high-altitude hypoxia

- - 1

Inactivation of corticotropin releasing hormone-induced insulinotropic role by 1

high-altitude hypoxia 2

Running title: hypoxia inactivates insulinotropic role of CRH 3

Ke Hao1, Fan-Ping Kong1, Yu-Qi Gao2, Jia-Wei Tang1, Jian Chen2, Mark Evans3, Stafford L. 4

Lightman4, Xue-Qun Chen1* and Ji-Zeng Du1* 5

6

1Division of Neurobiology and Physiology, Department of Basic Medical Sciences, School of 7

Medicine, Key Laboratory of Medical Neurobiology of the Ministry of Health of China, 8

Zhejiang University, Hangzhou, China 9

2Department of Pathophysiology and High Altitude Physiology, College of High Altitude 10

Military Medicine, Third Military Medical University, Chongqing, China 11

3Centre for Integrative Physiology, College of Medicine and Veterinary Medicine, University 12

of Edinburgh, Edinburgh, UK 13

4Henry Wellcome Laboratories for Integrative Neuroscience & Endocrinology, University of 14

Bristol, Bristol, UK 15

16

*Corresponding authors: Prof. Ji-Zeng Du and Xue-Qun Chen, Research Building C507, 17

School of Medicine, Zhejiang University, Hangzhou, 310058, China 18

Tel: 8657188208182; Fax: 8657188208182; 19

E-mail: [email protected] and [email protected] 20

Word count: 21

Abstract: 199 22

Main text: 3999 23

Figures: 8 24

25

Page 1 of 34 Diabetes

Diabetes Publish Ahead of Print, published online October 2, 2014

- - 2

Abstract 1

We have shown that hypoxia reduces plasma insulin, which correlates with 2

corticotropin-releasing hormone (CRH) receptor 1 (CRHR1) in rats, but the mechanism 3

remains unclear. Here, we report that hypobaric hypoxia of 5,000 m altitude for 8 h enhanced 4

rat plasma CRH, corticosterone, and glucose levels, while plasma insulin and pancreatic 5

ATP/ADP ratio were reduced. In islets cultured under normoxia, CRH stimulated insulin 6

release in a glucose- and CRH-level dependent manner by activating CRHR1 and thus the 7

cAMP-PKA pathway and calcium influx through L-type channels. In islets cultured under 8

hypoxia, however, the insulinotropic effect of CRH was inactivated due to reduced ATP and 9

cAMP, and coincident loss of intracellular calcium oscillations. Serum and 10

glucocorticoid-inducible kinase 1 (SGK1) also played an inhibitory role. In human volunteers 11

rapidly ascended to 3,680 m, plasma CRH and glucose increased without a detectable change 12

in plasma insulin. By contrast, volunteers with acute mountain sickness (AMS) exhibited a 13

marked decrease in homeostasis model assessment of insulin sensitivity (HOMA-IS) and 14

enhanced plasma CRH. In conclusion, hypoxia may attenuate the CRH-insulinotropic effect 15

by reducing cellular ATP/ADP ratio, cAMP and calcium influx, and upregulated SGK1. 16

Hypoxia may not affect HOMA-IS in healthy volunteers, but reduces it in AMS volunteers. 17

18

Page 2 of 34Diabetes

- - 3

To enjoy social activities, millions of people travel to high altitudes every year. High-altitude 1

hypoxia often induces dysfunction and illness, particularly acute mountain sickness (AMS) 2

(1). During the construction of the Qinghai-Tibet railway (at altitudes of 3,000-5,000 m) in 3

China, > 100,000 construction workers were involved and 51% of them developed AMS (2). 4

More over, since the railway began service, > 10 million travelers had visited the Tibet region 5

in 2012, of which 31% developed AMS even despite traveling with oxygen supply on the 6

train (3). Increasing evidence in both humans and animals suggests that exposure to either 7

high-altitude or hypobaric hypoxia influences the plasma insulin levels and glucose 8

homeostasis, depending on the oxygen level and duration of exposure (4-9). We previously 9

showed that sub-acute hypoxia at 5,000 m altitude for 5 days reduces plasma insulin in rats 10

and this effect is blocked by a corticotropin-releasing hormone (CRH) receptor 1 (CRHR1) 11

antagonist in vivo (10). However the underlying mechanisms have not been clearly addressed. 12

Insulin, the unique hypoglycemic hormone, plays a crucial role in maintaining 13

glucose-sensing in pancreatic β-cells and regulating glucose uptake in a variety of tissues and 14

cells during health and disease (11,12). Apart from glucose, many neural and endocrine 15

hormones regulate pancreatic insulin release (13). In particular, CRH is the key regulator of 16

the hypothalamic-pituitary-adrenal (HPA) axis and is activated by a variety of stressors 17

including hypoxia, and mediates a variety of neural and endocrine response to stress (14). 18

Recent studies showed that CRHR1 exists in human, mouse, and rat islets (15,16), and CRH 19

enhances calcium influx (17), increases insulin content, and elevates insulin secretion in a 20

glucose-dependent manner in cultured islets (15,16,18). Furthermore, CRH modulates 21

development, proliferation, and anti-apoptosis in islets (15,16,19). These findings suggest that 22

CRH and CRHR1 may play a significant role in regulating insulin release under normal 23

conditions. We previously showed that hypobaric hypoxia results in upregulated CRH in the 24

paraventricular nucleus and corticosterone (CORT) in the plasma of rats (20,21), which was 25


- - 4

associated with reduced plasma insulin (reversed by a CRHR1 antagonist) and glucose levels 1

in vivo (10). 2

In the present study we address the mechanisms of CRHR1 mediating insulin secretion 3

and glucose homeostasis during hypoxia. To achieve these goals, we completed comparative 4

studies on rats under hypobaric hypoxia and on humans following a rapid ascent to the Tibet 5

plateau. Under hypoxia the cell metabolic state switches from aerobic metabolism towards 6

anaerobic glycolysis, which may lead to reduced ATP production and plasma insulin (10). In 7

this paper, our data suggest that a fall in ATP/ADP ratio and loss of cAMP signaling capacity 8

during hypoxia, attenuates voltage-gated calcium influx and thus inactivates insulinotropic 9

action of CRH. 10

11

RESEARCH DESIGN AND METHODS 12

Animals Male Sprague-Dawley rats, weighing 200-220 g, were purchased from the 13

Laboratory Animal Center of Zhejiang Province, China (Certification No. SCXK2008-0033) 14

and maintained in a 12 h light/dark cycle (lights on at 06:00) at 20 ± 2°C with food and water 15

ad libitum. Rats were adapted for 1 week before experiments. All animal experiments were 16

approved by the Animal Care and Use Committee of the School of Medicine, Zhejiang 17

University. 18

Islet isolation Pancreatic islets were isolated by collagenase digestion from rats as previously 19

described (22). Intact islets were cultured in RPMI 1640 medium (containing 8.3 mM glucose) 20

supplemented with 10% FBS, 10 mM HEPES, and penicillin/streptomycin (Invitrogen, 21

Carlsbad, CA) at 37°C under 5% CO2 and 21% O2 for overnight recovery before experiments. 22

Human hypoxia exposure Sixty-seven healthy male volunteers (18-23 years old) were 23

recruited in Chengdu, China, at 540 m altitude, as basal lowland controls. They were 24

informed about the objectives of the study and agreed to the experimental protocols. All 25


- - 5

studies were approved by the Ethics Committee of the Third Military Medical University. 1

Their blood oxygen saturation (SpO2) was determined with a finger pulse oximeter. Fasting 2

blood samples were collected at 07:00-08:00 before breakfast in Chengdu. Each day, starting 3

two days before the flight to Rikaze, China, at 3,860 m altitude, volunteers were given a 4

Rhodiola capsule (Z10980020, Tibet Nuodikang Medicine, Lhasa, China) orally to improve 5

endurance and resistance to hypoxia. On the third morning at Rikaze, SpO2 was measured and 6

fasting blood samples were collected again. The AMS score was obtained using the Lake 7

Louise Score (LLS ≥ 3) (23). Plasma was obtained by centrifugation as soon as possible and 8

stored at -80°C until use. 9

Hypoxia exposure of animals and isolated islets The rats in the hypoxia group were placed 10

in a hypobaric chamber (FLYDWC-50-IIC; AVIC Guizhou Fenglei Aviation Armament Co., 11

Ltd, Guizhou, China,) and exposed to hypoxia of 2,000 m altitude (79.97 kPa, equivalent to 12

16.0% O2 at sea level) or 5,000 m altitude (54.02 kPa, 10.8% O2). The chamber was opened 13

daily for 30 min to clean and replenish food and water during the 5 days of exposure. The 14

normoxia group was placed in an identical chamber at sea level (100.08 kPa, 20.9% O2). Rats 15

received intraperitoneal injections of the CRHR1 antagonist cp-154,526 (30 mg/kg; kindly 16

donated by Pfizer, Groton, CT), the glucocorticoid receptor (GR)-specific antagonist RU486 17

(50 mg/kg; Tocris, Bristol, UK), or vehicle 30 min before exposure. After exposure, rats were 18

sacrificed by decapitation at 13:00-14:00 and trunk blood was collected. Plasma was obtained 19

by centrifugation and stored at -80°C. The liver and pancreas were immediately removed, 20

frozen in liquid nitrogen, and stored at -80°C until use. 21

Isolated islets in the hypoxia group were incubated in 5% CO2 and various O2 conditions 22

delivered by the hypoxia chamber (Proox model P110 and ProCO2 model P120 systems, 23

BioSpherix, Lacona, NY) (24). 24

Insulin secretion Size-matched islets were washed and pre-incubated for 1 h in RPMI 1640 25


- - 6

medium containing 2.8 mM glucose, 10 mM HEPES, and 0.1% BSA. Then 10 islets per well 1

were incubated in testing RPMI 1640 containing 10 mM HEPES and 0.1% BSA with the 2

indicated glucose and drugs under hypoxia or normoxia. At the end of experiments, the 3

testing medium was collected for insulin measurement using a rat insulin EIA kit (Mercodia, 4

Uppsala, Sweden), while islets were placed in lysis buffer for quantitative PCR (Q-PCR) 5

assay. 6

Calcium imaging Islets were washed and loaded with 5 µM Fluo-4 AM (Molecular Probes, 7

Eugene, OR) in Krebs-Ringer HEPES buffer (KRBH) composed of (in mM) 129 NaCl, 4.7 8

KCl, 1.2 KH2PO4, 5.0 NaHCO3, 2.0 CaCl2, 1.2 MgSO4, 10 HEPES and 0.1% BSA at pH 7.4 9

containing with 5.6 mM glucose for 1 h at 37°C. Calcium-free conditions were achieved by 10

use of calcium free KRBH containing 2 mM EGTA. Intact islets were immobilized with a 11

wide-bore glass suction pipette under a Nikon TE2000 inverted microscope with a Yokogawa 12

spinning-disk confocal system (PerkinElmer, Wellesley, MA). Calcium images were captured 13

at 3 sec intervals and 3 different depths with 488 nm excitation and 505-530 nm emission. At 14

the end of each experiments, 0.5 mM tolbutamide, a KATP channel inhibitor (Sigma, St. Louis, 15

MO), was added to present the functional β-cells (25). As a rule, cells in islets were defined as 16

β-cells if fluorescence signals were markedly increased in response to tolbutamide. The 17

change of fluorescence intensity (∆F) was calculated as a percentage of the basal level (F0, 18

background subtracted), and frequency was calculated as events/min. 19

Methods for assays of plasma hormones and metabolism (glucose, lactate, pyruvate, ATP, 20

ADP, and AMP), drug treatment, cAMP assay, Q-PCR, immunofluorescence staining, and 21

Rhodiola rosea treatment are described in the Supplementary Data. 22

Statistical analysis All data are presented as mean ± SD, and were analyzed using Student’s 23

unpaired two-tailed t-test and one-way ANOVA with Tukey’s post hoc test (GraphPad Prism 24

6). The paired t-test was used in calcium imaging and human data analysis. P < 0.05 was 25


- - 7

considered significant. 1

2

RESULTS 3

Acute hypobaric hypoxia affects insulin and glucose levels in rat plasma via CRHR1 To 4

investigate the effect of hypoxic stress on plasma glucose, insulin, CRH, and CORT, rats were 5

exposed to hypoxia of 2,000 m or 5,000 m elevation for 8 h. Hypoxia of 5,000 m, but not 6

hypoxia of 2,000 m, decreased plasma insulin and increased plasma glucose, CRH, CORT and 7

Homeostasis model assessment of insulin sensitivity (HOMA-IS; Fig. 1A-E). All these 8

changes were reversed by treatment with a CRHR1 antagonist (cp-154,526) (Fig. 1A-E). 9

Therefore, following activation of the HPA axis, CRHR1 is likely involved in the regulation 10

of insulin release and glucose metabolism under acute hypoxia. 11

12

Acute or subacute hypobaric hypoxia reduces ATP level in rat pancreas To determine 13

how hypobaric hypoxia influences ATP homeostasis in the pancreas, the lactate/pyruvate ratio, 14

ATP/ADP and ATP/AMP ratio were assessed in both the pancreas and liver of rats under 15

5,000 m hypoxia. Following 8 h hypoxia rat pancreas exhibited an elevated lactate/pyruvate 16

ratio, lowered ATP/ADP and increased AMP/ATP ratio (Fig. 2A, C and E). The 17

lactate/pyruvate ratio was also raised in the liver (Fig. 2B) but without detectable falls in 18

ATP/ADP or AMP/ATP ratio (Fig. 2D and F). However, following subacute hypoxia for 5 19

days the lactate/pyruvate ratio was not changed (Fig. 2A and B), even though the ATP/ADP 20

ratio decreased and AMP/ATP increased in both pancreas and liver (Fig. 2C-F). These 21

changes indicated that acute or subacute hypoxia switches glucose metabolism to anaerobic 22

glycolysis and thus reduces ATP production in the pancreas. 23

24

CRH stimulates and hypoxia suppresses insulin release To investigate the insulinotropic 25


- - 8

action of CRH and the effects of hypoxia on this process, isolated islets were exposed to 1

hypoxia and rotenone, an inhibitor of mitochondrial respiratory chain complex I. Treatment of 2

islets with CRH (10 pM-10 nM) for 1 h induced dose-dependent increases in insulin secretion 3

at 5.6 or 11.1 mM glucose, but not at 2.8 mM glucose (Fig. 3A). The CRH induced maximum 4

magnitude of insulin at 11.1 mM glucose (1.7 fold) was larger than at 5.6 mM glucose (1.4 5

fold) (Fig. 3A). The insulinotropic action of CRH was persistently shown after 1, 12, or 24 h 6

incubation at 5.6 mM glucose, and this augmentation was completely abolished by 7

pretreatment with 1 µM cp-154,526, a CRHR1 antagonist (Fig. 3B). This CRH-insulinotropic 8

action was blocked by protein kinase A (PKA) inhibitors (H89 and Rp-8-Br-cAMPs, 10 µM), 9

but not by inhibitors of protein kinase C (PKC; Go 6983, 10 µM) or phospholipase C (PLC; 10

U-73122, 10 µM) (Fig. 3C). Moreover, this insulinotropic effect of CRH was dependent on 11

extracellular calcium and blocked by an L-type calcium channel inhibitor (nifedipine, 10 µM) 12

(Fig. 3C). 13

Hypoxia reduced the CRH-insulinotropic action in a manner that was inversely related to 14

O2 supply. Under 5% O2, CRH (0.01 nM -1 nM) failed to stimulate insulin secretion at 5.6 15

mM glucose (Fig. 3D), while 1% O2 not only suppressed the insulinotropic action of CRH but 16

also reduced basal insulin secretion (Fig. 3D). In order to mimic the inhibition of oxidative 17

phosphorylation and ATP production in the absence of hypoxia, rotenone was used to inhibit 18

complex I of the mitochondrial electron transport chain in islets. Rotenone treatment (0.1-10 19

nM) gradually inhibited insulin secretion. Rotenone (0.1 nM) suppressed the augmentation of 20

insulin release by 0.1 nM CRH, while 1 nM or 10 nM rotenone completely abolished 1 nM 21

CRH stimulated insulin release (Fig. 3E). 22

Importantly, q-PCR results indicated an increase Crhr1 mRNA in islets under 5% O2 23

hypoxia, but not under 1 nM rotenone induced ATP deficiency (Fig. 3F). These indicated that, 24

although hypoxia increases Crhr1 expression (Fig. 3F), the insulinotropic action of CRH was 25


- - 9

attenauted by hypoxia due to insufficient supplies of O2 and ATP. 1

2

CRH-insulinotropic effect is inactivated by gradually reducing cAMP, ATP, and calcium 3

influx in islets To determine the requirement for ATP as a substrate for the CRHR1-activated 4

insulin release pathway, the cAMP level, ATP/ADP ratio, and calcium oscillations in islets 5

were assessed. CRH (0.1-1 nM) significantly enhanced the accumulation of cAMP in 6

normoxia and 1 nM CRH increased the cAMP levels at 0.1 or 1 nM rotenone, whereas the 7

basal cAMP levels were decreased and not stimulated by CRH at 10 nM rotenone (Fig. 4A). 8

Furthermore 1 nM CRH markedly elevated the ATP/ADP ratio under normoxia. This 9

elevation was abolished by pretreatment with 10 nM rotenone (Fig. 4B), which increased the 10

AMP/ATP ratio in a concentration-dependent manner (0.1-10 nM; Fig. 4D). Moreover, 1 and 11

10 nM rotenone suppressed the basal ATP/ADP ratio (Fig. 4B) and the CRH-induced 12

increases in ATP/ADP ratio were blocked by the CRHR1 antagonist with or without 1 nM 13

rotenone (Fig. 4C). 14

1 nM CRH markedly increased the frequency of calcium oscillations in identified β-cells 15

(Fig. 4E and F), and this increase was reversed by pretreatment with the CRHR1 antagonist (1 16

µM) and the PKA inhibitor (10 µM Rp-8-Br-cAMPs; Fig. 4E). In calcium-free conditions, 17

calcium oscillations were not induced by 1 nM CRH or 1 µM forskolin (Fig. 4I). In the 18

rotenone-induced ATP-deficient condition, the frequency of calcium oscillations was 19

unaltered by CRH (Fig. 4E, G), but was still increased by forskolin (Fig. 4E, H). These 20

findings strongly suggest that a deficiency of ATP and reduced ATP/ADP ratio limit cAMP 21

production and thus lead to defective calcium oscillations in islets, in a manner that may 22

contribute to the inactivation of CRH-insulinotropic action. 23

24

Hypoxia inhibits insulin release by both reducing ATP and increasing CORT in islets To 25


- - 10

examine the effects of glucocorticoid and intracellular ATP on insulin secretion under 1

hypoxia, insulin secretion and GR target-gene mRNA levels were assessed in isolated rat 2

islets. Dexamethasone (DEX) concentration-dependently decreased insulin secretion under 3

normoxia and 5% O2 and severely inhibited it under 1% O2 (Fig. 5A). Reduction of insulin 4

release correlated with increased DEX and rotenone (ATP reduction) concentration (Fig. 5B). 5

DEX elevated serum and glucocorticoid-inducible kinase 1 (Sgk1) mRNA and inhibited Glut2 6

and Crhr1 mRNA expression under normoxia (Fig. 5C). These changes were not affected by 7

ATP-deficiency (1 nM rotenone) or hypoxia (5% O2), despite the fact that hypoxia increased 8

Crhr1 mRNA level (Fig.5C). These data suggested that both hypoxia-stimulated 9

glucocorticoid release and a reduced ATP supply may inhibit insulin release from pancreatic 10

islets. 11

12

GR mediates inhibition of insulin release under hypobaric hypoxia To test the role of 13

glucocorticoid in insulin secretion and glucose homeostasis under hypoxia in vivo, a GR 14

antagonist (RU486) was utilized in rats under 5,000 m altitude hypoxia for 8 h. RU486 15

pretreatment reversed the hypoxia-induced hyperglycemia and low plasma insulin (Fig. 6A). 16

Immunofluorescence also showed a higher SGK1 signal in the nuclei of islet β-cells under 17

hypoxia. The proportion of SGK1-positive β-cells increased under hypoxia, and this was 18

blocked by RU486 (Fig. 6B and C). These data suggest that hypoxia-evoked increases of 19

SGK1 may contribute to the inhibitory role of GR in insulin release in pancreatic islets. 20

21

High-altitude hypoxia affects human plasma insulin and glucose homeostasis To 22

determinate the regulatory effect of high altitude hypoxia on circulating hormones and plasma 23

glucose in humans, 67 volunteers rapidly ascended to 3,860 m altitude in Rikaze and stayed 24

for 2 days. On the morning of day 3, plasma glucose, insulin, CRH, and cortisol were 25


- - 11

analyzed. High-altitude hypoxia induced a dramatic decrease in SpO2 and increase in plasma 1

CRH (Fig. 7A and D), but exerted no detectable effect on plasma insulin (Fig. 7B). Despite of 2

unaffected plasma insulin, plasma glucose was significantly elevated relative to control (Fig. 3

7C). Further analysis showed that plasma glucose increased only in volunteers with AMS 4

(12/67), but not in those without AMS (55/67) (Fig. 7F). HOMA-IS declined only in AMS 5

volunteers (Fig. 7G), who have a higher plasma CRH compared to those without AMS (Fig. 6

7D, H). In our experiments, plasma cortisol was decreased under hypoxia in all volunteers 7

studied (Fig. 7E). 8

9

DISCUSSION 10

In the present study, we addressed a different regulatory effect of CRH and glucocorticoids on 11

hypoxia-reduced insulin levels. Under hypoxia, CRH-stimulated insulin release was abolished 12

due to hypoxia-reduced cellular ATP and cAMP levels, and a consequent inhibition of calcium 13

influx in isolated rat islets, despite that hypoxia-activated CORT still inhibited insulin release 14

(Fig. 8). In humans, rapid ascent to high altitude acutely elevated plasma glucose without 15

altering plasma insulin. Furthermore, AMS volunteers exhibited reduced HOMA-IS and 16

higher plasma CRH compared to non-AMS volunteers. 17

CRH, a critical stress peptide, plays a key role in regulating the HPA axis and adjustments 18

in neural, endocrine, metabolic and glucose homeostasis to various stressors, including 19

hypoxia (14,20,26,27). Consistent with our previous study (10), we have shown that acute 20

hypobaric hypoxia induces marked increases in plasma CRH, which mediates reduced insulin 21

and increased glucose in rat plasma (Fig. 1). Insulin, the hypoglycemic hormone, is only 22

secreted from pancreatic islet β-cells, and mainly regulated by glucose and neuro-endocrine 23

inputs (11,13). There have been reports that CRHR1 is expressed in human, mouse, and rat 24

islets (15,16) which, upon activation by CRH, increases calcium influx (17), stimulates 25


- - 12

insulin secretion in a glucose-dependent manner (15,16,18). The present study demonstrated a 1

24 h persistent insulinotropic role of CRH under normoxia depending on both glucose and 2

CRHR1 signaling pathways, namely cAMP-PKA, and L-type calcium channel-mediated 3

calcium influx (Fig. 3A-C). However, under hypoxia this effect of CRH was inactivated (Fig. 4

3D) despite Crhr1 mRNA was upregulated in islets (Fig. 3F). These findings suggest that the 5

insulinotropic effect of CRH depends on sufficient O2 supply, and this view is supported by 6

previous reports of attenuated glucose-stimulated insulin secretion with stable basal insulin 7

levels under hypoxia of 6.7% (28) and 3% O2 (29). 8

It is well documented that decreased O2 supply switches cell respiration from aerobic 9

metabolism towards anaerobic glycolysis. Consistent with this view ATP production was 10

deficient in rat pancreas under 5,000 m hypoxia (Fig. 2C). Islets β-cells express low levels of 11

lactate dehydrogenase (30). Islets may thus have lower capacity of anaerobic glycolysis and 12

ATP production. ATP/ADP ratio of islets β-cells, therefore, may decrease more dramatically 13

than that of pancreas under hypoxia. ATP is not only an energy molecule, but an important 14

signaling molecule in islet β-cells, controlling insulin secretion. Under physiological 15

conditions, insulin secretion is tightly correlated with ATP/ADP ratio in islets β-cells, 16

although it is still controversial that increased ATP or decreased ADP contributes to the 17

alteration of ATP/ADP ratio upon glucose stimulation (31,32). Not least because other 18

nutrients including amino acids and free fatty acids also have the capacity to modify 19

ATP/ADP ratio and insulin secretion (11). Therefore islets may be more sensitive to ATP 20

deficiency under hypoxia than other cells. Here, rotenone-induced ATP deficiency abolished 21

the stimulatory role of CRH on insulin secretion (Fig. 3E), as did 5% O2 (Fig. 3D). Under 22

normoxia CRH increased cAMP production by stimulating G-protein binding to CRHR1 and 23

thus activating adenylate cyclase (AC), but cAMP production was lowered (not enhanced) 24

when islets was deficient in ATP (Fig. 4A). This reduction in cAMP likely contributes to the 25


- - 13

suppression of CRHR1 signaling and might result from low ATP/ADP ratio under hypoxia 1

and consequent reductions in substrate supply for AC-dependent cAMP production. Hypoxia 2

or ATP deficiency also induced increased AMP/ATP ratio (Fig. 2E and Fig. 4D) resulting in 3

inhibited AC activity via binding to intracellular P-site (33,34). Otherwise, low ATP/ADP 4

ratio under ATP deficiency (Fig. 4B and C) might limit CRHR1 signaling pathway by gating 5

KATP channels, closure of L-type calcium channels, reduced calcium oscillations (Fig. 4E) and 6

consequent reductions in insulin secretion (Fig. 3E). We conclude, therefore, that the 7

insulinotropic role of CRH is inactivated by a fall in ATP production under hypoxia, 8

consequent reductions in cAMP level, ATP/ADP ratio and thus inhibition of calcium 9

oscillations in islets (Fig. 8). Consequently, high plasma CRH during hypoxia may not exert 10

the expected insulinotropic effects. 11

Acute (Fig. 1) or subacute hypoxia (10,26) not only increases plasma CRH but also CORT 12

through activation of the HPA axis, raising the possibility that hypoxia-stimulated CORT is 13

important in insulin regulation. Glucocorticoids coordinate various stress responses and 14

glucose homeostasis (35,36), and DEX is known to inhibit insulin secretion in isolated islets 15

(37,38). We found the same inhibitory effect of DEX on insulin secretion in cultured islets 16

(Fig. 5A and B), associated with upregulated Sgk1 and downregulated Glut2 and Crhr1 17

mRNA expression under ATP deficiency or hypoxia conditions (Fig. 5C). These data 18

suggested that CORT, activated by hypoxia, may initiate a discrete inhibitory pathway from 19

CRH and correlated with the O2 and ATP supply. Our in vivo study showed that acute 20

hypoxia-induced high CORT does indeed contribute to the low plasma insulin and high 21

plasma glucose mediated by GR (Fig. 6A) via high SGK1 expression in islets (Fig. 6B and C). 22

In humans, high-altitude hypoxia exposure for 2 days significantly reduced SpO2 (Fig. 7A) 23

and increased plasma CRH (Fig. 7D). To reduce the responsiveness to hypoxia, all volunteers 24

took a Rhodiola capsule (extracted from Rhodiola rosea), a traditional Chinese herb to 25


- - 14

improve resistance to AMS. Interestingly, Rhodiola rosea can reduce hypoxia-induced high 1

plasma CRH and CORT in rats (Supplementary Figure 1). Consistent with the “anti-stress” 2

effect in previous reports (39-41), Rhodiola rosea may thus contribute to the low plasma 3

cortisol at high altitude (Fig. 7E). In the present study, cortisol remains low but high plasma 4

CRH levels are still evoked by hypoxia in human. Under these conditions, the raised plasma 5

CRH level fails to stimulate insulin release during high-altitude hypoxia. These results greatly 6

support our conclusion derived from animal experiments that hypoxia increases CRH and 7

inactivates its insulinotropic role by inhibiting the CRHR1 signaling pathway. 8

In this study, acute hypoxia (5,000 m, 8 h) induced low plasma insulin, high plasma 9

glucose, and increased insulin sensitivity in rats (Fig. 1A-C). Other studies individually show 10

a gradually decreases in insulin level of rats during acute hypoxia for 1-4 days (6) or 11

hyperglycemia in mice under 1 day of hypoxia (7). We found that the CRH-induced high 12

CORT mainly decreased insulin release and elevated blood glucose. High CORT directly 13

elevates blood glucose via decreased glycogen synthesis and glucose uptake in muscle (35). 14

In liver, the high anaerobic glycolysis rate and glycogen storage maintain stable liver ATP 15

production and support hyperglycemia under acute hypoxia (Fig. 2D). After 5 days of 16

hypoxia, low insulin modulated by CRHR1 still occurs in rats. However decreased blood 17

glucose is not affected by CRHR1 (10). The low insulin and hypoglycemia also occur in mice 18

after 4 weeks of hypoxia (8) and likely results from adaptations to hypoxia that consequently 19

reduce the anaerobic glycolysis rate and ATP/ADP ratio in liver (Fig. 2D), despite that 20

hepatic glycogen is sufficient and CORT remains high (10). Therefore, CRHR1 regulation of 21

blood glucose likely depends on high hepatic metabolism. In man, 3,860 m hypoxia for 2 days 22

only increased plasma glucose and impacted insulin sensitivity in the AMS group (Fig. 7C, G) 23

associated with low cortisol (Fig. 7E) induced by Rhodiola rosea. Other studies have reported 24

high cortisol, glycemia, and insulin levels in man in the first 1-2 days exposed to 4,300 m 25


- - 15

hypoxia without any drugs (4,5). The sustained hyperglycemia with different insulin and 1

cortisol levels in acute hypoxia may imply that blood glucose is regulated by greater 2

integration of systems including, for example, the autonomic nervous system. In short, a 3

greater increase of CRH in the AMS group may activate the sympathetic nervous system (42) 4

and induce hyperglycemia (43). Furthermore, 5-10 days of adaptation to hypoxia returns 5

hyperglycemia to basal levels in healthy people (5). Moreover chronic hypoxic exposure 6

reduces fasting insulin and improves insulin resistance in type 2 diabetes patients (44-46) and 7

decreases the insulin dosage in type 1 diabetes patients (47,48). Of note, lower insulin levels 8

or reduced insulin signaling is beneficial for health and longevity (49,50). It is therefore 9

tempting to speculate that fast travel to high altitude may benefit both healthy people and 10

diabetic patients in terms of glucose-insulin metabolic control. 11

In conclusion, we propose a dynamic modulation of CRH-insulinotropic role in pancreatic 12

islets, which depends on CRH, glucose levels, and O2 availability. Under normoxia, the 13

CRH-insulinotropic role increases with raised glucose levels, but becomes inactivated under 14

hypoxia due to reductions in ATP, cAMP, and calcium influx into islets, even though plasma 15

CRH and islet Crhr1 are upregulated. Additionally, hypoxia-stimulated CORT inhibits insulin 16

release via activated SGK1, and in an O2- and ATP-dependent manner. Consistent with these 17

findings, rapid ascent to high altitude does not affect HOMA-IS in healthy volunteers, but 18

reduces HOMA-IS in AMS volunteers who usually exhibit high plasma CRH. 19

20

ACKNOWLEDGMENTS 21

This work was supported by grants from the Ministry of Science and Technology of China, 22

the National Basic Research Program of China (973 Program No. 2012CB518200 and No. 23

2006CB504100) and the National Natural Science Foundation of China (No. 31171145 and 24

No. 30871221). 25


- - 16

The authors declare no conflict of interest associated with this manuscript. 1

X.-Q.C. and J.-Z.D. designed this study, K.H., F.-P.K. and J.-W.T. conducted the 2

experimental research, K.H., X.-Q.C. and J.-Z.D. analyzed the data. K.H., M.E., S.L.L., 3

X.-Q.C. and J.-Z.D. wrote and edited the manuscript. J.C. and Y.-Q.G. contributed to the 4

collection of human plasma samples. X.-Q.C. and J.-Z.D. are the guarantors of this work and, 5

as such, had full access to all the data in the study and take responsibility for the integrity of 6

the data and the accuracy of the data analysis. 7

The authors thank Prof. Iain C. Bruce (Department of Physiology, School of Medicine, 8

Zhejiang University, China) for editing the manuscript, and also thank all the volunteers for 9

participating. 10

REFERENCES 11

1. Basnyat B, Murdoch DR: High-altitude illness. Lancet 2003;361:1967-1974 12

2. Wu TY, Ding SQ, Liu JL, Yu MT, Jia JH, Chai ZC, Dai RC, Zhang SL, Li BY, Pan L, 13

Liang BZ, Zhao JZ, Qi de T, Sun YF, Kayser B: Who should not go high: chronic disease 14

and work at altitude during construction of the Qinghai-Tibet railroad. High Alt Med Biol 15

2007;8:88-107 16

3. Wu TY, Ding SQ, Zhang SL, Duan JQ, Li BY, Zhan ZY, Wu QL, Baomu S, Liang BZ, 17

Han SR, Jie YL, Li G, Sun L, Kayser B: Altitude illness in Qinghai-Tibet railroad 18

passengers. High Alt Med Biol 2010;11:189-198 19

4. Larsen JJ, Hansen JM, Olsen NV, Galbo H, Dela F: The effect of altitude hypoxia on 20

glucose homeostasis in men. J Physiol 1997;504 ( Pt 1):241-249 21

5. Barnholt KE, Hoffman AR, Rock PB, Muza SR, Fulco CS, Braun B, Holloway L, 22

Mazzeo RS, Cymerman A, Friedlander AL: Endocrine responses to acute and chronic 23

high-altitude exposure (4,300 meters): modulating effects of caloric restriction. Am J 24

Physiol Endocrinol Metab 2006;290:E1078-1088 25

6. Simler N, Grosfeld A, Peinnequin A, Guerre-Millo M, Bigard AX: Leptin 26

receptor-deficient obese Zucker rats reduce their food intake in response to hypobaric 27

hypoxia. Am J Physiol Endocrinol Metab 2006;290:E591-597 28

7. Lee EJ, Alonso LC, Stefanovski D, Strollo HC, Romano LC, Zou B, Singamsetty S, 29

Yester KA, McGaffin KR, Garcia-Ocana A, O'Donnell CP: Time-dependent changes in 30

glucose and insulin regulation during intermittent hypoxia and continuous hypoxia. Eur J 31

Appl Physiol 2013;113:467-478 32

8. Gamboa JL, Garcia-Cazarin ML, Andrade FH: Chronic hypoxia increases 33

insulin-stimulated glucose uptake in mouse soleus muscle. Am J Physiol Regul Integr 34

Comp Physiol 2011;300:R85-91 35

9. Chintamaneni K, Bruder ED, Raff H: Effects of age on ACTH, corticosterone, glucose, 36

insulin, and mRNA levels during intermittent hypoxia in the neonatal rat. Am J Physiol 37

Regul Integr Comp Physiol 2013;304:R782-789 38

10. Chen XQ, Dong J, Niu CY, Fan JM, Du JZ: Effects of hypoxia on glucose, insulin, 39


- - 17

glucagon, and modulation by corticotropin-releasing factor receptor type 1 in the rat. 1

Endocrinology 2007;148:3271-3278 2

11. Prentki M, Matschinsky FM, Madiraju SR: Metabolic signaling in fuel-induced insulin 3

secretion. Cell Metab 2013;18:162-185 4

12. White MF: Insulin signaling in health and disease. Science 2003;302:1710-1711 5

13. Chandra R, Liddle RA: Neural and hormonal regulation of pancreatic secretion. Curr 6

Opin Gastroenterol 2009;25:441-446 7

14. Bale TL, Vale WW: CRF and CRF receptors: role in stress responsivity and other 8

behaviors. Annu Rev Pharmacol Toxicol 2004;44:525-557 9

15. Huising MO, van der Meulen T, Vaughan JM, Matsumoto M, Donaldson CJ, Park H, 10

Billestrup N, Vale WW: CRFR1 is expressed on pancreatic beta cells, promotes beta cell 11

proliferation, and potentiates insulin secretion in a glucose-dependent manner. Proc Natl 12

Acad Sci U S A 2010;107:912-917 13

16. Schmid J, Ludwig B, Schally AV, Steffen A, Ziegler CG, Block NL, Koutmani Y, Brendel 14

MD, Karalis KP, Simeonovic CJ, Licinio J, Ehrhart-Bornstein M, Bornstein SR: 15

Modulation of pancreatic islets-stress axis by hypothalamic releasing hormones and 16

11beta-hydroxysteroid dehydrogenase. Proc Natl Acad Sci U S A 2011;108:13722-13727 17

17. Kanno T, Suga S, Nakano K, Kamimura N, Wakui M: Corticotropin-releasing factor 18

modulation of Ca2+ influx in rat pancreatic beta-cells. Diabetes 1999;48:1741-1746 19

18. O'Carroll AM, Howell GM, Roberts EM, Lolait SJ: Vasopressin potentiates 20

corticotropin-releasing hormone-induced insulin release from mouse pancreatic beta-cells. 21

J Endocrinol 2008;197:231-239 22

19. Jeong KH, Sakihara S, Widmaier EP, Majzoub JA: Impaired leptin expression and 23

abnormal response to fasting in corticotropin-releasing hormone-deficient mice. 24

Endocrinology 2004;145:3174-3181 25

20. Wang X, Meng FS, Liu ZY, Fan JM, Hao K, Chen XQ, Du JZ: Gestational hypoxia 26

induces sex-differential methylation of Crhr1 linked to anxiety-like behavior. Mol 27

Neurobiol 2013;48:544-555 28

21. Xu JF, Chen XQ, Du JZ, Wang TY: CRF receptor type 1 mediates continual 29

hypoxia-induced CRF peptide and CRF mRNA expression increase in hypothalamic PVN 30

of rats. Peptides 2005;26:639-646 31

22. Sutton R, Peters M, McShane P, Gray DW, Morris PJ: Isolation of rat pancreatic islets by 32

ductal injection of collagenase. Transplantation 1986;42:689-691 33

23. Roach RC, Bartsch P, Hackett PH, Oelz O, Aldashev A, Basnyat B, Bradwell AR, Clark 34

C, Coates G, Cymerman A: The Lake Louise acute mountain-sickness scoring system. In 35

Sutton JR, Houston CS, Coates: Hypoxia and Mountain Medicine. Queen City Printers, 36

Burlington VT 1993; pp:272-274 37

24. Zhao Y, Ren JL, Wang MY, Zhang ST, Liu Y, Li M, Cao YB, Zu HY, Chen XC, Wu CI, 38

Nevo E, Chen XQ, Du JZ: Codon 104 variation of p53 gene provides adaptive apoptotic 39

responses to extreme environments in mammals of the Tibet plateau. Proc Natl Acad Sci 40

U S A 2013;110:20639-20644 41

25. Quesada I, Nadal A, Soria B: Different effects of tolbutamide and diazoxide in alpha, 42

beta-, and delta-cells within intact islets of Langerhans. Diabetes 1999;48:2390-2397 43

26. Chen XQ, Kong FP, Zhao Y, Du JZ: High-altitude hypoxia induces disorders of the 44

brain-endocrine-immune network through activation of corticotropin-releasing factor and 45

its type-1 receptors. Zhongguo Ying Yong Sheng Li Xue Za Zhi 2012;28:481-487 46

27. Carlin KM, Vale WW, Bale TL: Vital functions of corticotropin-releasing factor (CRF) 47

pathways in maintenance and regulation of energy homeostasis. Proc Natl Acad Sci U S 48

A 2006;103:3462-3467 49

28. Dionne KE, Colton CK, Yarmush ML: Effect of hypoxia on insulin secretion by isolated 50


- - 18

rat and canine islets of Langerhans. Diabetes 1993;42:12-21 1

29. Hyder A, Laue C, Schrezenmeir J: Metabolic aspects of neonatal rat islet hypoxia 2

tolerance. Transpl Int 2010;23:80-89 3

30. Sekine N, Cirulli V, Regazzi R, Brown LJ, Gine E, Tamarit-Rodriguez J, Girotti M, Marie 4

S, MacDonald MJ, Wollheim CB, Rutter GA: Low lactate dehydrogenase and high 5

mitochondrial glycerol phosphate dehydrogenase in pancreatic beta-cells. Potential role 6

in nutrient sensing. J Biol Chem 1994;269:4895-4902 7

31. Doliba NM, Wehrli SL, Vatamaniuk MZ, Qin W, Buettger CW, Collins HW, Matschinsky 8

FM: Metabolic and ionic coupling factors in amino acid-stimulated insulin release in 9

pancreatic beta-HC9 cells. Am J Physiol Endocrinol Metab 2007;292:E1507-1519 10

32. Tanaka T, Nagashima K, Inagaki N, Kioka H, Takashima S, Fukuoka H, Noji H, 11

Kakizuka A, Imamura H: Glucose-stimulated single pancreatic islets sustain increased 12

cytosolic ATP levels during initial Ca2+ influx and subsequent Ca2+ oscillations. J Biol 13

Chem 2014;289:2205-2216 14

33. Johnson RA, Shoshani I: Kinetics of "P"-site-mediated inhibition of adenylyl cyclase and 15

the requirements for substrate. J Biol Chem 1990;265:11595-11600 16

34. Hardie DG: Metformin-acting through cyclic AMP as well as AMP? Cell Metab 17

2013;17:313-314 18

35. Vegiopoulos A, Herzig S: Glucocorticoids, metabolism and metabolic diseases. Mol Cell 19

Endocrinol 2007;275:43-61 20

36. Kainuma E, Watanabe M, Tomiyama-Miyaji C, Inoue M, Kuwano Y, Ren H, Abo T: 21

Association of glucocorticoid with stress-induced modulation of body temperature, blood 22

glucose and innate immunity. Psychoneuroendocrinology 2009;34:1459-1468 23

37. Lambillotte C, Gilon P, Henquin JC: Direct glucocorticoid inhibition of insulin secretion. 24

An in vitro study of dexamethasone effects in mouse islets. J Clin Invest 25

1997;99:414-423 26

38. Ullrich S, Berchtold S, Ranta F, Seebohm G, Henke G, Lupescu A, Mack AF, Chao CM, 27

Su J, Nitschke R, Alexander D, Friedrich B, Wulff P, Kuhl D, Lang F: Serum- and 28

glucocorticoid-inducible kinase 1 (SGK1) mediates glucocorticoid-induced inhibition of 29

insulin secretion. Diabetes 2005;54:1090-1099 30

39. Panossian A, Wikman G, Sarris J: Rosenroot (Rhodiola rosea): traditional use, chemical 31

composition, pharmacology and clinical efficacy. Phytomedicine 2010;17:481-493 32

40. Panossian A, Hambardzumyan M, Hovhanissyan A, Wikman G: The adaptogens rhodiola 33

and schizandra modify the response to immobilization stress in rabbits by suppressing the 34

increase of phosphorylated stress-activated protein kinase, nitric oxide and cortisol. Drug 35

Target Insights 2007;2:39-54 36

41. Olsson EM, von Scheele B, Panossian AG: A randomised, double-blind, 37

placebo-controlled, parallel-group study of the standardised extract shr-5 of the roots of 38

Rhodiola rosea in the treatment of subjects with stress-related fatigue. Planta Med 39

2009;75:105-112 40

42. Nijsen MJ, Croiset G, Stam R, Bruijnzeel A, Diamant M, de Wied D, Wiegant VM: The 41

role of the CRH type 1 receptor in autonomic responses to corticotropin- releasing 42

hormone in the rat. Neuropsychopharmacology 2000;22:388-399 43

43. Kalsbeek A, Bruinstroop E, Yi CX, Klieverik LP, La Fleur SE, Fliers E: Hypothalamic 44

control of energy metabolism via the autonomic nervous system. Ann N Y Acad Sci 45

2010;1212:114-129 46

44. Schobersberger W, Leichtfried V, Mueck-Weymann M, Humpeler E: Austrian Moderate 47

Altitude Studies (AMAS): benefits of exposure to moderate altitudes (1,500-2,500 m). 48

Sleep Breath 2010;14:201-207 49

45. Schobersberger W, Schmid P, Lechleitner M, von Duvillard SP, Hortnagl H, Gunga HC, 50


- - 19

Klingler A, Fries D, Kirsch K, Spiesberger R, Pokan R, Hofmann P, Hoppichler F, 1

Riedmann G, Baumgartner H, Humpeler E: Austrian Moderate Altitude Study 2000 2

(AMAS 2000). The effects of moderate altitude (1,700 m) on cardiovascular and 3

metabolic variables in patients with metabolic syndrome. Eur J Appl Physiol 4

2003;88:506-514 5

46. de Mol P, Fokkert MJ, de Vries ST, de Koning EJ, Dikkeschei BD, Gans RO, Tack CJ, 6

Bilo HJ: Metabolic effects of high altitude trekking in patients with type 2 diabetes. 7

Diabetes Care 2012;35:2018-2020 8

47. de Mol P, de Vries ST, de Koning EJ, Gans RO, Tack CJ, Bilo HJ: Increased insulin 9

requirements during exercise at very high altitude in type 1 diabetes. Diabetes Care 10

2011;34:591-595 11

48. Moore K, Vizzard N, Coleman C, McMahon J, Hayes R, Thompson CJ: Extreme altitude 12

mountaineering and Type 1 diabetes; the Diabetes Federation of Ireland Kilimanjaro 13

Expedition. Diabet Med 2001;18:749-755 14

49. Bluher M, Kahn BB, Kahn CR: Extended longevity in mice lacking the insulin receptor 15

in adipose tissue. Science 2003;299:572-574 16

50. Taguchi A, Wartschow LM, White MF: Brain IRS2 signaling coordinates life span and 17

nutrient homeostasis. Science 2007;317:369-372 18

19


- - 20

Fig. 1. CRHR1 is involved in the regulation of rat plasma insulin and glucose under 5,000 m 1

altitude hypoxia for 8 h. 5,000 m hypoxia significantly decreased plasma insulin (A), and 2

increased plasma glucose (B) and HOMA-IS (C); these effects were blocked by pretreatment 3

with a CRHR1 antagonist. CRHR1 antagonist administration reversed the hypoxia-induced 4

high CRH (D) and high CORT (E) in plasma. n = 7 in each group. *P < 0.05, ***P < 0.001 vs. 5

control group; ##P < 0.01, ###

P < 0.001 vs. cp group. cp: cp-154,526. 6

7

8

Fig. 2. Metabolic changes of rat pancreas and liver after 5,000 m altitude hypoxia for 8 h or 5 9

days. Hypoxia for 8 h increased the lactate/pyruvate ratio in pancreas (A) and liver (B) and 10

decreased the ATP/ADP ratio in pancreas (C), while 5 days of hypoxia reduced ATP/ADP 11

ratio in both pancreas (C) and liver (D). The AMP/ATP ratio in pancreas (E) was increased 12

with 8 h or 5 days of hypoxia, and AMP/ATP in liver (F) was elevated only with 5 days of 13

hypoxia. n = 7 in each group. *P < 0.05, **P < 0.01 vs. each control group. C: Control; H: 14

Hypoxia. 15

16

17

Fig. 3. Hypoxia and ATP-deficiency inactivates the insulinotropic action of CRH in isolated 18

rat islets. CRH augmented insulin secretion at 5.6 and 11.1 mM glucose but not at 2.8 mM for 19

1 h. The CRH induced maximum magnitude of insulin was at 1.7 fold at 11.1 mM glucose 20

and 1.4 fold at 5.6 mM glucose (A). CRH persistently enhanced insulin secretion at 5.6 mM 21

glucose at 1, 12 and 24 h, and this was blocked by pretreatment with cp-154,526 (B). The 22

insulinotropic action of CRH was blocked by PKA inhibitors (10 µM H89 and 23

Rp-8-Br-cAMPs), an L-type calcium channel inhibitor (10 µM nifedipine), and in 24

calcium-free solution (2 mM EGTA) at 5.6 mM glucose; this effect was not changed by 25


- - 21

inhibitors of PKC (Go 6983) and PLC (U-73122) (C). Hypoxia (5% or 1% O2) abolished the 1

insulinotropic action of CRH on 24 h insulin secretion at 5.6 mM glucose (D). 1 nM CRH 2

stimulated insulin secretion with 0.1 nM rotenone, but this effect did not occur with 1 nM or 3

10 nM rotenone at 5.6 mM glucose. Linear regression analysis showed a correlation between 4

rotenone concentration and insulin secretion at three doses of CRH (each slope is shown in 5

the inset) (E). Crhr1 mRNA expression was high in islets under hypoxia (5% O2) but not 6

under rotenone (1 nM)-induced ATP-deficient conditions (F). n = 3-4 in each group. *P < 7

0.05, **P < 0.01, ***P < 0.001 vs. each control group; $P < 0.05,

$$P < 0.01,

$$$P < 0.001 vs. 8

vehicle treatment group; #P < 0.05, ##

P < 0.01, ###P < 0.001. cp: cp-154,526; Rp-cAMP: 9

Rp-8-Br-cAMPs. 10

11

12

Fig. 4. Low cAMP and calcium oscillations suppress the insulinotropic action of CRH under 13

ATP-deficient condition. The CRH-induced high cAMP level (A) and ATP/ADP ratio (B) were 14

attenuated or abolished by rotenone pretreatment. The CRH-induced increase of ATP/ADP 15

ratio was blocked by the CRHR1 antagonist with or without 1 nM rotenone (C). The 16

AMP/ATP ratio was elevated by rotenone pretreatment (D). CRH increased the calcium 17

oscillatory frequency of β-cells in normal condition, and this increase was abolished by 18

cp-154,526 or Rp-8-Br-cAMPs (E). However, CRH did not increase the calcium oscillatory 19

frequency in β-cells under ATP-deficient condition (F-H). Calcium signaling patterns of 20

single β-cells under CRH challenge in normal (F), ATP-deficient (G, H), and calcium-free 21

conditions (I). In figures A-D, n = 3-4 per group. *P < 0.05, **P < 0.01, ***P < 0.001 vs. 22

each control group; $P < 0.05 vs. vehicle treatment group;

#P < 0.05,

##P < 0.01 vs. cp group. 23

In figure E, n = 30-40 β-cells from > 5 islets in 5 rats. &&&P < 0.001 vs. control group. TOL: 24

tolbutamide. 25


- - 22

1

2

Fig. 5. DEX inhibits insulin secretion under normoxic, hypoxic and ATP-deficient conditions 3

in isolated rat islets. DEX inhibited 24 h insulin secretion under normoxia (21% O2) and 4

hypoxia (5%, 1% O2) (A). Inhibition of insulin release by DEX was negatively correlated with 5

ATP level (0.1-10 nM rotenone) (B). DEX elevated Sgk1 mRNA, and inhibited Glut2 and 6

Crhr1 mRNA expression under normoxia, and these changes were not affected by 7

ATP-deficiency (1 nM rotenone) or hypoxia (5% O2) (C). Hypoxia induced Crhr1 mRNA 8

expression. n = 3-4 in each group. *P < 0.05, **P < 0.01, ***P < 0.001 vs. each control group; 9

$P < 0.05, $$$

P < 0.001 vs. vehicle treatment group. 10

11

12

Fig. 6. GR mediates hypoxia-induced plasma insulin reduction. GR antagonist RU486 13

administration reversed the increased glucose and decreased insulin in rat plasma induced by 14

hypoxia (5,000 m, 8 h) (A). Immunofluorescence of SGK1 (red), insulin (green), and nuclei 15

(DAPI) showed a high SGK1 signal (B) and an elevated percentage of SGK1-positive cells (C) 16

in pancreatic islets under hypoxia; these increases were reversed by RU486. In figure A, n = 17

7-8 rats in each group. In figure B and C, n = 15-20 islets from 5-7 rat pancreases for B and C. 18

Scale bar, 100 µm; dotted line, islet region. *P < 0.05, **P < 0.01, ***P < 0.001 vs. control 19

group; ##P < 0.01, ###

P < 0.001 vs. hypoxia group. 20

21

22

Fig. 7. High-altitude hypoxia results in changes of insulin and glucose homeostasis and these 23

are correlated with AMS in humans. Comparing with low altitude (540 m), high altitude 24

(3,860 m) decreased SpO2 (A), caused no changed plasma insulin (B), increased plasma 25


- - 23

glucose (C) and CRH (D), and decreased plasma cortisol (E). Plasma glucose was elevated in 1

volunteers with AMS (F), while their HOMA-IS was reduced (G). The increase in plasma 2

CRH was significantly higher in volunteers with AMS than in those without (H). n = 67 (12 3

with AMS, 55 without). *P < 0.05, **P < 0.01, ***P < 0.001 vs. low altitude; $P < 0.05, 4

AMS vs. no AMS. 5

6

7

Fig. 8. Proposed inhibitory regulation of insulin release by hypoxia-activated CRH and CORT. 8

Hypoxia switches aerobic to anaerobic glycolysis resulting in low ATP/ADP and high 9

AMP/ATP ratio, which inhibit cAMP production and calcium oscillations in rat islets. This 10

consequently inactivates the insulinotropic role of CRH, although CRHR1 is triggered by 11

upregulated plasma CRH. Meanwhile, hypoxia-stimulated plasma CORT inhibits insulin 12

secretion via upregulated Sgk1 mRNA, and Crhr1 mRNA is also inhibited by CORT. 13


Fig.1. CRHR1 is involved in the regulation of rat plasma insulin and glucose under 5,000 m altitude hypoxia for 8 h. 5,000 m hypoxia significantly decreased plasma insulin (A), and increased plasma glucose (B) and HOMA-IS (C); these effects were blocked by pretreatment with a CRHR1 antagonist. CRHR1 antagonist

administration reversed the hypoxia-induced high CRH (D) and high CORT (E) in plasma. n = 7 in each group. *P < 0.05, ***P < 0.001 vs. control group; ##P < 0.01, ###P < 0.001 vs. cp group. cp: cp-

154,526. 50x14mm (300 x 300 DPI)


Fig.2. Metabolic changes of rat pancreas and liver after 5,000 m altitude hypoxia for 8 h or 5 days. Hypoxia for 8 h increased the lactate/pyruvate ratio in pancreas (A) and liver (B) and decreased the ATP/ADP ratio in

pancreas (C), while 5 days of hypoxia reduced ATP/ADP ratio in both pancreas (C) and liver (D). The

AMP/ATP ratio in pancreas (E) was increased with 8 h or 5 days of hypoxia, and AMP/ATP in liver (F) was elevated only with 5 days of hypoxia. n = 7 in each group. *P < 0.05, **P < 0.01 vs. each control group. C:

Control; H: Hypoxia. 93x106mm (300 x 300 DPI)


Fig.3. Hypoxia and ATP-deficiency inactivates the insulinotropic action of CRH in isolated rat islets. CRH augmented insulin secretion at 5.6 and 11.1 mM glucose but not at 2.8 mM for 1 h. The CRH induced

maximum magnitude of insulin was at 1.7 fold at 11.1 mM glucose and 1.4 fold at 5.6 mM glucose (A). CRH

persistently enhanced insulin secretion at 5.6 mM glucose at 1, 12 and 24 h, and this was blocked by pretreatment with cp-154,526 (B). The insulinotropic action of CRH was blocked by PKA inhibitors (10 µM H89 and Rp-8-Br-cAMPs), an L-type calcium channel inhibitor (10 µM nifedipine), and in calcium-free

solution (2 mM EGTA) at 5.6 mM glucose; this effect was not changed by inhibitors of PKC (Go 6983) and PLC (U-73122) (C). Hypoxia (5% or 1% O2) abolished the insulinotropic action of CRH on 24 h insulin

secretion at 5.6 mM glucose (D). 1 nM CRH stimulated insulin secretion with 0.1 nM rotenone, but this effect did not occur with 1 nM or 10 nM rotenone at 5.6 mM glucose. Linear regression analysis showed a

correlation between rotenone concentration and insulin secretion at three doses of CRH (each slope is shown in the inset) (E). Crhr1 mRNA expression was high in islets under hypoxia (5% O2) but not under rotenone (1 nM)-induced ATP-deficient conditions (F). n = 3-4 in each group. *P < 0.05, **P < 0.01, ***P < 0.001 vs. each control group; $P < 0.05, $$P < 0.01, $$$P < 0.001 vs. vehicle treatment group; #P < 0.05, ##P

< 0.01, ###P < 0.001. cp: cp-154,526; Rp-cAMP: Rp-8-Br-cAMPs. 160x146mm (300 x 300 DPI)


Fig.4. Low cAMP and calcium oscillations suppresses the insulinotropic action of CRH under ATP-deficient condition. The CRH-induced high cAMP level (A) and ATP/ADP ratio (B) were attenuated or abolished by

rotenone pretreatment. The CRH-induced increase of ATP/ADP ratio was blocked by the CRHR1 antagonist with or without 1 nM rotenone (C). The AMP/ATP ratio was elevated by rotenone pretreatment (D). CRH

increased the calcium oscillatory frequency of β-cells in normal condition, and this increase was abolished by cp-154,526 or Rp-8-Br-cAMPs (E). However, CRH did not increase the calcium oscillatory frequency in β-

cells under ATP-deficient condition (F-H). Calcium signaling patterns of single β-cells under CRH challenge in normal (F), ATP-deficient (G, H), and calcium-free conditions (I). In figures A-D, n = 3-4 per group. *P <

0.05, **P < 0.01, ***P < 0.001 vs. each control group; $P < 0.05 vs. vehicle treatment group; #P < 0.05, ##P < 0.01 vs. cp group. In figure E, n = 30-40 β-cells from > 5 islets in 5 rats. &&&P < 0.001 vs. control

group. TOL: tolbutamide. 178x181mm (300 x 300 DPI)


Fig. 5. DEX inhibits insulin secretion under normoxic, hypoxic and ATP-deficient conditions in isolated rat islets. DEX inhibited 24 h insulin secretion under normoxia (21% O2) and hypoxia (5%, 1% O2) (A).

Inhibition of insulin release by DEX was negatively correlated with ATP level (0.1-10 nM rotenone) (B). DEX

elevated Sgk1 mRNA, and inhibited Glut2 and Crhr1 mRNA expression under normoxia, and these changes were not affected by ATP-deficiency (1 nM rotenone) or hypoxia (5% O2) (C). Hypoxia induced Crhr1 mRNA expression. n = 3-4 in each group. *P < 0.05, **P < 0.01, ***P < 0.001 vs. each control group; $P < 0.05,

$$$P < 0.001 vs. vehicle treatment group. 108x66mm (300 x 300 DPI)


Fig. 6. GR mediates hypoxia-induced plasma insulin reduction. GR antagonist RU486 administration reversed the increased glucose and decreased insulin in rat plasma induced by hypoxia (5,000 m, 8 h) (A).

Immunofluorescence of SGK1 (red), insulin (green), and nuclei (DAPI) showed a high SGK1 signal (B) and an elevated percentage of SGK1-positive cells (C) in pancreatic islets under hypoxia; these increases were reversed by RU486. In figure A, n = 7-8 rats in each group. In figure B and C, n = 15-20 islets from 5-7 rat pancreases for B and C. Scale bar, 100 µm; dotted line, islet region. *P < 0.05, **P < 0.01, ***P < 0.001

vs. control group; ##P < 0.01, ###P < 0.001 vs. hypoxia group. 69x27mm (300 x 300 DPI)


Fig. 7. High-altitude hypoxia results in changes of insulin and glucose homeostasis and these are correlated with AMS in humans. Comparing with low altitude (540 m), high altitude (3,860 m) decreased SpO2 (A), caused no changed plasma insulin (B), increased plasma glucose (C) and CRH (D), and decreased plasma cortisol (E). Plasma glucose was elevated in volunteers with AMS (F), while their HOMA-IS was reduced (G). The increase in plasma CRH was significantly higher in volunteers with AMS than in those without (H). n = 67 (12 with AMS, 55 without). *P < 0.05, **P < 0.01, ***P < 0.001 vs. low altitude; $P < 0.05, AMS vs. no

AMS. 83x39mm (300 x 300 DPI)


Fig. 8. Proposed inhibitory regulation of insulin release by hypoxia-activated CRH and CORT. Hypoxia switches aerobic to anaerobic glycolysis resulting in low ATP/ADP and high AMP/ATP ratio, which inhibit

cAMP production and calcium oscillations in rat islets. This consequently inactivates the insulinotropic role of CRH, although CRHR1 is triggered by upregulated plasma CRH. Meanwhile, hypoxia-stimulated plasma CORT

inhibits insulin secretion via upregulated Sgk1 mRNA, and Crhr1 mRNA is also inhibited by CORT. 92x106mm (300 x 300 DPI)


Assays of human plasma Plasma samples were analyzed by commercial kits: Glucose (GO)

Assay kit (Sigma, St. Louis, MO) for plasma glucose, Human Insulin EIA kit (Mercodia,

Uppsala, Sweden) for plasma insulin, Human Corticotropin Releasing Hormone (CRH) EIA

kit (Peninsula, San Carlos, CA) for plasma CRH and Cortisol EIA kit (Cayman, Ann Arbor,

MI) for plasma cortisol. Homeostasis model assessment of insulin sensitivity (HOMA-IS) was

calculated using the following equations: HOMA-IS = 1/ (plasma insulin (mIU/L) × plasma

glucose (mM))(1).

Assays of rat plasma Plasma glucose was analyzed using Glucose (GO) Assay kit, plasma

insulin using Rat Insulin EIA kit (Mercodia, Uppsala, Sweden), plasma CRH using Rat CRH

EIA kit (Peninsula, San Carlos, CA) and plasma corticosterone (CORT) using Corticosterone

EIA kit (Cayman, Ann Arbor, MI). HOMA-IS was calculated using the following equations:

HOMA-IS = 1/ (plasma insulin (ng/mL) × plasma glucose (mM) ×22.5)(1).

Measurement of metabolites concentration ATP contents in tissue and cultured islets was

determined by using an ATP Luminometric Assay kit (Beyotime, Peking, China) according to

the manufacturer’s instructions. ADP content was measured after being converted to ATP by

pyruvate kinase (Sigma, St. Louis, MO) with phosphoenolpyruvate (2). AMP content was

measured after being converted to ADP by adenylate kinase (Sigma, St. Louis, MO) with

deoxycytidine triphosphate and thereby being converted to ATP (3). Lactate and pyruvate was

determined with commercial kits (Nanjing Jiancheng Bioengineering Institute, Nanjing,

China).

Drug treatment In vivo, CRH receptor 1 (CRHR1) antagonist cp-154,526 was suspended in

10% DMSO and 90% saline solution. GR specific antagonist RU486 (Tocris, Bristol, UK)

was suspended in 100% DMSO.

For in vitro experiments, cp-154,526 (CRHR1 antagonist), Rp-8-Br-cAMPs (protein

kinase A (PKA) antagonist), H89 (PKA antagonist), Go6983 (protein kinase C (PKC)

antagonist), U-73122 (phospholipase C (PLC) antagonist), nifedipine (L-type calcium channel

inhibitor) and rotenone (inhibitor of mitochondrial respiratory chain complex I) (Sigma, St.

Louis, MO) were suspended in DMSO and added from the last 30 min of pre-incubation.

CRH (Tocris, Bristol, UK) was suspended in sterile water and presented in testing mediun.

Dexamethasone (DEX) and forskolin (adenylate cyclase activator, Sigma, St. Louis, MO)

were suspended in DMSO and added to testing medium. Final DMSO concentration was less


than 0.1% in solution.

cAMP assay Islets were washed and pre-incubated for 1 h at 37°C in Krebs-Ringer HEPES

buffer (KRBH) containing 2.8 mM glucose. Then 15 size-matched islets per well were used

after 1 h incubation in testing KRBH buffer with 5.6 mM glucose and agents as indicated at

37°C. The cAMP within islets was then measured with a cAMP EIA kit (Cayman, Ann Arbor,

MI). 1 mM 3-isobutyl-1-methyxanthine (IBMX, Sigma, St. Louis, MO) was added to KRBH

for inhibiting cAMP phosphodiesterase activity.

Quantitative PCR (Q-PCR) After incubation for 12 h, 30 size-matched islets were patched

into lysis buffer. Total RNA was extracted and purified using MicroElute Total RNA kit

(Omega bio-tek, Norcross, GA). RNA was converted to cDNA with First-strand cDNA

synthesis supermix (Transgen, Beijing, China). Q-PCR was preformed with SYBR premix Ex

TaqTM

(Takara, Dalian, China) on LightCycler 480II (Roche, Meylan, France). The RNA

expression were determined by the ∆∆Ct method using 18s ribsome mRNA as endogenous

control. Primers are listed below.

Supplementary Table 1. Names and sequences of primers

Name Genbank NO. Primer sequence 5’-3’ Product

length

Sgk1 NM_019232.3 Sense: GAGCCCGAACTTATGAACGC

Antisense: GTCAGAGGGTTTGGCGTGG 99 bp

Glut2 NM_012879.2 Sense: AGCACATACGACACCAGACG

Antisense: AAGAGGGCTCCAGTCAACGA 201 bp

Crhr1 NM_030999.3 Sense: GTCCGCTACAACACGACAAACA

Antisense: GTAGGATGAAAGCCGAGATGAG 271 bp

18s NR_046237.1 Sense: GTAACCCGTTGAACCCCATT

Antisense: CCATCCAATCGGTAGTAGCG 151 bp

Immunofluorescence staining 10 µm frozen sections of pancreas were cut by cryostat

microtome (HM505E, Microm, Walldorf, Germany), and employed to immunofluorescence

staining as described (4). The primary antibodies were rabbit anti-Serum and glucocorticoid

inducible kinase 1 (SGK1) and mouse anti-insulin (1:200, Millipore, Billerica, MA).

Secondary antibodies were Alexa Fluor 555 conjugated donkey anti-rabbit and Alexa Flour


488 conjugated donkey anti-mouse (1:200, Invitrogen, Carlsbad, CA). DAPI was used as a

nuclear stain. Imaging was captured and analyzed in confocal microscope and Volocity

software (PerkinElmer, Wellesley, MA).

Rhodiola rosea treatment Rhodiola capsule (Tibet Nuodikang Medicine, Lhasa, China) was

dissolved in water (140 mg/mL). The rats received intragastric administration of Rhodiola

rosea (670 mg/kg) or water daily for 4 days (2 days before hypoxia exposure). Hypoxia group

were exposed to hypobaric hypoxia of 5,000 m altitude for 2 days. Normoxia group was

placed in an identical chamber at sea level. After hypoxia exposure, rats were sacrificed for

collected trunk blood.

Rhodiola rosea (oral) suppressed the hypoxia-induced high plasma CRH and CORT in rats.

Supplementary Figure 1. Rhodiola rosea (oral) suppressed the high plasma CRH and CORT

in rats under hypoxia, but did not change plasma CRH and CORT under normoxia. n = 7. * P

< 0.05, ** P < 0.01 vs. control group; # P < 0.05 vs. hypoxia group.

REFERENCE

1. Matthews DR, Hosker JP, Rudenski AS, Naylor BA, Treacher DF, Turner RC: Homeostasis model

assessment: insulin resistance and beta-cell function from fasting plasma glucose and insulin

concentrations in man. Diabetologia 1985;28:412-419

2. Nagel A, Barker CJ, Berggren PO, Illies C: Diphosphosinositol polyphosphates and energy

metabolism: assay for ATP/ADP ratio. Methods Mol Biol 2010;645:123-131

3. Jansson V, Jansson K: An enzymatic cycling assay for adenosine 5'-monophosphate using adenylate

kinase, nucleoside-diphosphate kinase, and firefly luciferase. Anal Biochem 2003;321:263-265

4. Fan JM, Chen XQ, Jin H, Du JZ: Gestational hypoxia alone or combined with restraint sensitizes the

hypothalamic-pituitary-adrenal axis and induces anxiety-like behavior in adult male rat offspring.

Neuroscience 2009;159:1363-1373


high-altitude hypoxia

Documents