Hepatic cell-to-cell transmission of small silencing RNA can extend the therapeutic reach of RNA interference (RNAi)

ORIGINAL ARTICLE

Hepatic cell-to-cell transmission of small silencingRNA can extend the therapeutic reach of RNAinterference (RNAi)

Qiuwei Pan,1 Vedashree Ramakrishnaiah,2 Scot Henry,2,3 Suomi Fouraschen,2

Petra E de Ruiter,2 Jaap Kwekkeboom,1 Hugo W Tilanus,2 Harry L A Janssen,1

Luc J W van der Laan2

ABSTRACTBackground/aims RNA interference (RNAi),a sequence-specific gene silencing technology triggeredby small interfering RNA (siRNA), represents promisingnew avenues for treatment of various liver diseasesincluding hepatitis C virus (HCV) infection. In plants andinvertebrates, RNAi provides an important mechanism ofcellular defence against viral pathogens and is dependenton the spread of siRNA to neighbouring cells. A studywas undertaken to investigate whether vector-deliveredRNAi can transfer between hepatic cells in vitro and inmice, and whether this exchange could extend thetherapeutic effect of RNAi against HCV infection.Methods Transmission of RNAi was investigated inculture by assessing silencing of HCV replication andexpression of viral entry receptor CD81 using a humanhepatic cell line and primary B lymphocytes transducedwith siRNA-expressing vectors. In vivo transmissionbetween hepatic cells was investigated in NOD/SCIDmice. Involvement of exosomes was demonstrated bypurification, uptake and mass spectrometric analysis.Results Human and mouse liver cells, as well as primaryhuman B cells, were found to have the ability toexchange small RNAs, including cellular endogenousmicroRNA and delivered siRNA targeting HCV or CD81.The transmission of RNAi was largely independent of cellcontact and partially mediated by exosomes. Evidence ofRNAi transmission in vivo was observed in NOD/SCIDmice engrafted with human hepatoma cells producingCD81 siRNA, causing suppression of CD81 expression inmouse hepatocytes.Conclusion Both human and mouse hepatic cellsexchange small silencing RNAs, partially mediated byshuttling of exosomes. Transmission of siRNA potentiallyextends the therapeutic reach of RNAi-based therapiesagainst HCV as well as other liver diseases.

INTRODUCTIONThe translation of molecular biology research hasrecently fuelled a rapid progress in the drug devel-opment for hepatitis C virus (HCV) infection. Thedirectly acting antivirals, including a range ofprotease and polymerase inhibitors, are at variousstages of clinical development.1 These compoundshave potent antiviral activity but also dramaticallypotentiate the efficacy of the current standard ofcare, based on pegylated interferon a combined with

ribavirin.2 3 However, given the large infected popu-lation (approximately 170 million carriers), accumu-lated non-responders, poor tolerability to interferonor the directly acting antivirals and special popula-tions (eg, HIV co-infected patients and transplantedpatients), novel antivirals remain urgently required,which ideally should act on distinct mechanisms andbe applicable in current non-responders and specialpopulations with fewer side effects.RNA interference (RNAi) is a sequence-specific

inhibition of gene expression at the post-tran-scriptional level. It is triggered by small interferingRNA (siRNA), which can be introduced into cells assynthetic siRNA or synthesised from a transgene inthe cells as the short-hairpin RNA (shRNA)precursor.4 By using the cellular gene silencing/microRNA (miRNA) biogenesis machinery, thesedelivered siRNA induce degradation of mRNA bytargeting the complementary sequences.5 This

< Additional materials arepublished online only. To viewthese files please visit thejournal online (http://gut.bmj.com/content/early/recent).1Department ofGastroenterology andHepatology, ErasmusMC-University Medical Center,Rotterdam, The Netherlands2Department of Surgery,Laboratory of ExperimentalTransplantation and IntestinalSurgery, Erasmus MC-UniversityMedical Center, Rotterdam, TheNetherlands3Department of Surgery,Columbia University MedicalCenter, Columbia University,New York, USA

Correspondence toDr Luc J W van der Laan,Laboratory of ExperimentalTransplantation and IntestinalSurgery (LETIS), Department ofSurgery, Erasmus MC-UniversityMedical Center, Room L458, ‘sGravendijkwal 230, Rotterdam3015 CE, The Netherlands;[email protected]

Revised 28 November 2011Accepted 29 November 2011

Significance of this study

What is already known about this subject?< RNA interference (RNAi) represents a new

therapeutic modality for the treatment ofdiseases.

< Cell-to-cell transmission of small silencing RNAin plants and invertebrates is critical for defenceagainst viral infection.

< Transmission of small silencing RNA in mamma-lian cells has been demonstrated in culture.

What are the new findings?< In vivo transmission of small silencing RNA

occurs between hepatic cells in mouse liver.< Shuttling of small silencing RNA is independent

of cell contact and is mediated in part byexosomes.

< Transmission of small silencing RNA can extendthe reach of vector-delivered RNAi.

How might it impact on clinical practice in theforeseeable future?< Hepatic transmission of small silencing RNA

potentially extends the therapeutic reach ofRNAi-based therapies against hepatitis C andother liver diseases.

Pan Q, Ramakrishnaiah V, Henry S, et al. Gut (2011). doi:10.1136/gutjnl-2011-300449 1 of 10

Hepatology Gut Online First, published on December 23, 2011 as 10.1136/gutjnl-2011-300449

Copyright Article author (or their employer) 2011. Produced by BMJ Publishing Group Ltd (& BSG) under licence.

group.bmj.com on December 28, 2011 - Published by gut.bmj.comDownloaded from

technology has now emerged as a new avenue to combat viralinfections, and recent developments in the field of gene therapyhave increased the feasibility of clinical applications withnumerous clinical trials of RNAi currently underway (http://www.ClinicalTrials.gov). Both the viral genome and host cellularfactors involved in the viral life cycle, such as viral receptorCD81, can be targeted by RNAi and convey protection againstinfection.6 7 In the context of treating chronic HCV orpreventing recurrence in HCV-positive transplants, a single doseadministration with long-lasting therapeutic effects would beideal. Integrating lentiviral vector expressing shRNA thereforerepresents a suitable strategy.8

In plants and invertebrates, RNAi naturally provides an impor-tant defence mechanism against pathogens. Pathogen-derivedsiRNA, formed by processing of double stranded RNA (replication)intermediates during infection, spreads to neighbouring cellsand even propagates throughout the entire organism.9e11 Thistransmission of RNAi was shown to be of critical importance forplant and insect resistance against infections.9 11 12 RNAi trans-mission is also able to direct epigenetic modification in recipientcells in plants and conveys protection against pathogenic chal-lenges.13 14 Mammalian cells such as mouse or human mast celllines,15 the African green monkey kidney fibroblast-like cell line16

and human glioma, embryonic kidney, EpsteineBarr virus positivenasopharyngeal carcinoma and B lymphocyte cell lines16e19 havebeen shown to be able to transfer cellular or viral encoded miRNAsin culture via secreted exosomes in a cell contact-independentmanner. In contrast, transmission of endogenous miRNA, viralmiRNA or delivered small RNA between B and T cell lines inculture occurs in a cell contact-dependent manner.20

In this study we investigated the transmission of vector-derived RNAi in culture of human hepatic cells and primaryhuman B cells and in mouse liver. We found that human andmouse liver cells and primary human B cells have the ability toexchange small RNAs including small silencing RNA as well asmiRNA. We further demonstrated that transmission of genesilencing is independent of cell-cell contact and, as for miRNA,can be partially mediated by exchange of secreted exosomes. Theproperty of hepatic cells to exchange small silencing RNAs cansignificantly extend the therapeutic reach of RNAi-basedtherapy against HCV infection and other liver diseases.

MATERIALS AND METHODSCell cultureCell monolayers of the human embryonic kidney epithelial cellline 293T and human hepatoma cell lines Huh7, Huh6 andHepG2 were maintained in Dulbecco’s Modified Eagle Medium(DMEM, Invitrogen-Gibco, Breda, The Netherlands) supple-mented with 10% v/v fetal calf serum (Hyclone, Logan, Utah,USA), 100 IU/ml penicillin, 100 mg/ml streptomycin and 2 mML-glutamine (Invitrogen-Gibco). Huh7 cells containing a subge-nomic HCV bicistronic replicon (I389/NS3-3V/LucUbiNeo-ET,Huh7-ET) were maintained with 250 mg/ml G418 (Sigma,Zwijndrecht, The Netherlands). Primary human B lymphocyteswere obtained from multiorgan donors and expanded fromsplenocytes using a mouse fibroblast cell line stably transfectedwith human CD40L. The detailed protocol has been described inour previous study.21 The Medical Ethical Council of theErasmus MC approved the use of human samples.

Luciferase assayEffects on HCV replication were determined based on luciferaseactivity. 100 mM luciferin potassium salt (Sigma) was added to

Huh-7 ET cells and incubated for 30 min at 378C. Luciferaseactivity was quantified using a LumiStar Optima luminescencecounter (BMG LabTech, Offenburg, Germany).

miR-122 reporter assaypMiR-Luc reporter vector expressing firefly luciferase geneincorporated with a unique miR-122 target site at its 39UTR waspurchased from Signosis (Sunnyvale, California, USA). 293Tcells were transfected with the plasmid and treated withconcentrated Huh7-CM or control medium for 24 h. Luciferaseactivity was measured as described above.

Lentiviral vectors, conditioned medium (CM) and RNAi transferexperimentsLentiviral vectors LV-shCD81 and LV-shNS5b were constructedand produced as previously reported.8 LV-shNS5b containsexpression cassettes of shRNA and targets the viral NS5b region(GACACUGAGACACCAAUUGAC 6367-6388). LV-shCD81targets human and mouse CD81 mRNA (GGAUGUGAAGCA-GUUCUAU). Lentiviral vector expressing miR-122 (LV-miR-122)was constructed by cloning the precursor sequence of maturemiR-122 amplified by PCR from human genomic DNA. A third-generation lentiviral packaging system (pND-CAG/GFP/WPRE)was used to produce high-titre VSV-G-pseudotyped lentiviralvectors in 293T cells. Vector supernatants were removed 36 and48 h after transfection, passed through a 0.45 mm filter andconcentrated 1000-fold by ultracentrifugation. Concentratedvirus stocks were titrated using 293T cells 24 h after infection,with transduction efficiency based on the number of greenfluorescent protein (GFP)-positive cells as determined by flowcytometry (FACSCalibur; BD BioSciences, Mountain View,California, USA) after 72 h. The vector concentration wasdetermined in 293T cells based on the number of GFP-positivecells as determined by flow cytometry. CD81 expression wasdetermined using flow cytometry by staining with phyco-erythrin (PE) conjugated mouse anti-human CD81 monoclonalantibody (BD Pharmingen, San Diego, California, USA).Mouse IgG1 was used as isotype-matched control antibody (BDPharmingen). The effect of RNAi on CD81 expression wasdetermined by flow cytometry.Huh7 cells were cultured with normal culture medium. When

cultures reached 60e70% confluence the cells were untrans-duced or transduced with LV-shCD81, LV-shNS5b or LV-shConfor 6 h, washed three times with PBS and subcultured in normalmedium for more than 8 days. Conditioned medium (CM) wascollected after the second refreshment of the culture medium. Togenerate CM specifically containing miR-122, 293T cells weretransduced with LV-miR-122 or control lentiviral vector (LV-CTR). After overnight transduction, 293T cells were washedthree times and cultured for up to 8 days. The CM from 293Twas prepared using fresh culture medium and collected after48 h. All CM were centrifuged at 4000 rpm for 30 min to removecell contaminants. Concentrated CM (approximately 25e100-fold) was prepared using ultrafiltration units with a 3 kDa cut-off membrane (Millipore, Bedford, Massachusetts, USA). Huh7cells were treated with CM for 48 h at 1:1 dilution.

Cell co-culture experimentsTo generate stable shRNA integrated cell lines, naïve Huh7 cellswere transduced with the lentiviral vectors and expanded inculture for at least 8 days before using in experiments. Co-culture experiments were performed for 48 h in 96-well cultureplates, with 20 000 Huh7-ET HCV replicon cells per well mixedwith 20 000, 10 000 or 2000 control LV-shRNA or LV-shNS5b

2 of 10 Pan Q, Ramakrishnaiah V, Henry S, et al. Gut (2011). doi:10.1136/gutjnl-2011-300449

Hepatology

group.bmj.com on December 28, 2011 - Published by gut.bmj.comDownloaded from

transduced Huh7 cells. HCV replication was determined byluciferase activity. Co-culture with control (parental) Huh7 cellshad no effect on HCV replication/luciferase activity and did notaffect Huh7-ET cell proliferation at any condition, as measuredby CFSE dilution assays. Primary human B cells were alsotransduced with LV-shRNA or LV-shNS5b vector to generatestable shRNA donor cells. Co-culture experiments wereperformed by mixing with Huh7-ET cells.

RNA transfer experiments in miceImmunodeficient NOD/SCID mice (Charles River Laboratories,Wilmington, Massachusetts, USA) aged 3e4 weeks were used.The use of animals was approved by the institutional animalethics committee at Erasmus Medical Center Rotterdam. Micewere engrafted with 0.53106 Huh7-shCD81 cells (four mice) orHuh7-shCon cells (seven mice) injected intrasplenically. Celltransplantations and surgical procedures were performed under1.5% isoflurane inhalation anaesthesia and a prophylactic anti-biotic was given. Two and a half weeks after engraftment themice were killed and liver tissue was obtained for analysis. Todemonstrate cell-free transfer of small RNA, NOD/SCID micewere intravenously injected with 200 ml 100-fold concentratedshCD81-CM or shCon-CM every 2 days on three occasions (fouranimals per group). After 6 days the mouse livers were procured,dissociated by collagenase digestion22 and analysed for CD81expression by flow cytometry.

Exosome purification and electron microscopy imagingExosomes were prepared from the supernatant of Huh7 cells bydifferential centrifugation. Briefly, supernatant was centrifugedat 3000g for 20 min to eliminate cells and at 10 000 g for 30 minto remove cell debris. Exosomes were pelleted by ultracentrifu-gation (Beckman SW28) at 64 047g for 110 min followed bya sucrose gradient isolation at 100 000 g (Beckman SWTi60). Foruptake experiments, 0.1% Rhodamine C18 solution was addedto the sucrose before centrifugation. For electron microscopy,exosomes were visualised by negatively staining using uranylacetate.

Exosome uptake and RNAi transferFor visualisation of exosome uptake, Huh7 cells were seeded onglass cover slips. Rhodamine-labelled exosomes were added tolive cells on coverslips in a heated chamber (378C) and uptakewas measured in real time by confocal microscopy (ZeissLSM510META). To determine the kinetics of exosome uptake,images were taken every minute for 45 min. Paraformaldehyde(PFA)-fixed cells served as controls to exclude passive transfer ofRhodamine by exosome cell fusion. In order to specify thesubcellular localisation of exosomes, nuclear staining using theHoechst dye was performed. In these experiments, measure-ments were taken at only two time points (1 and 30 min afteradding exosomes) to avoid cytotoxicity of Hoechst induction bythe laser and decay of the nuclear staining.

RNAi transfer by purified exosomes was tested by treatingHuh7-ET cells with shNS5-containing exosomes for 48 h andviral replication was measured based on luciferase activity.Similarly, Huh7 cells were treated with shCD81-containingexosomes for 48 h and CD81 cell surface expression was quan-tified by flow cytometry.

Mass spectrometric analysisTwo batches of purified exosomes were subjected to massspectrometry at the Erasmus MC Proteomics Center. Briefly, 1DSDS-PAGE gel lanes were cut into 2 mm slices using an auto-

matic gel slicer and subjected to in-gel reduction with dithio-threitol, alkylation with iodoacetamide and digestion withtrypsin (Promega sequencing grade), essentially as described byWilm et al.23 Nanoflow LC-MS/MS was performed on a 1100series capillary LC system (Agilent Technologies) coupled to anLTQ-Orbitrap mass spectrometer (Thermo) operating in posi-tive mode and equipped with a nanospray source. Peptidemixtures were trapped on a ReproSil C18 reversed phase column(Dr Maisch GmbH; column dimensions 1.5 cm3100 mm, packedin-house) at a flow rate of 8 ml/min. Peptide separation wasperformed on ReproSil C18 reversed phase column (Dr MaischGmbH; column dimensions 15 cm350 mm, packed in-house)using a linear gradient from 0% to 80% B (A¼0.1% formic acid;B¼80% (v/v) acetonitrile, 0.1% formic acid) for 70 min ata constant flow rate of 200 nl/min using a splitter. The columneluent was directly sprayed into the ESI source of the massspectrometer. Mass spectra were acquired in continuum mode;fragmentation of the peptides was performed in data-dependentmode. Peak lists were automatically created from raw data filesusing the Mascot Distiller software Version 2.3 (MatrixScience).The Mascot search algorithm Version 2.2 (MatrixScience) wasused for searching against a customised database containing allIPI_human protein sequences (release 2010_09). The peptidetolerance was typically set to 10 ppm and the fragment iontolerance was set to 0.8 Da. A maximum number of two missedcleavages by trypsin was allowed and carbamidomethylatedcysteine and oxidised methionine were set as fixed and variablemodifications, respectively. The Mascot score cut-off value fora positive protein hit was set to 65. Individual peptide MS/MSspectra with Mascot scores below 40 were checked manuallyand either interpreted as valid identifications or discarded.Typical contaminants also present in immunopurifications usingbeads coated with pre-immune serum or antibodies directedagainst irrelevant proteins were omitted from the table.

RNA isolation and real-time RT-PCR analysisTotal RNAwas extracted using the miRNeasy mini kit accordingto the manufacturer ’s instructions (Qiagen, Hilden, Germany).Mouse liver tissues were mechanically disrupted and lysed usingTrizol (Invitrogen-Gibco). RNA was quantified using a Nano-drop ND-1000 (Wilmington, Delaware, USA). cDNA wasprepared from 1 mg total RNA using a iScript cDNA SynthesisKit (Bio-Rad Laboratories, Stanford, California, USA). ThecDNA of mouse CD81, TBP, CyB and GAPDH was quantifiedusing real-time PCR (MJ Research Opticon, Hercules, California,USA) performed with SybrGreen (Sigma-Aldrich) according tothe manufacturer ’s instructions. CD81 mRNA levels werenormalised to the average level of the three independent refer-ence genes using the ddCT method. TaqMan-based real-timePCR kit for detection of miR-122 was purchased from AppliedBiosystems and analysis was performed according to themanufacturer ’s instructions. A customised kit for quantificationof small silencing RNA was designed by amplification of theantisense sequence of shCD81 (UAGAACUGCUUCACAUCC)using TaqMan-based real-time PCR from Applied Biosystems.The assay is supposed to amplify the mature miR-122 or siCD81preferentially but may also detect the precursors.

Fluorescent immunohistochemistryMouse liver tissue was dissected and cryoprotected in 30%sucrose for generation of frozen sections. Serial 6 mm cryo-sections were air-dried for 48 h at room temperature followed bya washing step with PBS. Sections were fixed with 50% acetonein PBS for 10 min on ice and blocked in PBS containing 4%

Pan Q, Ramakrishnaiah V, Henry S, et al. Gut (2011). doi:10.1136/gutjnl-2011-300449 3 of 10

Hepatology

group.bmj.com on December 28, 2011 - Published by gut.bmj.comDownloaded from

fat-free milk for 1 h at room temperature. The sections wereincubated with Alexa Fluor647 labelled anti-mouse CD81 anti-body (AbD Serotec, Oxford, UK) at a dilution of 1:100 for30 min. After three washes, nuclear staining was achieved byincubating with DAPI (Sigma-Aldrich) at a dilution of 1:50 for5 min. Multiple areas from the mouse liver tissue surroundingnodules of engrafted Huh7 cells were analysed by confocalmicroscopy. The Huh7 nodules were distinguished from liverparenchyma on the basis of GFP positivity and tumourmorphology.

Statistical analysisStatistical analysis was performed with either a matched-pairnon-parametric test (Wilcoxon signed-rank test) or a non-pairednon-parametric test (ManneWhitney test) using GraphPadPrism software. p Values <0.05 were considered as statisticallysignificant.

RESULTSTransmission of lentiviral vector-delivered RNAi targeting HCVreceptor or viral genomeWe have constructed a lentiviral vector, LV-shNS5b, whichcontains both the GFP reporter gene and a shRNA targeting theHCV NS5b region, which encodes the viral RNA-dependentRNA polymerase. We used a subgenomic HCV replicationmodel based on a Huh7 hepatoma cell line containing the non-structural sequence of the HCV genome with a luciferasereporter gene (Huh7-ET), mimicking viral replication withoutvirus particle production.24 As reported previously, LV-shNS5bresulted in a mean6SD maximum inhibition of HCV replica-tion of 9860.5% (n¼8, p<0.001) at the highest transductionefficiency.8 25 However, at suboptimal transduction efficiency,the percentage inhibition of viral replication as measured byluciferase activity significantly exceeded the percentage oftransduced cells as measured by GFP expression (figure S1 inonline supplement). For example, with a transduction efficiencyof 45% GFP, the observed inhibition of HCV replication was58%, suggesting possible extension of RNAi to non-transducedcells. Similar results were observed with the LV-shCD81,a vector containing GFP and shRNA targeting the HCV receptorCD81. LV-shCD81 significantly reduced CD81 cell surfaceexpression in transduced Huh7 cells (mean6SD inhibition92.965.9%, n¼8, p<0.001), but also significantly reduced CD81expression in non-transduced GFP-negative cells (30.1612.9%inhibition, p<0.001; figure 1A). CD81 reduction was not relatedto loss of cell viability as dead/permeable cells were excludedfrom analysis.

To ensure that the gene silencing effect on GFP-negative cellswas not due to insensitivity of GFP detection or silencing oftransgenic expression, additional co-culture experiments wereperformed (figure 1B). A significant inhibition of HCV replica-tion was observed when Huh7-ET HCV replicon cells were co-cultured with naïve Huh7 cells stably expressing shNS5b at a 1:1ratio (51612%, n¼6, p<0.01) compared with Huh7-shCon co-cultures and untreated Huh7 cells (figure 1C). A similar effectwas observed at a lower ratio of 1:0.5 Huh7-ET and Huh7-shNS5b cells, but lost significance when co-culturing at very lowratios (figure 1C). To confirm that primary human cells andother cell types also transmit RNAi, we tested primary Blymphocytes isolated from human spleen stably transducedwith shRNA vectors (figure 1E). Similar to the co-culture withtransduced Huh7 cells, a significant inhibition of viral replicationwas observed in replicon cells co-cultured with B cells expressing

shNS5b at a ratio of 1:1 (p<0.01) or 1:5 (p<0.05) compared withco-cultures of B cells with shCon (figure 1F).RNAi transmission has been reported to be dependent20 or

independent15 on cell contact depending on the model used,although the exact mechanisms remain largely elusive. Usingimmunofluorescence microscopy, we observed that LV-shCD81-dependent knockdown of CD81 expression in GFP-negative cellswas not restricted to cells in direct contact with GFP-positivecells but, rather, a general pattern of CD81 reduction was seen(data not shown). To further investigate whether RNAi can betransmitted in the absence of direct cell-cell contact, CM wasprepared from stably transduced Huh7 cells expressing shCon,shCD81 or shNS5b (figure 1B). As shown in figure 1D, exposureof Huh7-ET cells to shNS5b-CM (at a final concentration of50%) specifically reduced HCV replication by 39612% (n¼9,p<0.01) without transfer of GFP positivity. Treatment withshCD81-CM also significantly reduced CD81 expression inHuh7 cells (23.565.1% inhibition, n¼7, p<0.01). These resultssuggest that transmission of RNAi is independent of cell contactbut rather seems to involve the uptake of released silencing RNAcomponents.

Functional transmission of liver abundant miRNAWe further investigated whether the cell contact-independentmanner of small RNA transmission also exists for endogenousmiRNA. Huh7 cells highly express miR-122, a liver abundantmiRNA that has been reported to be a crucial positive regulatorof HCV replication and translation.26 We found that cell-freeCM of Huh7 cells (Huh7-CM) contained high levels of miR-122(figure S2 in online supplement). Concentration of Huh7-CM(Huh7-C-CM) using ultrafiltration resulted in a 10-fold increasein miR-122 levels. The miR-122 level of Huh7 cells is more than200-fold higher than another hepatoma cell line HepG2 and over50 000-fold higher than the embryonic kidney epithelial cell line293T (figure S2 in online supplement). Treatment of HepG2 cellswith Huh7-CM or Huh7-C-CM significantly increased intra-cellular miR-122 levels by 3e4-fold (p<0.01), indicating uptakeof miR-122 from the medium. An even more pronouncedmiRNA uptake was observed in 293Tcells, leading to an increasein cellular miR-122 levels of about 20-fold or 1750-fold afterexposure to Huh7-CM and Huh7-C-CM, respectively (figure2A). miRNA transfer was also observed in freshly isolatedhuman peripheral blood mononuclear cells, and incubation withHuh7-CM resulted in an increase in cellular miR-122 levels ofapproximately 100-fold (figure 2B). To demonstrate the transferof miRNA more specifically and to exclude possible induction ofmiRNA gene expression by other factors present in CM, wegenerated a lentiviral vector specifically expressing the precursorof miR-122 (LV-miR-122). CM was produced from LV-miR-122or control vector (LV-shCon) transduced 293T cells. 293T cellsnaturally expressed very low levels of miR-122 and transductionwith LV-miR-122 (w5% transduction efficiency) resulted in anincrease in cellular miR-122 levels of approximately 10-fold. Asshown in figure 2C, miR-122-CM but not shCon-CM specifi-cally increased the cellular miR-122 levels in 293T cells byapproximately fivefold. Similarly, incubation with miR-122-CMincreased the cellular miR-122 levels of the T cell line (SupT1cells) by approximately 15-fold (figure 2D). To investigate thefunctionality of miRNA transmission, a reporter plasmid-expressing luciferase gene coupled with miR-122 complementarysequence was used to transfect 293Tcells. As shown in figure 2E,treatment of concentrated Huh7-CM significantly reduced themiR-122-targeted luciferase activity compared with untreated orcontrol medium-treated conditions (p<0.01). This confirms

4 of 10 Pan Q, Ramakrishnaiah V, Henry S, et al. Gut (2011). doi:10.1136/gutjnl-2011-300449

Hepatology

group.bmj.com on December 28, 2011 - Published by gut.bmj.comDownloaded from

functional regulation of target reporter gene expression bytransferred miRNA.

Secreted exosomes contain small RNAs and RNA bindingproteinsPrevious studies have shown that cellular miRNA can be releasedfrom cells by secretion of microvesicles/exosomes.15 17 To furtherinvestigate whether exosomes are involved in the transfer ofsmall silencing RNA, we purified secreted exosomes from Huh7-CM or CM of stably transduced Huh7 cells expressing shCon,shCD81 or shNS5b using density gradient ultracentrifugation.Figure 3A shows an electron micrograph of a purified exosome.RT-PCR analysis of shCD81-CM exosomes revealed the presenceof both miRNA (miR-122) and shCD81 (figure 3B). Huh7-CM-derived exosomes were analysed by mass spectrometry to char-acterise the protein content. From two independent preparationsof exosomes, over 600 common proteins were detected includingthe established exosome markers Tsg101, CD63, CD9, Alix,Flotillin and RAB5.27 These proteins were further categorised

according to their location and function (see figure S3A and B inthe online supplement). Importantly, 56 distinct RNA bindingproteins were present, including ribosomal proteins, serine/argi-nine-rich splicing factors, heterogeneous nuclear ribonucleopro-teins, eukaryotic translation initiation factors and proteasomesubunits (see figure 3C and online table). Relevant to the contentof miRNA and siRNA, we identified four proteins in exosomeswhich are known to be important for the miRNA pathway andwhich are potential binding partners of the small silencing RNAcargo in hepatic exosomes (figure 3D). Of particular interest is thenucleolar phosphoprotein B23 (NPM1) which has recently beenshown specifically to protect the degradation of miRNAs.28 RAN,the Ras-related nuclear protein, is known to be involved innucleocytoplasmic transport. Interestingly, recent studies haveshown that Exportin-5-mediated nuclear export of pre-miRNA orshRNA acts in a Ran-GTP-dependent manner.29e31 Furtherstudies will be required to identify the exact molecular machineryinvolved in the sorting and packaging of small silencing RNA intoexosomes.

Figure 1 Evidence for intercellularfunctional transmission of smallsilencing RNAs. (A) Silencing of CD81expression by the lentiviral vector LV-shCD81 extended to green fluorescentprotein (GFP)-negative non-transducedcells. Huh7 cells were transduced byLV-GFP containing either a CD81targeting shRNA (LV-shCD81) ora scrambled control shRNA (LV-shCon).The upper panel shows a representativehistogram of GFP fluorescenceintensity. The lower panels showflowcytometric analysis of CD81staining ingated GFP-negative (leftpanel) and GFP-positive (right panel)cellstransduced with LV-shCon (seearrow) orLV-shCD81 (see arrow). Theleft lines show isotype-matched controlstaining. (B) Hepatitis C virus (HCV)replicon cells (Huh7-ET) were directlyco-cultured with cells stably expressingshNS5b (Huh7-shNS5b) or controlshRNA (Huh7-shCon) or treated withconditioned culture medium (CM) ofthese cells. (C) Significant inhibition ofHCV replication was observed at ratiosof 1:1 and 1:0.5 Huh7-ET with Huh7-shNS5b compared with co-cultureswith Huh7-shCon or untreated cells.Mean6SD values of six independentexperiments are shown (**p<0.01).(D) Huh7-ET replicon cells treated withshNS5b-CM (at final concentration50%) but not shCon-CM showedsignificantly reduced HCV replication of39612% (n¼9, **p<0.01) comparedwith untreated controls. (E) Huh7-ETcells were co-cultured with primaryhuman B cells stably expressingshNS5b or shCon. (F) Significantreduction of viral replication wasobserved when co-cultured with B cellsexpressing shNS5b at a ratio of 1:1(n¼4, **p<0.01). Such an effectwas also confirmed at a ratio of 1:5(n¼3, *p<0.05), although a high density of B cells appeared to cause some non-specific effects.

0

20

40

60

80

100

120

1 2 3 4 5 6 70

20

40

60

80

100

120

1 2 3 4

shCon-CM

shNS5b-CM

A

Stable Huh7-shNS5b/shCon Huh7-ET

C

**

Huh7-shCon - + - + - + -Huh7-shNS5b - - + - + - + Huh7-ET:Huh7-sh 1:1 1:0.5 1:0.1

**

Rel

ativ

e H

CV

Luc

ifera

seac

tivity

(%)

D

Rel

ativ

e H

CV

repl

icat

ion

(%)

**

shCD8152%

shCon98%

shCD815%

shCon99%

Green fluorescence intensity

Fluorescence intensity CD81 staining (% pos. cells)

GFP positiveGFP negative

CM

B

0% 10% 25% 50%Percentage of CM

Stable primary humanB cell-shNS5b/shCon Huh7-ET

0

20

40

60

80

100

120

4321

B-shCon

B-shNS5bR

elat

ive

HC

V L

ucife

rase

activ

ity (%

)

Huh7-ET:B-shRNA 1:0 1:0.1 1:1 1:5

** *

E F

Pan Q, Ramakrishnaiah V, Henry S, et al. Gut (2011). doi:10.1136/gutjnl-2011-300449 5 of 10

Hepatology

group.bmj.com on December 28, 2011 - Published by gut.bmj.comDownloaded from

Transmission of gene silencing is partially mediated byexosomesTo investigate the involvement of exosomes in small RNAtransfer, real-time live cell imaging was performed with Huh7cells exposed to fluorescent-labelled exosomes using confocalmicroscopy. Real-time analysis showed that exosome uptake israpid and occurs within 45 min (data not shown). As shown infigure 4A, ingested exosomes predominantly accumulate in thecytoplasm or other intracellular compartments but not in thenucleus. Exosome uptake was observed in most of the living cells(>80%) but little uptake occurred in PFA-fixed cells (figure 4B),confirming that uptake is an active process. Treatment of HCVreplicon cells with purified exosomes derived from shNS5b-CMresulted in a significant reduction of viral replication (mean6SDinhibition 21.666.4%, n¼4, p<0.01; figure 4C). Similarly,treatment of Huh7 cells with exosomes derived from shCD81-CM resulted in a significant downregulation of CD81 cell surfaceexpression (reduction of 24.563.1%, n¼4, p<0.05; figure 4D).These findings confirm that secreted exosomes containing smallRNAs, including miRNA and small silencing RNA, can mediatetransmission of functional gene silencing. In addition, recentstudies have suggested the co-existence of exosome-dependent

and exosome-independent pathways of small RNA release andtransfer.20 32 33

Transmission of gene silencing in mice liverTo explore the evidence for small RNA exchange in vivo, weengrafted Huh7-shCD81 cells, stably expressing shRNAtargeting mouse CD81, or Huh7-shCon cells, containing irrele-vant shRNA, in the liver of immunodeficient NOD/SCID miceby intrasplenic injection (figure 5A). Human hepatomas in themouse liver tissue were visualised based on GFP positivity.Mouse liver tissue surrounding nodules of Huh7-shCon cellsshowed comparable CD81 expression (figure 5B) to that ofuntreated mice (figure 5C). On the contrary, liver tissue adjacentto Huh7-shCD81 nodules showed a marked reduction in CD81expression (figure 5D). Flow cytometric quantification of mouse-specific CD81 expression on dissociated liver cells showeda mean reduction of 71.3% on both hepatocytes and non-parenchymal cells in Huh7-shCD81 versus Huh7-shConengrafted mice (p¼0.002, figure 5E). This finding suggeststransfer of RNAi from the human cells to the primary mousecells in vivo. In order to determine whether RNAi transfer invivo is dependent on cell contact, NOD/SCID mice were

Figure 2 Evidence for intercellularfunctional transmission of liverabundant microRNA (miRNA). (A)Uptake of miR-122 by 293T cells afterexposure to Huh7-CM or Huh7-C-CM.(B) Peripheral blood mononuclear cellsfrom healthy controls showing anincrease in the cellular miR-122 level ofabout 100-fold after 6 h of incubationwith Huh7-CM. (C) To confirm miRNAtransfer and rule out the induction ofmiRNA gene expression by otherfactors present in conditioned medium(CM), we generated CM of 293T cellstransduced by the lentiviral vectors LV-miR-122 or LV-shCon. Treatment ofnaı̈ve 293T cells with miR-122-CM butnot shCon-CM increased the cellularmiR-122 level by approximatelyfivefold. (D) Incubation with miR-122-CM resulted in about 15-fold increase ofcellular miR-122 levels in the T cell line,SupT1 cells. Data shown are mean6SDof three or four independentexperiments. (E) Treatment ofconcentrated Huh7-CM resulted ina significant reduction in miR-122-related luciferase activity in 293T cellstransfected with miR-122 reporterplasmid compared with the grouptreated with control medium or theuntreated group. Data shown aremean6SD of three independentexperiments (n¼11 replicates in total,**p<0.01).

6 of 10 Pan Q, Ramakrishnaiah V, Henry S, et al. Gut (2011). doi:10.1136/gutjnl-2011-300449

Hepatology

group.bmj.com on December 28, 2011 - Published by gut.bmj.comDownloaded from

intravenously treated with shCD81-C-CM or shCon-C-CM(figure 5A). At day 6 a significant reduction in the CD81 mRNAlevel was observed in mouse livers by shCD81-CM treatment(mean6SD reduction of 31.6615.6%, n¼4) compared with theshCon-CM controls (n¼4, p<0.05; figure 5F). Consistent withthe gene expression levels, an approximate reduction of 20% inCD81 cell surface expression was observed in both hepatocytesand non-parenchymal cell populations by flow cytometry (figure5G). The gene silencing by shCD81-CM was comparable to thatof liposome or nanoparticle delivery of siRNA observed ina transgenic mouse model of HCV or in human tumours.34 35

Despite earlier reports of hepatotoxicity by adeno-associatedvector-mediated RNAi,36 we observed no evidence of liver injuryby histology or serum transaminases as a result of shCD81-CMtreatment.

DISCUSSIONFrom the discovery of RNAi in 199837 to the approval of RNAitherapeutics or RNAi-based gene therapy by the FDA, itsapplication has been dramatically changing. Much attention hasbeen given to developing antiviral RNAi against, for example,HIV,38 HBV39 or HCV6 infection. If RNAi therapies are to beused as an effective treatment or prevention of HCV infection,long-term stable siRNA expression needs to be achieved. Rawsynthetic siRNA or plasmid-encoded shRNA transfections elicitonly short-term silencing, whereas viral vectors that encode forshRNA can potentially induce long-term and continuous gene

silencing.6 Adeno-associated viral (AAV) vectors are currentlyconsidered the prime candidate for clinical gene therapy appli-cations, including the treatment of various liver diseases. Biotechcompanies such as Tacere Therapeutics have pioneered thedevelopment of an AAV-based anti-HCV RNAi regimen termed‘TT-033’ (http://www.tacerebio.com). However, AAV-mediatedexpression of shRNA was shown to evoke liver toxicity in mice,ultimately causing death.36 It was suggested that the saturationof the endogenous miRNA processing machinery by overex-pressed shRNA is the potential cause,40 but the exact mecha-nism remains unclear. Lentiviral vector represents anotherpromising candidate for clinical RNAi delivery. Although certainlentiviral RNAi systemsdsuch as some commercial RNAilibrariesdexpress high levels of shRNA and cause disturbance ofcellular miRNA machinery, no significant cell toxicity wasobserved.41 The lethal toxicity observed by Grimm et al36 couldbe caused by the combination of AAV vector and overexpressedshRNA. Of note, the lentiviral RNAi vectors used in this studyexpress moderate levels of shRNA without a clear effect on themiRNA pathway.41 To overcome the potential toxicity and off-target issues, liver-specific promoters42 or miRNA-based RNAiconstructs43 have been used to generate safer vectors.Although studies have demonstrated the feasibility of

combating HIV infection by the ex vivo delivery of lentivralRNAi,44 it remains a challenge to produce sufficient vectorstargeting the entire liver organ. For almost any type of vector, itis not possible to achieve 100% transduction efficacy in patients.The finding in the current study that gene silencing can transfer

Figure 3 Exosomes contain smallRNAs and RNA binding proteins.Secreted exosomes were purified fromconditioned medium (CM) from Huh7cells using density gradientultracentrifugation. (A) Electronmicrograph showing the presence ofexosomes in the purified fraction. (B)RT-PCR analysis of purified exosomesfrom shCD81-CM showing the presenceof both miRNA and shCD81. Markersindicate the anticipated amplicon sizefor miR-122 and shCD81. No-template(H2O) and purified exosomes fromshNS5b-CM served as negativecontrols. This assay is supposed toamplify the mature miR-122 or siCD81preferentially but may also detect theprecursors. (C) Mass spectrometry wasperformed to analyse the proteincontent of two independent batches ofHuh7-CM-derived exosomes. Usinga Mascot cut-off for specificity (Mascot>40), a total of >600 commonproteins were identified including manyexosome-specific proteins; 56 proteinsare known RNA-binding proteins,including 32 ribosomal proteins. (D) Ofthe RNA-binding proteins, four areknown to be involved in the miRNApathway and are potentially involved inthe selection, sorting and packaging ofsmall silencing RNA in hepaticexosomes. The protein name, mainfunction and relative abundance inexosomes indicated by the amPAI value(mean of two samples) are shown.

Others , 12

Ribosomal proteins, 32

Eukaryotic translation initiation

factors, 3

Proteasome subunits, 2

Heterogeneous nuclear

ribonucleoproteins, 3Serine/arginine-

rich splicing factors, 4

Others, 563

RNA binding

proteins, 56

A Marker H2O Huh7-exo

100 bp50 bp miR-122

B

shCD81

Marker shCD81 shNS5b-exo -exo

50 bp100 bp

C

RAN 2.70 Nucleo-cytoplasmic transport/miRNA biogenesis

NPM1 1.12 Protection of miRNA degradation

TUT1 0.76 U6 snRNA terminal uridylyltransferase

SSB 0.08 RNA III polymerase transcription

Gene Protein name emPAI Functionssymbol value

Ras-related nuclear protein

Nucleolar phosphoprotein B23

U6 snRNA-specific-terminal uridylyltransferase 1 Sjogren syndrome antigen B

D

110 nm

Pan Q, Ramakrishnaiah V, Henry S, et al. Gut (2011). doi:10.1136/gutjnl-2011-300449 7 of 10

Hepatology

group.bmj.com on December 28, 2011 - Published by gut.bmj.comDownloaded from

to neighbouring non-transduced cells could potentially over-come this issue of suboptimal vector transduction to a certainextent. Whether it would be sufficient to silence the virus in thenon-transduced cells solely via the RNAi transmission routeremains questionable. Like HIV,45 HCV is prone to developresistant mutants if the antiviral potency is suboptimal. Vectorsimultaneous delivery of multiple shRNAs targeting differentregions of the virus or a combination of targeting host factorscould be one solution to prevent mutagenesis,46 since the non-transduced cells could receive multiple antiviral shRNAs eventhough the levels are less abundant. As with other new antivi-rals,2 3 combination with interferon is likely to be required forRNAi-based therapy to achieve ultimate success in patientschronically infected with HCV.47

The mechanism of RNAi transmission in plants and inverte-brates has been proposed to be via direct cell-to-cell contact orsystemic spreading, although the exact mechanism remainsunclear. Rechavi et al reported that transmission of small RNAbetween B and T cell lines in culture is dependent on cellcontact,20 whereas many others15e19 have described a secretorytransmission pathway involving exosomes in differentmammalian cell culture systems. In this study we also observedthe release and uptake of small RNA-packed exosomes byhepato-like cells. We further performed mass spectrometricanalysis to characterise the protein content of these exosomes.Along with previous studies characterising exosomes derivedfrom monocytes48 49 or hepatocytes,50 there appears to be somecell type specificity. For instance, AGO2, a protein involved inthe RNAi machinery, is detectable in monocytes48 49 but not inhepatocyte-derived50 exosomes. The differential enrichment of

nucleotide and nucleic acid binding proteins has been observedbetween Huh7 and primary hepatocyte-derived exosomes.50

Interestingly, we found several proteins present in our exosomesthat potentially contribute to the functional transmission ofsmall RNAs. RAN, which is known to have a role in nucleocy-toplasmic transport, was demonstrated to be involved inExportin-5-mediated nuclear export of pre-miRNA orshRNA.29e31 The co-presence of NPM1, which can specificallyprotect the degradation of miRNAs,28 and TUTase, which canpotentially edit miRNAs or shRNAs,51 suggests that the processof degradation and modification of small RNAs can be poten-tially regulated within the exosomes. It is possible that both theprotein and RNA content deters the function of transferredexosomes.

In the in vivo experiments in mice, we observed a robusttransmission of RNAi in the liver (figure 5). The differentpotency of CD81 knockdown between animals engrafted withHuh7 cells and those treated with shRNA-CM is probably dueto differences in the efficacy of RNAi delivery. Most efficientRNAi transfer was observed with engrafted Huh7 cells whichprovided a continuous source of siRNA, whereas treatmentwith CM only provided a transient delivery. Moreover, theproximity to the RNAi sources could be a factor. We assumedthat exosomes only partially mediated the transmission of genesilencing and the other part would be contributed by thesecreted small RNAs independent of exosomes. This is high-lighted by the fact that RNAi transfer was more effective withCM than with purified exosomes (figures 1 and 4). Thediscrepancy between the exosome uptake efficiency (figure 4A,>80% positive cells) and RNAi transfer efficiency (figure 4C,D)

Figure 4 Exosome-mediatedfunctional transmission of smallsilencing RNAs. (A) Dynamicvisualisation of rhodamine-labelledexosome uptake by live Huh7 cellsshowing intracellular accumulation inviable cells but not in paraformaldehyde(PFA)-fixed cells (B). Red stainingrepresents exosomes and blue stainingindicates the nucleus. Shown is one ofthree independent experiments(magnification 8003). (C) Treatment ofHuh7-ET replicon cells with purifiedexosomes derived from shNS5b-CMsignificantly reduced viral replication by21.666.4%. (D) Treatment of normalHuh7 cells with purified exosomesderived from shCD81-CM resulted ina significant downregulation of CD81cell surface expression by 24.563.1%.Mean6SD inhibition of fourindependent experiments is shown(*p<0.05).

8 of 10 Pan Q, Ramakrishnaiah V, Henry S, et al. Gut (2011). doi:10.1136/gutjnl-2011-300449

Hepatology

group.bmj.com on December 28, 2011 - Published by gut.bmj.comDownloaded from

can be explained by the cargo. Not all exosomes derived fromdonor cells may contain appropriate levels of shNS5b orshCD81 required for effective transfer of RNAi. A recent studyshowed that substantial amounts of extracellular miRNAs areassociated with Argonautes,32 which could represent anexosome-independent pathway of RNAi exchange. Furtherstudies are required to identify the exact molecular machineryused in regulating the release and uptake of functional smallRNAs.

In summary, this study has provided in vitro and in vivoevidence that small RNA could be exchanged between hepaticcells and that this property extends RNAi-mediated gene

silencing against HCV receptor or viral genome. Exchange ofsmall RNAs in our models was independent of direct cell-to-cellcontact and appeared to be mediated by the secretory pathwaypartially involving exosomes. Cells that stably express shRNAsuch as stem cells may represent an effective method for thetherapeutic delivery of RNAi in vivo. These findings may berelevant for the clinical application of RNAi-based therapy in thetreatment of chronic hepatitis C as well as in metabolic andimmunomediated liver diseases.52

Acknowledgements The authors would like to thank Dr Jeroen Demmers forhelping with mass spectrometry (Erasmus MC Proteomics Center), Dr Pascal van

Figure 5 In vivo evidence fortransmission of RNA interference(RNAi) in mice. (A) Schematicrepresentation of in vivo experimentswith immunodeficient mice. (1) NOD/SCID mice were either engrafted withcontrol Huh7 cells expressing irrelevantshRNA targeting NS5b (Huh7-shCon) orHuh7 cells expressing shRNA targetingmurine CD81 mRNA (Huh7-shCD81) inthe liver. (2) Alternatively, NOD/SCIDmice were injected intravenously with200 ml of 100-fold concentrated cell-free conditioned medium (CM) fromHuh7-shCD81 or Huh7-shCon cellsthree times at 48 h intervals (fouranimals in all groups). Confocalimmunofluorescence staining using ananti-mouse CD81-specific antibodyshowed normal CD81 expression (redfluorescence) in the mouse liver tissue(M) surrounding nodules of Huh7-shConcells (H) (B), comparable to expressionin untreated mice (C). (D) CD81expression in mouse liver tissue (M)surrounding Huh7-shCD81 cells (H) wasmarkedly reduced. (E) Flow cytometricquantification of dissociated liver cellsshowing a significant reduction in CD81expression in mouse hepatocytes andnon-parenchymal cells (mean reductionof 71.3%, p¼0.002) in mice engraftedwith Huh7-shCD81 (bottom panels)compared with mice engrafted withHuh7-shCon (top panels). Greenfluorescent protein (GFP)-positivehuman cells were gated out anda mouse specific anti-CD81 antibodywas used to specifically determinemouse CD81 expression. The datashown are the mean geometric meanfluorescence intensity. (F) Analysis ofliver mRNA showed a significantknockdown of CD81 expression in micetreated with shCD81-CM as comparedwith shCon-CM treatment. (G)Knockdown of CD81 surface expressionwas confirmed by flow cytometry inboth hepatocyte and non-parenchymalcell populations (approximately 20%;*p<0.05).

shCD81-CMshCon-CM

Huh7-shCD81Huh7-shCon

(1)A

E

B C

Huh

7-sh

CD

81

Huh

7-sh

Con

Hepatocytes Nonparenchymal cells

MFI 25

MFI 7

MFI 136

MFI 40

F

50

60

70

80

90

100

110

120

shCon shCD81

Rel

ativ

e C

D81

mR

NA

(%)

*

50

60

70

80

90

100

110

120

shCon shCD81

Hepatocytes

Rel

ativ

e C

D81

sur

face

exp

ress

ion

(%)

*

GHepatocytes

Nonparechymal cells

(2)

Fluorescence intensity CD81 staining

H

M H

MM

D

Pan Q, Ramakrishnaiah V, Henry S, et al. Gut (2011). doi:10.1136/gutjnl-2011-300449 9 of 10

Hepatology

group.bmj.com on December 28, 2011 - Published by gut.bmj.comDownloaded from

der Wegen, Dr Bob Scholte, Dr Rob Willemsen and Dr Guido Jenster (Erasmus MC,Rotterdam) for technical support, and Professor Ralf Bartenschlager and Dr VolkerLohmann (University of Heidelberg, Germany) for generously providing the Huh7 andHuh6 subgenomic HCV replicon cells. We also thank the Erasmus MC TranslationalResearch Fund and the Liver Research Foundation (SLO) Rotterdam for financialsupport.

Funding Financial support was provided by the Erasmus MC Translational ResearchFund and the Liver Research Foundation (SLO) Rotterdam.

Competing interest None.

Contributors QP designed and performed the experiments, performed data analysisand wrote the manuscript. VR performed the experiments. SH constructed the vectorsand performed the experiments. SF and PdR performed the experiments. JK, HWT andHLAJ contributed to the discussion and the manuscript. LJWL conceived the idea,designed and supervised the project, performed the data analysis and wrote themanuscript.

Provenance and peer review Not commissioned; externally peer reviewed.

REFERENCES1. Naggie S, Patel K, McHutchison J. Hepatitis C virus directly acting antivirals: current

developments with NS3/4A HCV serine protease inhibitors. J Antimicrob Chemother2010;65:2063e9.

2. McHutchison JG, Everson GT, Gordon SC, et al. Telaprevir with peginterferon andribavirin for chronic HCV genotype 1 infection. N Engl J Med 2009;360:1827e38.

3. Kwo PY, Lawitz EJ, McCone J, et al. Efficacy of boceprevir, an NS3 proteaseinhibitor, in combination with peginterferon alfa-2b and ribavirin in treatment-naivepatients with genotype 1 hepatitis C infection (SPRINT-1): an open-label, randomised,multicentre phase 2 trial. Lancet 2010;376:705e16.

4. Chang K, Elledge SJ, Hannon GJ. Lessons from nature: microRNA-based shRNAlibraries. Nat Methods 2006;3:707e14.

5. Hannon GJ. RNA interference. Nature 2002;418:244e51.6. Pan Q, Tilanus HW, Janssen HL, et al. Prospects of RNAi and microRNA-based

therapies for hepatitis C. Expert Opin Biol Ther 2009;9:713e24.7. Yang X, Haurigot V, Zhou S, et al. Inhibition of hepatitis C virus replication using

adeno-associated virus vector delivery of an exogenous anti-hepatitis C virusmicroRNA cluster. Hepatology 2010;52:1877e87.

8. Henry SD, van der Wegen P, Metselaar HJ, et al. Simultaneous targeting of HCVreplication and viral binding with a single lentiviral vector containing multiple RNAinterference expression cassettes. Mol Ther 2006;14:485e93.

9. Palauqui JC, Elmayan T, Pollien JM, et al. Systemic acquired silencing: transgene-specific post-transcriptional silencing is transmitted by grafting from silenced stocksto non-silenced scions. Embo J 1997;16:4738e45.

10. Himber C, Dunoyer P, Moissiard G, et al. Transitivity-dependent and -independentcell-to-cell movement of RNA silencing. Embo J 2003;22:4523e33.

11. Saleh MC, Tassetto M, van Rij RP, et al. Antiviral immunity in Drosophila requiressystemic RNA interference spread. Nature 2009;458:346e50.

12. Tijsterman M, Ketting RF, Plasterk RH. The genetics of RNA silencing. Annu RevGenet 2002;36:489e519.

13. Molnar A, Melnyk CW, Bassett A, et al. Small silencing RNAs in plants are mobileand direct epigenetic modification in recipient cells. Science 2010;328:872e5.

14. Dunoyer P, Schott G, Himber C, et al. Small RNA duplexes function as mobilesilencing Signals between plant cells. Science 2010;328:912e16.

15. Valadi H, Ekstrom K, Bossios A, et al. Exosome-mediated transfer of mRNAs andmicroRNAs is a novel mechanism of genetic exchange between cells. Nat Cell Biol2007;9:654e9.

16. Kosaka N, Iguchi H, Yoshioka Y, et al. Secretory mechanisms and intercellulartransfer of microRNAs in living cells. J Biol Chem 2010;285:17442e52.

17. Skog J, Wurdinger T, van Rijn S, et al. Glioblastoma microvesicles transport RNAand proteins that promote tumour growth and provide diagnostic biomarkers. NatCell Biol 2008;10:1470e6.

18. Meckes DG Jr, Shair KH, Marquitz AR, et al. Human tumour virus utilizes exosomesfor intercellular communication. Proc Natl Acad Sci U S A 2010;107:20370e5.

19. Pegtel DM, Cosmopoulos K, Thorley-Lawson DA, et al. Functional delivery of viralmiRNAs via exosomes. Proc Natl Acad Sci U S A 2010;107:6328e33.

20. Rechavi O, Erlich Y, Amram H, et al. Cell contact-dependent acquisition of cellularand viral nonautonomously encoded small RNAs. Genes Dev 2009;23:1971e9.

21. Tapirdamaz O, Mancham S, van der Laan LJ, et al. Detailed kinetics of the directallo-response in human liver transplant recipients: new insights from an optimizedassay. PLoS One 2010;5:e14452.

22. Pan Q, Fouraschen SM, Kaya FS, et al. Mobilization of hepatic mesenchymal stemcells from human liver grafts. Liver Transpl 2011;17:596e609.

23. Wilm M, Shevchenko A, Houthaeve T, et al. Femtomole sequencing of proteins frompolyacrylamide gels by nano-electrospray mass spectrometry. Nature1996;379:466e9.

24. Lohmann V, Korner F, Koch J, et al. Replication of subgenomic hepatitis C virusRNAs in a hepatoma cell line. Science 1999;285:110e13.

25. Henry SD, van der Wegen P, Metselaar HJ, et al. Hydroxyethyl starch-basedpreservation solutions enhance gene therapy vector delivery under hypothermicconditions. Liver Transpl 2008;14:1708e17.

26. Jopling CL, Yi M, Lancaster AM, et al. Modulation of hepatitis C virus RNAabundance by a liver-specific MicroRNA. Science 2005;309:1577e81.

27. Thery C, Zitvogel L, Amigorena S. Exosomes: composition, biogenesis and function.Nat Rev Immunol 2002;2:569e79.

28. Wang K, Zhang S, Weber J, et al. Export of microRNAs and microRNA-protectiveprotein by mammalian cells. Nucleic Acids Res 2010;38:7248e59.

29. Lund E, Guttinger S, Calado A, et al. Nuclear export of microRNA precursors.Science 2004;303:95e8.

30. Yi R, Qin Y, Macara IG, et al. Exportin-5 mediates the nuclear export ofpre-microRNAs and short hairpin RNAs. Genes Dev 2003;17:3011e16.

31. Bohnsack MT, Czaplinski K, Gorlich D. Exportin 5 is a RanGTP-dependent dsRNA-binding protein that mediates nuclear export of pre-miRNAs. RNA 2004;10:185e91.

32. Turchinovich A, Weiz L, Langheinz A, et al. Characterization of extracellularcirculating microRNA. Nucleic Acids Res 2011;39:7223e33.

33. Arroyo JD, Chevillet JR, Kroh EM, et al. Argonaute2 complexes carry a population ofcirculating microRNAs independent of vesicles in human plasma. Proc Natl Acad SciU S A 2011;108:5003e8.

34. Watanabe T, Umehara T, Yasui F, et al. Liver target delivery of small interfering RNAto the HCV gene by lactosylated cationic liposome. J Hepatol 2007;47:744e50.

35. Davis ME, Zuckerman JE, Choi CH, et al. Evidence of RNAi in humans from systemicallyadministered siRNA via targeted nanoparticles. Nature 2010;464:1067e70.

36. Grimm D, Streetz KL, Jopling CL, et al. Fatality in mice due to oversaturation ofcellular microRNA/short hairpin RNA pathways. Nature 2006;441:537e41.

37. Fire A, Xu S, Montgomery MK, et al. Potent and specific genetic interference bydouble-stranded RNA in Caenorhabditis elegans. Nature 1998;391:806e11.

38. Haasnoot J, Westerhout EM, Berkhout B. RNA interference against viruses: strikeand counterstrike. Nat Biotechnol 2007;25:1435e43.

39. McCaffrey AP, Nakai H, Pandey K, et al. Inhibition of hepatitis B virus in mice byRNA interference. Nat Biotechnol 2003;21:639e44.

40. Grimm D, Wang L, Lee JS, et al. Argonaute proteins are key determinants of RNAiefficacy, toxicity, and persistence in the adult mouse liver. J Clin Invest2010;120:3106e19.

41. Pan Q, de Ruiter PE, von Eije KJ, et al. Disturbance of the microRNA pathway bycommonly used lentiviral shRNA libraries limits the application for screening hostfactors involved in hepatitis C virus infection. FEBS Lett 2011;585:1025e30.

42. Kay MA, Giering JC, Grimm D, et al. Expression of shRNA from a tissue-specific polII promoter is an effective and safe RNAi therapeutic. Mol Ther 2008;16:1630e6.

43. Liu YP, Berkhout B. miRNA cassettes in viral vectors: problems and solutions.Biochim Biophys Acta 2011;1809:732e45.

44. ter Brake O, Legrand N, von Eije KJ, et al. Evaluation of safety and efficacy of RNAiagainst HIV-1 in the human immune system (Rag-2(-/-)gammac(-/-)) mouse model.Gene Ther 2009;16:148e53.

45. Berkhout B, von Eije KJ, ter Brake O. Human immunodeficiency virus type I escapeis restricted when conserved genome sequences are targeted by RNA interference. JVirol 2008;82:2895e903.

46. Henry SD, Pan Q, van der Laan LJ. Production of multicopy shRNA lentiviral vectorsfor antiviral therapy. Methods Mol Biol 2011;721:313e32.

47. Pan Q, Henry SD, Metselaar HJ, et al. Combined antiviral activity of interferon-alphaand RNA interference directed against hepatitis C without affecting vector deliveryand gene silencing. J Mol Med 2009;87:713e22.

48. Gibbings DJ, Ciaudo C, Erhardt M, et al. Multivesicular bodies associate withcomponents of miRNA effector complexes and modulate miRNA activity. Nat CellBiol 2009;11:1143e9.

49. Zhang Y, Liu D, Chen X, et al. Secreted monocytic miR-150 enhances targetedendothelial cell migration. Mol Cell 2010;39:133e44.

50. Conde-Vancells J, Rodriguez-Suarez E, Embade N, et al. Characterization andcomprehensive proteome profiling of exosomes secreted by hepatocytes. J ProteomeRes 2008;7:5157e66.

51. Hagan JP, Piskounova E, Gregory RI. Lin28 recruits the TUTase Zcchc11 to inhibitlet-7 maturation in mouse embryonic stem cells. Nat Struct Mol Biol 2009;16:1021e5.

52. Kerr TA, Davidson NO. Therapeutic RNA manipulation in liver disease. Hepatology2010;51:1055e61.

PAGE fraction trail=10

10 of 10 Pan Q, Ramakrishnaiah V, Henry S, et al. Gut (2011). doi:10.1136/gutjnl-2011-300449

Hepatology

group.bmj.com on December 28, 2011 - Published by gut.bmj.comDownloaded from

doi: 10.1136/gutjnl-2011-300449 published online December 23, 2011Gut

 Qiuwei Pan, Vedashree Ramakrishnaiah, Scot Henry, et al. reach of RNA interference (RNAi)silencing RNA can extend the therapeutic Hepatic cell-to-cell transmission of small

http://gut.bmj.com/content/early/2011/12/22/gutjnl-2011-300449.full.htmlUpdated information and services can be found at:

These include:

Data Supplement http://gut.bmj.com/content/suppl/2011/12/22/gutjnl-2011-300449.DC1.html

"Supplementary Data"

References http://gut.bmj.com/content/early/2011/12/22/gutjnl-2011-300449.full.html#ref-list-1

This article cites 52 articles, 16 of which can be accessed free at:

P<P Published online December 23, 2011 in advance of the print journal.

serviceEmail alerting

the box at the top right corner of the online article.Receive free email alerts when new articles cite this article. Sign up in

Notes

(DOIs) and date of initial publication. publication. Citations to Advance online articles must include the digital object identifier citable and establish publication priority; they are indexed by PubMed from initialtypeset, but have not not yet appeared in the paper journal. Advance online articles are Advance online articles have been peer reviewed, accepted for publication, edited and

http://group.bmj.com/group/rights-licensing/permissionsTo request permissions go to:

http://journals.bmj.com/cgi/reprintformTo order reprints go to:

http://group.bmj.com/subscribe/To subscribe to BMJ go to:

group.bmj.com on December 28, 2011 - Published by gut.bmj.comDownloaded from