervix via DNA damage. Mutat Res 724: 69–75 Geng X, Feng J, Liu S, Wang Y, Arias C, Liu Z (2014) Transcriptional regulation of hypoxia inducible factors alpha (HIF-α) and their inhibiting factor (FIH-1) of channel catfish (Ictalurus punctatus) under hypoxia. Comp Biochem Physiol Part B 169: 38–50. Genten F, Terwinghe E and Dangy A (2009) Atlas of fish histology. Published by Science Publishers, Enfi eld, NH, USA, pp 92-98. Grivennikov SI, Greten FR, and Karin M (2010) Immunity, Inflammation, and Cancer. Cell 140: 883–899. Grabher C and Thomas AL (2006) Fishing for cancer models. Nat Biotechnol 24: 45 – 46. Harris CC, Vahakangas K, Newman MJ, Trivers GT, Shamsuddin A, Sinopoli N, Mann DL and Wright WE (1985). Detection of benzo[a]pyrene diol epoxide-DNA adducts in peripheral blood lymphocytes and antibodies to the adducts in serum from coke oven workers. Proceedings of the National Academy of Sciences of the USA 82: pp. 6672 - 6676. Health AG (1995) Water Pollution and Fish Physiology, vol. 2. CRC Lewis Publishers, Boca Raton, pp. 125–140. Hinton DE and Lauren OJ (1990) Liver Structural Alterations Accompanying Chronic Toxicity in Fishes: Potential Biomarkers of Exposure. Biomarkers of Environ- mental Contamination. Lewis Publishers, MI, pp. 12–68. Hinton DE, Segner H and Braunbeck T (2001) Toxic responses of the liver. In: Schlenk, D., Benson, W.H. (Eds.), Target Organ Toxicity in Marine and Fresh- water Teleosts, Taylor and Francis, London, pp. 224–268. Husøy A., Myers MS, and Goksøyr, A. (1996) Cellular localization of cytochrome P450 (CYP1A) induction and histology in Atlantic cod (Gadus morhua L.) and European flounder (Platichthys flesus) after environmental exposure to contaminants by caging in Sørfjorden, Norway. Aquat Toxicol 36(1): 53-74. IARC, International Agency for Research on Cancer (2012) A review of human carcinogens: chemical agents and related occupations. In: IARC Monographs on the Evaluation of Carcinogenic Risks to Humans, vol. 100 F, pp. 111-114. http:// monographs.iarc.fr/ENG/Monographs/vol100F/. Jaakkola MS and Jaakkola JJ (1997) Assessment of exposure to environmental tobacco smoke. Eur Respir J 10: 2384–2397. Jeong HJ, Lee HJ, Hong S, Khim JS, Shim WJ and Kim GB (2015) DNA damage caused by organic extracts of contaminated sediment, crude, and weathered oil and their fractions recovered up to 5 years after the 2007 Hebei Spirit oil spill off Korea. Mar Pollut Bull 95(1):452-7. Kennedy SW, Lorenzen A, Jones SP, Hahn ME, Stegeman JJ (1996) Cytochrome P4501A induction in avian hepatocyte cultures: a promising approach for predicting the sensitivity of avian species to toxic effects of halogenated aromatic hydrocarbons. Toxicol Appl Pharmacol 141:214–230. Kim II-Y and Hyun CH (2006) Comparative evaluation of the alkaline comet assay with the micronucleus test for genotoxicity monitoring using aquatic organisms. Ecotoxicol Environ Saf 64: 288–297.
Kobayashi, Sugiyama C, Morikawa Y, Hayashi M and T. Sofuni (1995) A comparison between manual microscopic analysis and computerized image analysis in the single cell gel electrophoresis assay MMS Community, 2 pp. 103–115. Lacaze E, Geffard O, Bony S, and Devaux, A. (2010) Genotoxicity assessment in the amphipod Gammarus fossarum by use of the alkaline Comet assay. Mut Res/Gen Toxicol Environ Mut 700(1): 32-38.
Lam SH et al. (2006) Conservation of gene expression signatures between zebrafish and human liver tumors and tumor progression. Nat Biotechnol 24: 73–75.
Latimer JS and Zheng J, (2003) The sources, transport, and fate of PAHs in the marine environment. In: Peter, E.T.D. (Ed.), Pahs: An Ecotoxicological Perspective, pp. 7–33. Lemiere S, Cossu-Leguille C, Bispo A, Jourdain M-J, Lanhers M-C, Burnel D and Vasseur P (2005) DNA damage measured by the single-cell gel electrophoresis (Comet) assay in mammals fed with mussels contaminated by the ‘Erika’ oil-spill. Mutat Res 581:11–21. Lima I, Peck MR, Rendón-Von Osten J, Soares AMVM, Guilhermino L and Rotchell JM 2008) Ras gene in marine mussels: A molecular level response to petrochemical exposure. Mar Pollut Bull 56: 633–640. Lu GE, Wang E-C, Zhu Z (2009) The Dose–Response Relationships for EROD and GST Induced by Polyaromatic Hydrocarbons in Carassius auratus Bull Environ Contam Toxicol 82:194–199. Maertens O and Cichowski K (2014) An expanding role for RAS GTPase activating proteins (RAS GAPs) in cancer. Adv Biol Regul 55:1–14. Malmstrom CM, Koponen K, Lindstrom-Seppa P and Bylund G (2004) Induction and localization of hepatic CYP4501A in flounder and rainbow trout exposed to benzo[a]pyrene. Ecotoxicol Environ Saf 58: 365–372.
Mangold K, Chang, YJ, Mathews C, Marien K, Hendricks J, and Bailey G (1991) Expression of ras genes in rainbow trout liver. Mol Carcin 4(2): 97-102.
Marcuschi M et al. (2010) Purification, characterization and substrate specificity of a trypsin from the Amazonian fish tambaqui (Colossoma macropomum). Biochem Biophys Res Commun 396: 667–673 Mathur DS (1975) Histopathological changes in the liver of fishes resulting from exposure to dieldrin and lindane. Toxicology 13: 109–110. Maxwell PH (2005) The HIF pathway in cancer Seminars. Cell Dev Biol 16: 523–530. Maxwell PH, Dachs GU, Gleadle JM, Nicholls LG, Harris AL, Stratford IJ, Hankinson O, Pugh CW and Ratcliffe PJ (1997) Hypoxiainducible factor-1 modulates gene expression in solid tumors and influences both angiogenesis and tumor growth, Proc. Natl. Acad. Meador JP, Stein, JE Reichert WL, and Varanas, U (1995) Bioaccumulation of polycyclic aromatic hydrocarbons by marine organisms. Rev Environ Contam Toxicol 143:79–165. Melstrom LG, Salabat MR, Ding X-Z, Strouch MJ, Grippo PJ, Mirzoeva S, Pelling JC, David J and Bentrem M (2011) Association for academic surgery Apigenin Down-Regulates the Hypoxia Response Genes: HIF-1a, GLUT-1, and VEGF in Human Pancreatic Cancer Cells. J Surg Res 167: 173–181.
Michel C, Bourgeault A, Palais F, Geffard A and Vincent-Hubert F (2013) Seasonal and PAH impacton DNA strand-break levels in gill softransplanted zebra mussels. Ecotoxicol Environ Saf 92: 18–26.
Moller AM, KorytarˇT, Kollner B, Schmidt-Posthaus H and Segner H (2014) The teleostean liver as an immunological organ: Intrahepatic immune cells (IHICs) in healthy and benzo[a]pyrene challenged rainbow trout (Oncorhynchus mykiss). Dev Comp Immunol 46: 518–529. Nath B and Szabo G (2012) Hypoxia and hypoxia inducible factors: diverse roles in liver diseases. Hepatol 55: 622–633. Nemoto N, Kodama K, Tazawa A, Masahito P and Ishikawa T (1986) Extensive sequence homology of the goldfish ras gene to mammalian ras genes Differentiation 32: 17-23. Nero V, Farwell A, Lister A, Van Der Kraak G, Lee LEJ Van Meer T MacKinnon MD and Dixon DG (2006) Gill and liver histopathological changes in yellow perch (Perca flavescens) and goldfish (Carassius auratus) exposed to oil sands process-affected water. Ecotoxicol Environ Saf 63: 365–377. Nogueira P, Pacheco M, Pereira ML, Mendo S and Rotchell JM (2010) Anchoring novel molecular biomarker responses to traditional responses in fish exposed to environmental contamination. Environ Pollut 158: 1783–1790. Nogueira PR, Lourenço J, Mendo S and Rotchell JM (2006) Mutation analysis of ras gene in the liver of European eel(Anguilla anguilla L.) exposed to benzo[a]pyrene. Mar Pollut Bull 52:1611–1616.
Oliveira Ribeiro CA, Padrós J, Valdez Domingos FX, Akaishi FM and Pelletier É (2007) Histopathological evidence of antagonistic effects of tributyltin on benzo[a]pyrene toxicity in the Arctic charr (Salvelinus alpinus). Sci Total Environ 372: 549–553. Ostrander GK and Rotchell JM (2005) Fish models of carcinogenesis. Biochemistry and Molecular Biology of Fishes. Elsevier B.V vol. 6, pp 255-288.
Padrós J, Pelletier É and Ciro Oliveira Ribeiro CA (2006) Metabolic interactions between low doses of benzo[a]pyrene and tributyltin in arctic charr (Salvelinus alpinus): a long-term in vivo study. Toxicol Appl Pharmacol 192:45–55
Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT PCR. Nucleic Acids Res 29(9): 2003-2007.
Poleksic V and Mitrovic-Tutundžic V (1994) Fish gills as a monitor of sublethal and chronic effects of pollution. IN: Müller, R.; Lloyd, R. Sublethal and chronic effects of pollutants on freshwater fish. Oxford: Fishing News Books. 30: 339-352.
Pryor WA and Stone K (1993). Oxidants in cigarette smoke. Radicals, hydrogen peroxide, peroxynitrate, and peroxynitrite. NY Acad. Sci. 68: 12–27. Rimoldi S, Terova G, Ceccuzzi P, Marelli S, Antonini M and Saroglia M (2012) HIF-1a mRNA levels in Eurasian perch (Perca fluviatilis) exposed to acute and chronic hypoxia Mol Biol Rep 39:4009–4015. Rissanen E, Tranberg HK, Sollid J, Nilsson GE and Nikinmaa M (2006) Temperature regulates hypoxia-inducible factor-1 (HIF-1) in a poikilothermic vertebrate, crucian carp (Carassius carassius). J Exp Biol 209: 994-1003. Rojo-Nieto E, Oliva, M, Sales D and Perales JA (2014) Feral finfish, and their relationships with sediments and seawater, as a tool for risk assessment of PAHs in chronically polluted environments. Sci Total Environ 470–47/ 1030–1039.
Rotchell MJ, Lee J, Chipman JK and Ostrander GK (2001) Structure, expression and activation of fish ras genes. Aquat Toxicol 55:1–21. Rytkönen TK, Ryynänen HJ, Nikinmaa M and Primmer CR (2008) Variable patterns in the molecular evolution of the hypoxia-inducible factor-1 alpha (HIF-1α) gene in teleost fishes and mammals. Gene 420: 1–10. Salazar-Lugo R, Mata C, Oliveros A, Rojas LM, Lemus M and Rojas-Villarroel E (2011) Histopathological changes in gill, liver and kidney of neotropical fish Colossoma macropomum exposed to paraquat at different temperatures. Environ Toxicol Pharmacol 3: 490–495. Sanchez-Arguello P, Aparicio N and Fernández C (2012) Linking embryo toxicity with genotoxic responses in the freshwater snail Physa acuta: Single exposure to benzo(a)pyrene, fluoxetine, bisphenolA, vinclozolin and exposure to binary mixtures with benzo(a)pyrene. Ecotoxicol Environ Saf 80: 152–160. Schweiki D, Itan A, Soffer D and Keshet E (1992) Vascular endothelial growth factor may mediate hypoxia-initiated angiogenesis. Nat 359: 843– 845. Semenza G L (2012) Hypoxia-inducible factors in physiology and medicine. Cell 148: 399–408. Siddiq A, Aminova LR, Ratan RR (2007) Hypoxia Inducible Factor Prolyl 4-Hydroxylase Enzymes: Center Stage in the Battle Against Hypoxia, Metabolic Compromise and Oxidative Stress Neurochem Res 32:931–946. Silva J, Freitas TRO, Marinho JR, Speit G and Erdtmann B (2000) An alkaline single-cell gel electrophoresis (comet) assay for environmental biomonitoring with native rodents. Gen Mol Biol 23(1): 241-245.
Singh NP, McCoy MT, Tice RR and Schneider EL (1988) A Simple technique for quantitation of low levels of DNA damage in individual cells. Exp Cell Res 175: 184-191.
Stehr CM, Johnson LL and Myers MS (1998) Hydropic vacuolation in the liver of three species of fish from the US West Coast: lesion description and risk assessment associated with contaminant exposure. Dis Aquat Org 32:119–135. Stentiford GD, Massoud MS, Al-Mudhhi S, Al-Sarawi M, Al-Enezi M and Lyons BP (2014) Histopathological survey of potential biomarkers for the assessment of contaminant related biological effects in species of fish and shellfish collected from Kuwait Bay, Arabian Gulf. Mar Environ Res 98: 60-67 Taylor PC and Sivakumar B (2005) Hypoxia and angiogenesis in rheumatoid arthritis. Curr Opin Rheumatol 17:293–298. Terova G, Rimoldi S, Corà S, Bernardini G, Gornati R and Saroglia M (2008) Acute and chronic hypoxia affects HIF-1α mRNA levels in sea bass (Dicentrarchus labrax). Aquaculture 279: 150–159. Tintos A, Gesto M, Miguez JM and Soengas JL (2008) b-Naphthoflavone and benzo(a)pyrene treatment affect liver intermediary metabolism and plasma cortisol levels in rainbow trout Oncorhynchus mykiss. Ecotoxicol Environ Saf 69:180–186. Tsukatani H, Tanaka Y, Sera N, Shimizu N, Kitamori S, Inoue N (2003) Validity of mutagenic activity as an indicator of river water pollution. Environ Health Prev Med 8: 133-138.
64
Val AL and Honczaryk A (1995). Criando peixes na Amazônia. Manaus: INPA (Editor), Manaus, Brasil. pp160. Van Beneden R J, Henderson KW, Blair DG, Papas TS and Gardner HS (1990) Oncogenes in hematopoietic and hepatic fish neoplasms. Cancer Res, 50(17 Supplement):5671s-5674s.
Varanasi U, Stein JE and Nishimoto (1989) Biotransformation and disposition of PAH in fish. In: Varanasi, U. (Ed.), Metabolism of Polycyclic Aromatic Hydrocarbon in the Aquatic Environment. CRC Press, Boca Raton, Florida, pp. 93–150. Vienneau DS, DeBoni U and Wells PG (1995) Initiation of micronuclei by benzo(a)pyrene and benzo(e)pyrene in UDP-glucuronosyltransferase-deficient cultured rat skin fibroblasts. Cancer Res 55: 1045-1051.
Yu RMK, Ng PKS, Tan T, Chu DLH, SunWu RS and Kong RYC (2008) Enhancement of hypoxia-induced gene expression in fish liver by the aryl hydrocarbon receptor (AhR) ligand, benzo[a]pyrene (BaP). Aquat Toxicol 90: 235–242.
Zhong H, De Marzo AM, Laughner E, et al. (1999) Over expression of hypoxia-inducible factor 1 in common human cancers and their metastasis. Cancer Res. 59: 5830– 5835.
65
Table 1. Details of each primer designed for candidate reference genes (28S and ef-1) and the two
target genes (ras and hif-1).
Gene
Symbol
Primer sequence (5`-3`) forward/reverse Length (bp)
Amplicon length(bp)
Tm Eff(%)a
28S-F
CGGGTTCGTTTGCGTTAC
18 150 54.5 98.19
28S-R
AAAGGGTGTCGGGTTCAGAT
20 150 56.3 98.19
ef-1F
GTTGGTGAGTTTGAGGCTGG
20 78 60.7 99.09
ef-1R
CACTCCCAGGGTGAAAGC
18 78 60.9 99.09
Ras-F
CCAGTACATGAGGACAGGAG
20 134 60.3 99.31
Ras-R
CAAGCACCATTGGCACATCG
20 134 60.3 99.31
HIF-1F
CTTCTGAGCTCTGATGAGGC
20 98 60.1 105.24
HIF-1R
GAAAGCACCATCAGGAAGCC
20 98 61.2 105.24
a. Primer efficiency
66
Figure 1. C. macropomum liver exposed to corn oil (control group). (A) Hepatocytes are organized in one
or two layers surrounded by sinusoides (black arrows). (B) Normal liver parenchyma, highlighting a vase
with red blood cells (asterisk). (C) Image of liver exposed to 8 mol/kg B[a]P evidencing the
hepatopancreas (asterisk) and sinusoide obstruction (white arrow). (D) Image of fish liver exposed to 8
mol/kg B[a]P, showing necrotic area (asterisk). (E) Image of liver exposed to 16mol/kg B[a]P showing
some hepatocytes without nucleus (white asterisk), sinusoidal dilatation (black arrows) and hemosiderin
(white arrow). (F) Image of vacuolated hepatocytes of fish exposed to 32 mol/kg B[a]P; the cytoplasm
degeneration (black asterisks) and picnoti nucleous (black arrow) are evident. Slides were stained with
Hematoxylin and Eosin.
67
Figure 2. Histopathological Alteration Index (HAI) of C. macropomum liver after exposure to different
injections of B[a]P. Indexes are in accordance with Poleksic and Mitrovic-Tutundsic (1994). *Indicates
significant differences compared to control group (corn oil) (P< 0.05).
68
Figure 3. Genetic Damage Index (GDI) in erythrocytes of C. macropomum after 96h of injection of
different concentrations of B[a]P. *Indicates significant differences compared to control group (corn oil)
(P< 0.05).
69
Figure 4. Relative expression of the oncogene ras in liver of C. macropomum after 96h of injection of
different concentrations of B[a]P. *Indicates significant difference in comparison to control group (P<0.05).
70
Figure 5. Relative expression of gene hif-1 gene in C. macropomum after 96h of injection of different
concentrations of B[a]P. *Indicates significant difference in comparison to control group (corn oil)
(P<0.05).
71
Capítulo II
Toxicological responses of Amazon fish Colossoma macropomum contaminated with
Benzo[a]pyrene are magnified by climate change scenario.
72
Title
Toxicological responses of Amazon fish Colossoma macropomum contaminated with
Benzo[a]pyrene are magnified by climate change scenario.
Running title
Climate Change, C. macropomum, Benzo[a]pyrene
Author names and affiliations
Grazyelle Sebrenski da Silva1,2, Luciana Mara Lopes Fé1, Lorena V. de Matos2,
Adalberto L. Val2 and Vera Maria Fonseca de Almeida e Val1
1Laboratory of Ecophysiology and Molecular Evolution (LEEM), Brazilian National
Institute for Research in the Amazon (INPA). 69067-375 André Araújo Avenue, 2936,
Petrópolis. Manaus, AM, Brazil.
2Institute of Biological Science (ICB) in Amazon Federal University (UFAM), General
(P<0.001). Thus, for both scenarios the fish injected with BaP had the HDI classification
as irreparable damage (Poleksic and Mitrovic-Tutundsic, 1994). No differences were
observed between fish kept at the two scenarios neither significant interation between
scenarios and treatments (Table 4).
Cellular and nuclear hypertrophies (Figure 5B) were alterations observed in low
(0+) and moderate frequency (+) for all treatments. Sinusoidal dilatation (Figure 6 B)
was frequent in fish injected with BaP (8 and 16 mol/kg). Nuclear vacuolization was
absent (0) in control group exposed in the current scenario, but appeared with low
frequence (0+) in all treatments in the extreme scenario (Figure 5C). Sinusoidal
dilatation and vessel congestion also occurred (Figure 5C and 6D). Another tissue
damage observed was pyknotic nuclei (Figure 6C). In fish injected with BaP, the
89
incidence of damages was irreparable, independent of the scenarios. The occurrence of
vacuolization (Figure 5F), cellular disrupts (Figure 5E and 6C) and necrosis was more
frequent (Figures 5D and 5E and Figure 6E and 6F).
3.5. Gene expression
The oncogene ras behaved differentially between the two studied scenarios.
However, we observed no differences in ras expression when BaP doses (0, 8 and 16
mol/kg) were considered in the current scenario. In the extreme scenario, though, BaP
doses had a positive effect on ras expression in liver. In fact, the injection of BaP at 8
mol/kg overexpressed ras oncogene was by 12.26-fold, and the injection of 16 mol/kg
overexpressed this gene by 8.23-fold (Figure 7A). The comparison of the same
treatments between the different scenarios showed an increase in the relative
expression of ras oncogene in the liver of animals exposed to the extreme scenario over
the animals at the current scenario. Ras oncogene was overexpressed 2.86-fold in fish
exposed to 8 mol/kg (P<0.001) of BaP and 2.46-fold in fish exposed to 16 mol/kg
(P<0.001) of BaP in extreme scenario compared to the current scenario (Figure 7A).
There was a statistically significant interaction between scenarios and treatments (8 and
16 mol/kg of Bap) (P <0.001).
No difference was observed in the relative expression of the gene hypoxia
inducible factor-1 in the livers of fish exposed to current scenario in all treatments.
However, in fish exposed to the extreme scenario, hif-was overexpressed 2.35-fold
in fish exposed to 8 mol/kg and 2.44-fold in fish exposed to 16 mol/kg of BaP. The
relative expression of hif- increased in C. macropomum treated with BaP at the
extreme scenario compared to current scenario. There was a significant interaction
between scenarios and treatments (8 and 16 mol/kg of BaP) (P = <0.001). Hif-1 was
overexpressed 11.82-fold and 9.81-fold in fish exposed respectively to 8 mol/kg and 16
mol/kg of BaP in the extreme scenario compared to the same treatments in fish kept at
the current scenario (Figure 7B).
90
3.6. Multivariate Analysis
Multivariate principal component analysis (PCA) after 30 days exposure revealed
the grouping of different variables. Distribution of PCA in biplot after 30 days exposure
(Figure 8) shows two groups: P1 is the scenarios (current scenario and extreme
scenario) and P2 is the treatments (0, 8, and 16 mol/kg of BaP) for the observed
variables. Most variables are clustered and well explained in fish exposed to the
extreme scenarios. Fish injected with 16 mol/kg of BaP explains the hematological
variables (Ht, MCH, MCV and MCHC), the liver histopathology, and the DNA damage.
Fish injected with 8 mol/kg of BaP grouped the variables Hb, RBC and glucose levels.
GST, CAT and LPO clustered together in P1, showing the influence of the current
scenario. Ras oncogene and hif-1are grouped together and are well explained by the
extreme scenario. All groups are compared and the variation among all parameters is
explained by P1=37% and P2=17%.
4. Discussion
Currently, there is a consensus that climate change is a global threat and a
challenge for the 21st century. A great deal of information is available demonstrating
how the increased temperature may affect aquatic ecosystems and living resources.
Many ecosystems are also affected by human releases of contaminants from land-
based sources or from the atmosphere, which also causes severe effects. So far, these
two significant stressors (climate change and pollutants) have been discussed
independently (Schiedek et al., 2007) and there is a lack of information about the joint
effects in ecosystems in general. Herein we analyzed the combined effect of the
carcinogenic pollutant benzo[a]pyrene adding the consequences of the increase in
atmospheric CO2 and temperature over the Amazon fish Colossoma macropomum
exposed to the extreme A2 scenario, as forecasted by IPCC (2007).
Hematological parameters are commonly used as an index to detect
physiological changes in many fish species and to assess structural and functional
health during stress conditions (Adhikari et al., 2004, Barcellos et al., 2004). In the
91
present study there was no alteration in Ht, Hb, RBC, MCV, CHCV in all treatments and
scenarios during the 30 days exposure. Oliveira and Val (2016), studying the influence
of four IPCC (2007) scenarios (B1, A1B, and A2) in C. macropomum without the
presence of a pollutant, observed an increase in Ht levels after 30 days exposition in
scenario A2. Kaya et al. (2016), studying Oreochromis mossambicus exposed to two
different temperature and carbon dioxide partial pressure levels for about two weeks,
observed in the group exposed to CO2 at 25 oC changes in hematology (RBC, Hb, Ht,
MCV, MCH, MCHC), but at the end of the first week (7days), the parameters returned to
the normal values at the end of the trial (14 days), what was explained by the operation
of the adaptation mechanism (Kaya et al., 2016). Similarly, in another study conducted
by Fivelstad et al. (2003) on Atlantic salmons, fish were exposed to 16 and 24 mg/L
CO2 for 57 days and, at the end of the test, no difference was detected in hematologic
parameters (Ht, Hb, and MCH) among experimental and control fish. Studyng the
Korean rockfish Sebastes schlegeli (Hilgendorf) exposed to 7,12-
dimethylbenzo(a)anthracene, Jee et al. (2006) showed a decrease in RBC, Hb and Ht
while the levels of MCH, MCHC and MVC revealed no difference from control.
In the present work, we observed an increase in MCH in the group of fish
exposed to 16 mol/kg of BaP in the extreme scenario in comparison with the control
group. No alteration in MCH was observed in the other treatments and scenarios.
Oliveira and Val (2016) also observe an alteration in MCH cells in C. macropomum
exposed to the various scenarios (B1, A1B, and A2); significant variations of MCH (P =
0.016) occurred at the 15 and the 30-days checkpoints. At the 15 days checkpoint, the
fish exposed to extreme scenario had an increase in MCH in comparison with the
current scenario, and after the 30 days exposure, the MCH decreased in fish exposed
to extreme scenario. In our study the contrary occurred; after 30 days exposure the
MHC was higher in fish exposed to extreme scenario and injected with 16 mol/kg of
BaP in comparison with the same treatment in the current scenario. Despite the studies
with PAH as 7,12dimethylbenz(a)anthracene and phenanthrene revealing a disruptive
action of the PAH on the erythropoietin tissue compromising the viability of the maturing
cells and haematological parameters (Jee and Kang 2004, Jee et al., 2006), in the
92
present work the single alteration observed was in fish treated with 16 mol/kg of BaP in
MCH parameter.
Physical, chemical and biological agents can act in the DNA, resulting in
mutation involved in cancer. Thus, genotoxic tests are required by regulatory agencies
to evaluate the potential risk of cancer. Among these tests, the Comet Assay (CA) is
commonly used (Araldi et al., 2015). CA also allows detecting breaks in DNA strands,
which can be visualized by the increased migration of free DNA segments, resulting in
images similar to comets, justifying the name of the assay (Azqueta and Collins, 2013).
The CA has been used in multiple freshwater and marine fish species as an indicator of
DNA damage (Yang et al., 2006, Winter et al., 2004, Bombail et al., 2001).
In the present study, we observed an increase of DNA strand breaks in blood
cells in fish exposed to BaP (8 and 16 mol/kg) in the current scenario, and a significant
difference between the treatments with BaP (8 and 16 mol/kg) in comparison with the
control in the extreme scenario. In comparison between the scenarios only fish injected
with 16 mol/kg of BaP and exposed to the extreme scenario presented an increase in
DNA damage. Flammarion and co-workers (2002) observed an increase of DNA
damage in chub (Leuciscus cephalus) erythrocytes from Mocella River (France)
exposed to areas contaminated with PAH. Izunza and co-workers (2006) also observed
high indices of DNA damage in Oncorhynchus mykiss erythrocytes in fish exposed to
sediment from two rivers contaminated by PAHs. They also showed that the average
comet length increased as the PAH concentration in the sediments increased. BaP is a
potent inducer of DNA damage, as demonstrated by Šrut and co-workers (2010) in
RTG-2 fish cell line after three days of exposure to a concentration range of model
genotoxic agent (BaP).
Climate changes can also affect de levels of DNA strand breaks in fish blood
cells as demonstrated by Lima (2016) in tambaqui exposed to IPCC (2007) scenarios.
Lima (2016) reported that tambaqui exposed for 30 days to both intermediate (A1B) and
extreme (A2) climate change scenarios revealed a significantly higher amount of DNA
damage in blood cells, evidenced by an average of 1.8-fold increase of GDI values, in
relation to fish in the current scenario at the same time of exposure. Our results are in
accordance with Lima (2016) since in extreme scenario fish exposed to 16 mol/kg of
93
BaP presented more DNA strand breaks in comparison with the same treatment in the
current scenario. Multivariate analysis also grouped the DNA damage results in the
concentration of 16 mol/kg of BaP in the extreme scenario, showing that these two
variables had a great influence in DNA strand breaks through comet assay. We may
suggest that the increase in temperature and CO2 in the extreme scenario (A2) may
influence the genotoxic effects of BaP in the higher dose and induce more DNA
damages. Anitha and co-workers (2000) exposed fish Carassius aurata to heat shock at
34 oC, 36 oC and 38 oC and observed an increase in DNA strand breaks in the highest
temperatures. Bruschini and colleagues (2003) also described the effect of increased
temperatures (4, 18, 28 and 37 oC) in mussels’ hemocytes (Dreissena polymorpha). The
data obtained in vivo showed an increased amount of DNA damage at increasing
temperatures in cells directly withdrawn from the mussels. The same authors suggested
that water temperature could alter DNA-damage baseline levels in mussels and suggest
that mussel sensitivity towards environmental pollutants could be temperature
dependent.
Carbon dioxide can also disturb the cell metabolism increasing the reactive
oxygen species (ROS) as demonstrated by Montalto and co-workers (2013) where SH-
SY5Y cell cultures were exposed to 15 mmHg CO2 had an increasing in ROS levels. An
increase in ROS levels serves as a sensor of oxidative stress and can readily damage
biological molecules including DNA (Ray et al., 2012, Sammour et al., 2009). The main
effect of ROS on cells is the damage of nucleic acids. Oxidative DNA damage occurs in
the form of strand breaks and base and nucleotide modifications (Waris and Ahsan
2006).
In the present study, we also evaluated the enzymatic reponse in C.
macropomum; GST and CAT activities, and LPO levels were investigated in fish liver.
There was no difference in GST activity between all treatments in fish exposed to the
current scenario. In the extreme scenario, GST activity had the same behavior as the
current scenario, where no difference was observed. There was a decrease in GST
activity in fish exposed to the extreme scenario in comparison to the current scenario of
2 to 3 fold, suggesting the malfunction of this organ regarding xenobiotic process, since
94
this enzyme acts in the Phase II of xenobiotic metabolism, acting in exogenous
compounds, derived or not from Phase I of biotransformation resulting in the increase of
contaminants solubility in the water and, consequently, in the increase of the removal
rate. An increase in GST activity indicates efficient disposal of such compounds in the
body (Rinaldi et al., 2002). GST activity increases are widely reported in the literature in
fish exposed to pollutants (Jeved et al., 2016, Mohanty and Samanta, 2016, Pereira et
al., 2013). Sadauskas-Henrique and co-workers (2017) observed an increase in GST
activity in C. macropomum acutely (96 h) exposed to BaP (1, 10 and 100 μmolar. Kg-1
of BaP). Conversely, Almeida and co-workers (2012) observed no differences in GST
activity of Dicentrarchus labrax L. exposed for 96h to BaP. Also, Beyer and colleagues
(1997) found no difference in GST activity of Platichthys flesus L. exposed to
benzo[a]pyrene; 2,3,3`,4,4`,5-hexachlorobiphenyl (PCB-156) and cadmium. Glutathione
S-transferase (GST) activities also remained unaffected by any of the treatments with
BaP (2, 4, 8, 16, 32, 64, 128 and 256 μg. L−1) in flatfish dab (Limanda limanda) (van
Shanke et al., 2000).
In the present work, the decrease in GST response was observed 30 days after
the injection at the extreme scenario; temperature and CO2 levels probably influenced
the decline in GST activity over the pollutant effect. Some authors suggest that there is
no involvement of GST in detoxifying the BaP (Collier and Varanasi 1991, Lemaire et
al., 1992). The increase of temperature influences parameters such as metabolic rate
and oxygen consumption, and frequently causes oxidative stress in the ectothermic
organisms (Bagnyukova et al., 2007). Thus, the induction of antioxidant defenses is an
essential part of the stress response against oxidative stress in biological systems
(Parihar et al., 1997). Our results are in accordance with Bagnyukova and co-workers
data (2007) where goldfish (Carassius aurata) were acutely moved from 3 to 23 oC,
and, as consequence, GST activities increased in the brain after 48 h exposure at the
warmest temperature, but decreased again to initial values by 120 h. Liver GST activity
was unaffected by the experimental conditions in goldfish.
Changes in environmental conditions such as thermal stress and pollution can
lead to oxidative stress in organisms by the production of Reactive Oxygen Species
(ROS) (Ahmed, 2005, Helliwel 1994). Aerobic organisms face challenges associated
95
with the formation of reactive oxygen species (ROS), including superoxide (O2•–),
hydroxyl radical (–OH) and the peroxyl radical (ROO•) (Halliwell and Gutteridge, 1999).
The challenges associated to ROS include several cellular components: lipids, proteins,
free amino acids, DNA, and carbohydrates (Toyokuni, 1999; Abele and Puntarulo,
2002). To cope with oxidative stress, the cell has a nonenzymatic and enzymatic
antioxidant system involved in many cellular reactions to removal of ROS (van der Oost
et al., 2003, Fang et al., 2002).
One of these enzymatic systems involves catalase (CAT). Catalase reduces
H2O2 to water, prevents oxyradical formation, and intercepts oxidative propagation
reactions promoted by the oxyradicals (Bainy et al. 1996). We didn’t observe any
alteration in CAT activity of fish injected with BaP in fish exposed to the current and
extreme scenario. Similar to GST, CAT activity decreased in all treatments in fish
exposed to the extreme scenario.
Catalase activity in the liver was not affected in Dicentrarchus labrax exposed in
vivo to chronic hydrocarbon pollution (Danion et al., 2014). Pan and co-workers (2009)
verified that the exposure to different concentrations of benzo(a)pyrene (BaP) (0.5 μg/L,
1.0 μg/L, 10.0 μg/L and 50.0 μg/L) in scallop Chlamys farreri for 30 days in seawater
resulted in the increase of CAT activity after 6 and 3 days exposure to 0.5 and 1.0 μg/L,
respectively, presenting a decrease to control levels after the entire experimental
period. The CAT activities of fish exposed to 10.0 μg/L and 50.0 μg/L BaP decreased
during the entire experimental period. In our experiment, we verified no change of CAT
activity. It is most probable that the CAT activity dropped to the control level at the end
of the 30 days due to cellular malfunction. No difference was observed in CAT activity
o in C. macropomum exposed to intraperitoneal injection of 1000 μmolar Kg-1 BaP for
96 h, as describe by Sadauskas-Henrique and collaborators (2017). Madeira and co-
workers (2013) described the effect of temperature (24 to 32 oC) in CAT activity in
Diplodus sargus, which presented significant changes in fish exposed to increasing
temperature; and in Diplodus vulgaris the opposite occurred, with a significant decrease
in fish exposed to higher temperature (2.6-fold decrease as temperature increased).
Some reactive oxygen species possess sufficient energy to initiate lipid
peroxidation in biological membranes, self-propagating reactions with the potential to
96
damage membranes by altering their physical properties and ultimately their function
(Crockett 2008). Some ROS can initiate lipid peroxidation (LPO), a self-propagating
process in which a peroxyl radical is formed when a ROS has sufficient reactivity to
abstract a hydrogen atom from an intact lipid (Halliwell and Gutteridge, 1999). The
membrane peroxidation reaction is initiated when there is a subtraction of allylic
hydrogen, carbon which is adjacent to the double bond, the ROS as ●OH, thereby
forming a lipid peroxy radical (L-OOH). Thus, a molecule ●OH can generate
propagation of the lipid peroxidation, which leads to changes in membrane fluidity and
permeability, impairing cell function and tissue of animals (Sadauskas-Henrique, 2015).
In the present work, we observed no change in hepatic LPO levels in fish
exposed to different concentration of BaP kept in the current scenario. Instead, in the
extreme scenario, fish exposed to BaP decrease LPO levels, again suggesting an
impairment of antioxidant defense of the cell. LPO levels declined in all treatments at
the extreme scenario in comparison with the same treatments of the current scenario.
Several works had related a different result for LPO levels in fish exposed to pollutants,
increasing the lipid peroxidation products (Choi and Oris 2000, Sayeed et al., 2003).
Almeida and co-workers (2012) observed high LPO levels in Dicentrarchus labrax L.
exposed to BaP for 96 h. The same was observed by Sadauskas-Henrique and
collaborators (2017) where an increase in LPO levels occurred in C. macropomum
exposed acutely to BaP Injection. Similar to our findings, some authors described low
LPO levels; Solé and co-workers (2008) reported no difference in LPO levels of 8 fish
species (Pagellus acarne, Mullus barbatus, Merluccius merluccius, Trisopterus minutus,
Micromesistius poutassou, Phycis blennoides, Trachyrhynchus scabrous and Galeus
melastomus) sampled in a polluted area in Barcelona coast (NW Mediterranean Sea).
Sagerup and co-workers (2016) verified the biological effects of marine diesel oil
exposure in red king crab (Paralithodes camtschaticus); lipid peroxidation levels in the
low and high exposure groups were significantly lower.
Our results suggest that the extreme scenario in tambaqui injected with BaP
influenced the LPO levels. Madeira and co-workers (2013) verified no alteration in LPO
levels in Diplodus vulgaris exposed to high temperatures. The same authors suggest
that the response is species specific and cannot be generalized to untested organisms
97
(Madeira et al., 2013). Oliveira (2014), studying the levels of stearoyl-CoA (SCD) gene
expression in C. macropomum exposed to different IPCC (2007) scenarios, proposed
that elevation of the temperature and CO2 can alter the lipid properties of the biological
membranes. The effects of temperature and CO2 in SCD influence the physical
properties of lipid complex systems, particularly membrane phospholipids, triglycerides
and cholesterol, which can result in changes of membrane fluidity and lipid metabolism.
Histopathological indicator is a useful tool for fish health monitoring. Histological
analyses provide information about the effects of contaminants in a particular organ and
are also relevant for the assessment of fish stress (Rašković et al., 2013, van der Oost
et al., 2003, Schwaiger et al., 1997). In the present work, we observed an increase liver
damage in C. macropomum exposed to BaP in both scenarios (current and extreme),
and, in opposition of the gene expression results, there was no effect of the extreme
scenario exposure. In fact, fish from both scenarios and exposed to BaP presented
cellular vacuolization, deformation in cell shape, nuclear degeneration, cytoplasmic
degeneration and cell disruption. Leite and co-workers (2015) observed cytoplasmic
vacuolization, nucleus abnormally located in the cell periphery and changes in cell
shape in Oreochromis niloticus exposed to high doses of water-soluble fraction (WSF).
These are considered responses to stressors since they are indicative of the functional
activation of this organ. Cellular vacuolization is an alteration described after
contamination of a lot of pollutants as organophosphorus (Fanta et al., 2003), chromium
(Mishra and Mohanty 2008), paraquat (Salazar-lugo et al., 2011) and heavy oil (Pal et
al., 2011). Cytoplasmic vacuolization is usually produced by deposition of glycogen and
lipids (Myers et al., 1987), which will eventually lead to the displacement and
deformation of the nucleus (Holm et al., 1991).
The most relevant histological alterations observed in the liver of Prochilodus
lineatus exposed to WSD were biliary stagnation, nuclear and cellular degeneration
(Simonato et al., 2008). We also observed nuclear and cellular degeneration in C.
macropomum exposed to BaP. In our experiment, fish injected with BaP showed
necrosis and leucocytes infiltration. Khan (1998) found necrosis in winter flounder
(Pleuronectes americanus) sampled next to a petroleum refinery. Necrosis was
frequently recorded in the BaP-exposed rainbow trout, often accompanied by massive
98
infiltration with inflammatory cells (Malmstrom et al., 2004). Herein, the observed HP in
C. macropomum indicates that this species is sensible to BaP exposure so that necrosis
occur impairing the proper function of the organ, what is evidenced by our enzyme
measurements.
Oncogenes are altered cellular genes that disrupt the control systems of cell
growth and cell differentiation and, in this way, contribute to the development of cancer
cells (Bishop, 1987). The ras oncogene is considered one of the most important genes
involved in multistep carcinogenesis (Bos, 1989). Ras genes are a ubiquitous eukaryotic
gene family identified in mammals, birds, fishes, insects, mollusks, plants, fungi, and
yeasts. Sequence analysis of these genes and their products has revealed a high
degree of conservation, which suggests that they may play a fundamental role in
cellular proliferation (Barbacid, 1987). Ras genes have been characterized in several
fish species, and they all had a high degree of nucleotide sequence and deduced amino
acid similarity with the mammalian ras gene (Rotchell et al., 2001, Vincent et al., 1998).
In the present work we observed, exposure to different BaP dosages at the
current scenario caused no difference in ras oncogene expression. Nogueira and co-
workers (2006) described similar results studying European eel (Anguilla anguilla L.)
exposed during one month to BaP; no mutations or changes in ras oncogene
expression levels occurred compared to control fish. Later, Nogueira and co-workers
(2010) also found no alteration in ras oncogene expression in the liver of Dicentrarchus
labrax and Liza aurata colected in a contaminated coastal lagoon from River Aveiro,
Portugal.
Conversely, the exposure to the future scenario caused an increase in ras
oncogene expression in C. macropomum injected with BaP (8 and 16 mol/kg)
suggesting that the extreme increase in the mean temperature and CO2 magnified the
effects of this HPA, one of the strongest pollutant derived from petroleum. Most works
with fish ras oncogene describe the hot spots for the mutation that can induce cancer
(Cronin et al., 2002, Vincent et al., 1998, Torten et al., 1996). Ras gene mutation is
considered to develop cancer, and its overexpression is the second mechanism
implicated in carcinogenesis (Nogueira et al., 2006). In a previous experiment, we
verified the overexpression of ras oncogene on the liver of C. macropomum acutely
99
exposed to 8 and 16 mol/kg of BaP (96 h) (Silva et al., accepted for publication). Lee
and co-workers (2006) described the up-regulation of c-K-ras (long form) in the liver of
Rivulos mamoratus treated with a 4-nonylphenol endocrinal disruptor, but there was no
significant up-regulation of c-Ki-ras (short form). R-ras gene was also up-regulated on
the liver of Kryptolebias marmoratus after exposure to an endocrine-disrupting
chemical. The authors showed that the liver showed the highest level of expression
compared to other tissues, even though each R-ras gene showed different expression
patterns in tissues (Rhee et al., 2009).
Another gene involved in neoplasia development is the hypoxia inducible factor-
1 (hif-1). Most of the works with hif-1 expression in fish are related to environmental
hypoxia (Rimoldi et al., 2012, Shen et al., 2010). However, this gene is also related to
the development of tumor and is overexpressed in the cancer cellular environment
(Wong et al., 2003, Law et al., 2008). Herein, we observed no alteration in hif-1
expression in fish exposed to different treatments of BaP in the current scenario.
However, hif-1 was overexpressed in fish injected with BaP and exposed to extreme
scenario, both compared to fish injected with corn oil (control), and with fish with similar
treatments in the current scenario. Yu and co-workers (2008) examined the expression
of four hypoxia-responsive genes (HIF-1-mediated) – igfbp (insulin-like growth factor
binding protein), epo (erythropoietin), ldh-a (lactate dehydrogenase-a isoform) and vegf
(vascular endothelial growth factor) in the orange-spotted grouper (Epinephelus
coioides) upon single and combined exposures to BaP and hypoxia. BaP in normoxic
condition did not induce the expression of any of the above-mentioned genes. Instead,
we observed an overexpression of hif-1 on the liver of C. macropomum acutely
exposed to BaP (4, 8, 16 mol/kg) in normoxic environment (Silva et al., accepted for
publication).
In the present work, we observed an increase on the relative expression of ras
oncogene and hif-1 gene in fish injected with BaP and exposed to the extreme
scenario compared with fish exposed to BaP in the current scenario, what was
corroborated by the PCA analysis. The effect of increased temperature and CO2 is
manifested at all levels in the organism, from genes to behavior; and changes in
100
temperature over diel or seasonal periods induce shifts in a variety of gene transcripts
expression levels that result in numerous metabolic and hormonal adaptations
(Hochachka and Somero, 2002). Moreover, temperature-driven gene expression
changes in fish adapted to differing thermal environments are constrained by the level
of gene pleiotropy, estimated by either the number of protein interactions or gene
biological processes (Papakostas et al., 2014). This must be the case of both genes
studied herein; oncogene ras and hif-1, which, as already mentioned, are responsible
by the control of a series of other gene transcripts.
Rissanen and co-workers (2006) verified the effect of different temperatures (8,
18 and 26 oC) over HIF-1 in crucian carp (Carassius carassius). Temperature had a
significant effect on HIF-1 protein amounts in the liver and gills of crucian. In the heart,
acclimation to cold (8 °C) increased HIF-1a protein amounts slightly, but not
significantly. Mladineo and Block (2009), studying the effects of chronic warm (23 oC)
and cold (15 oC) exposure in bluefin tuna (Thunnus sp), observed an increase in the
amount of hif-1 transcripts in liver. No information is available in the literature
regarding the effects of temperature on ras oncogene expression in fish. However it is
already known that temperature influences the patterns of gene expression (Hochachka
and Somero, 2002; Gutierrez de Paula et al., 2014). As occured with hif-1a relative
expression in C. macropomum injected with BaP, an increase in ras relative expression
was observed in fish injected with BaP and exposed to the extreme scenario, where the
temperature is 4.5 degrees higher than the current scenario. Eisenmann and Kim
(1997) described the substitution of leucine (L) by phenylalanine (F) at amino acid 19, a
conserved residue of H-Ras, after the in vivo exposure to different temperatures (15 o,
20 o, 24 o, 37 o and 42 oC); finding a temperature-dependent GTPase activity. In the
present work, the new scenario, where temperature was increased, magnified the
effects of BaP on oncogene ras and hif-1 gene expression. Temperature is generally
assumed to be positively correlated with toxic effects. This has been attributed to
increased uptake and increased accumulation of the toxicant at higher temperatures
(Holmstrup et al., 2010). Herein we evaluated the combination of increased
temperature, CO2 and pollutant, what may be a dangerous threat in the near future for
101
fish of the Amazon due to both ongoing climate changes and increased pollution
activities.
In the current scenario there was not an increase in gene expression in
oncogene ras and hif-1 in fish injected with BaP in comparison with the control.
Otherwise, the GST and CAT activity and LPO levels were higher than fish under the
same treatments exposed to the extreme scenario. The activity of enzymes contributes
to cellular maintenance even in treatments where the fish received BaP injection and
tissue damage was severe.
5. Conclusions
The present work shows that climate changes as proposed by IPCC (2007) in the
extreme scenario (A2) magnifies the action of the contaminant (BaP), increasing the
expression of the ras oncogene and hif-1 gene. Overexpression of both genes in the
extreme scenario in fish injected with BaP can be explained by the increased metabolic
demands of the liver for maintaining cellular integrity since ras is involved with the
control of the cell cycle, and hif-1 participates in cell proliferation and erythropoiesis.
The increase in ras oncogene and hif-1 expression compensates for the low
responses of GST, CAT, and LPO, helping to maintain cell survivor since liver tissue in
fish injected with BaP in the extreme scenario was greatly injured. After 30 days
exposuer to climate changes, the biomarkers GST, CAT, and LPO did not present
differences in the extreme scenario, showing maladaptive responses to oxidative stress
that needs to be better understood. The blood cells DNA strand breaks were expected
in fish exposed to BaP, but the effect of the A2 (IPCC, 2007) scenario magnified the
genotoxicity in fish injected with 16mol/kg BaP. Irreparable tissue damage occurred in
both scenarios, where fish exposed to BaP presented necrosis. So, fish cellular
defenses to BaP were diminished as fish were kept in the extreme scenario due to
magnification of some damages, and impairment of antioxidant metabolism. As a
consequence, the overexpression of ras and hif-1 was the way the cells responded to
keep fish survival in such conditions. Further studies are needed to find out these
responses in a prolonged period under such extreme scenario.
102
Acknowledgments: FAPEAM and CNPq supported this study through INCT-ADAPTA
grant to ALV. We thank Julie Andrez de Andrade Paredes and Juliana Freitas their
assistance in realize the experiment. Thank for SERPROR for the donation of the fish
used in the experiment. Thanks are also due to the personnel of the Functional
Histology Laboratory of the Federal University of Amazonas for their support with the
preparation of histological material.
6. References
Abele, D., Heise, K., Pörtner, H. O., & Puntarulo, S. (2002). Temperature-dependence of mitochondrial function and production of reactive oxygen species in the intertidal mud clam Mya arenaria. Journal of Experimental Biology, 205(13), 1831-1841. Adhikari, S., Sarkar, B., Chatterjee, A., Mahapatra, C. T., & Ayyappan, S. (2004). Effects of cypermethrin and carbofuran on certain hematological parameters and prediction of their recovery in a freshwater teleost, Labeo rohita (Hamilton). Ecotoxicology and Environmental Safety, 58(2), 220-226. Ahmed, R.G., 2005. Is there a balance between oxidative stress and antioxidant defense system during development? MJIAS 15 (2), 55–63. Almeida J.R.; Gravato C. and Guilhermino L. (2012). Biological parameters towards polycyclic aromatic hydrocarbons pollution: A Study with Dicentrarchus labrax L. Exposed to the Model Compound Benzo(a)pyrene. Water Air and Soil Pollution, 223(8):4709-4722. Anitha, B., Chandra, N., Gopinath, P. M., & Durairaj, G. (2000). Genotoxicity evaluation of heat shock in gold fish (Carassius auratus). Mutation Research/Genetic Toxicology and Environmental Mutagenesis, 469(1), 1-8.
Araldi, R.P., de Melo, T.C., Mendes, T.B., de Sa Junior, P.L., Nozima, B.H.N., Ito, E.T., de Cassia Stocco, R. (2015). Using the comet and micronucleus assays for genotoxicity studies: a review. Biomedicine & Pharmacotherapy, 72: 74-82.
Azqueta, A. and Collins, A.R. (2013). The essential comet assay: a comprehensive guide to measuring DNA damage and repair. Archives of toxicology, 87(6): 949-968.
Bagnyukova, T.V., Lushchak, O.V., Storey, K.B., & Lushchak, V.I. (2007). Oxidative stress and antioxidant defense responses by goldfish tissues to acute change of temperature from 3 to 23 C. Journal of Thermal Biology, 32(4), 227-234. Bainy, A., Saito, E., Carvalho, P., Junqueira, V. (1996) Oxidative stress in gill, erythrocytes, liver and kidney of Nile tilapia (Oreochromis niloticus) from a polluted site. Aquatic Toxicology. 34:151–162. Barbacid, M. (1987). Ras genes. Annual review of biochemistry, 56(1), 779-827.
Barcellos, L.J.G., Kreutz, L.C., Souza, C., Rodriguez, L.B., Fioreze, I., Quevedo, R.M., Cericato, L., Soso, A.B., Fagundes, M., Conrad, J., Lacerda, L.A., Terra, S. (2004). Haematological changes in Jundia
103
(Rhamdia quelen) after acute and chronic stress caused by usual aquacultural management, with emphasis on immunosuppressive effects. Aquaculture, 237: 229–236.
Beutler, E. (1975). Red Cell Metabolism: A manual of biochemical methods. Grune & Straton, New York.
Bos, J.L., 1989. Ras oncogenes in human cancer: a review. Cancer Research, 49: 4682–4689. Beyer, J., Sandvik, M., Skare, J. U., Egaas, E., Hylland, K., Waagbo, R., & Goksoyr, A. (1997). Time-and dose-dependent biom arker responses in flounder (Platichthys flesus L.) exposed to benzo [a] pyrene, 2, 3, 3′, 4, 4′, 5-hexachlorobiphenyl (PCB-156) and cadmium. Biomarkers, 2(1), 35-44. Bishop, J.M. (1987) The molecular genetics of cancer, Science. 235: 305-311. Bombail, V., Aw, D., Gordon, E., Batty,J. (2001) .Application of the comet and micronucleus assay to butter fish (Pholis gunnellus) erythrocytes from the Firth of Forth, Scotland. Chemosphere, 44: 383–392.
Bos, J.L. (1988). The ras gene family and human carcinogenesis. Mutation Research/Reviews in Genetic Toxicology, 195(3), 255-271. Boyd, C.E.; Tucker, C.S. (1992). Water quality and pond soil analysis for aquaculture. Auburn: Auburn University. 183p.
Bradford, M.M. (1976). A rapid and sensitive method for the quantification of microgram quantities of
protein utilizing the protein-dye binding. Analytical Biochemistry, 72:248-254.
Brandão, R.M.L. Efeitos do hormônio do crescimento recombinante bovino (rbgh lactotropin
®) na
expressão do gene igf-i e parâmetros fisiológicos em juvenis de tambaqui (Colossoma macropomum)/ Rúbia Maielli Lima Brandão. Dissertação (mestrado) Newton Lins, Manaus, 2015. Orientador: Dra.Vera Maria Fonseca de Almeida e Val. Área de concentração: Aquicultura. Brow, B.A. 1976. Hematology: principles and procedures. 2ª ed. Philadelphia. Lea & Febiger.
Buschini, A., Carboni, P., Martino, A., Poli, P., & Rossi, C. (2003). Effects of temperature on baseline and genotoxicant-induced DNA damage in haemocytes of Dreissena polymorpha. Mutation Research/Genetic Toxicology and Environmental Mutagenesis, 537(1), 81-92. Cavas, T. (2011). In vivo genotoxicity evaluation of atrazine and atrazine–based herbicide on fish Carassius auratus using the micronucleus test and the comet assay. Food and Chemical Toxicology, 49(6), 1431-1435.
Choi, J., and Oris, J. T. (2000). Anthracene photoinduced toxicity to plhc‐1 cell line (Poeciliopsis lucida)
and the role of lipid peroxidation in toxicity. Environmental toxicology and chemistry, 19(11), 2699-2706. Collier T.K. & Varanasi U. (1991). Hepatic activities of xenobiotic metabolizing enzymes and biliary levels of xenobiotics in English sole (Parophrys vetulus) exposed to environmental contaminants. Archives of Environmental Contamination Toxicology, 20:462–73.
Comte, L., Buisson, L., Daufresne, M., & Grenouillet, G. (2013). Climate‐induced changes in the
distribution of freshwater fish: observed and predicted trends. Freshwater Biology, 58(4), 625-639. Crockett, E.L. (2008). The cold but not hard fats in ectotherms: consequences of lipid restructuring on susceptibility of biological membranes to peroxidation, a review. Journal of Comparative Physiology B, 178(7), 795-809.
104
Cronin, M.A., Wickliffe, J.K., Dunina, Y., Baker, R.J. (2002). K-ras oncogene DNA sequences in pink salmon in streams impacted by the Exxon Valdez oil spill: no evidence of oil-induced heritable mutations. Ecotoxicology, 11: 233–241. Cui, H., Grosso, S., Schelter, F., Mari, B., and Krüger, A. (2012). On the pro-metastatic stress response to cancer therapies: evidence for a positive co-operation between TIMP-1, HIF-1α, and miR-210. Frontiers in pharmacology.3: 134. Danion, M., Le Floch, S., Lamour, F., & Quentel, C. (2014). EROD activity and antioxidant defenses of sea bass (Dicentrarchus labrax) after an in vivo chronic hydrocarbon pollution followed by a post-exposure period. Environmental Science and Pollution Research, 21(24), 13769-13778.
Eisenmann, D.M., & Kim, S.K. (1997). Mechanism of activation of the Caenorhabditis elegans ras homologue let-60 by a novel, temperature-sensitive, gain-of-function mutation. Genetics, 146(2), 553-565. Elith J., Kearney M. & Phillips S. (2010) The art of modeling range-shifting species. Methods in Ecology and Evolution. 1: 330–342. Fang, Y. Z., Yang, S., & Wu, G. (2002). Free radicals, antioxidants, and nutrition. Nutrition, 18(10), 872-879. Fanta, E., Rios, F. S. A., Romão, S., Vianna, A. C. C., & Freiberger, S. (2003). Histopathology of the fish Corydoras paleatus contaminated with sublethal levels of organophosphorus in water and food. Ecotoxicology and environmental safety, 54(2), 119-130. Ficke, A.D., Myrick, C.A., & Hansen, L.J. (2007). Potential impacts of global climate change on freshwater fisheries. Reviews in Fish Biology and Fisheries, 17(4), 581-613. Fivelstad, S., Waagbø, R., Zeitz, S.F., Hosfeld, A.C.D., Olsen, A B., & Stefansson, S. (2003). A major water quality problem in smolt farms: combined effects of carbon dioxide, reduced pH and aluminium on Atlantic salmon (Salmo salar L.) smolts: physiology and growth. Aquaculture, 215(1): 339-357. Flammarion, P., Devaux, A., Nehls, S., Migeon, B., Noury, P., & Garric, J. (2002). Multibiomarker responses in fish from the Moselle River (France). Ecotoxicology and environmental safety, 51(2), 145-153. García-Tavera, J.L., Valdés-Lozano, D., Poblete-Naredo, I., Albores-Medina, A., & Zapata-Pérez, O. (2013). Bile benzo [a] pyrene concentration and hepatic CYP1A induction in hypoxic adult tilapia (Oreochromis niloticus). Chemosphere, 92(1), 16-23. González-Doncel, M., González, L., Fernández-Torija, C., Navas, J. M., & Tarazona, J. V. (2008). Toxic effects of an oil spill on fish early life stages may not be exclusively associated to PAHs: studies with Prestige oil and medaka (Oryzias latipes). Aquatic Toxicology. 87(4): 280-288.
Goulding, M., & Carvalho, M. L. (1982). Life history and management of the tambaqui (Colossoma macropomum, Characidae): an important Amazonian food fish. Revista Brasileira de Zoologia, 1(2), 107-133. Gouveia, C., Liberato, M.L.R., DaCamara, C.C., Trigo, R.M., & Ramos, A.M. (2011). Modelling past and future wine production in the Portuguese Douro Valley. Climate Research, 48(2-3), 349-362. Gouveia, C., Trigo, R.M., DaCamara, C. C., Libonati, R., & Pereira, J. (2008). The North Atlantic oscillation and European vegetation dynamics. International Journal of Climatology, 28(14), 1835-1847.
105
Gutierrez de Paula, T. de Almeida, F. L. A., Carani, F. R., Vechetti-Junior, I. J., Padovani, C. R., Salomão, R. A. S., ... & Dal-Pai-Silva, M. (2014). Rearing temperature induces changes in muscle growth and gene expression in juvenile pacu (Piaractus mesopotamicus). Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology, 169, 31-37. Halliwell, B. (1994). Free radicals, antioxidants, and human disease: curiosity, cause, or consequence?. The lancet, 344(8924), 721-724. Hochachka, P. W., & Somero, G.N. (2002). Biochemical Adaptation, Mechanism and Process in Physiological Evolution Oxford University Press. USA, New York. Hofmann, G.E. & Todgham, A.E. (2010). Living in the now: physiological mechanisms to tolerate a rapidly changing environment. Annual Review of Physiology, 72: 127–145.
Holm, G., Norrgren, L., & Lindén, O. (1991). Reproductive and histopathological effects of long‐term
experimental exposure to bis (tributyltin) oxide (TBTO) on the three‐spined stickleback, Gasterosteus
aculeatus Linnaeus. Journal of fish biology, 38(3), 373-386.
Holmstrup, M., Bindesbøl. A-M., Oostingh, G.J., Duschl A., Scheil V., et al. (2010) Interactions between effects of environmental chemicals and natural stressors: A review. Science of The Total Environment, 408: 3746–3762. Hong, W.J., Jia, H., Li, Y.F., Sun,Y., Liu, X., & Wang, L. (2016). Polycyclic aromatic hydrocarbons (PAHs) and alkylated PAHs in the coastal seawater, surface sediment and oyster from Dalian, Northeast China. Ecotoxicology and environmental safety, 128: 11-20.
International Agency for Research on Cancer, (IARC). (2012). A review of human carcinogens: chemical agents and related occupations. In: IARC Monographs on the Evaluation of Carcinogenic Risks to Humans, vol. 100 F, pp. 111-114. http:// monographs.iarc.fr/ENG/Monographs/vol100F/. Intergovernmental Panel on Climate Change (IPCC). 2007. Summary for Policymakers. In: Solomon, S.; Qin, D.; Manning, M., Chen, Z.; Marquis, M.; Averyt, K.B.; Tignor, M.; Miller, H.L. (Eds). Climate Change 2007: The 117 Physical Science Basis. Contribution of Working Group I to the Fourth Assessment Report of the Intergovernmental Panel on Climate Change. Cambridge University Press, Cambridge, United Kingdom and New York, United States of America. p. 1-17. Inzunza, B., Orrego, R., Peñalosa, M., Gavilán, J. F., & Barra, R. (2006). Analysis of CYP4501A1, PAHs metabolites in bile, and genotoxic damage in Oncorhynchus mykiss exposed to Biobio River sediments, Central Chile. Ecotoxicology and environmental safety, 65(2): 242-251. Javed, M., Ahmad, I., Usmani, N., & Ahmad, M. (2016). Bioaccumulation, oxidative stress and genotoxicity in fish (Channa punctatus) exposed to a thermal power plant effluent. Ecotoxicology and environmental safety, 127, 163-169. Jee, J. H., & Kang, J. C. (2004). Effect of phenanthrene on haematological parameters in olive flounder, Paralichthys olivaceus (Temminch et Schlegel). Aquaculture Research, 35(14): 1310-1317.
Jee, J. H., Park, K. H., Keum, Y. H., & Kang, J. C. (2006). Effects of 7, 12‐dimethylbenz (a) anthracene on
growth and haematological parameters in Korean rockfish, Sebastes schlegeli (Hilgendorf). Aquaculture Research. 37(5): 431-442.
Jha, A.N. (2008). Ecotoxicological application and significance of the comet assay. Mutagenesis. 23: 207–221.
106
Jiang, Z.Y., Woolland, A.C.S., Wolf, S.P. (1991). Lipid hydroperoxide measurement by oxidation of Fe2+ in the presence of xylenol orange-comparison with TBA assay and on iodometric method. Lipids 26:777-860. Kampen, E.J. & Zijlstra, W.G. 1964. Standartization of haemoglobinometry. In: Boroviczény, C. G. (Ed.) Erythrocytometric Methods and their standardization. Blibliotheca Haematologica, p.68-72. Karol, I.L., Kiselev, A.A. and Frolkis, V.A. (2011). Indices of the Factors that Form Climate Changes of Different Scales. Atmospheric and Oceanic Physics, 47(4): 415–429. Kitajima, Y., & Miyazaki, K. (2013). The critical impact of HIF-1a on gastric cancer biology. Cancers, 5(1), 15-26. Kaya, H., Hisar, O., Yılmaz, S., Gürkan, M., & Hisar, Ş. A. (2016). The effects of elevated carbon dioxide and temperature levels on tilapia (Oreochromis mossambicus): Respiratory enzymes, blood pH and hematological parameters. Environmental toxicology and pharmacology, 44, 114-119.
Keen, J.H., Habig, W.H., Jakoby, W.B. 1976. Mechanism for the several activities of the glutathione S-transferase. The Journal of Bbiological Chemistry, 251:6183-6188. Khan, R. A. (1998). Influence of petroleum at a refinery terminal on feral winter flounder, Pleuronectes americanus. Bulletin of Environmental Contamination and Toxicology, 61(6), 770-777. Kobayashi, S.C., Morikawa, Y., Hayashi, M., Sofuni, T. (1995). A comparison between manual microscopic analysis and computerized image analysis in the single cell gel electrophoresis assay MMS Community, 2 pp. 103–115. Kolch, W. (2000). Meaningful relationships: the regulation of the Ras/Raf/MEK/ERK pathway by protein interactions. Biochemical Journal, 351(2), 289-305. Law, A. Y., Lai, K. P., Ip, C. K., Wong, A. S., Wagner, G. F., & Wong, C. K. (2008). Epigenetic and HIF-1 regulation of stanniocalcin-2 expression in human cancer cells. Experimental Cell Research, 314(8), 1823-1830. Lee, Y. M., Jung, S. O., Seo, J. S., Yoon, Y. D., & Lee, J. S. (2006). Cloning of Ki-ras and Ha-ras cDNAs from the hermaphroditic fish Rivulus marmoratus (Cyprinodontiformes, Rivulidae) and its expression after exposure to 4-nonylphenol. Marine environmental research, 62, S136-S140. Leite, M.B.N.L., da Cruz, A.L., Rodrigues, L.E.A., Yamashita, S.R., Carqueija, C.R.G., & Nascimento, I. A. (2015). Comparing the Toxicity of Water-Soluble Fractions of Biodiesel, Diesel and 5% Biodiesel/Diesel Blend on Oreochromis niloticus Using Histological Biomarkers. Bulletin of Environmental Contamination and Toxicology, 95(5), 574-581. Lemaire, P., Mathieu, A., Carrière, S., Narbonne, J.F., Lafaurie, M., & Giudicelli, J. (1992). Hepatic biotransformation enzymes in aquaculture European sea bass (Dicentrarchus labrax): kinetic parameters and induction with benzo (a) pyrene. Comparative Biochemistry and Physiology Part B: Comparative Biochemistry, 103(4), 847-853. Lima, M.P. Efeitos das mudanças climáticas sobre a expressão gênica e fisiologia do tambaqui (Colossoma macropomum Cuvier, 1818)/ Marcos Prado Lima. Manaus: AM, 2014. xvii+152p. Tese (doutorado) INPA, Manaus, 2016.Orientador: Dr. Adalberto Luís Val Área de concentração: Genética, Conservação e Biologia Evolutiva. Lotufo, G. R., and Fleeger, J. W. (1997). Effects of sediment-associated phenanthrene on survival, development and reproduction of two species of meiobenthic copepods. Marine Ecology Progress Series, 151: 91-102.
107
Lucas, J., Percelay, I., Larcher, T., & Lefrançois, C. (2016). Effects of pyrolytic and petrogenic polycyclic aromatic hydrocarbons on swimming and metabolic performance of zebrafish contaminated by ingestion. Ecotoxicology and Environmental Safety, 132: 145-152. Madeira, D., Narciso, L., Cabral, H. N., Vinagre, C., & Diniz, M. S. (2013). Influence of temperature in thermal and oxidative stress responses in estuarine fish. Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology, 166(2), 237-243. Malmström, C. M., Koponen, K., Lindström-Seppä, P., & Bylund, G. (2004). Induction and localization of hepatic CYP4501A in flounder and rainbow trout exposed to benzo [a] pyrene. Ecotoxicology and environmental safety, 58(3), 365-372.
Manoli, E., & Samara, C. (1999). Polycyclic aromatic hydrocarbons in natural waters: sources, occurrence and analysis. TrAC Trends in Analytical Chemistry, 18(6), 417-428.
Maria, V.L., & Bebianno, M. J. (2011). Antioxidant and lipid peroxidation responses in Mytilus galloprovincialis exposed to mixtures of benzo (a) pyrene and copper. Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology. 154(1): 56-63.
Mishra, A.K., & Mohanty, B. (2008). Acute toxicity impacts of hexavalent chromium on behavior and histopathology of gill, kidney and liver of the freshwater fish, Channa punctatus (Bloch). Environmental Toxicology and Pharmacology, 26(2), 136-141. Mladineo, I., & Block, B.A. (2009). Expression of Hsp70, Na+/K+ ATP-ase, HIF-1α, IL-1β and TNF-α in captive Pacific bluefin tuna (Thunnus orientalis) after chronic warm and cold exposure. Journal of Experimental Marine Biology and Ecology, 374(1), 51-57. Mohanty, D., and Samanta, L. (2016). Multivariate analysis of potential biomarkers of oxidative stress in Notopterus notopterus tissues from Mahanadi River as a function of concentration of heavy metals. Chemosphere. 155: 28-38. Montalto, A. S., Currò, M., Russo, T., Visalli, G., Impellizzeri, P., Antonuccio, P., ... & Romeo, C. (2013). In vitro CO2-induced ROS production impairs cell cycle in SH-SY5Y neuroblastoma cells. Pediatric surgery international, 29(1), 51-59. Moore, M.J., Smolowitz, R., and Stegeman, J.J. (1989). Cellular alterations preceding neoplasia in Pseudopleuronectes americanus from Boston Harbor. Marine Environmental Research, 28(1-4), 425-429. Myers, M.S., Olson, O.P., Johnson, L.L., Stehr, C.S., Hom, T., & Varanasi, U. (1992). Hepatic lesions other than neoplasms in subadult flatfish from Puget Sound, Washington: relationships with indices of contaminant exposure. Marine Environmental Research, 34(1-4), 45-51.
Myers, M.S., Rhodes, L.D., & McCain, B.B. (1987). Pathologic anatomy and patterns of occurrence of hepatic neoplasms, putative preneoplastic lesions, and other idiopathic hepatic conditions in English sole (Parophrys vetulus) from Puget Sound, Washington. Journal of the National Cancer Institute, 78(2), 333-363. Navarro, C.E.K.G.; Pachaly, J.R. 1994. Manual de hematologia veterinária. São Paulo: Varela. p. 74–75.
Nogueira, P., Pacheco, M., Pereira, M. L., Mendo, S., & Rotchell, J. M. (2010). Anchoring novel molecular biomarker responses to traditional responses in fish exposed to environmental contamination. Environmental Pollution, 158(5), 1783-1790. Nogueira, P. R., Lourenço, J., Mendo, S., & Rotchell, J. M. (2006). Mutation analysis of ras gene in the liver of European eel (Anguilla anguilla L.) exposed to benzo [a] pyrene. Marine pollution bulletin. 52(12): 1611-1616.
108
Oliveira, A.M. Influência da temperatura ambiental e dos cenários climáticos futuros sobre os ácidos graxos ω-3 e ω-6 e desempenho zootécnico do tambaqui (Colossoma macropomum)/Alzira Miranda de Oliveira. Manaus: AM, 2014. xi+127p. Tese (doutorado) INPA, Manaus, 2014. Orientador: Dr. Adalberto Luís Val. Área de concentração: Biologia de Água Doce e Pesca Interior. Oliveira, A.M. & Val, A.L. (2016). Effects of climate scenarios on the growth and physiology of the Amazonian fish tambaqui (Colossoma macropomum) (Characiformes: Serrasalmidae). Hydrobiologia. DOI 10.1007/s10750-016-2926-0 Osorio-Yáñez, C., García-Tavera, J.L., Pérez-Núñez, M.P.,Poblete-Naredo, I., Muñoz, B., Barron-Vivanco, B.S., Rothenberg, S.J., Omar Zapata-Pérez, O., and Albores, A. (2012). Benzo (a) pyrene induces hepatic AKR1A1 mRNA expression in tilapia fish (Oreochromis niloticus). Toxicology Mechanisms and Methods, 22(6), 438-444. Pal, S., Kokushi, E., Cheikyula, J. O., Koyama, J., & Uno, S. (2011). Histopathological effects and EROD induction in common carp exposed to dietary heavy oil. Ecotoxicology and Environmental Safety, 74(3), 307-314.
Pan, L., Ren, J., & Zheng, D. (2009). Effects of benzo (a) pyrene exposure on the antioxidant enzyme activity of scallop Chlamys farreri. Chinese Journal of Oceanology and Limnology, 27, 43-53. Papakostas, S., Vøllestad, L. A., Bruneaux, M., Aykanat, T., Vanoverbeke, J., Ning, M., ... & Leder, E. H. (2014). Gene pleiotropy constrains gene expression changes in fish adapted to different thermal conditions. Nature Communications, 5. Parihar, M.S., Javeri, T., Hemnani, T., Dubey, A.K., & Prakash, P. (1997). Responses of superoxide dismutase, glutathione peroxidase and reduced glutathione antioxidant defenses in gills of the freshwater catfish (Heteropneustes fossilis) to short-term elevated temperature. Journal of Thermal Biology, 22(2), 151-156. Pereira, S., Pinto, A.L., Cortes, R., Fontaínhas-Fernandes, A., Coimbra, A.M., & Monteiro, S.M. (2013). Gill histopathological and oxidative stress evaluation in native fish captured in Portuguese northwestern rivers. Ecotoxicology and Environmental Safety, 90, 157-166.
Pfaffl, M.W. 2001. A new mathematical model for relative quantification in real-time RT PCR. Nucleic Acids Research, 29(9): 2003-2007. Poleksic, V. & Mitrovic-Tutundžic V. 1994. Fish gills as a monitor of sublethal and chronic effects of pollution. IN: Müller, R.; Lloyd, R. Sublethal and chronic effects of pollutants on freshwater fish. Oxford: Fishing News Books. 30: 339-352.
Pryor, S.C., & Barthelmie, R.J. (2010). Climate change impacts on wind energy: a review. Renewable and Sustainable Energy Reviews, 14(1), 430-437.
Rašković, B., Jarić, I., Koko, V., Spasić, M., Dulić, Z., Marković, Z., & Poleksić, V. (2013). Histopathological indicators: a useful fish health monitoring tool in common carp (Cyprinus carpio Linnaeus, 1758) culture. Open Life Sciences, 8(10), 975-985 Ray, P.D., Huang, B.W., & Tsuji, Y. (2012). Reactive oxygen species (ROS) homeostasis and redox regulation in cellular signaling. Cellular Signalling, 24(5), 981-990.
Rhee, J. S., Lee, Y.M., Raisuddin, S., & Lee, J.S. (2009). Expression of R-ras oncogenes in the hermaphroditic fish Kryptolebias marmoratus, exposed to endocrine disrupting chemicals. Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology, 149(3), 433-439.
109
Rimoldi, S., Terova, G., Ceccuzzi, P., Marelli, S., Antonini, M., & Saroglia, M. (2012). HIF-1α mRNA levels in Eurasian perch (Perca fluviatilis) exposed to acute and chronic hypoxia. Molecular Biology Reports, 39(4), 4009-4015. Rinaldi, R., Eliasson, E., Swedmark, S., & Morgenstern, R. (2002). Reactive intermediates and the dynamics of glutathione transferases. Drug Metabolism and Disposition, 30(10), 1053-1058. Rissanen E, Tranberg HK, Sollid J, Nilsson GE and Nikinmaa M (2006) Temperature regulates hypoxia-inducible factor-1 (HIF-1) in a poikilothermic vertebrate, crucian carp (Carassius carassius). Journal of Experimental Biology, 209: 994-1003. Rotchell, J.M., Lee, J.S., Chipman, J.K., Ostrander, G.K. (2001). Structure, expression and activation of fish ras genes. Aquatic Toxicology, 55: 1–21. Sadauskas-Henrique, H. Efeitos subletais da poluição por petróleo e derivados sobre peixes da Amazônia (Amazonas, Brasil) /Helen Sadauskas Henrique. Manaus: AM, 2015. xv+195p. Tese (doutorado) INPA, Manaus, 2015. Orientador: Dra.Vera Maria Fonseca de Almeida e Val. Área de concentração: Biologia de Água Doce e Pesca Interior. Sadauskas-Henrique, H., Duarte, R.M., Gagnon, M.M., Almeida-Val, V.M.F. (2017). Validation of a suite of biomarkers of fish health in the tropical bioindicator species, tambaqui (Colossoma macropomum). Ecological Indicators 73, 443–451. Sagerup, K., Nahrgang, J., Frantzen, M., Larsen, L. H., & Geraudie, P. (2016). Biological effects of marine diesel oil exposure in red king crab (Paralithodes camtschaticus) assessed through a water and foodborne exposure experiment. Marine Environmental Research, 119, 126-135. Salazar-Lugo, R., Mata, C., Oliveros, A., Rojas, L. M., Lemus, M., & Rojas-Villarroel, E. (2011). Histopathological changes in gill, liver and kidney of neotropical fish Colossoma macropomum exposed to paraquat at different temperatures. Environmental Toxicology and Pharmacology, 31(3), 490-495.
Sammour, T., Mittal, A., Loveday, B.P.T., Kahokehr, A., Phillips, A.R.J., Windsor, J.A., & Hill, A.G. (2009). Systematic review of oxidative stress associated with pneumoperitoneum. British Journal of Surgery, 96(8), 836-850. Sayeed, I., Parvez, S., Pandey, S., Bin-Hafeez, B., Haque, R., & Raisuddin, S. (2003). Oxidative stress biomarkers of exposure to deltamethrin in freshwater fish, Channa punctatus Bloch. Ecotoxicology and Environmental Safety, 56(2), 295-301. Schiedek, D., Sundelin, B., Readman, J. W., & Macdonald, R. W. (2007). Interactions between climate change and contaminants. Marine Pollution Bulletin, 54(12), 1845-1856. Schwaiger, J., Wanke, R., Adam, S., Pawert, M., Honnen, W., & Triebskorn, R. (1997). The use of histopathological indicators to evaluate contaminant-related stress in fish. Journal of Aquatic Ecosystem Stress and Recovery, 6(1), 75-86. Shackelford, R.E., Kaufmann, W.K., Paules, R.S. (1999). Cell cycle control, checkpoint mechanisms, and genotoxic stress. Environ. Health Perspective. 107 (1): 5–24.
Shaw, G. R., & Connell, D. W. (1994). Prediction and monitoring of the carcinogenicity of polycyclic aromatic compounds (PACs). In Reviews of Environmental Contamination and Toxicology (pp. 1-62). Springer New York.
Shen, R.J., Jiang, X.Y., Pu, J.W., & Zou, S.M. (2010). HIF-1α and-2α genes in a hypoxia-sensitive teleost species Megalobrama amblycephala: cDNA cloning, expression and different responses to hypoxia. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology, 157(3), 273-280.
110
Silva, J., Freitas, T.R.O., Marinho, J.R., Speit, G., Erdtmann, B. (2000). An alkaline single-cell gel electrophoresis (comet) assay for environmental biomonitoring with native rodents. Genetics and Molecular Biology, 23(1): 241-245.
Silva, A.G. (2004). Alterações histopatológicas de peixes como biomarcadores da contaminação aquática. Dissertação (Mestre em Ciências Biológicas). Universidade Estadual de Londrina.
Simonato, J. D., Guedes, C. L., & Martinez, C. B. (2008). Biochemical, physiological, and histological changes in the neotropical fish Prochilodus lineatus exposed to diesel oil. Ecotoxicology and Environmental Safety, 69(1), 112-120.
Singh, N. P.; M. T. Mccoy; R.R. Tice & E. L. Schneider. (1988). A simple technique for quantitation of low levels of DNA damage in individual cells. Experimental Cell Research, 175:184-191.
Solé, M., Lobera, G., Aljinovic, B., Ríos, J., de la Parra, L. G., Maynou, F., & Cartes, J. E. (2008). Cholinesterases activities and lipid peroxidation levels in muscle from shelf and slope dwelling fish from the NW Mediterranean: Its potential use in pollution monitoring. Science of the Total Environment, 402(2), 306-317.
Šrut, M., Štambuk, A., & Klobučar, G. I. (2010). Genotoxicity and genetic changes in RTG-2 fish cell line upon exposure to benzo [a] pyrene and ethyl methanesulfonate detected by the Comet assay and AFLP marker analysis. Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology, 157, S13.
Strobel, A., Burkhardt-Holm, P., Schmid, P., & Segner, H. (2015). Benzo (a) pyrene Metabolism and EROD and GST Biotransformation Activity in the Liver of Red-and White-Blooded Antarctic Fish. Environmental science & technology. 49(13): 8022-8032. Tishkov, A.A. (1994). Geographic Patterns of Natural and Anthropogenic Successions, Extended Abstract of Doctoral (Geogr.) Dissertation, Moscow: Inst. Geogr. Ros. Akad. Nauk. Tishkov, A.A., II i Mezhdunarodnyi Simpozium “Chuzherodnye vidy v Golarktike (Borok_2)” (II Int. Symp. “Alien Species in the Holarctic” (Borok 2)), Rybinsk: Ros. Akad. Nauk, 2005, p. 31. Torten, M., Liu, Z., Okihiro, M. S., Teh, S. J., & Hinton, D. E. (1996). Induction of ras oncogene mutations and hepatocarcinogenesis in medaka (Oryzias latipes) exposed to diethylnitrosamine. Marine Environmental Research, 42(1), 93-98.
Toyokuni, S. (1999). Reactive oxygen species‐induced molecular damage and its application in
pathology. Pathology international, 49(2), 91-102. Val, A.L. & Honczaryk, A. (1995). Criando peixes na Amazônia. Manaus: INPA (Editor), Manaus, Brasil. p.160. Val, A.L. & Almeida-Val, V.M.F. (1995). Fishes of the Amazon and their environment: physiological and biochemical features. Heidelberg: Springer-Verlag. Val, A. L., Kapoor, B. G., Raschi, W. G., & Gerry, S. P. (2003). Fish adaptations.
Van der Oost, R., Beyer, J., & Vermeulen, N. P. (2003). Fish bioaccumulation and biomarkers in environmental risk assessment: a review. Environmental toxicology and pharmacology, 13(2), 57-149. van Schanke, A., Boon, J.P., Aardoom, Y., van Leest, A., van Schooten, F.J., Maas, L., ... & Everaarts, J.M. (2000). Effect of a dioxin-like PCB (CB 126) on the biotransformation and genotoxicity of benzo [a] pyrene in the marine flatfish dab (Limanda limanda). Aquatic Toxicology, 50(4), 403-415.
111
Vásquez, K.L. Ontogenia das enzimas digestivas do tambaqui, Colossoma macropomum (CUVIER, 1818): subsídios para a aquicultura/Katherine López Vásquez. Manaus: AM, 2009. Tese (doutorado), Manaus, 2009.Orientador: Dr. Adalberto Luís Val Área de concentração: Biotecnologia. Vincent, F., Boer, J., Pfohl-Leszkowicz, A., Cherrel, Y., Galgani, F. (1998). Two cases of ras mutation are associated with liver hyperplasia in Callionymus lyra exposed to polychlorinated biphenyls and polycyclic aromatic hydrocarbons. Molecular Carcinogenesis. 21: 121–127. Vogelbein, W. K., Fournie, J. W., Van Veld, P. A., & Huggett, R. J. (1990). Hepatic neoplasms in the mummichog Fundulus heteroclitus from a creosote-contaminated site. Cancer Research, 50(18), 5978-5986. Voolstra, C., Schnetzer, J., Peshkin, L., Randall, C.J., Szmant, A.M., Medina, M. (2009) Effects of temperature on gene expression in embryos of the coral Montastraea faveolata. BMC Genomics.10: 627. Vörösmarty, C.J., McIntyre, P.B., Gessner, M.O., Dudgeon, D., Prusevich, A., Green, P., Gilden, S., Bunn, S.E., Sullivan, C.A., Reidy Liermann, C., Davies, P.M. (2010). Global threats to human water security and river biodiversity. Nature. 467: 555–561. Waris, G., & Ahsan, H. (2006). Reactive oxygen species: role in the development of cancer and various chronic conditions. Journal of Carcinogenesis, 5(1), 14. Winter, M.J., Day, N., Hayes, R.A., Taylor, E.W., Butler, P.J., & Chipman, J.K. (2004). DNA strand breaks and adducts determined in feral and caged chub (Leuciscus cephalus) exposed to rivers exhibiting variable water quality around Birmingham, UK. Mutation Research/Fundamental and Molecular Mechanisms of Mutagenesis, 552(1), 163-175.
Wong, C., Wellman, T. L., & Lounsbury, K. M. (2003). VEGF and HIF-1α expression are increased in advanced stages of epithelial ovarian cancer. Gynecologic oncology, 91(3), 513-517.
Yang, G., Mercado‐Uribe, I., Multani, A. S., Sen, S., Shih, I. M., Wong, K. K., ... & Liu, J. (2013). RAS
promotes tumorigenesis through genomic instability induced by imbalanced expression of Aurora‐A and
BRCA2 in midbody during cytokinesis. International Journal of Cancer. 133(2): 275-285.
Yang, X., Meier, J., Chang, L., Rowan, M., & Baumann, P. C. (2006). DNA damage and external lesions in brown bullheads (Ameiurus nebulosus) from contaminated habitats. Environmental toxicology and chemistry, 25(11), 3035-3038.
Yu, R.M.K., Ng, P.K.S., Tan, T., Chu, D.L.H., Sun, Wu, R.S. & Kong R.Y.C. (2008) Enhancement of hypoxia-induced gene expression in fish liver by the aryl hydrocarbon receptor (AhR) ligand, benzo[a]pyrene (BaP). Aquatic Toxicology. 90: 235–242.
112
Tables and Figures
Table 1. Physicochemical parameters of water and air in the current and extreme scenarios where the specimens of
tambaqui were kept for 30 days. The data are reported as the mean ± standard error of the mean.
mg. L-1) did not affect C. macropomum oxygen consumption. The average critical
oxygen tensions (PO2crit) were 1.49 mg O2. L-1 ± 0.06 and 1.47 O2. L
-1 ± 0.13 for control
and RD groups, respectively (n=3) (Figure 1).
3.2. Hematological plasma glucose parameters
There was no statistical difference in Hb, Ht, RBC, MCH, MCV and CMCH blood
parameters in fish exposed to normoxia (N x NRD). The same occurred in Hb, RBC,
MCH, MCV and CMCH for fish exposed to hypoxia (H x HRD). Hb concentration was
higher in fish exposed to hypoxia (H) than in normoxia (N) (P= 0.008) (Table 2). Ht
decreased in fish exposed to HRD in comparison with H (P= 0.006), and increased in
hypoxia (H), in comparison with fish under normoxia (N) (P=0.012). RBC increased in
fish exposed to hypoxia (H) in comparison with (N) (P = 0.040), and in MCH the same
occurred (P= 0.047). Glucose levels were higher in fish exposed to NRD than in N
treatment (P= 0.005). Fish exposed to HRD presented an increase in glucose levels in
comparison with H (P< 0.001). Tambaqui under hypoxia (H) and hypoxia plus RD
139
(HRD) showed an increase in glucose levels in comparison with NRD (P = 0.003) (Table
2).
3.3. Genetic damage in erythrocytes by comet assay
DNA damage in erythrocytes increased in fish exposed to NRD (GDI: 327.0 ±
7.7) in comparison with N (GDI: 234.6 ± 15.0) (P< 0.001). There was no difference in
genetic damages between tambaquis subjected to hypoxia (H) and hypoxia plus RD
(HRD). According to genetic damage index, DNA damage in erythrocytes was higher in
fish exposed to H (GDI: 317.2 ± 18.5) than in fish exposed to N (GDI: 234.6 ± 15.0) (P<
0.001) (Table 3).
3.4. Biochemical analysis
No difference was observed in liver GST activity of fish exposed to N and NRD,
neither in H and HRD. Fish exposed to hypoxia (HRD) presented an increase in GST
activity (1.89 times) in comparison with fish exposed to normoxia (NRD) (P< 0.001)
(Figure 2A) suggesting a magnification of the RD effect when combined with hypoxia.
CAT activity was higher in fish exposed to hypoxia (H [1.51 times] and HDR [1.39
times]) compared with fish exposed to normoxia (N and RD). However, there was no
difference in liver CAT activity in fish exposed to normoxia (N and RD) and hypoxia (H
and HRD) (Figure 2B).
No difference was also observed in lipoperoxidation levels (LPO) between the
groups of fish exposed to normoxia (N and NRD). However, fish exposed to hypoxia
presented a decrease in LPO levels in HRD treatment in comparison with N (P = 0.016).
There was no difference in LPO levels between the treatments and normoxia and
hypoxia condition (Figure 2C).
3.5. Liver histopathology
Normal fish liver presented a parenchyma consisting by polyedric hepatocytes
organized in cords with one or two cells, surrounded by sinusoids, as observed in
control (N) (Figure 3A). Fish liver showed also the hepatopancreas cell types (Figure
140
3B). Some of the liver alteration observed in the all treatments with moderate (+) or low
frequency (0+) were sinusoidal swelling (Figure 3C) and Leukocyte infiltration (Figure
3D). Cellular vacuolization was frequent (++) in fish exposed to N and NRD treatments
and highly frequent (+++) in fish exposed to HRD (Figure 3D). Fish liver exposed to
normoxia and RD presented most of the histopathological damages classified as
moderate frequency (+). Qualitatively, the intensity of tissue damage and the level of the
damages (stage II and III) increased in the hepatic tissue of fish exposed to hypoxia and
hypoxia plus RD (HRD) (Table 4). Fish exposed to hypoxia presented higher damage
levels as the occurrence and frequence of injuries in HDR. Injuries in stage II as
cytoplasm degeneration, pyknotic nuclei (Figure 3 E) and cell disruption were classified
as frequent (++) in NRD and H groups. In HDR treatments, fish showed high frequency
(+++) of injuries in stage II. High frequency (+++) of focal necrosis (Figure 3F) was
observed in fish exposed to hypoxia and RD, the same occurred with fish exposed only
to hypoxia (H).
3.6. Hif-1 expression and ras oncogene
Relative expression of hif-1 on the liver of C. macropomum was not statistically
different between the different concentration of oxygen (normoxia and hypoxia) and
between the treatments (no RD and RD) (P = 0.113). No difference was observed
between fish exposed to normoxia (N and NRD). The same behavior was observed in
the relative expression of hif-1in fish exposed to hypoxia (H and HRD). Instead, there
was a down regulation in the expression of hif-1 in fish exposed to H (2.18-fold) and
HRD (6.81-fold) in comparison with fish exposed to normoxia (N and NRD) (Figure 4).
The relative expression of ras oncogene was statically different between the
different concentration of oxygen (normoxia and hypoxia) and the treatments (no RD
and RD) (P < 0.001). Ras oncogene was over expressed 3.68-fold in fish exposed to
RD (NRD) in comparison with fish in the absence of the contaminant in normoxia (N) (P
<0.001). There was no difference in ras relative expression between fish exposed to
hypoxia (H and HRD). Fish exposed to HRD down regulated the expression of ras
oncogene (12.20-fold) in comparison with fish exposed to NRD (P < 0.001) (Figure 5).
141
4. Discussion
Glyphosate-based herbicides are considered relatively nontoxic (WHO, 1994),
and its broad application to aquatic systems and pollution of terrestrial ecosystems are
a concern for ecotoxicologists. Therefore, the increasing preoccupation results in the
need to find reliable markers reflecting RD effects in order to better understand its
potential hazards and prognose faraway perspectives (Lushchak et al., 2009).
Responses of fish to the impact of any kind of toxicant appear, first of all, as main
blood parameters changes. Hematological analysis enables to elicit latent course of the
toxicosis, warning the danger even when all other parameters indicate relative well
being (Zhydenko, 2008). Evaluating fish blood parameters might be a useful tool to
understand the impact of agrichemicals on fish health (Kreutz 2011). Herein, no
difference was observed in C. macropomum hematological parameters (Hb, Ht, RBC,
MVC, MHC and MCHC) comparing fish exposed to normoxia (N) with normoxia plus RD
(NRD). Moreover, when we compared fish submitted to hypoxia (H) and hypoxia plus
RD (HRD), no alteration was observed in Hb, RBC, MVC, MHC and MCHC parameters.
However, a decrease in Ht levels could be observed in fish in hypoxia plus RD
compared to hypoxia. Hb, Ht and RBC blood parameters decreased in common carp
(Cyprinus carpio) subjected to RD at 3.5, 7 and 14 ppm for 16 days compared to
control. On the other hand, MCV and MCH increased and MCHC decreased (Gholami-
Seyedkolaei et al., 2013). Hematocrit levels did not change in catfish (Rhamdia quelen)
following short term exposure to sublethal concentrations of glyphosate (0.730 mg/l-1)
witch corresponds to 10% of LC 50% in 96h (Kreutz et al., 2011). Piava fish (Leporinus
obtusidens) exposed to different concentration of RD (2, 6, 10 ad 20 mg/L) showed a
decrease in hematological parameter evaluated (Hb, Ht and RBC) (Glusczak et al.,
2006). Herein, hematocrit levels, hemoglobin, RBC, MVC and MHC increased in C.
macropomum exposed to hypoxia (H) when compared with fish exposed to normoxia
(N). C. macropomum is an Amazon fish with the capacity to regulate the levels of
hematocrit and hemoglobin to cope with low concentration of oxygen (Val, 1996). The
increase in Ht levels is a consequence of spleen contraction since hemoglobin
concentration also increased, leading to increased cell volume (MCV) and MCH. The
142
increase observed in MCV and MCH values possibly result from the increase of
immature RBC (Saravanan et al., 2011). Concerning the influence of RD contamination
on fish blood response it is clear that it depends on the contaminant concentration, the
surfactant compounds applied in the herbicide formulation, the time of exposure, and
fish species tested.
Indeed, contaminants such as RD along with hypoxia conditions are stressful to
fish. In response to stress, the body prepares to minimize the effects of the stressor.
The release of hormones such as catecholamines and cortisol are well followed by
increased glucose, an energy reserve ready for use (Val et al., 2004). In the present
work, fish exposed to normoxia plus RD (NRD) showed high levels of glucose
compared to C. macropomum exposed to normoxia. There was an increase in glucose
levels of fish exposed to hypoxia and RD compared to hypoxia (H), and fish submitted
to HRD also showed higher glucose levels than fish exposed to NRD. The RD
contamination was stressful for C. macromopum, and the combined effect with hypoxia
was even more. Langiano and Martinez (2008) observed increased levels of plasma
glucose of P. lineatus exposed to 10 mg L−1 of RD for 24 and 96 h. Other herbicides
are also described in the literature to affect fish glucose levels. For instance, juvenile
rainbow trout (Oncorhynchus mykiss) chronically exposed to verapamil (0.5, 27 and 270
g/L) showed increase in glucose levels (Li et al., 2011); Rhandia quelen exposed to
clomazone (0.5 and 1.0 mg/L also presented elevated plasma glucose in treated fish. A
different result was described by Braz-Mota and collaborators (2015), where no
alteration in plasma glucose of C. macropomum exposed to RD occurred. According
Almeida-Val et al. (2005), most Amazonian fish species submitted to some level of
oxygen depletion show alterations in plasma glucose. The Amazon cichlid, Astronotus
crassipinnis, presented accumulation of plasma glucose at low oxygen levels, probably
due to an activation of hepatic glycogenolysis as indicated by the decreases in liver
glycogen (Chippari-Gomes et al., 2005). An increase in blood glucose levels was also
observed in Atlantic sturgeon (Acipenser oxyrinchus) and shortnose sturgeon
(Acipenser brevirustrum) exposed to hypoxia (Baker et al., 2005).
Comet assay is a technique used to detect genomic lesions, which after being
processed, may result in mutation. Different than mutations, the lesions detected with
143
the comet assay can be recovered (Gontijo and Tice, 2003). Results of genotoxicity
studies on glyphosate products are contradictory depending on purity of the active
agent, nature of inert components, type of the applied test, as well as organisms tested
(Çavas and Konen, 2007). For instance, in cultured human cell line Hep-2, settled with
glyphosate at concentrations of 3.00 -7.50 mM, an increase in DNA damage was
reported as well as an extention in DNA migration compared with control (Mañas et al.,
2009). In another study, addressing microbial mutagenicity, Salmonella typhimztrium
strains TA1535, TAlOO, TA1537, TA1538, and TA98 were treated with 10 to 5000
mg/plate of glyphosate and no statistically significant induction of mutagenecity above
solvent control levels was observed as well as no significant dose-response (Li and
Long, 1988).
In the present study, fish exposed to normoxia plus RD (NRD) showed an
increase in genetic damage index (GDI) compared with fish exposed to normoxia (N).
However, fish exposed to hypoxia plus RD, when compared with fish exposed to
hypoxia (H) did not present differences. Fish exposed to hypoxia (H) showed higher
GDI values than fish exposed to normoxia (N). RD was able to induce DNA damage in
blood cells of C. macropomum. The predominant class of DNA damage in C.
macropomum erythrocytes was the class 4 in treatments of fish exposed to NRD, H and
HRD. Negreiros and collaborators (2011) observed an increase in DNA damage in
Hippocampus reidi exposed to hypoxia and petroleum. The comet scores for fish
exposed to hypoxia, oil and hypoxia plus oil were significantly higher than the respective
negative control groups. The predominant class of DNA damage in Hippocampus reidi
was class 2 in hypoxia.
Guilherme and collaborators (2014) confirmed the genotoxic effect of RD through
comet assay analyzing Anguilla anguila erythrocytes. Authors observed an increase in
DNA strand breaks in fish exposed during 3 days to 116 g L-1 of RD and the
predominant class of DNA damage was the class 3. In another work, Anguilla anguilla
fish were exposed to RD (58 and 116 g L-1) and the active ingredient, glyphosate
(17.9 and 35.7g L-1) and the surfactant polyethoxylated amine; (POEA) (9.3 and 17.3
g L-1). After one day exposure, the GDI values, with the exception of the lower
concentration of RD, displayed significantly higher values in comparison with control
144
(Guilherme et al., 2012). The induction of DNA damage (Comet assay) on peripheral
erythrocytes was also observed in freshwater goldfish Carassius auratus; RD
significantly increased the DNA damage following 2 days exposure and gradual
increases in GDI values were noticed at the fourth and sixth days, indicating inhibition of
DNA repair during the exposure period (Çavas and Konen, 2007). RD is clearly toxic for
C. macropomum inducing DNA damages; hypoxia was also capable to induce DNA
strand breaks.
Contaminants such as pesticides may induce reactive oxygen species (ROS),
resulting in the imbalance between pro-oxidant and antioxidant defense mechanisms
(Glusczak et al., 2011). Enzymatic and non-enzymatic antioxidants are essential to
maintain the redox status of fish cells and serve as an important biological defense
against oxidative stress (Bainy et al., 1996). Variations in the activities of antioxidant
enzymes have been proposed as indicators of pollutant mediated oxidative stress
(Ahmad et al., 2000; Li et al., 2003). Recently, the effects of RD and glyphosate on
oxidative stress markers have been addressed in fish (Braz-Mota et al, 2015, Lushchak
et al., 2009, Glusczak et al., 2007). GSTs are detoxifying enzymes of phase II that
catalyze the conjugation of GSH with a variety of electrophilic compounds (Ferreira et
al., 2010). In the present study GST activity increased in the liver of C. macropomum
exposed to hypoxia combined with RD (HRD) in comparison with fish exposed to
normoxia combined with RD. There was no difference, though, in GST activity between
fish exposed to normoxia (N) versus normoxia plus RD (NRD). The same behavior was
observed in fish submitted to hypoxia (H) versus hypoxia plus RD (HRD). Lushchak and
collaborators (2009) observed a reduction in GST activity in goldfish exposed to RD (2.5
- 20mg L-1) for 96 h in comparison with control. On the other hand, Langiano and
Martinez (2008), studying Prochilodus lineatus exposed to RD (7.5 and 10 mg L-1) for 6,
24 and 96 h, observed no alteration in GST activity. The same authors explained the
absence of variation in GST activity as the metabolism of the compounds present in RD,
which may be processed by other biotransformation pathways. In the present study, the
increase in GST activity in C. macropomum under HRD may be explained by the
oxidative stress induced by hypoxia. Changes in environmental O2 availability can alter
145
ROS production, and both hyperoxia and hypoxia are thought to increase oxidative
stress (Lushchak, 2011).
In the present work, catalase (CAT) did not present alteration between fish
exposed to normoxia versus normoxia and RD (NRD). The same occurred with fish
submitted to hypoxia compared with HRD. Menezes and collaborators (2011) observed
no alteration in CAT activity in catfish (Rhamdia quelen) exposed to RD (0.45 and 0.95
mg L-1) for 8 days. Catalase activity in the liver of Rhamdia quelen also did not change
during 96h exposure to 0.2 and 0.4 mgRD.L-1 according to Glusczak and collaborators
(2007). On the other hand, our results showed an increase in CAT activity in C.
macropomum exposed to hypoxia (H) compared with fish exposed to normoxia (N). The
same behavior was presented by fish exposed to hypoxia plus RD (HRD) compared to
fish under NRD. The hypoxia combined with RD was, again, the inducible factor of
increased oxidative stress. Zhang and collaborators (2016) evaluated the enzymatic
activities of Darkbarbel catfish, Pelteobagrus vachelli, for oxidative stress induced by
acute hypoxia. The authors observed an increase in GST and CAT activity of fish
exposed to 1.5 mg L-1 oxygen concentration in comparison with the control group. It has
been considered that the reduced dissolved O2 also affects oxidative stress in fishes,
but via mechanism that are still unclear (Chandel and Shumacker, 2000).
Lipid peroxidation is thought to be an effect of the toxic action of environmental
pollutants, leading to injuries of cellular function under oxidative stress conditions. Lipid
peroxidation takes place in the the cell membrane lipids, altering cohesion, flow,
permeability, and metabolic function, leading to cell membrane instability with
consequent cellular damage and death (Ortiz-Ordonez et al., 2011). There was no
alteration in LPO levels between fish exposed to normoxia and normoxia plus RD.
Neither in fish exposed to normoxia (N) versus fish exposed to hypoxia (H). The same
occurred between fish submitted to normoxia and RD (NRD) and hypoxia and RD
(HRD). However, fish exposed to hypoxia and RD (HRD) presented a decrease in LPO
levels in comparison with fish submitted to hypoxia (H). The lower LPO levels in hypoxia
and RD (HRD) treatment can be explained by the increased activity of antioxidant
defense enzymes, as above mentioned. We observed higher levels of GST and CAT on
liver of fish in the same conditions. The GST and CAT are able to reduce the oxidative
146
stress damages in hepatic tissue caused by ROS. Different results were observed by
Modesto and Martinez (2010) with Prochilodus lineatus exposed to Roundup
Transdorb® (RDT) acutely exposed (6, 24 and 96 h) to 1 mg L-1 of RDT and 5 mg L-1 of
RDT. In their study LPO levels increased significantly in the liver of fish exposed to both
concentrations of RDT for 6 h. However, GST activity was significantly reduced in fish
exposed for 6 h to both RDT concentrations and CAT activity showed a significant
reduction in fish exposed for 6 h to the highest concentration of herbicide. Menezes and
collaborators (2011) also observed the same pattern measuring LPO levels throughout
the TBARS (thiobarbituric acid reactive species) methodology. There was a significantly
higher TBARS levels in liver of Rhamdia quelen exposed to the 0.95 mg/l compared
with control fish. Conversely, hepatic tissue exposed to RD presented no alteration of
CAT activity compared with the control group. The differences in peroxide levels have
also been attributed to the variation in antioxidant mechanisms of fish species (Radi et
al. 1985; Ahmad et al. 2000). In the present work, considering the fact that hypoxia can
induce oxidative stress, the antioxidant enzymes GST and CAT acted minimizing the
effects of reactive oxygen species in fish exposed to hypoxia combined to RD (HDR).
Exposure to xenobiotics as metals, pesticides and petroleum derivates can
induce histopathological damages in fish organs as liver and gills (Jayaseelan et al.,
2014, Leite et al., 2015, Samanta et al., 2016). The liver is the central metabolic organ
and plays a key role in biochemical transformations of the xenobiotic substances, which
inevitably reflects on its integrity by creating lesions and other histopathological
alterations in the liver parenchyma (Roberts, 1978). Histopathological changes may
affect organ function depending on the distribution and intensity of the lesions (Bernet et
al., 1999).
In the present work C. macropomum submitted to normoxia (N) and normoxia
plus RD (NRD) showed low frequency of leukocyte infiltration. On the other hand, fish
exposed to hypoxia (H) and hypoxia and RD (HRD) showed a moderate frequency of
leukocyte infiltration indicating an increase in inflammatory processes. Hued and
collaborators (2012) also observed leukocyte infiltration as signal of inflammatory
process in Jenynsia multidentata subjected to different concentration of RD (5, 10. 20
and 35 mg/l). In our work fish exposed to hypoxia and RD (HRD) showed the most
147
injured hepatic liver, presenting higher frequency of cytoplasm vacuolization, nuclear
degeneration, cytoplasm degeneration, pyknotic nuclei, cell disruption and focal
necrosis. In fish exposed to hypoxia (H), most of tissue damage was classified as
frequent, and focal necrosis had high frequency, resulting in tissue damage as well.
Necrotic focus compromises the function of the liver as it is considered irreparable
damage (Poleksic and Mitrovic-Tutundsic, 1994). Langiano and Martinez (2008)
frequently observed cellular and nuclear degeneration; cytoplasmatic vacuolization; and
pyknotic nuclei em P. lineatus exposed to RD. Cytoplasmatic vacuolization suggest
changes in liver function (Takashima and Hibiya, 1995). The vacuolization of
hepatocytes might indicate an imbalance between the rate of synthesis of substances in
the parenchymal cells and the rate of their release into the systemic circulation
(Gingerich, 1982). Necrosis were found in the liver of African catfish (Clarias gariepinus)
after exposure to glyphosate (Ayoola, 2008), and in liver of neotropical fish Piaractus
mesopotamicus necrosis was described after exposure to Roundup® Ready (RR)
(Shiogiri et al., 2012). An increase in vacuolization is related with induction of necrosis
as observed by Zhidenko and Kovalenko (2007) in the liver of carps exposed to RD for
14 days. Histological changes, which are connected with the granular and vacuolar-drop
dystrophy, lead to the death of hepatocytes and to necrotic changes and, as a
consequence, to the functional liver failure.
Hypoxia can affect the liver structure, as we observed in this work, where higher
frequency of necrosis was observed in fish under hypoxia and hypoxia plus RD
condition. Similarly, Mustafa and collaborators (2012) found lipid vacuolization and
necrosis in liver of Cyprinus carpio exposed to hypoxia and hypoxia plus copper
contamination. All these damages may have altered the gene expression and enzyme
activities as we mentioned before. Necrosis, as observed in H and HRD exposed fish,
may have lead to malfunction of the cells and impairment of molecular machinery. In
fact, DNA damages also occurred in these animals, as seen through comet assay.
To the best of our knowledge, the present work is the first to correlate gene
expression (hif-1 gene and ras oncogene) and RD contamination combined with
hypoxia in an Amazon fish species. Variation in the level of oxygen concentration in the
Amazon waters is a common phenomenon, and Amazon fish developed a series of
148
strategies to cope with low oxygen levels during their evolutionary history (Almeida-Val
et al., 1999a, 1999b). The use of herbicides in the last few years have been common in
the Amazon region, specially surrounding fish farm tanks, and no information is
available about the combined effects of hypoxia and RD in fish.
Hif-1 acts as a key transcription factor in regulating metabolism, development,
cellular survival, proliferation and pathology under hypoxia condition. Compared to
mammals, fish are more vulnerable to hypoxia stress and contamination; however, the
regulation of hif-1 in fish remains obscure (Liu et al., 2013). In the present work there
was no alteration in hif-1relative expression between fish exposed to normoxia and
normoxia plus RD. The same results were observed in fish exposed to hypoxia
compared to hypoxia plus RD. However, comparing fish under normoxia and hypoxia,
we observed down regulation of hif-1 gene expression for both contamined and non-
contamined groups. Our results are different from those showed by Baptista and
collaborators (2016), where the levels of hif-1 increased on the liver of Oscar
(Astronotus ocellatus) exposed to 3h hypoxia. A slight over expression of hif-1 was
observed by Kodama and collaborators (2012) in dragonet fish (Callionymus
valenciennei) exposed to environmental hypoxia (1.7 ml l-1) in Tokyo Bay, but the
difference between non hypoxic and hypoxic sites was not significant. The hif-1 level
were significantly increased with the gradual decline of oxygen (7.2, 3.2, 2.8 and 2.2
mg/L) concentration in larval fish of Chinese sucker (Myxocyprinus asiaticus); however,
there was no significant difference among different hypoxia groups after re-oxygenation
(Chen et al., 2012). Most of the studies describe an over expression of hif-1 gene in
fish exposed to hypoxia (Terova et al., 2008, Geng et al., 2014), different from our
results for Amazon fish C. macropomum exposed to hypoxia and hypoxia plus RD. A
possible explanation for this controverse result, once this gene is responsible by the
transcription of more than 100 genes related to hypoxia, relies in a malfunction of
molecular machinery, as we shall mention further. Nevertheless, more studies must be
developed to better understand and elucidate these results.
The ras family of proto-oncogenes encodes small GTP binding proteins that
transduce mitogenic signals from tyrosine-kinase receptors (Barbacid, 1987; Cahill et
149
al., 1996). Ras genes are associated with tumorigenesis and also with metastasis (Cox
et al., 1004, Saez et al., 1994, Mora et al., 2007). Mutational events at codon 12 and 13
of the ras oncogene have already been associated with tumorigenesis in rainbow trout
(Onchorhynchus mykiss) and other teleost fishes (Nemoto et al., 1986).
Another mechanism of ras-implicated carcinogenesis involves overexpression of
the gene (Nogueira et al., 2006). In the present work, C. macropomum exposed to
normoxia plus RD (NRD) presented an overexpression of ras oncogene compared to
fish submitted to normoxia. Similar to the hif-1gene, ras oncogene was down
regulated in fish exposed to HRD compared to fish exposed only to hypoxia. However,
there was no difference in ras oncogene expression between fish exposed only to
normoxia versus hypoxia. Fish submitted to HRD showed a decrease in ras oncogene
expression compared to NRD. As far as we know, there is no prior work relating the
influence of RD or hypoxia over ras oncogene expression. Nogueira and collaborators
(2010) observed no alteration in ras oncogene expression of Dicentrarchus labrax and
Liza aurata collected in a polluted area (various types and sources of contamination) in
Ria Aveiro, Portugal. Ras was also overexpressed in C. macropomum acutely exposed
to Benzo[a]pyrene (4, 8 and 16 mol/kg) (Silva et al., 2016 accepted for publication). C.
macropomum exposed to Benzo[a]pyrene in the extreme scenario (A2) proposed by
IPCC, 2007 increased the levels of ras oncogene expression on the liver in comparison
with control (Silva et al., 2016 accepted for publication). Rivululos marmonatos, after
exposure to 4-nanylphenol presented a significant overexpression (P < 0.001) in the
liver c-Ki-ras (long form) (Lee et al., 2006). Glyphosate and the kind of surfactant used
can also affect the pattern of gene expression as demonstrated by Uchida and
collaborators (2012). The authors observed no significant gene expression changes in
liver of medaka (Oryzias latipes) after exposure to glyphosate through DNA microarray
analysis. Nevertheless, 78 and 138 genes were significantly induced by fatty acid
alkanolamide surfactant (DA) and glyphosate DA mixture, respectively. RAB 27A
member of ras oncogene family and ras homologous gene family member Q were
significantly affected in medaka exposed to glyphosate DA mixture. Herein, we
demonstrated that RD induces the overexpression of ras oncogene in normoxia
condition. Fish exposed to NRD presented moderate liver tissue damage (+), including
150
the damage in stage III (necrosis). It is likely that Ras oncogene was induced to
maintain the survivor and division capacity of the hepatocytes. On the other hand,
hypoxia fish downregulated the expression of ras oncogene when combined with RD
(HRD). As the histopathology analyzes revealed, the fish under HRD treatments had
their liver highly injured compared with fish under NRD. Necrotic focus appeared in a
higher frequency (+++) on the liver of those animals, and, so, the hepatocytes may have
lost their ability to induce the expression of ras oncogene and hif-1as above-described
due to hepatic tissue disruption and molecular machinery failure. As far as we know,
this is the first work describing the combined effects of hypoxia and RD. The similar
effect of these two stressors separately and combined need to be better understood.
5. Conclusion
The results obtained in this studt revealed that C. macropomum is very sensitive
species concerning RD contamination, and this sensitivity increases when combined
with hypoxia exposure. We observed that hypoxia interestingly induced a down
regulation in hif-1 expression, and this behavior could be explained by an impairment
in the molecular machinery since this was the strongest situation imposed to the fish
(HRD) and caused cellular and DNA damages. Nevertheless, further studies are
necessary to better explain those results. RD induced and overexpression of the
oncogene ras, contributing to cell survivor, but the combination with hypoxia caused a
down regulation of this oncogene ras as occurred with hif-1. Hepatic tissue injuries
increased in fish under hypoxia and hypoxia plus RD, affecting the organ function.
Despite de RD contamination, antioxidant defenses (GST and CAT) were capable to
minimize ROS stress and avoider high levels of membrane lipoperoxidation. RD is very
toxic to C. macropomum as demonstrated by genotoxic results.
Acknowledgments: FAPEAM and CNPq supported this study through INCT-ADAPTA
grant to ALV. Thanks are also due to the personnel of the Functional Histology
Laboratory of the Federal University of Amazonas for their support with the preparation
of histological material. VMFAV is the recipient of a Research Fellowship by CNPq.
151
6. References
Ahmad, I., Hamid, T., Fatima, M., Chand, H. S., Jain, S. K., Athar, M., & Raisuddin, S. (2000). Induction of hepatic antioxidants in freshwater catfish (Channa punctatus Bloch) is a biomarker of paper mill effluent exposure. Biochimica et Biophysica Acta (BBA)-General Subjects, 1523(1), 37-48. Almeida-Val, V.M.F., Val, A.L. and Walker I. (1999a) Long- and short-term adaptation of amazon fishes to varying O2 levels: Intra-specific phenotypic plasticity and interspecific variation. In: Val AL and Almeida-Val VMF (eds) Biology of Tropical Fishes. Editora do INPA, Manaus, pp 185-206. Almeida-Val V.M.F., Paula-Silva M.N., Duncan W.P., Lopes N.P. and Val A.L. (1999b) Increase of anaerobic potential during growth of an Amazonian cichlid, Astronotus ocellatus. Survivorship and LDH regulation after hypoxia exposure. In: Val AL and Almeida-Val, V.M.F.(eds) Biology of Tropical Fishes. Editora do INPA, Manaus, pp 437-448. Almeida‐Val, V. M. F., Gomes, A. R. C., & Lopes, N. P. (2005). Metabolic and physiological adjustments to low oxygen and high temperature in fishes of the Amazon. Fish physiology, 21, 443-500. Araújo, R.S., Garcia, M.V.B., Garcia, T.B., (2008). Toxicidade aguda do herbicida Glifosato (Roundup) para Danio rerio (Teleostei, Cyprinidae), em condições tropicais. In: Anais da III Jornada de Iniciação Científica da Embrapa Amazônia Ocidental. Ed. 57. ISSN 1517–3135. Ayoola, S. O. (2008). Histopathological effects of glyphosate on juvenile African catfish (Clarias gariepinus). Am Eurasian J Agric Environ Sci, 4, 362-7.
Bainy, A.C.D. (1996). Oxidative stress as biomarker of polluted aquatic sites. In: Val, A.L., Almeida-Val, V.M.F., Randall, D.J. (Eds.), Physiology and Biochemistry of the Fishes of the Amazon. INPA, Manaus, Brazil, pp. 101–110. Baker, D.W., Wood, A.M., & Kieffer, J.D. (2005). Juvenile Atlantic and short nose sturgeons (family: Acipenseridae) have different hematological responses to acute environmental hypoxia. Physiological and Biochemical Zoology, 78(6), 916-925. Baldisserotto, B., Chippari-Gomes, A.R., Lopes, N.P., Bicudo, J.E.P.W., Paula-Silva, M.N., Almeida-Val, V.M.F., & Val, A.L. (2008). Ion fluxes and hematological parameters of two teleosts from the Rio Negro, Amazon, exposed to hypoxia. Brazilian Journal of Biology, 68(3), 571-575.
Baptista, R.B., Souza-Castro, N., & Almeida-Val, V.M.F. (2016). Acute hypoxia up-regulates HIF-1α and VEGF mRNA levels in Amazon hypoxia-tolerant Oscar (Astronotus ocellatus). Fish physiology and biochemistry, 1-12.
Barbacid, M. (1987). Ras genes. Annual Review Biochemistry. 56, 779–827.
Bernet, D., Schmidt, H., Meier, W., Burkhardt‐Holm, P., & Wahli, T. (1999). Histopathology in fish: proposal for a protocol to assess aquatic pollution. Journal of fish diseases, 22(1), 25-34.
Beutler, E. (1975). Red Cell Metabolism: A manual of biochemical methods. Grune & Straton, New York.
Bolognesi, C. (2003). Genotoxicity of pesticides: a review of human biomonitoring studies. Mutation Research/Reviews in Mutation Research, 543(3), 251-272.. Boutilier, R.G. (2001). Mechanisms of cell survival in hypoxia and hypothermia. Journal of Experimental Biology, 204(18), 3171-3181. Bracken, C.P., Whitelaw, M. L., & Peet, D.J. (2003). The hypoxia-inducible factors: key transcriptional
152
regulators of hypoxic responses. Cellular and Molecular Life Sciences CMLS, 60(7), 1376-1393.
Bradford, M.M. (1976). A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the protein-dye binding. Analytical Biochemistry 72:248-254.
Brandão, R.M.L. Efeitos do hormônio do crescimento recombinante bovino (rbgh lactotropin
®) na
expressão do gene igf-i e parâmetros fisiológicos em juvenis de tambaqui (Colossoma macropomum)/ Rúbia Maielli Lima Brandão. Dissertação (mestrado) Newton Lins, Manaus, 2015. Orientador: Dra.Vera Maria Fonseca de Almeida e Val. Área de concentração: Aquicultura.
Braz-Mota, S., Sadauskas-Henrique, H., Duarte, R. M., Val, A. L., & Almeida-Val, V. M. (2015). Roundup
®
exposure promotes gills and liver impairments, DNA damage and inhibition of brain cholinergic activity in the Amazon teleost fish Colossoma macropomum. Chemosphere, 135, 53-60.
Cahill, M.A., Janknecht, R., & Nordheim, A. (1996). Signalling pathways: jack of all cascades. Current Biology, 6(1), 16-19. Cattaneo, R., Clasen, B., Loro, V. L., de Menezes, C.C., Pretto, A., Baldisserotto, B., ... & de Avila, L. A. (2011). Toxicological responses of Cyprinus carpio exposed to a commercial formulation containing glyphosate. Bulletin of Environmental Contamination and Toxicology, 87(6), 597-602.
Cavalcante, D. G. S. M., Martinez, C. B. R., & Sofia, S. H. (2008). Genotoxic effects of Roundup® on the
fish Prochilodus lineatus. Mutation Research/Genetic Toxicology and Environmental Mutagenesis, 655(1), 41-46.
Çavaş, T., & Könen, S. (2007). Detection of cytogenetic and DNA damage in peripheral erythrocytes of goldfish (Carassius auratus) exposed to a glyphosate formulation using the micronucleus test and the comet assay. Mutagenesis, 22(4), 263-268. Chabot, D., & Claireaux, G. (2008). Environmental hypoxia as a metabolic constraint on fish: the case of Atlantic cod, Gadus morhua. Marine Pollution Bulletin, 57(6), 287-294. Chandel, N. S., & Schumacker, P. T. (2000). Cellular oxygen sensing by mitochondria: old questions, new insight. Journal of Applied Physiology, 88(5), 1880-1889.
Chen, N., Chen, L. P., Zhang, J., Chen, C., Wei, X. L., Gul, Y., ... & Wang, H. L. (2012). Molecular characterization and expression analysis of three hypoxia-inducible factor alpha subunits, HIF-1α/2α/3α of the hypoxia-sensitive freshwater species, Chinese sucker. Gene, 498(1), 81-90. Chippari-Gomes, A.R., Gomes, L.C., Lopes, N.P., Val, A.L., & Almeida-Val, V.M.F. (2005). Metabolic adjustments in two Amazonian cichlids exposed to hypoxia and anoxia. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology, 141(3), 347-355. Cox, A.D., Brtva, T.R., Lowe, D.G., Der, C.J. (1994). R-ras induces malignant, but not De Boeck, G., Wood, C. M., Iftikar, F. I., Matey, V., Scott, G. R., Sloman, K. A., ... & Val, A. L. (2013). Interactions between hypoxia tolerance and food deprivation in Amazonian oscars, Astronotus ocellatus. Journal of Experimental Biology, 216(24), 4590-4600.
Ferreira, D., da Motta, A. C., Kreutz, L. C., Toni, C., Loro, V. L., & Barcellos, L. J. G. (2010). Assessment of oxidative stress in Rhamdia quelen exposed to agrichemicals. Chemosphere, 79(9), 914-921.
153
Geng, X., Feng, J., Liu, S., Wang, Y., Arias, C., & Liu, Z. (2014). Transcriptional regulation of hypoxia inducible factors alpha (HIF-α) and their inhibiting factor (FIH-1) of channel catfish (Ictalurus punctatus) under hypoxia. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology, 169, 38-50. Gholami-Seyedkolaei, S. J., Mirvaghefi, A., Farahmand, H., Kosari, A.A., Gholami-Seyedkolaei, S.J., Gholami-Seyedkolaei S. J. (2013). Optimization of recovery patterns in common carp exposed to Roundup using response surface methodology: evaluation of neurotoxicity and genotoxicity effects and biochemical parameters. Ecotoxicology and Environmental Safety, 98, 152-161.
Gingerich, W.H. (1982). Hepatic toxicology of fishes. In Aquatic Toxicology (L. J. Weber, ed.), pp. 55–105. Raven Press, New York. Glusczak, L., dos Santos Miron, D., Crestani, M., da Fonseca, M. B., de Araújo Pedron, F., Duarte, M. F., & Vieira, V. L. P. (2006). Effect of glyphosate herbicide on acetylcholinesterase activity and metabolic and hematological parameters in piava (Leporinus obtusidens). Ecotoxicology and Environmental Safety, 65(2), 237-241.
Glusczak, L., dos Santos Miron, D., Moraes, B.S., Simões, R.R., Schetinger, M.R.C., Morsch, V.M., & Loro, V.L. (2007). Acute effects of glyphosate herbicide on metabolic and enzymatic parameters of silver catfish (Rhamdia quelen). Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology, 146(4), 519-524. Glusczak, L., Loro, V.L., Pretto, A., Moraes, B.S., Raabe, A., Duarte, M.F., ... & de Sousa Valladão, D.M. (2011). Acute exposure to glyphosate herbicide affects oxidative parameters in piava (Leporinus obtusidens). Archives of Environmental Contamination and Toxicology, 61(4), 624-630. Gontijo, A.M.M.C., & Tice, R. (2003). Teste do cometa para a detecção de dano no DNA e reparo em células individualizadas. Mutagênese ambiental. Canoas: Ulbra, 173-200. Guilherme, S., Gaivao, I., Santos, M. A., & Pacheco, M. (2010). European eel (Anguilla anguilla) genotoxic and pro-oxidant responses following short-term exposure to Roundup
®a glyphosate-based
herbicide. Mutagenesis, 25(5), 523-530. Guilherme, S., Santos, M. A., Barroso, C., Gaivão, I., & Pacheco, M. (2012). Differential genotoxicity of Roundup® formulation and its constituents in blood cells of fish (Anguilla anguilla): considerations on chemical interactions and DNA damaging mechanisms. Ecotoxicology, 21(5), 1381-1390. Guilherme, S., Santos, M.A., Gaivão, I., & Pacheco, M. (2014). Are DNA-damaging effects induced by herbicide formulations (Roundup® and Garlon®) in fish transient and reversible upon cessation of exposure. Aquatic Toxicology. 155: 213-221. He, W., Cao, Z. D., & Fu, S. J. (2015). Effect of temperature on hypoxia tolerance and its underlying biochemical mechanism in two juvenile cyprinids exhibiting distinct hypoxia sensitivities. Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology, 187, 232-241. Hochachka, P.W., Somero, G.N., 2002. Biochemical Adaptation: Mechanism and Process in Physiological Evolution. Oxford University Press. Hued, A. C., Oberhofer, S., & de los Ángeles Bistoni, M. (2012). Exposure to a commercial glyphosate formulation (Roundup
®) alters normal gill and liver histology and affects male sexual activity of Jenynsia
multidentata (Anablepidae, Cyprinodontiformes). Archives of Environmental Contamination and Toxicology, 62(1), 107-117. Jayaseelan, C., Rahuman, A. A., Ramkumar, R., Perumal, P., Rajakumar, G., Kirthi, A. V., ... & Marimuthu, S. (2014). Effect of sub-acute exposure to nickel nanoparticles on oxidative stress and
histopathological changes in Mozambique tilapia, Oreochromis mossambicus. Ecotoxicology and Environmental Safety, 107, 220-228.
Jiang, Z.Y., Woolland, A.C.S., Wolf, S.P. (1991). Lipid hydroperoxide measurement by oxidation of Fe2+ in the presence of xylenol orange-comparison with TBA assay and on iodometric method. Lipids 26:777-860.
Junk, W. J. (1980). Áreas inundáveis-Um desafio para limnologia. Acta Amazonica. n. 10, 775– 796.
Kampen, E.J.; Zijlstra, W.G. 1964. Standartization of haemoglobinometry. In: Boroviczény, C. G. (Ed.) Erythrocytometric Methods and their standardization. Blibliotheca Haematologica, p.68-72. Keen, J.H., Habig, W.H., Jakoby, W.B. 1976. Mechanism for the several activities of the glutathione S-transferase. The Journal of Biological Chemistry 251:6183-6188. Kobayashi, S.C., Morikawa, Y., Hayashi, M., Sofuni, T. (1995). A comparison between manual microscopic analysis and computerized image analysis in the single cell gel electrophoresis assay MMS Community, 2 pp. 103–115.
Kochhann, D., Campos, D.F., & Val, A.L. (2015). Experimentally increased temperature and hypoxia affect stability of social hierarchy and metabolism of the Amazonian cichlid Apistogramma agassizii. Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology, 190, 54-60. Kodama, K., Rahman, M.S., Horiguchi, T., & Thomas, P. (2012). Upregulation of hypoxia-inducible factor (HIF)-1α and HIF-2α mRNA levels in dragonet Callionymus valenciennei exposed to environmental hypoxia in Tokyo Bay. Marine pollution bulletin, 64(7), 1339-1347. Kreutz, L. C., Barcellos, L. J. G., de Faria Valle, S., de Oliveira Silva, T., Anziliero, D., dos Santos, E. D., ... & Zanatta, R. (2011). Altered hematological and immunological parameters in silver catfish (Rhamdia quelen) following short term exposure to sublethal concentration of glyphosate. Fish & Shellfish Immunology, 30(1), 51-57. Langiano, C.C. & Martinez, C.B. (2008). Toxicity and effects of a glyphosate-based herbicide on the Neotropical fish Prochilodus lineatus. Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology, 147(2), 222-231.
Lee, Y. M., Jung, S. O., Seo, J. S., Yoon, Y. D., & Lee, J. S. (2006). Cloning of Ki-ras and Ha-ras cDNAs from the hermaphroditic fish Rivulus marmoratus (Cyprinodontiformes, Rivulidae) and its expression after exposure to 4-nonylphenol. Marine environmental research, 62, S136-S140. Leite, M. B. N. L., da Cruz, A. L., Rodrigues, L. E. A., Yamashita, S. R., Carqueija, C. R. G., & Nascimento, I. A. (2015). Comparing the Toxicity of Water-Soluble Fractions of Biodiesel, Diesel and 5% Biodiesel/Diesel Blend on Oreochromis niloticus Using Histological Biomarkers. Bulletin of Environmental Contamination and Toxicology, 95(5), 574-581. Li, A. P., & Long, T. J. (1988). An evaluation of the genotoxic potential of glyphosate. Toxicological Sciences, 10(3), 537-546. Li, W. M., Yin, D. Q., Zhou, Y., Hu, S. Q., & Wang, L. S. (2003). 3, 4-Dichloroaniline-induced oxidative stress in liver of crucian carp (Carassius auratus). Ecotoxicology and Environmental Safety, 56(2), 251-255. Li, Z. H., Velisek, J., Zlabek, V., Grabic, R., Machova, J., Kolarova, J., ... & Randak, T. (2011). Chronic toxicity of verapamil on juvenile rainbow trout (Oncorhynchus mykiss): effects on morphological indices, hematological parameters and antioxidant responses. Journal of Hazardous Materials, 185(2), 870-880.
155
Liu, S., Zhu, K., Chen, N., Wang, W., & Wang, H. (2013). Identification of HIF-1α promoter and expression regulation of HIF-1α gene by LPS and hypoxia in zebrafish. Fish physiology and biochemistry, 39(5), 1153-1163. Lushchak, V. I. (2011). Environmentally induced oxidative stress in aquatic animals. Aquatic Toxicology, 101(1), 13-30.
Lushchak, V., Kubrak, O. I., Storey, J. M., Storey, K. B., & Lushchak, V. I. (2009). Low toxic herbicide Roundup induces mild oxidative stress in goldfish tissues. Chemosphere, 76(7), 932-937.
Lutz, P. L. and Nilsson, G. E. (1997). Contrasting strategies for anoxic brain survival – glycolysis up or down. Journal of Experimental Biology. 200, 411-419. Mañas, F., Peralta, L., Raviolo, J., Ovando, H. G., Weyers, A., Ugnia, L., ... & Gorla, N. (2009). Genotoxicity of glyphosate assessed by the comet assay and cytogenetic tests. Environmental Toxicology and Pharmacology, 28(1), 37-41. Mangold, K., Chang, Y. J., Mathews, C., Marien, K., Hendricks, J., & Bailey, G. (1991). Expression of ras genes in rainbow trout liver. Molecular Carcinogenesis, 4(2), 97-102. Menezes, C. C., Da Fonseca, M. B., Loro, V. L., Santi, A., Cattaneo, R., Clasen, B., ... & Morsch, V. M. (2011). Roundup effects on oxidative stress parameters and recovery pattern of Rhamdia quelen. Archives of Environmental Contamination and Toxicology, 60(4), 665-671. Miyazaki, D.M.Y., Machado Neto, J.G., Castagnolli, N., (2004). Toxicidade aguda de triclorfon, partion metílico e glifosato para alevinos de tambaqui (Colossoma macropormum) e tambacu (C. macropormum X Piaractus mesopotamicus). In: Anais Encontro Brasileiro de Patologistas de Organismos Aquáticos (ENBRAPOA), Laguna. Maringá: Biblioteca Setorial da UEM. 8, 203. Modesto, K. A., & Martinez, C. B. (2010). Effects of Roundup Transorb on fish: hematology, antioxidant defenses and acetylcholinesterase activity. Chemosphere, 81(6), 781-787. Mora, N., Rosales, R., & Rosales, C. (2007). R-Ras promotes metastasis of cervical cancer epithelial cells. Cancer Immunology, Immunotherapy, 56(4), 535-544. Mustafa, S. A., Davies, S. J., & Jha, A. N. (2012). Determination of hypoxia and dietary copper mediated sub-lethal toxicity in carp, Cyprinus carpio, at different levels of biological organisation. Chemosphere, 87(4), 413-422. Muusze, B., Marcon, J., van den Thillart, G., & Almeida-Val, V. (1998). Hypoxia tolerance of Amazon fish: respirometry and energy metabolism of the cichlid Astronotus ocellatus. Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology, 120(1), 151-156.
Navarro, C.E.K.G.; Pachaly, J.R. 1994. Manual de hematologia veterinária. São Paulo: Varela. p. 74–75.
Negreiros, L. A., Silva, B. F., Paulino, M. G., Fernandes, M. N., & Chippari-Gomes, A. R. (2011). Effects of hypoxia and petroleum on the genotoxic and morphological parameters of Hippocampus reidi. Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology, 153(4), 408-414. Nemoto, N., Kodama, K. I., Tazawa, A., Masahito, P., & Ishikawa, T. (1986). Extensive sequence homology of the goldfish ras gene to mammalian ras genes. Differentiation, 32(1), 17-23. Neškovic, N.K., Poleksic, V., Elezovic,I., Karan,V., Budimir, M. (1996). Biochemical and histopathological effects of glyphosate on carp, Cyprinus carpio L. Bulletin of Environmental Contamination and Toxicology.56: 295–302.
156
Nogueira, P. R., Lourenço, J., Mendo, S., & Rotchell, J. M. (2006). Mutation analysis of ras gene in the liver of European eel (Anguilla anguilla L.) exposed to benzo [a] pyrene. Marine Pollution Bulletin, 52(12), 1. Nogueira, P., Pacheco, M., Pereira, M. L., Mendo, S., & Rotchell, J. M. (2010). Anchoring novel molecular biomarker responses to traditional responses in fish exposed to environmental contamination. Environmental Pollution, 158(5), 1783-1790. Ortiz-Ordoñez, E., Uría-Galicia, E., Ruiz-Picos, R. A., Duran, A. G. S., Trejo, Y. H., Sedeño-Díaz, J. E., & López-López, E. (2011). Effect of Yerbimat herbicide on lipid peroxidation, catalase activity, and histological damage in gills and liver of the freshwater fish Goodea atripinnis. Archives of Environmental Contamination and Toxicology, 61(3), 443-452.
Pfaffl, M.W. 2001. A new mathematical model for relative quantification in real-time RT PCR. Nucleic Acids Research, 29(9): 2003-2007.
Poleksic, V. e Mitrovic-Tutundžic V. 1994. Fish gills as a monitor of sublethal and chronic effects of pollution. IN: Müller, R.; Lloyd, R. Sublethal and chronic effects of pollutants on freshwater fish. Oxford: Fishing News Books. 30: 339-352.
Pörtner, H. O., & Grieshaber, M. K. (1993). Critical PO2 (s) in oxyconforming and oxyregulating animals gas exchange, metabolic rate and the mode of energy production. The vertebrate gas transport cascade adaptations to environment and mode of life (JEPW Bicudo, ed) CRC Press, Boca Raton FL, 330-357.
Quintero, M., Mackenzie, N., & Brennan, P. A. (2004). Hypoxia-inducible factor 1 (HIF-1) in cancer. European Journal of Surgical Oncology (EJSO), 30(5), 465-468. Radi, A. A. R., Matkovics, B., & Gabrielak, T. (1985). Comparative antioxidant enzyme study in freshwater fish with different types of feeding behaviour. Comparative Biochemistry and Physiology Part C: Comparative Pharmacology, 81(2), 395-399. Relyea, R.A. (2005). The impact of insecticides and herbicides on the biodiversity and productivity of aquatic communities. Ecological Applications, 15(2), 618-627. Roberts RJ. Fish pathology. London: Bailliere Tindall London; 1978. pp318. Rotchell, J. M., Lee, J. S., Chipman, J. K., & Ostrander, G. K. (2001). Structure, expression and activation of fish ras genes. Aquatic Toxicology, 55(1), 1-21. Saez, R., Chan, A.M., Miki, T., Aaronson, S.A., 1994. Oncogenic activation of human R-ras by point mutations analogous to those of prototype H-ras oncogenes. Oncogene 9, 2977–2982. Samanta, P., Mukherjee, A. K., Pal, S., Kole, D., & Ghosh, A. R. (2016). Toxic effects of glyphosate-based herbicide, Excel Mera 71 on gill, liver, and kidney of Heteropneustes fossilis under laboratory and field conditions. Journal of Microscopy and Ultrastructure. Saravanan, M., Karthika, S., Malarvizhi, A., & Ramesh, M. (2011). Ecotoxicological impacts of clofibric acid and diclofenac in common carp (Cyprinus carpio) fingerlings: hematological, biochemical, ionoregulatory and enzymological responses. Journal of hazardous materials, 195, 188-194. Semenza, G. L. (2001). HIF-1 and mechanisms of hypoxia sensing. Current Opinion in Cell Biology, 13(2), 167-171.
157
Shiogiri, N. S., Paulino, M. G., Carraschi, S. P., Baraldi, F. G., da Cruz, C., & Fernandes, M. N. (2012). Acute exposure of a glyphosate-based herbicide affects the gills and liver of the Neotropical fish, Piaractus mesopotamicus. Environmental Toxicology and Pharmacology, 34(2), 388-396.
Silva, A.G. 2004. Alterações histopatológicas de peixes como biomarcadores da contaminação aquática. Dissertação (Mestre em Ciências Biológicas). Universidade Estadual de Londrina.
Silva, J., Freitas, T.R.O., Marinho, J.R., Speit, G., Erdtmann, B. 2000. An alkaline single-cell gel electrophoresis (comet) assay for environmental biomonitoring with native rodents. General Molecular Biology. 23(1): 241-245.
Singh, N. P.; M. T. Mccoy; R.R. Tice & E. L. Schneider. (1988). A simple technique for quantitation of low levels of DNA damage in individual cells. Experimental Cell Research, 175:184-191.
Smith, M.R., DeGudicibus, S.J., Stacey, D.W., 1986. Requirement for c-ras proteins during viral oncogene transformation. Nature, 320, 540–543. Steffensen, J., (1989). Some errors in respirometry of aquatic breathers: how to avoid and correct for them. Fish Physiology and Biochemistry 6: 49–59. Takashima, F., Hibiya, T. (1995). An Atlas of Fish Histology. Normal and Pathological Features, second ed. Kodansha Ltd., Tokyo. Terova, G., Rimoldi, S., Corà, S., Bernardini, G., Gornati, R., & Saroglia, M. (2008). Acute and chronic hypoxia affects HIF-1α mRNA levels in sea bass (Dicentrarchus labrax). Aquaculture, 279(1), 150-159. Tomita, R. Y., & Beyruth, Z. (2002). Toxicologia de agrotóxicos em ambiente aquático. Biológico, 64(2), 135-142.
Torten, M., Liu, Z., Okihiro, M. S., Teh, S. J., & Hinton, D. E. (1996). Induction of ras oncogene mutations and hepatocarcinogenesis in medaka (Oryzias latipes) exposed to diethylnitrosamine. Marine Environmental Research, 42(1), 93-98. Tsui, M. T., & Chu, L. M. (2004). Comparative toxicity of glyphosate-based herbicides: aqueous and sediment pore water exposures. Archives of Environmental Contamination and Toxicology, 46(3), 316-323. Uchida, M., Takumi, S., Tachikawa, K., Yamauchi, R., Goto, Y., Matsusaki, H., ... & Arizono, K. (2012). Toxicity evaluation of glyphosate agrochemical components using Japanese medaka (Oryzias latipes) and DNA microarray gene expression analysis. The Journal of Toxicological Sciences, 37(2), 245-254. Val, A.L., 1995. Oxygen transfer in fish: morphological and molecular adjustments. Braziliam Jounal of Medicine and Biology Research. 28, 1119–1127. Val, A. L., & Honczaryk, A. (1995). A criação de peixes na Amazônia: um futuro promissor. Criando peixes na Amazônia, 1-5. Val AL, de Almeida-Val VMF. Fishes of the Amazon and their Environment. Physiological and Biochemical Aspects. Berlin: Springer, 1995. Val, A.L. 1996. Surviving low oxygen levels: lessons from fishes of the Amazon. In Val, AL., Almeida-Val, VMF. and Randall,DJ. (Eds.). Physiology and Biochemistry of the Fishes of the Amazon. Manaus: INPA. p. 59-73. Val, A.L. and Almeida-Val, V.M.F. Effect of crude oil on respiratory aspects of some fish species of the Amazon, Biology of Tropical Fish. 22 (1999) 277–291.
158
Val, A. L., Silva, M. N. P., & Val, V. M. F. A. (2004). Estresse em peixes–ajustes fisiológicos e distúrbios orgânicos. Sanidade de organismos aquáticos. São Paulo: Varela, 75-88. Vásquez, K.L. Ontogenia das enzimas digestivas do tambaqui, Colossoma macropomum (CUVIER, 1818): subsídios para a aquicultura/Katherine López Vásquez. Manaus: AM, 2009. Tese (doutorado), Manaus, 2009.Orientador: Dr. Adalberto Luís Val Área de concentração: Biotecnologia. Wang, G. L., & Semenza, G. L. (1993). Characterization of hypoxia-inducible factor 1 and regulation of DNA binding activity by hypoxia. Journal of Biological Chemistry, 268(29), 21513-21518. WHO – International Programme on Chemical Safety Glyphosate, 1994. Environmental Health Criteria 159 – Glyphosate. Wu, R.S.S. (2009). Effects of hypoxia on fish reproduction and development. In: Richards, J.G., Farrell, A.P., Brauner, C.J. (Eds.), Hypoxia. Elsevier, London, pp. 79–141. Zhang, G., Mao, J., Liang, F., Chen, J., Zhao, C., Yin, S., ... & Chen, S. (2016). Modulated expression and enzymatic activities of Darkbarbel catfish, Pelteobagrus vachelli for oxidative stress induced by acute hypoxia and reoxygenation. Chemosphere, 151, 271-279. Zhydenko, A. O. (2008). Dynamics of the Juvenile Carps' Hematological Parameters under the Impact of Herbicides. Hydrobiological Journal, 44(5). Zhydenko, A. O., & Kovalenko, Y. M. (2007). The influence of Roundup on the dynamics of histological changes in organs of carps. Hydrobiological Journal, 43(2).
159
Tables and Figures
Table 1. Characteristics of each specific primer obtained for the experiment. Primers for endogenous
genes (28S e ef-1) and primers for the target genes (ras e hif-1).
Gene
Primer sequence (5`-3`)
forward/reverse
Length (bp)
Amplicon length(bp)
Tm
Ef(%)
*
28S-Fa
CGGGTTCGTTTGCGTTAC
18 150 54.5 98.19
28S-Ra
AAAGGGTGTCGGGTTCAGAT
20 150 56.3 98.19
ef-1Fb
GTTGGTGAGTTTGAGGCTGG
20 78 60.7 99.09
ef-1Rb
CACTCCCAGGGTGAAAGC
18 78 60.9 99.09
Ras-F
CCAGTACATGAGGACAGGAG
20 134 60.3 99.31
Ras-R
CAAGCACCATTGGCACATCG
20 134 60.3 99.31
HIF-1F
ATCAGCTACCTGCGCATG 18 133 59.3 100.69
HIF-1R
CTCCATCCTCAGAAAGCAC 19 133 57.3 100.69
*Primer Efficience a. Vasquez (2009) b. Brandão (2015)
160
Table 2. Hematological and glucose parameters of tambaqui (Colossoma macropomum) submitted to
different concentration of O2 and contamination by RD. The values are presented as mean ± standard
error of the mean (SEM). Lowercase letters represent significant differences (p <0.05) between the
different treatments (N x NRD and H x HRD). The asterisk represents significant difference (p <0.05)
between the treatments N x H and NRD and HRD.
Treatment [Hb]
(g/dL)
Ht
(%)
RBC
(106/mm
3)
MVC
(μm3)
MHC
(pg)
MCHC
(%)
Glucose
mg/dL
Normoxia (N)
6.41 ± 0.5a 28.3 ± 1.0
a 1.48 ± 0.07
a 187.2 ± 4.8
a 43.3 ± 2.8
a 23.0 ± 1.1
a 54.0 ± 6.4
a
Normoxia and RD (NRD)
6.80 ± 0.6a 27.3 ± 1.0
a 1.43 ± 0.03
a 187.4 ± 5.9
a 47.1 ± 3.3
a 25.1 ± 1.7
a 96.2 ± 7.5
b
Hypoxia (H)
8.27 ± 0.3a* 32.0 ± 0.9
a* 1.69 ± 0.08
a* 197.6 ± 6.9
a 50.8 ± 1.8
a* 25.7 ± 0.6
a 35.4 ± 6.8
a
Hypoxia and RD (HRD)
7.71 ± 0.2a 27.6 ± 1.0
b 1.52 ± 0.09
a 182.9 ± 8.6
a 51.0 ± 2.4
a 27.9 ± 0.7
a 144.2 ± 20.0
b*
161
Table 3. Distribution of blood cells DNA damage in tambaqui according to the level of comet damage in each
treatment and Genetic Damage Index (0-400). The levels of comet damage are distributed in perceptual of cells
damage (%). The GDI values are presented as mean ± standard error of the mean (SEM). Lowercase letters
represent significant differences (p <0.05) between the different treatments (N x NRD) and (H x HRD). The asterisk
represents significant difference (p <0.05) between the same treatments N and H.
Treatments Levels of comet damage in 100 cells (%) Genetic Damage Index (GDI 0-400) 0 1 2 3 4
Normoxia (N)
6.88 20.22 27.77 21.55 23.55 234.6 ± 15.0 a
Normoxia and Roundup (NRD)
2.44 7.61 16.27 16.22 57.44 327.0 ± 7.7 b
Hypoxia (H)
0.58 10.47 18.7 15.47 54.76 317.2 ± 18.5 a*
Hypoxia and Roundup (HRD)
0 3 24.12 18.12 54.75 327.4 ± 21.31 a
162
Table 4. Qualitative distribution of histopathology damage and occurrence intensity (0 absent, 0+ low frequency, +
moderate frequency, ++ frequent and +++ high frequency) on the liver of C. macropomum after 96h exposure to
normoxia (N), normoxia plus RD (NRD), hypoxia (H) and hypoxia plus RD (n=10).
Lesion Type Stage Treatments
N NRD H HRD
Nuclei Hypertrophy
I + + + +
Cell Hypertrophy
I + + ++ +
Nuclei in cell periphery
I 0+ + ++ ++
Cytoplasm Vacuolization
I ++ ++ +++ +++
Leukocyte infiltration
I 0+ 0+ + +
Sinusoid Dilation
I + + + +
Cellular deformation
I + ++ +++ ++
Derangement of hepatic cords
I 0 0+ ++ ++
Vessel congestion
II
+ + + +
Nuclei vacuolization
II
0+ + + ++
Nuclei degeneration
II
+ + ++ +++
Cytoplasm degeneration
II
+ ++ ++ +++
Pyknotic nuclei
II
++ ++ ++ +++
Cell disruption
II
+ ++ ++ +++
Focal Necrosis
III
0+ + +++ +++
163
Figure 1. The effects of progressive hypoxia on MO2 in C. macropomum after 96h exposure to no
contaminated water (A) and RD contaminated water (B). The average critical oxygen tensions (PO2 crit)
that were calculated for no contaminated C.macropomum (1.49 mg l-1
± 0.06) and C. macropomum
exposed to RD (1.47 mg l-1
± 0.13).
164
Figure 2. GST (A) and CAT (B) activity and LPO (C) levels in C. macromopum exposed to normoxia (N), normoxia plus RD (NRD), hypoxia (H)
and hypoxia plus RD (HRD) exposed for 96h. Lowercase letters represent significant differences (P <0.001) between the different treatments. The
asterisk represents significant difference (P <0.001) between N compared with H and NRD compared to HRD.
165
Figure 3. C. macropomum liver exposed for 96h for N, NRD, H and HRD treatments. A: Normal C.
macropomum liver exposed to normoxia (N), asterisk indicate a blood vessel. B: Normal C.
macropomum liver exposed to normoxia (N), asterisk indicate liver hepatopancreas. C: Liver exposed to
NRD. Head arrows indicate sinusoids dilatation. D: Fish liver exposed to H. Black arrows indicate
leucocytes infiltration. E: Fish liver exposed to H. Head arrows indicate nuclear vacuolization, asterisks
cellular vacuolization. F: C. macropomum exposed to HRD. Asterisks showed injured bile duct. Black
arrows indicate focal necrosis of the bile duct and hepatocytes around. Hematoxylin and Eosin Stain.
166
Figure 4. Hif-1 relative gene expression in C. macromopum exposed to normoxia (N), normoxia plus
RD (NRD), hypoxia (H) and hypoxia plus RD (HRD) exposed for 96h. Lowercase letters represent
significant differences (P <0.001) between the different treatments. The asterisk represents significant
difference (P <0.001) between N compared with H and NRD compared to HRD.
Figure 5. Ras oncogene relative gene expression in C. macromopum exposed to normoxia (N), normoxia
plus RD (NRD), hypoxia (H) and hypoxia plus RD (HRD) exposed for 96h. Lowercase letters represent
significant differences (P <0.001) between the different treatments. The asterisk represents significant
difference (P <0.001) between N compared with H and NRD compared to HRD.
167
5. Conclusões Gerais
No primeiro capítulo verificamos que em tambaqui sob o efeito agudo do BaP o
oncogene ras e o gene hif-1 apresentaram maiores níveis de expressão nas
concentrações intermediárias do contaminante (4, 8 e 16 mol/kg de BaP). No grupo
controle e na maior concentração do contaminante (32 mol/kg de BaP) ambos os
genes apresentaram baixos níveis de expressão. Esses resultados, menores níveis de
expressão gênica para ras e gene hif-1 na maior concentração de BaP, foram
explicados pelos danos histológicos no fígado dos animais expostos, que apresentou
intensa ocorrência de necrose tecidual com comprometimento do funcionamento do
órgão.
No segundo capítulo ficou evidente que o cenário extremo (A2) proposto pelo
IPCC (2007) magnifica os efeitos do contaminante BaP em tambaqui exposto
cronicamente a este cenário. O tambaqui exposto ao cenário extremo apresentou
maiores níveis de expressão do oncogene ras e do gene hif-1 em ambas as
concentrações de BaP (8 e 16 mol/kg de BaP). A maior expressão de ambos os
genes no cenário extremo em peixes injetados com BaP pôde ser explicada por um
aumento da demanda metabólica do fígado para manter a integridade celular, já que
ras está envolvido com o controle do ciclo celular e hif-1 participa dos processos de
proliferação celular. As defesas antioxidantes (CAT e GST) e os níveis de
lipoperoxidação (LPO) do fígado não apresentaram diferença após 30 dias de
exposição, evidenciando uma diminuição das respostas adaptativas ao estresse
oxidativo. Os danos genotóxicos das células sanguíneas, verificados por meio do
ensaio cometa, e as alterações histológicas do fígado demonstraram ser excelentes
ferramentas para a análise dos efeitos de BaP em peixes expostos aos cenários do
IPCC. Portanto, as defesas celulares dos tambaquis expostos ao BaP foram
comprometidas nos peixes expostos ao cenário extremo, com o aumento dos danos
histológicos e grau de quebra de DNA nas células sanguíneas.
No terceiro capítulo verificamos que o tambaqui é uma espécie muito sensível aos
efeitos do herbicida Roundup® (RD) e que este efeito é ainda maior quando combinado
168
com a exposição a baixas concentrações de oxigênio (hipóxia). Nos peixes
submedidos a hipóxia e RD os danos teciduais no fígado foram intensos, com aumento
da ocorrência de necroses; além disso, os danos genotóxicos também foram maiores
nas células sanguíneas onde foi observado o aumento do grau de quebra de DNA. A
hipóxia teve um feito supressor nos níveis de expressão do gene hif-1, este
comportamento pôde ser explicado pelo maior desafio imposto à maquinaria celular
para a manutenção da integridade do tecido hepático. O RD induziu uma maior
expressão do oncogene ras, contribuindo para a sobrevivência celular, mas combinado
com a hipóxia, os seus níveis de expressão caíram, assim como ocorreu com o gene
hif-1. As defesas antioxidantes (GST e CAT) foram capazes de minimizar o efeito das
espécies reativas de oxigênio evitando altos níveis de lipoperoxidação das membranas
celulares dos hepatócitos.
Em síntese, a espécie do peixe amazônico Colossoma macropomum,
demonstrou ser um excelente modelo em trabalhos toxicológicos e em trabalhos que
envolvam marcadores genotóxicos. Sugerimos que tambaqui pode e deve ser utilizado
como espécie bioindicadora da qualidade do ambiente aquático, bem como modelo
para entender o comportamento de alguns genes relacionados ao desenvolvimento de