Top Banner
Introduction to RNA Interference (RNAi) Technology Patipan Jaipeng (DVM) 1
22

Introduction to RNA Interference (RNAi) Technology · 2017-02-10 · Introduction to RNA Interference (RNAi) Technology MicroRNA mechanism in mammalian cells Nucleus Cytoplasm pri-miRNA

Mar 18, 2020

Download

Documents

dariahiddleston
Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Page 1: Introduction to RNA Interference (RNAi) Technology · 2017-02-10 · Introduction to RNA Interference (RNAi) Technology MicroRNA mechanism in mammalian cells Nucleus Cytoplasm pri-miRNA

Introduction to RNA Interference (RNAi)

Technology

Patipan Jaipeng (DVM)

1

Page 2: Introduction to RNA Interference (RNAi) Technology · 2017-02-10 · Introduction to RNA Interference (RNAi) Technology MicroRNA mechanism in mammalian cells Nucleus Cytoplasm pri-miRNA

Introduction to RNA Interference (RNAi) Technology

The Central dogma of molecular genetic- Replication- Transcription- Translation

Replication

Transcription Translation

2

DNA RNA Protein

Page 3: Introduction to RNA Interference (RNAi) Technology · 2017-02-10 · Introduction to RNA Interference (RNAi) Technology MicroRNA mechanism in mammalian cells Nucleus Cytoplasm pri-miRNA

Introduction to RNA Interference (RNAi) Technology

Study of gene function- Forward genetic (Mutation phenotype Mutant allele Gene

or Protein sequence)- Reverse genetic (Gene or Protein sequence Mutant allele

Mutant phenotype) Gene replacement or gene knockout [1st recorded in 1989]

Gene silencing or RNA interference [1st recorded in 1998]

CRISPR/Cas9 and Targeted Genome Editing [Function confirmed in

2007]

They were awarded the 2007 Nobel Prize in Physiology or Medicine

They were awarded the 2006 Nobel Prize in Physiology or Medicine 3

Page 4: Introduction to RNA Interference (RNAi) Technology · 2017-02-10 · Introduction to RNA Interference (RNAi) Technology MicroRNA mechanism in mammalian cells Nucleus Cytoplasm pri-miRNA

RNA interference (RNAi) - Phenotypic effect after injection of single-stranded or double-stranded unc-22

RNA into the gonad of C. elegans. - The unc-22 gene encodes a myofilament protein. - Decrease in unc-22 activity is known to produce severe twitching movements.

- Injected double-stranded RNA, but not single-stranded RNA, induced the twitching phenotype in the progeny.

Introduction to RNA Interference (RNAi) Technology

unc-22 RNA

4

Page 5: Introduction to RNA Interference (RNAi) Technology · 2017-02-10 · Introduction to RNA Interference (RNAi) Technology MicroRNA mechanism in mammalian cells Nucleus Cytoplasm pri-miRNA

Introduction to RNA Interference (RNAi) Technology

What are sense strand and antisense strand ?

5

Sense DNA strandAnti-sense DNA strandSense RNA strand

Sense DNA strandAnti-sense DNA strand (Template)

Sense DNA strandAnti-sense DNA strand

Sense RNA strand

Anti-sense RNA strand

mRNA

Transcription

Page 6: Introduction to RNA Interference (RNAi) Technology · 2017-02-10 · Introduction to RNA Interference (RNAi) Technology MicroRNA mechanism in mammalian cells Nucleus Cytoplasm pri-miRNA

Introduction to RNA Interference (RNAi) Technology

6

dsRNA

Anti-sense RNA

Sense RNA

Anti-sense RNA is complementary to mRNA

mRNAProtein

Anti-sense RNA

The anti-sense RNA hybridizes to the mRNA mRNA degradation or blocking translation

DNA

RNA interference (RNAi)- Anti-sense RNA mechanism (concept)

Page 7: Introduction to RNA Interference (RNAi) Technology · 2017-02-10 · Introduction to RNA Interference (RNAi) Technology MicroRNA mechanism in mammalian cells Nucleus Cytoplasm pri-miRNA

Introduction to RNA Interference (RNAi) Technology

RNA interference (RNAi) - RNA interference is a posttranscriptional specific gene silencing

(PTGS) pathway or specific gene knockdown mechanism in eukaryotes.

- Double strand RNA (dsRNA)- Degradation or translation inhibition of the mRNA target

RNA interference (RNAi) application- Basic research (Gene function)- Medicine (Tumor suppression, Antiviral replication)- Agriculture technology

7

Page 8: Introduction to RNA Interference (RNAi) Technology · 2017-02-10 · Introduction to RNA Interference (RNAi) Technology MicroRNA mechanism in mammalian cells Nucleus Cytoplasm pri-miRNA

Introduction to RNA Interference (RNAi) Technology

Main Type of RNA interference (origin, structure) MicroRNA (miRNA) Small interfering RNA (siRNA) Piwi-interacting RNA (piRNA); (functional most clearly in germline)

8

siRNA (Small interfering RNA)

miRNA (Micro RNA)

Page 9: Introduction to RNA Interference (RNAi) Technology · 2017-02-10 · Introduction to RNA Interference (RNAi) Technology MicroRNA mechanism in mammalian cells Nucleus Cytoplasm pri-miRNA

Introduction to RNA Interference (RNAi) Technology

MicroRNA biogenesis Nearly 97% of the human genome is composed of non-coding DNA. Numerous non-coding DNA have been recently found to encode

miRNAs (Lin et al., 2006)

9

miRNA (Micro RNA)

Page 10: Introduction to RNA Interference (RNAi) Technology · 2017-02-10 · Introduction to RNA Interference (RNAi) Technology MicroRNA mechanism in mammalian cells Nucleus Cytoplasm pri-miRNA

Introduction to RNA Interference (RNAi) Technology

MicroRNA biogenesis in mammalian cells

(Lin et al., 2006)10

Page 11: Introduction to RNA Interference (RNAi) Technology · 2017-02-10 · Introduction to RNA Interference (RNAi) Technology MicroRNA mechanism in mammalian cells Nucleus Cytoplasm pri-miRNA

Monocistronic miRNA

Dicistronic miRNA

Polycistronic miRNA

Transcription (RNA pol II)

Monocistronic pri-miRNA

Dicistronic pri-miRNA

Polycistronic pri-miRNA

m7Gppp AAA m7Gppp AAA m7Gppp AAA

Cleavage Dorsha

5’P OH

5’P OH

5’P OH

5’P OH5’P OH 5’P OH

Nucleus

CytoplasmExportin-5

*Imperfectly base-paired hairpins

Introduction to RNA Interference (RNAi) Technology

MicroRNA biogenesis in mammalian cells

Sarnow et al. Nature Reviews Microbiology 4, 651–659 (September 2006) | doi:10.1038/nrmicro147311

pre-miRNA (70-100 nt)

Page 12: Introduction to RNA Interference (RNAi) Technology · 2017-02-10 · Introduction to RNA Interference (RNAi) Technology MicroRNA mechanism in mammalian cells Nucleus Cytoplasm pri-miRNA

Introduction to RNA Interference (RNAi) Technology

MicroRNA mechanism in mammalian cells

Nucleus

Cytoplasm

pri-miRNA pre-miRNA (70-100 nt)

Exportin-5

miRNA (19-23 nt)

RISC assembly

Anti-sense miRNA

Sense miRNA

miRNA gene

RNA pol II

pre-miRNA

12

(passenger strand)

Dicer AGO

TRBP PACT

Helicase

DicerAGO

TRBPPACT

Target mRNA DicerAGO

TRBPPACT

Dorsha

Dicer

TRPB

TRPB: TAR RNA binding proteinRISC: RNA induced silencing complex

PACT: Protein activator of PKRAGO: Argonaute protein; guide strand recognition

RISC

Translation inhibition or mRNA cleavage

degrade

Mature-

Page 13: Introduction to RNA Interference (RNAi) Technology · 2017-02-10 · Introduction to RNA Interference (RNAi) Technology MicroRNA mechanism in mammalian cells Nucleus Cytoplasm pri-miRNA

Introduction to RNA Interference (RNAi) Technology

Step of an RNAi experimenti. RNAi design

GenBank®; nucleotide sequence database DNA Sequencing

13

Page 14: Introduction to RNA Interference (RNAi) Technology · 2017-02-10 · Introduction to RNA Interference (RNAi) Technology MicroRNA mechanism in mammalian cells Nucleus Cytoplasm pri-miRNA

Introduction to RNA Interference (RNAi) Technology

Step of an RNAi experimenti. RNAi design

Non-vector base RNAi (synthetic siRNA/Long dsRNA); A, B Vector base RNAi (synthetic shRNA; short-hairpin RNA) C, D

14

(A) Synthetic siRNA (B) Long dsRNA (C) Plasmid-based shRNA vector

(D) Virus-based shRNA vector

Mammalian cell

siRNA (19-23 nt)

RISC assembly

Target mRNA

Dicer

sene

senepromoter

Page 15: Introduction to RNA Interference (RNAi) Technology · 2017-02-10 · Introduction to RNA Interference (RNAi) Technology MicroRNA mechanism in mammalian cells Nucleus Cytoplasm pri-miRNA

Introduction to RNA Interference (RNAi) Technology

Step of an RNAi experimenti. RNAi design

Long double-stranded RNA

15

In-vitro transcription double-stranded RNA1. Target gene2. Primer design; contained T7

promoter (GAATTAATACGACTCACTATAGGGAGA)

3. PCR amplification for making DNA template

4. Synthetic dsRNA in a tube at 37˚C for overnight

5. Long-dsRNA purification

T7 promoterT7 promoter

DNA template

T7 promoterT7 promoter

Transcribe with T7 RNA Polymerase

DNA template

ssRNA

dsRNA

Page 16: Introduction to RNA Interference (RNAi) Technology · 2017-02-10 · Introduction to RNA Interference (RNAi) Technology MicroRNA mechanism in mammalian cells Nucleus Cytoplasm pri-miRNA

Introduction to RNA Interference (RNAi) Technology

Step of an RNAi experimenti. RNAi design

RNAi design; online tool

16

Page 17: Introduction to RNA Interference (RNAi) Technology · 2017-02-10 · Introduction to RNA Interference (RNAi) Technology MicroRNA mechanism in mammalian cells Nucleus Cytoplasm pri-miRNA

Introduction to RNA Interference (RNAi) Technology

Step of an RNAi experimentii. Delivery system

Micro-injection; in worm and animal model Feeding of artificial diet; in worm model Soaking; in worm model Transfection; in cell culture model Viral transduction; in cell culture and animal model Electroporation; in cell culture model Inhalation; in animal model

17

Page 18: Introduction to RNA Interference (RNAi) Technology · 2017-02-10 · Introduction to RNA Interference (RNAi) Technology MicroRNA mechanism in mammalian cells Nucleus Cytoplasm pri-miRNA

Introduction to RNA Interference (RNAi) Technology

Step of an RNAi experimentii. Delivery system

Transfection; in cell culture and animal model• Chemically modified structure of nucleic acid

Enhanced stability (resistance to nuclease activity) Higher target specificity

• Ligand-based targeting molecule High affinity for cell specific targeting

• Lipid-based delivery Protection for nuclease degradation

18

Page 19: Introduction to RNA Interference (RNAi) Technology · 2017-02-10 · Introduction to RNA Interference (RNAi) Technology MicroRNA mechanism in mammalian cells Nucleus Cytoplasm pri-miRNA

Introduction to RNA Interference (RNAi) Technology

Step of an RNAi experimentii. Delivery system

Aptamer-conjugated siRNA

Cholesterol-conjugated siRNA

Necked siRNA

19

Direct injection (Ex. Ocular, CNS system)

Direct injection (Ex. Intra-tumor)

Systemic administration (Ex. Target: hepatocyte)

Page 20: Introduction to RNA Interference (RNAi) Technology · 2017-02-10 · Introduction to RNA Interference (RNAi) Technology MicroRNA mechanism in mammalian cells Nucleus Cytoplasm pri-miRNA

Introduction to RNA Interference (RNAi) Technology

Step of an RNAi experimentii. Delivery system

Liposome formulated siRNA Antibody-protamine complex siRNA

PEG: polyethylene glycol 20

Systemic administration

Systemic administration(Specific cell expressed surface protein)

Page 21: Introduction to RNA Interference (RNAi) Technology · 2017-02-10 · Introduction to RNA Interference (RNAi) Technology MicroRNA mechanism in mammalian cells Nucleus Cytoplasm pri-miRNA

Introduction to RNA Interference (RNAi) Technology

Step of an RNAi experimentiii. Validation and measurement

#Phenotypic analysis

21

Page 22: Introduction to RNA Interference (RNAi) Technology · 2017-02-10 · Introduction to RNA Interference (RNAi) Technology MicroRNA mechanism in mammalian cells Nucleus Cytoplasm pri-miRNA

Thank you for your attention

22