Genetic diversity and safety aspects of enterococci from slightly fermented sausages

Genetic diversity and safety aspects of enterococci fromslightly fermented sausages

B. Martin1, M. Garriga1, M. Hugas2 and T. Aymerich1

1IRTA, Meat Technology Centre, Granja Camps i Armet, Girona, Spain, and 2European Food Safety Authority (EFSA), Bruxelles,

Belgium

2004/1134: received 28 September 2004, revised 16 November 2004 and accepted 23 November 2004

ABSTRACT

B. MARTIN, M. GARRIGA, M. HUGAS AND T. AYMERICH. 2005.

Aims: To determine the biodiversity of enterococci from slightly fermented sausages (chorizo and fuet) at species

and strain level by molecular typing, while considering their safety aspects.

Methods and Results: Species-specific PCR and partial sequencing of 16S rRNA and sodA genes were used to

identify enterococcal population. Enterococcus faecium was the most frequently isolated species followed by E.faecalis, E. hirae and E. durans. Randomly amplified polymorphic DNA (RAPD)-PCR revealed species-specific

clusters and allowed strain typing. Sixty strains of 106 isolates exhibited different RAPD profiles indicating a high

genetic variability. All the E. faecalis strains carried virulence genes (efaAfs, esp, agg and gelE) and all E. faeciumisolates carried efaAfm gene. Enterococcus faecalis showed higher antibiotic resistance than the other species. Only

one E. faecium strain showed vanA genotype (high-level resistance to glycopeptides) and E. gallinarum and E.casseliflavus/flavescens isolates showed vanC1 and vanC2/C3 genotypes (low-level resistance only to vancomycin)

respectively.

Conclusions: E. faecalis has been mainly associated with virulence factors and antimicrobial multi-resistance and,

although potential risk for human health is low, the presence of this species in slightly fermented sausages should be

avoided to obtain high quality products.

Significance and Impact of the Study: The enterococcal population of slightly fermented sausages has been

thoroughly characterized. Several relevant safety aspects have been revealed.

Keywords: antibiotic resistance, enterococci, fermented sausages, RAPD-PCR, virulence genes.

INTRODUCTION

Enterococci are ubiquitous micro-organisms that inhabit the

gastrointestinal tract of humans and animals. They are

frequently isolated from fermented meat products with

counts up to 105 CFU g)1 (Teuber et al. 1999; Aymerich

et al. 2003) because of their tolerance to sodium chloride and

nitrite allowing them to survive, and even to multiply, during

fermentation (Giraffa 2002). Their presence in foods is highly

controversial; while some authors consider them undesirable,

indicators of faecal contamination and responsible for the

spoilage of meat products (Franz et al. 1999), others reporttheir important role in flavour development of cheeses,

bioprotection in dairy and meat products and benefits as

probiotics (Coppola et al. 1988; Centeno et al. 1996; Ayme-

rich et al. 2000). In recent decades, although food-borne

enterococci have not yet been clearly proved to be the direct

cause of clinical infections (Adams 1999), enterococci have

unfortunately acquired clinical relevance. They have become

the third cause of nosocomial diseases causing urinary tract

infections, bacteraemia and endocarditis (CDCNNIS System

1998) Enterococcus faecalis has been implicated in 80% of the

cases and E. faecium in 15–20% (Morrison et al. 1997).Virulence mechanisms of enterococci are not com-

pletely known but enterococcal virulence factors includingCorrespondence to: Teresa Aymerich, IRTA, Meat Technology Centre, Granja

Camps i Armet, 17121 Monells, Spain (e-mail: [email protected]).

ª 2005 The Society for Applied Microbiology

Journal of Applied Microbiology 2005, 98, 1177–1190 doi:10.1111/j.1365-2672.2005.02555.x

adherence to host tissue, invasion and abscess formation,

resistance to and modulation of host defence mechanisms,

secretion of cytolysins and production of plasmid-encoded

pheromones have been reported (Jett et al. 1994; Dunny

et al. 1995; Lowe et al. 1995; Singh et al. 1998; Haas and

Gilmore 1999; Shankar et al. 1999).The resistance of enterococci to a wide variety of anti-

microbials contributes to enterococci pathogenicity and

impedes medical treatment of enterococcal infections (Mur-

ray 1990; Mundy et al. 2000). Their ability of gene exchangeby conjugation (Clewell 1990; Franz et al. 1999) may spread

antibiotic resistance and virulence factors between enterococci

or some other pathogenic bacteria (Leclercq et al. 1989;Noble

et al. 1992; Cocconcelli et al. 2003).Vancomycin-resistant

enterococci (VRE) are the main cause of concern, as

enterococci are resistant to many antibiotics and vancomycin

is one of the last options for antimicrobial therapy in some

infections by Gram-positive bacteria (Wegener et al. 1999).The discovery of genes for vancomycin and other antibiotic

resistances in plasmids and transposons (Murray 1990;

Leclercq 1997) increased the concern. Virulence factors have

been found in food strains (Eaton and Gasson 2001; Franz

et al. 2001; Semedo et al. 2003) and antibiotic-resistant

enterococci seem to be widespread in raw food (Giraffa

2002) and have also been isolated from dairy products, ready-

to-eat foods and meat products (Quednau et al. 1998; Teuberet al. 1999; Giraffa et al. 2000; Baumgartner et al. 2001).Accurate species identification and strain typing is

important to evaluate the genetic diversity among entero-

cocci populations and to select nonpathogenic bacteria for

further use in food technology and probiotics (Franz et al.1999; Giraffa 2002). Species identification in routine and

clinical laboratories uses mainly phenotypic methods (Dev-

riese et al. 1996). Nevertheless these methods are often

unreliable and can take several days (Cheng et al. 1997).Several molecular approaches have been developed as an

alternative to facilitate reliable identification of enterococcal

species, such as SDS-PAGE of whole cell proteins (Des-

cheemaeker et al. 1997; Devriese et al. 2002), PCR-basedmethods (Dutka-Malen et al. 1995) and sequenciation of

sodA and 16S rRNA genes (Poyart et al. 2000; Angeletti

et al. 2001).Genetic typing techniques, such as plasmid profiling

(Farber et al. 1996), pulsed-field gel electrophoresis of DNA

macro-restriction patterns (Descheemaeker et al. 1997;

Vancanneyt et al. 2002), randomly amplified polymorphic

DNA (RAPD)-PCR (Cocconcelli et al. 1995; Descheemae-

ker et al. 1997) and amplified fragment length polymor-

phisms (Antonishyn et al. 2000; Vancanneyt et al. 2002)

have been widely used to characterize clinical and dairy

isolates of enterococci.

The aim of this study was to analyse the biodiversity of

enterococci present in slightly fermented sausages at species

and strain level, the incidence of several virulence traits and

their antibiotic susceptibility.

MATERIALS AND METHODS

Bacterial strains and culture conditions

Reference strains listed in Table 1 were obtained from

Spanish Type Culture Collection (CECT) and from our

own collection (CTC Meat Technology Center). All strains

were grown in tryptic soya broth (Difco Laboratories,

Detroit, MI, USA) with 0Æ6% yeast extract (TSBYE) at

37�C for 24 h under anaerobic conditions (Oxoid jars with

AnaeroGen; Oxoid, Basingstoke, UK).

Enterococcal strains isolation

Twelve samples of commercial slightly fermented sausages

(pH 5Æ3–6Æ2), six fuets (cold ripened fermented sausages

with black pepper) and six chorizos (cold ripened fermented

sausages with paprika and garlic) from different producers

were purchased at local butchers/supermarkets.

After removal of the casing, 10 g of each sample were

homogenized in 90 ml of 0Æ1% peptone (Difco) and

0Æ85% NaCl (Merck, Darsmstadt, Germany), pH 7Æ0, in a

Stomacher Lab-Blender (model 400; Cooke Laboratories,

Table 1 Reference strains used in this study

Reference strain

Virulence

determinants Origin and/or comment

Enterococcus

faecium CECT410

efaAfm+ Equivalent to ATCC 19434.

Type strain

Enterococcus

faecium CTC492

efaAfm+ Fermented sausages

Enterococcus

faecium CTC496

efaAfm+ Fermented sausages

Enterococcus

faecalis CECT481

efaAfs+

gelE+ esp+Equivalent to ATCC 19433

Enterococcus

faecalis CECT184

efaAfs+

gelE+ agg+Equivalent to ATCC 27285.

Isolated from cheese

Enterococcus

faecalis CECT795

– Equivalent to ATCC 29212.

Control strain for antibiotic

testing

Lactobacillus

sakei CTC494

– Fermented sausages. Used as

negative control

Lactobacillus

curvatus CTC371

– Fermented sausages. Used as

negative control

Lactobacillus

plantarum CTC305

– Fermented sausages. Used as

negative control

efaAfm, efaAfs: cell wall adhesin EfaA for Enterococcus faecium and E.

faecalis respectively; gelE: gene encoding gelatinase; esp: gene encoding

surface protein Esp; agg: gene encoding aggregation protein.

1178 B. MARTIN ET AL.

ª 2005 The Society for Applied Microbiology, Journal of Applied Microbiology, 98, 1177–1190, doi:10.1111/j.1365-2672.2005.02555.x

Alexandria, VA, USA), pour-plated in kanamycin-esculin-

azide agar (Oxoid) and incubated for 24 h at 37�C.Twelve colonies showing typical morphology from each

sample were randomly picked and grown in plate counting

agar for 24 h at 37�C. In samples with low counts of

enterococci (<10 colonies per plate) all colonies were

picked. Isolates able to agglutinate with latex (Slidex

Strepto B. BioMerieux, Marcy L’Etoile, France) were

grown overnight in TSBYE and stored at )80�C after

addition of 20% of glycerol.

Enterococcal DNA extraction

Genomic DNA from all strains was extracted from

overnight TSBYE cultures using the DNeasy tissue kit

(Qiagen, Hilden, Germany) following manufacturer’s rec-

ommendations. DNA was quantified using the GeneQuant

RNA/DNA Calculator (Amersham Biosciences, Uppsala,

Sweden), adjusted at 0Æ1 mg ml)1 and stored at )20�C.

Identification of recovered isolates

Determination of enterococci at genus level was assessed by

PCR amplification of tuf gene (elongation factor EF-Tu) as

previously described (Ke et al. 1999).Identification of E. faecium and E. faecalis species was

carried out by ddl multiplex-PCR amplification as reported

by Dutka-Malen et al. (1995). A standard PCR was

performed in a final volume of 25 ll containing 20 mmol l)1

Tris–HCl (pH8Æ0), 50 mmol l)1 KCl, 1Æ5 mmol l)1 MgCl2,

0Æ4 mmol l)1 of each dNTP (Promega, Madison, WI, USA),

0Æ2 lmol l)1 of each primer (Table 2) and 1 U of Taqpolymerase (Roche Molecular Biochemicals, Indianapolis,

IN, USA). Thermal cycling was carried out in the

Table 2 List of primers used in this study

Primer Sequence (5¢–3¢) Target gene Reference

Ent1 TACTGACAAACCATTCATGATG tuf Ke et al. (1999)

Ent2 AACTTCGTCACCAACGCGAAC

EFM1 GCAAGGCTTCTTAGAGA E. faecium ddl Dutka-Malen et al. (1995)

EFM2 CATCGTGTAAGCTAACTTC

EFK1 ATCAAGTACAGTTAGTCTT E. faecalis ddl Dutka-Malen et al. (1995)

EFK2 ACGATTCAAAGCTAACTG

BSF8 AGAGTTTGATCATGGCTCAG 16S rRNA

BSF 343 TACGGGAGGCAGCAG

BSF1541 AAGGAGGTGATCCAGCCGCA

sodA1 CCITAYICITAYGAYGCIYTIGARCC sodA Poyart et al. (2000)

sodA2 ARRTARTAIGCRTGYTCCCAIACRTC

vanA1 GGGAAAACGACAATTGC vanA Dutka-Malen et al. (1995)

vanA2 GTACAATGCGGCCGTTA

vanB1 ATGGGAAGCCGATAGTC vanB Dutka-Malen et al. (1995)

vanB2 GATTTCGTTCCTCGACC

vanC1-F GGTATCAAGGAAACCTC vanC1 Dutka-Malen et al. (1995)

vanC1-R CTTCCGCCATCATAGCT

vanC2/C3-F CTCCTACGATTCTCTTG vanC2/C3 Dutka-Malen et al. (1995)

vanC2/C3-R CGAGCAAGACCTTTAAG

esp1 TTGCTAATGCTAGTCCACGACC esp Eaton and Gasson (2001)

esp2 GCGTCAACACTTGCATTGCCGAA

agg1 AAGAAAAAGAAGTAGACCAAC agg Eaton and Gasson (2001)

agg2 AAACGGCAAGACAAGTAAATA

gelE1 ACCCCGTATCATTGGTTT gelE Eaton and Gasson (2001)

gelE2 ACGCATTGCTTTTCCATC

efaAfs1 GACAGACCCTCACGAATA efaAfs Eaton and Gasson (2001)

efaAfs2 AGTTCATCATGCTGTAGTA

efaAfm1 AACAGATCCGCATGAATA efaAfm Eaton and Gasson (2001)

efaAfm2 CATTTCATCATCTGATAGTA

R1 GGTGCGGGAA Random primer

R2 GTTTCGCTCC Random primer

R5 AACGCGCAAC Random primer

M13R2 GGAAACAGCTATGACCATGA Random primer

BIODIVERSITY OF ENTEROCOCCI FROM FERMENTED SAUSAGES 1179

ª 2005 The Society for Applied Microbiology, Journal of Applied Microbiology, 98, 1177–1190, doi:10.1111/j.1365-2672.2005.02555.x

GeneAmp PCR System 2700 (Applied Biosystems, Foster

City, CA, USA) using the following programme: initial

denaturation at 94�C for 2 min; 30 cycles of denaturation at

94�C for 1 min, annealing at 54�C for 1 min and extension

at 74�C for 1 min; ending with a final extension at 74�C for

5 min.

The other enterococcal species were identified by partial

sequenciation of 16S rRNA gene and sodA gene. PCR

amplification of V1–V3 regions of 16S rRNA gene was

assessed by oligonucleotides BSF8 and BSF1541 (Table 2).

The standard PCR reaction was used except for an annealing

temperature of 50�C and an elongation step of 1Æ5 min DNA

was purified with GeneClean kit II (Bio 101, La Jolla, CA,

USA). DNA was sequenced by using the BigDye Termi-

nator v3Æ1 cycle sequencing kit, the oligonucleotides BSF8,

BSF343 (Table 2) and BSR1541 and the sequencing device

ABI PRISM 310 (Applied Biosystems). The sodA gene was

partially sequenced as previously described by Poyart et al.(2000). The BLAST-W2 and ClustalW software from the

European Bioinformatics Institute (Wellcome Trust Gen-

ome Campus, Hinxton, UK. Web site: http://www.ebi.

ac.uk) was used for the analysis of sequences.

PCR amplification of virulence genes

Primers used for the amplification of genes esp (surface

protein gene), agg (aggregation substance gene), gelE (coding

for gelatinase), efaAfs and afaAfm (genes coding for cell wall

adhesins in E. faecalis and E. faecium respectively) were

those described by Eaton and Gasson (2001) (Table 2). PCR

conditions were the same as described in the standard PCR

except for annealing temperature (50�C for efaAfm, 55�C for

efaAfs, 56�C for agg, 60�C for gelE and 61�C for esp). AllPCR performances included positive and negative control

strains (Table 1).

Antibiotic susceptibility testing

Susceptibility testing was based on the agar overlay disc

diffusion test described by Charteris et al. (1998) with some

modifications. Enterococci were grown overnight in TSBYE

at 37�C under anaerobic conditions (Oxoid jars with

AnaeroGen; Oxoid). Eight millilitres of Mueller–Hinton

Agar (MHA, Oxoid) kept at 50�C were inoculated with

0Æ2 ml of the grown culture. Petri dishes containing 15 ml of

MHA were overlaid with 7Æ2 ml of the inoculated MHA and

allowed to solidify at room temperature. Antibiotic discs

(Oxoid) were placed onto the overlaid plates and all plates

were incubated for 20–24 h at 37�C under anaerobic

conditions. All enterococcal recovered isolates were screened

for their susceptibility to ampicillin (10 lg), chloramphen-

icol (30 lg), ciprofloxacin (5 lg), gentamicin (120 lg),erythromycin (15 lg), linezolid (30 lg), nitrofurantoin

(300 lg), penicillin G (10 U), quinupristin/dalfopristin

(15 lg), rifampicin (5 lg), teicoplanin (30 lg), tetracycline(30 lg) and vancomycin (30 lg). The results were inter-

preted following the recommendations of the National

Committee for Clinical Laboratory Standards (NCCLS

2002). Enterococcus faecalis CECT795 (equivalent to

ATCC29212) was used as the control strain for monitoring

the performance of the study conditions.

PCR amplification of van genes

In addition to the disc diffusion test, high and low-level

resistance to glycopeptides was confirmed using the PCR

protocol described by Dutka-Malen et al. (1995) with the

specific primers for the genes vanA, vanB, vanC1 and

vanC2/C3 (Table 2). Two separate PCR amplifications were

carried out, one to detect vanA and vanB genotypes and

another for vanC1 and vanC2/C3 in order to avoid

interferences due to the high number of primers. PCR

mixtures and amplification programmes were the same as

described in the standard PCR except for annealing

temperature (57�C for vanA-vanB and 55�C for vanC1-vanC2/C3) and number of cycles (25).

RAPD-PCR

Four random primers (R1, R2, R5 and M13R2; Table 2)

were tested for their ability to discriminate between strains

of enterococci and for their reproducibility. Primers R5 and

M13R2 showed higher discrimination capacity and they

were selected for RAPD-PCR analysis. Each 25-ll PCR mix

contained 20 mmol l)1 Tris–HCl (pH 8Æ0), 50 mmol l)1

KCl, 1Æ5 mmol l)1 MgCl2 (2Æ5 mmol l)1 when primers R1,

R2 and R5 were used), 0Æ2 mmol l)1 of each dNTP,

0Æ8 lmol l)1 of primer, 2 U of Taq polymerase and 100 ng

of extracted DNA. When primers R1, R2 and R5 were used

the amplification process consisted of 5 min of initial

denaturation at 94�C and 40 cycles consisting of denatur-

ation at 94�C for 1 min, and 40 cycles of denaturation at

94�C for 1 min, annealing at 29�C for 1Æ5 min and

elongation at 72�C for 2 min, followed by a final extension

of 5 min at 74�C. With primer M13R2, 35 cycles were

performed, each consisting of 1 min of denaturation at

94�C, 1 min of annealing at 38�C and elongation at 72�C for

1 min.

After amplification, 10 ll of PCR product were mixed

with 1 ll of loading buffer (40% sucrose, 0Æ25% bromo-

phenol blue) and subjected to agarose electrophoresis for

100 min at 80 mA. Gels were stained with 0Æ1 lg ml)1

ethidium bromide (Sigma Chemical Comp., MO, USA).

Each gel contained two lines of 1 kb DNA ladder

(Invitrogen, Merelbeke, Belgium) as molecular weight

and normalization gel standards. The banding profiles

1180 B. MARTIN ET AL.

ª 2005 The Society for Applied Microbiology, Journal of Applied Microbiology, 98, 1177–1190, doi:10.1111/j.1365-2672.2005.02555.x

were visualized under u.v. light and digitalized by the

Gelprinter photodocumentation equipment (TDI, Barce-

lona, Spain).

Clustering analysis

Relevant safety traits (antibiotic resistance and presence of

virulence factors) and RAPD-PCR electrophoretic profiles

were analysed using the software Fingerprinting II Infor-

matix (Bio-Rad Laboratories, Hercules, CA, USA). Safety

traits were recorded as �1� or �0� if positive or negative

respectively. The similarity matrix was defined by the

Simple Matching coefficient and cluster analysis were

carried out by the unweighted pair group method with

arithmetic averages (UPMGA).

For RAPD-PCR electrophoretic profiles, conversion,

normalization and analysis were performed by the software

package Fingerprinting II Informatix (Bio-Rad). RAPD

profiles of both primers were combined and compared using

the Dice coefficient; correlation coefficients were calculated

by the UPMGA.

RESULTS

Identification of recovered isolates

A total of 115 strains were isolated from fermented sausages.

Among them, 106 strains were assigned to the genus

Enterococcus on the basis of genus-specific PCR identifica-

tion. Nine strains were identified as Pediococcus pentosaceus(five strains) and P. acidilactici (four strains) by 16S rRNA

gene sequencing (data not shown). The enterococcal isolates,

48 from chorizo and 58 from fuet, were subjected to species

identification by species-specific multiplex-PCR, partial

sequencing of 16S rRNA gene and sodA sequencing.

Multiplex-PCR allowed the identification of all E. faecium(51Æ9% of the isolates) and E. faecalis strains (14Æ2% of the

isolates). Partial 16S rRNA gene and sodA gene sequencing

identified the remaining strains. About 13Æ2% of isolates

were assigned to E. hirae and E. durans each, 5Æ7% to

E. casseliflavus/flavescens, 0Æ94% to E. mundtii and 0Æ94% to

E. gallinarum.Comparing the two types of sausages studied, E. faecium,

with 69% of the isolates, was dominant in fuet while E. hiraeand E. durans represented 17Æ2 and 10Æ3% respectively. Only

3Æ4% were allotted to E. faecalis. Chorizo showed more

enterococcal species diversity. Enterococcus faecium and

E. faecalis were balanced representing 31Æ3 and 27Æ1% of

isolates respectively. Enterococcus durans, E. casseliflavus/flavescens and E. hirae comprised 16Æ7, 12Æ5 and 8Æ3% of the

chorizo isolates. Only one strain from chorizo was identified

as E. mundtii (2Æ1%) and another one as E. gallinarum(2Æ1%).

RAPD-PCR typing

To study intraspecies diversity of enterococci isolated from

fermented sausages all strains were subjected to RAPD-PCR

analysis with two different primers, M13R2 and R5 (Fig. 1).

The reproducibility of RAPD-PCR assay and running

conditions estimated by analysis of repeated DNA extracts

of several type strains was >92% (results not shown).

After numerical analyses of the combined RAPD-PCR

profiles of the two primers used, 60 different patterns were

obtained (Fig. 2). When the similarity value of 92% was

considered, 56 strains of 106 could be differentiated. Ten

RAPD clusters were defined at a similarity level of 50% and

eight species-specific clusters were found. Cluster I grouped

all E. casseliflavus/flavescens strains (5Æ7% of isolates)

although they were distributed in two different subgroups.

Cluster II contained all but one E. faecalis strains (13Æ2% of

isolates). Cluster V grouped all E. durans strains (13Æ2% of

isolates). cluster VI included only one strain assigned to E.gallinarum species and cluster VII grouped all E. hiraestrains (13Æ2% of isolates). All E. faecium isolates, except for

three single strains, were grouped in clusters VIII and IX.

Cluster VIII was composed of 11 different profiles distri-

buted in two subgroups defined at a similarity level of 60%.

This cluster included 17 E. faecium strains (16% of isolates).

Cluster IX was the major RAPD group as it included 35 E.faecium isolates (33% of isolates). This cluster was composed

of 20 profiles also distributed in two subgroups defined at a

similarity level of 60%. Cluster X comprised only the isolate

assigned to the species E. mundtii. The remaining clusters

(III and IV) contained the strains that did not group in their

corresponding species cluster. Cluster III contained two

isolates of E. faecium (including the vanA+ E. faecium) andone E. faecalis isolate. Cluster IV comprised one single

isolate of E. faecium.The isolates from fuet and chorizo did not form separated

RAPD clusters. Genotypic grouping was compared with

potentially pathogenic traits and antibiotic resistance of E.faecium strains. The three E. faecium isolates containing all

virulence genes studied were clustered in the same subgroup

of cluster VII. Multi-resistant strains were distributed in

several RAPD groups.

Incidence and distribution of virulencedeterminants

A molecular screening of the genes encoding virulence

factors revealed distinct trends in the occurrence of

virulence between species. Enterococcus faecium and E.faecalis strains carried the virulent-associated genes (efa,esp, agg, gelE) while the other species were clear of them.

All E. faecalis and all E. faecium carried the gene encoding

for efaAfs and efaAfm respectively. All E. faecalis strains

BIODIVERSITY OF ENTEROCOCCI FROM FERMENTED SAUSAGES 1181

ª 2005 The Society for Applied Microbiology, Journal of Applied Microbiology, 98, 1177–1190, doi:10.1111/j.1365-2672.2005.02555.x

carried the gelE gene (coding for gelatinase) and agg gene

while only 5Æ5% of E. faecium isolates harboured them.

About 99Æ3% of E. faecalis strains and 5Æ5% of E. faeciumisolates carried the esp gene.

A higher incidence of virulence determinants was observed

in enterococci from chorizo, due to its larger proportion of E.faecalis strains. The gelE, esp and agg genes were detected in

33Æ3%of isolates and efaAfm and efaAfs geneswere detected in31Æ3 and 27Æ1% of the chorizo strains respectively. In general,

enterococci from fuet presented fewer incidences of virulence

genes, as only 3Æ4% carried gelE, agg and efaAfs genes and1Æ7% carried esp gene. However, the gene encoding efaAfmadhesin was detected in 69Æ0% of isolates from fuet, due to the

large proportion of E. faecium strains in this product.

Antibiotic susceptibility

All enterococcal isolates were subjected to antibiotic

susceptibility testing towards 13 antibiotics using a modified

disc diffusion technique. Vancomycin resistance was con-

firmed by PCR. The prevalence of antibiotic resistance

among enterococcal species is shown in Table 3. A high

resistance to rifampicin was observed in all the enterococcal

species. About 100% of E. faecalis and E. durans isolates,92Æ9% of E. hirae, 83Æ3% of E. casseliflavus/flavescens and69Æ1% of E. faecium isolates presented resistance to

rifampicin. A high incidence of E. faecalis-resistant strainsto chloramphenicol (93Æ3%), erythromycin (93Æ3%) and

tetracycline (86Æ7%) was recorded. Enterococcus hirae strainsshowed an elevated incidence of resistance to ciprofloxacin

(71Æ4%) and nitrofurantoin (85Æ7%).

The disc diffusion test showed poor reliability for

vancomycin resistance as previously reported (Swenson

et al. 1989; Temmerman et al. 2003), four false negative and34 false positive were detected for vancomycin resistance

among enterococci from slightly fermented sausages. A very

low incidence of resistance to glycopeptides was found. The

presumptively vancomycin- and teicoplanin-resistant iso-

lates, obtained by the disc diffusion assay, were confirmed

by PCR amplification of van genes. Only one E. faecium

Fig. 1 RAPD-PCR profiles of enterococcal

strains obtained with primer M13R2 (a) and

primer R5 (b). Lanes 1–10: strains 14A, 14B,

14C, 14D, 14E, 14F, 14G, 14H, 14K and 14L;

lanes 11–16: strains 15A, 15B, 15C, 15D 15E

and 15F. M: 1 kb DNA ladder

1182 B. MARTIN ET AL.

ª 2005 The Society for Applied Microbiology, Journal of Applied Microbiology, 98, 1177–1190, doi:10.1111/j.1365-2672.2005.02555.x

strain (0Æ9%) showed vanA genotype that confers high-level

resistance to vancomycin and teicoplanin. The genes

encoding Van C type resistance, comprising low-level

resistance only to vancomycin, were also detected. All the

isolates belonging to E. casseliflavus/flavescens species (5Æ7%)

carried vanC2/C3 gene and the only isolate that could be

identified as E. gallinarum (0Æ9%) was vanC1 positive. None

of the enterococcal strains showed high-level resistance to

gentamicin.

None of the enterococcal strains tested were resistant to all

the antibiotics used in this study but multiple resistances

were observed. Most isolates (78Æ3%) were susceptible

35

M13+R5

40

45

50

55

60

65

70

75

80

85

90

95

10

0

E. mundtii

I

II

III

IV

V

VIII

IX

X

VI

VII

.10I

.10L

.10A

.10B

.10J

.17A

.17H

.12L

.17K

.4D

.14C

.14D

.10F

.17B

.9G

.12F

.4E

.4F

.4C

.3A

.3B

.10K

.15F

.15H

.15A

.17F

.17I

.9E

.11C

.9D

.12C

.4B

.

.11A

.11K

.11H

.12D

.15G

.15E

.15C

.15D

.11G

.12A

.14B

.14A

.14E

.14K

.11D

.11E

.16A

.11F

.13B

.10C

.10H

.2D

.2C

.2E

.11J

.13A

.10D

9B

E. cas/flavE. cas/flavE. cas/flavE. cas/flavE. cas/flavE. faecalisE. faecalisE. faecalisE. faecalisE. faecalisE. faecalisE. faecalis

E. faecalisE. faecium

E. faecium

E. faeciumE. faeciumE. faeciumE. faeciumE. faeciumE. faeciumE. faeciumE. faeciumE. faeciumE. faeciumE. faeciumE. faeciumE. faeciumE. faeciumE. faeciumE. faeciumE. faeciumE. faeciumE. faeciumE. faeciumE. faeciumE. faeciumE. faeciumE. faeciumE. faeciumE. faeciumE. faeciumE. faeciumE. faeciumE. faeciumE. faecium

E. faeciumE. duransE. duransE. duransE. duransE. duransE. gallinarumE. hiraeE. hiraeE. hiraeE. hiraeE. hiraeE. hirae

X

Fig. 2 Dendogram generated from RAPD-

PCR profiles of the 60 different RAPD-PCR

profiles obtained from the enterococcal iso-

lates studied. The scale indicates the similarity

level (Dice coefficient · 100). Profiles were

grouped using the UPMGA. The dashed line

marks the cut-off value at 50% arbitrarily

chosen to define RAPD groups within the

dendogram (lettered I to X)

BIODIVERSITY OF ENTEROCOCCI FROM FERMENTED SAUSAGES 1183

ª 2005 The Society for Applied Microbiology, Journal of Applied Microbiology, 98, 1177–1190, doi:10.1111/j.1365-2672.2005.02555.x

towards six to 10 of the antibiotics and 33% were susceptible

to nine or more antibiotics.

Clustering analysis of relevant safety traits

To study diversity of enterococcal isolates considering their

safety aspects, antibiotic susceptibility and presence or

absence of virulence genes were analysed using the Infor-

matix software from Bio-Rad. By combining all data, we

could differentiate 78 different patterns (Fig. 3) although

some of them showed similarity levels of 95% (differing only

in one trait). The isolates were grouped in four main groups

(A–D). Group A contained E. faecium and E. faecalis isolatespresenting genes associated to virulence traits. These strains

represented 16% of isolates and were distributed in 10

different patterns. The isolates were resistant towards six to

11 antibiotics and all of them showed resistance to

chloramphenicol, erythromycin and rifampicin. Group B

contained 57Æ5% of isolates distributed in 44 different

profiles. These strains were resistant towards one to six

antibiotics (one isolate was susceptible to all antibiotics

tested) and did not carry virulence genes, except for efaAfmin E. faecium isolates. This group included E. gallinarum and

E. casseliflavus/flavescens isolates that carried vanC1 and

vanC2/C3 genes respectively. Group C contained 16% of

isolates and included the vanA+ strain. All of them were

resistant towards six to 12 antibiotics and did not carry

virulence genes except for efaAfm in E. faecium strains. All

isolates were resistant to ampicillin, penicillin and rifampi-

cin. Group D contained 8Æ5% of enterococcal isolates, all

showing resistance towards four to seven antibiotics and

carrying efaAfm gene. All isolates were resistant to eryth-

romycin, penicillin and tetracycline. Two isolates were not

included in any of the four groups, one E. faecalis that didnot carry esp gene and was resistant to only three antibiotics

and one E. faecium that showed an intermediate profile

among groups B, C and D.

DISCUSSION

Identification of recovered isolates

As classical identification of enterococci by phenotypic

methods often gives ambiguous results, several molecular

methods have been developed as alternative tools to reliable

identification of Enterococcus species (Domig et al. 2003). Inthe present study, the identification of enterococci was

carried out by PCR amplification (Dutka-Malen et al. 1995),partial sequence analysis of 16S rRNA and sodA genes as

previously described (Poyart et al. 2000). PCR amplification

of ddl gene allowed the identification of all E. faecium and

E. faecalis strains. The gene sodA constituted a more

discriminative target sequence than 16S rRNA gene and

allowed differentiation of all enterococci except between

E. casseliflavus and E. flavescens which it was not possible to

discriminate. Partial 16S rRNA gene sequencing did not

complete the identification due to the high homology

between closely related enterococcal species. As reported

by Devriese and Pot (1995) and Descheemaeker et al.(1997), E. casseliflavus/flavescens could not even be separated

by SDS-PAGE of whole cell. It has been suggested that

E. flavescens should be considered as an E. casseliflavusbiovar rather than a separate species (Descheemaeker et al.1997).

Table 3 Prevalence of antibiotic-resistant enterococci isolated from slightly fermented sausages to selected antibiotics using disc diffusion test,

expressed as percentage

Antibiotic

Total strains

(n ¼ 106)

E. faecium

(n ¼ 55)

E. faecalis

(n ¼ 5)

E. hirae

(n ¼ 14)

E. durans

(n ¼ 14)

E. casseliflavus/

flavescens (n ¼ 6)

Ampicillin (10 lg) 27Æ4 30Æ9 13Æ3 14Æ3 57Æ1 0

Chloramphenicol (30 lg) 26Æ4 20 93Æ3 14Æ3 7Æ1 0

Ciprofloxacin (5 lg) 52Æ8 54Æ5 46Æ7 71Æ4 50 16Æ7Gentamicin (120 lg) 0 0 0 0 0 0

Erythromycin (15 lg) 50Æ9 56Æ4 93Æ3 35Æ7 8Æ6 0

Linezolid (30 lg) 32Æ1 21Æ8 40 28Æ6 57Æ1 50

Nitrofurantoin (300 lg) 50Æ9 52Æ7 33Æ3 85Æ7 42Æ9 33Æ3Penicillin G (10 U) 42Æ5 58Æ2 6Æ7 28Æ6 57Æ1 0

Quinupristin/dalfopristin (15 lg) 37Æ7 27Æ3 –* 14Æ3 57Æ1 0

Rifampicin (5 lg) 80Æ2 69Æ1 100 92Æ9 100 83Æ3Teicoplanin (30 lg)� (10Æ4) 0Æ9 (9Æ1) 1Æ8 (33Æ3) 0 (7Æ1) 0 (0) 0 (0) 0

Tetracycline (30 lg) 47Æ2 29Æ1 86Æ7 28Æ6 35Æ7 0

Vancomycin (30 lg)� (27Æ4) 7Æ5 (12Æ7) 1Æ8 (86Æ7) 0 (14Æ3) 0 (35Æ7) 0 (33Æ3) 100

*Intrinsic resistance.

�Vancomycin and teicoplanin results using disc diffusion test are expressed in parentheses followed by final results after PCR screening of van genes.

1184 B. MARTIN ET AL.

ª 2005 The Society for Applied Microbiology, Journal of Applied Microbiology, 98, 1177–1190, doi:10.1111/j.1365-2672.2005.02555.x

Fig. 3 Dendogram generated from safety traits data of the 78 different profiles obtained from the enterococcal isolates studied. The scale indicates

the similarity level (Simple Matching coefficient · 100). Profiles were grouped using the UPMGA method. Main groups are lettered A–D. AMP,

ampicillin; C, chloramphenicol; CIP, ciprofloxacin; CN, gentamicin; E, erythromycin; LZD, linezolid; F, nitrofurantoin; P, penicillin G; QD,

quinupristin/dalfopristin; RD, rifampicin; TEC, teicoplanin; TE, tetracycline, VA, vancomycin

BIODIVERSITY OF ENTEROCOCCI FROM FERMENTED SAUSAGES 1185

ª 2005 The Society for Applied Microbiology, Journal of Applied Microbiology, 98, 1177–1190, doi:10.1111/j.1365-2672.2005.02555.x

In this study, the most common enterococcal species found

in the slightly fermented sausages was E. faecium (51Æ9%).

This is in agreement with Reuter (1995) but in contrast with

recent studies that indicate E. faecalis as being more frequent

in food from animal origin thanE. faecium (Peters et al. 2003).Klein (2003) reported difficulties of E. faecium isolation and

enumeration in selective media and a consequent underesti-

mation of this species in meat and meat products when

compared with E. faecalis. In our study, E. faecalis, E. hiraeand E. durans isolates were very balanced in fermented

sausages when compared with the results of Devriese et al.(1995), who identified E. faecium, E. faecalis and, less

frequently, E. hirae/E. durans in meat and fermented meat.

In food from animal origin, Peters et al. (2003) found a higherproportion ofE. faecalis (72%) and a lower proportion (6%) of

E. durans/E. hirae compared with our results. Enterococcuscasseliflavus/flavescens, E. gallinarum and E. mundtii were

minority species (between 0Æ9 and 5Æ7%). Peters et al. (2003)found a similar proportion of E. casseliflavus and E. gallinarumbut they did not detect any E. mundtii strain.The natural contamination of meat from the gastrointes-

tinal content of the slaughtered animals and occasionally from

human origin may explain the species distribution in this kind

of product. Enterococcus faecium and E. faecalis are usually thespecies most isolated from the intestinal tract of domestic

animals and humans while E. durans/E. hirae, E. gallinarumand E. avium are, in general, less frequent (Devriese and Pot

1995; Klein 2003). In pig excrement, E. faecium is dominant

over E. faecalis, and E. hirae is a common enterococcal species

(Devriese et al. 1987; Devriese and Pot 1995). Enterococcusdurans is a frequent inhabitant in preruminant calves and in

chicken (Devriese and Pot 1995) and its presence in fermented

sausages might suggest a cross-contamination from meat of

different animal species in the manufacturing process.

Enterococcus casseliflavus, E. mundtii and E. gallinarum are

rare in animals and humans. Enterococcus mundtii has beenisolated from plants and soils (Collins et al. 1986; Niemi et al.1993) and occasionally from meat and meat products (Dev-

riese et al. 1995; Klein et al. 1998; Peters et al. 2003).The heterogeneity among enterococcal species found in

chorizo when compared with fuet could be explained by

the differences in the composition of both products. Fuet

contains black pepper whereas chorizo is made with

paprika and garlic. Also the initial content of enterococci

in the meat butter, human cross-contamination, the

temperature, the pH and the relative humidity during

processing can affect the final enterococcal population

from product to product.

RAPD-PCR typing

The RAPD-PCR profiles have proved to be a sensitive and

efficient molecular method for the characterization of inter-

strains variations. In this study, the use of two primers

(M13R2 and R5) and two different PCR conditions enabled

the elucidation of the genetic diversity among isolates and

within enterococcal species. Eight species-specific clusters

were obtained at a similarity level of 50%, for which RAPD-

PCR was useful not only for strain typing, but also for

species identification of isolates. All but three E. faeciumisolates were distributed into two separated clusters that

were each further subdivided in two main subgroups, but no

correlation with type of product, pathogenicity or antibiotic

resistance could be established. Vancanneyt et al. (2002) alsofound two genomic groups in E. faecium from various

sources although no phenotypic features could clearly

differentiate one group from the other. These results may

suggest the presence of exchange genetic material in the

enterococcal population.

Clustering analysis of genotypic typing and safety traits

showed 60 different RAPD profiles and 78 different patterns

respectively. Nevertheless, if considering the reproducibility

value of 92% for RAPD analysis and a similarity value of

95% to differentiate among safety traits patterns, 54 and 55

isolates were characterized respectively. These results

suggest that phenotypic and genotypic traits are comple-

mentary to characterize individual strains.

Strains with identical RAPD profiles were found in the

same sample and in products from different origins. This

could be explained by the predominance of a particular

strain among the enterococci population in a product or, by

the fact that different sausage producers can obtain meat

from the same slaughterhouse, representing a common meat

origin.

Incidence and distribution of virulencedeterminants

The incidence of virulence genes in the enterococci isolated

from fermented sausages was found to be lower in E. faeciumstrains than in E. faecalis, in accordance with the results of

several authors on food and clinical isolates (Eaton andGasson

2001; Franz et al. 2001; Dupre et al. 2003; Semedo et al.2003). The most widely spread virulence determinants were

cell-wall adhesins. All E. faecium and E. faecalis strains

harboured efaAfm and efaAfs genes respectively. Eaton and

Gasson (2001) and Semedo et al. (2003) also reported a high

incidence of efaAfs and efaAfm among enterococci from food

origin although lower than in clinical strains. Mannu et al.(2003) reported efaA as the only virulence trait present in E.faecium from dairy origin but in a lower percentage. The high

proportion of different adhesins among enterococcal isolates

may constitute an important advantage to the survival of

enterococci in all environments (Semedo et al. 2003).The genes agg and gelE were detected in all E. faecalis

strains and 5Æ5% of E. faecium strains and the gene esp in

1186 B. MARTIN ET AL.

ª 2005 The Society for Applied Microbiology, Journal of Applied Microbiology, 98, 1177–1190, doi:10.1111/j.1365-2672.2005.02555.x

93Æ3% of E. faecalis and 5Æ5% of E. faecium strains. Semedo

et al. (2003) also detected these genes in most E. faecalisisolates from food and clinical origin. Eaton and Gasson

(2001) and Franz et al. (2001) showed lower incidence

among E. faecalis strains and none of the E. faecium strains

harboured these genes. Franz et al. (2001) explained the

high incidence of gelE among food enterococci by their

origin from a protein-rich source; the production of protease

may be a selection mechanism for enterococci growing as it

may enable them to utilize proteins as a source of amino

acids. The enterococcal surface protein (Esp) plays a role in

adhesion and is also involved in immune evasion (Shankar

et al. 1999). Thus, enterococcal strains harbouring this gene

should be clearly undesirable for use as starter cultures in

food (Franz et al. 2001). The aggregation substance has been

described as characteristic of E. faecalis pheromone response

plasmids (Dunny 1990) and in fact, several authors (Franz

et al. 1999; Eaton and Gasson 2001; Dupre et al. 2003)

found only agg+ genotype among isolates of this species. We

detected the agg gene in three E. faecium strains isolated

from a sample with a high proportion of E. faecalis strainssuggesting that they may have acquired this virulence factor

by a natural conjugation gene transfer process. In fact, all E.faecium harbouring agg, esp and gelE genes belonged to the

same sample with a high presence of E. faecalis. Eaton and

Gasson (2001) showed the possibility of virulence determi-

nants transfer from a strain of E. faecalis with a sex

pheromone plasmid into E. faecalis starter strains; althoughthe transfer into E. faecium strains was not achieved by these

authors, sex pheromone cross talk between E. faecium and E.faecalis has been established (Heaton et al. 1996). The

existence of E. faecium isolates of food origin containing agg,esp and gelE genes is in contrast to previous works (Eaton

and Gasson 2001; Franz et al. 2001). Enterococcus faeciumstrains containing these virulence genes may be involved in

the evolution of pathogenic E. faecium strains (Eaton and

Gasson 2001) and related with E. faecium-derived infections.

Another sample with high prevalence of E. faecalis strainsharbouring the virulence genes studied was characterized. In

this sample the remaining isolates were identified as E. hiraeand they all were clear of virulence traits.

Antibiotic susceptibility

It is difficult to assess the role of the food chain as a possible

source of antibiotic-resistant enterococci, but strains resist-

ant to glycopeptides and other antibiotics has been isolated

from foods (Knudtson and Hartman 1993; Teuber et al.1999; Franz et al. 2001).Our results showed that vancomycin-resistant entero-

cocci, one of the major concerns from the clinical point of

view, are not common in slightly fermented sausages. Only

one E. faecium isolate of 106 enterococci presented vanA

genes associated with a high level of resistance to vancomy-

cin and teicoplanin (Arthur et al. 1996). Six motile entero-

cocci carried the vanC gene, associated with a low-level

resistance to vancomycin and intrinsic to the motile

enterococcal species (Leclercq 1997). Teuber et al. (1999)in a study of cheeses from Europe, Quednau et al. (1998) inenterococci from meat and Franz et al. (2001) in dairy

enterococci also reported a low incidence of VRE. Robredo

et al. (2000) found VRE in 27Æ2% of chicken products but

no VRE were detected in cooked pork or turkey products

from Spain. Peters et al. (2003) did not find any VRE in

foods of animal origin.

The E. faecium strains isolated from this study showed a

higher incidence of penicillin resistance when compared

with E. faecalis as previously reported by Murray (1990) and

Franz et al. (2001). Enterococcus faecium showed a higher

incidence of ampicillin resistance than those reported by

Quednau et al. (1998), Franz et al. (2001) and Peters et al.(2003). This may be a cause of concern due to monotherapy

with penicillin or ampicillin has been used for decades as a

general treatment for enterococci infections. However, none

of the strains presented high-level resistance to gentamicin,

an aminoglycoside that is generally combined with penicillin

or ampicillin to treat serious enterococcal infections, espe-

cially endocarditis. Franz et al. (2001) also reported a low

incidence of gentamicin resistance among E. faecium isolates

but a relatively high incidence among E. faecalis strains

(25Æ5%) and Peters et al. (2003) only found one E. faecalisstrain with a high-level resistance to gentamicin.

From our results, E. faecalis isolates showed a higher

incidence of antibiotic resistance than E. faecium and the

other enterococcal species except for ampicillin, ciprofloxa-

cin, nitrofurantoin and penicillin. Enterococcus faecalisshowed high prevalence of resistance towards chloramphen-

icol, erythromycin, quinupristin/dalfopristin, rifampicin

and tetracycline. Teuber et al. (1999) and Franz et al.(2001) reported lower resistance to tetracycline, erythromy-

cin and chloramphenicol among E. faecalis strains.Although no multi-resistant enterococcal strains could be

grouped in a single cluster group by RAPD typing, three

samples concentrated all these multi-resistant strains. This

suggests a high selective pressure exerted by the use of

antibiotics in food animals that may be an activation of

efficient gene transfer under stress conditions among the

enterococcal community in fermented sausages. In E.faecalis, plasmids encoding antibiotic resistances can be

mobilized within the enterococcal food community during

fermentation at high frequency, even without selective

pressure; the conjugal transfer seems more efficient in the

fermented sausage model than on agar plate or in cheese

(Cocconcelli et al. 2003).Although some enterococcal strains isolated from fer-

mented sausages were resistant to a high number of

BIODIVERSITY OF ENTEROCOCCI FROM FERMENTED SAUSAGES 1187

ª 2005 The Society for Applied Microbiology, Journal of Applied Microbiology, 98, 1177–1190, doi:10.1111/j.1365-2672.2005.02555.x

antibiotics, most of them were susceptible to clinically

relevant antibiotics, such as gentamicin and vancomycin, in

accordance with results obtained in other food enterococci

(Franz et al. 2001; Peters et al. 2003). Nevertheless, there

was a relatively high incidence towards ampicillin and

penicillin among E. faecium and E. durans strains not

previously reported in enterococci from food.

The enterococcal population from slightly fermented

sausages showed a considerable genetic diversity at species

and strain level, which was even higher in chorizo than in

fuet. The enterococci population can be quantitatively

important in slightly fermented sausages achieving counts

of 104–105 CFU g)1, and their use as bioprotective starter

cultures against Listeria monocytogenes and probiotics has

been reported (Coppola et al. 1988; Centeno et al. 1996;

Aymerich et al. 2003). In this study, the presence of

virulence factors and the higher incidence of antibiotic

resistance have been mainly associated with E. faecalisspecies, which are, moreover, recorded as responsible for

most nosocomial infections. Therefore, it is recommended

to use E. faecium instead of E. faecalis as starter culture in

fermented sausages but safety aspects of selected strains

must be considered. Typing of E. faecium isolates will ensure

the selection of safety strains as starter and bioprotective

cultures in fermented sausages. Although the potential risk

for human health associated to the presence of enterococci in

slightly fermented sausages is very low, the production of

these products without any virulent or antimicrobial resist-

ant enterococci is possible, therefore these characteristics

could be considered as a quality trait in this kind of

products.

ACKNOWLEDGEMENTS

This research was funded by the Spanish Inter-Ministerial

Commission of Science and Technology (CICYT ALI99-

0308 and AGL2004-05431/ALI). We thank Y. Beltran, A.

Claret and D. Tibau for technical assistance and the

Ministry of Science and Technology for Belen Martin’s

scholarship.

REFERENCES

Adams, M.R. (1999) Safety of industrial lactic acid bacteria. Journal of

Biotechnology 68, 171–178.

Angeletti, S., Lorino, G., Gherardi, G., Battistoni, F., De Cesaris, M.

and Dicuonzo, G.R. (2001) Routine molecular identification of

enterococci by gene-specific PCR and 16S ribosomal DNA sequen-

cing. Journal of Clinical Microbiology 39, 794–797.

Antonishyn, N.A., McDonald, R.R., Chan, E.L., Horsman, G.,

Woodmansee, C.E., Falk, P.C. and Mayhall, C.G. (2000) Evaluation

of fluorescence-based amplified fragment length polymorphism

analysis for molecular typing in hospital epidemiology: comparison

with pulsed-field gel electrophoresis for typing strains of vancomy-

cin-resistant Enterococcus faecium. Journal of Clinical Microbiology 38,

4058–4065.

Arthur, M., Reynolds, P. and Courvalin, P (1996) Glycopeptide

resistance in enterococci. Trends in Microbiology 4, 401–407.

Aymerich, M.T., Garriga, M., Ylla, J., Vallier, J., Monfort, J.M. and

Hugas, M. (2000) Application of enterocins as biopreservatives

against Listeria innocua in meat products. Journal of Food Protection

63, 721–726.

Aymerich, M.T., Martın, B., Garriga, M. and Hugas, M. (2003)

Microbial quality and direct PCR identification of lactic acid bacteria

and nonpathogenic staphylococci from artisanal low-acid sausages.

Applied and Environmental Microbiology 69, 4583–4594.

Baumgartner, A., Kueffer, M. and Rohner, P. (2001) Occurrence and

antibiotic resistance of enterococci in various ready-to-eat foods.

Archiv fur Lebensmittel Hygiene 52, 16–19.

CDC NNIS System (1998) National Nosocomial Infections Surveil-

lance (NNIS) report, data summary from October 1986–April 1998,

issued June 1998. American Journal of Infection Control 26, 522–533.

Centeno, J.A., Menendez, S. and Rodrıguez-Otero, J.L. (1996) Main

microbial flora present as natural starters in Cebreiro raw cow’s-milk

cheese (Northwest Spain). International Journal of Food Microbiology

33, 307–313.

Charteris, W.P., Kelly, P.M., Morelli, L. and Collins, J.K. (1998)

Antibiotic susceptibility of potentially probiotic Lactobacillus species.

Journal of Food Protection 61, 1636–1643.

Cheng, S., McCleskey, F.K., Gress, M.J., Petroziello, J.M., Liu, R.,

Namdari, H., Beninga, K., Salmen, A. et al. (1997) A PCR assay for

identification of Enterococcus faecium. Journal of Clinical Microbiology

35, 1248–1250.

Clewell, D.B. (1990) Movable genetic elements and antibiotic resist-

ance in enterococci. European Journal of Clinical Microbiology and

Infectious Diseases 9, 90–102.

Cocconcelli, P.S., Porro, D., Galandini, S. and Senini, L. (1995)

Development of RAPD protocol for typing of strains of lactic acid

bacteria and enterococci. Letters in Applied Microbiology 21, 376–379.

Cocconcelli, P.S., Cattivelli, D. and Gazzola, S. (2003) Gene transfer of

vancomycin and tetracycline resistances among Enterococcus faecalis

during cheese and sausage fermentations. International Journal of

Food Microbiology 88, 315–323.

Collins, M.D., Farrow, J.A.E. and Jones, D. (1986) Enterococcus

mundtii sp. Nov. International Journal of Systematic Bacteriology 36,

8–12.

Coppola, S., Parente, E., Dumontet, S. and La Peccerella, A. (1988)

The microflora of natural whey cultures utilized as starters in the

manufacture of Mozzarella cheese from water-buffalo milk. Lait 68,

295–310.

Descheemaeker, P., Lammens, C., Pot, B., Vandamme, P. and

Goossens, H. (1997) Evaluation of arbitrarily primed PCR analysis

and pulsed-field gel electrophoresis of large genomic DNA frag-

ments for identification of enterococci important in human medicine.

International Journal of Systematic Bacteriology 47, 555–561.

Devriese, L.A. and Pot, B. (1995) The genus Enterococcus. In The

Lactic Acid Bacteria ed. Wood, B.J.B. and Holzapfel, W.H. pp. 328–

367. London: Blackie Academic.

Devriese, L.A., Van De Kerckhove, A., Kilpper-Balz, R. and Schleifer,

K.H. (1987) Characterization and identification of Enterococcus

1188 B. MARTIN ET AL.

ª 2005 The Society for Applied Microbiology, Journal of Applied Microbiology, 98, 1177–1190, doi:10.1111/j.1365-2672.2005.02555.x

species isolated from animals. International Journal of Systematic

Bacteriology 37, 257–259.

Devriese, L.A., Pot, B., Van Damme, L., Kersters, K. and Hae-

sebrouck, F. (1995) Identification of Enterococcus species isolated

from foods of animal origin. International Journal of Food Microbio-

logy 26, 187–197.

Devriese, L.A., Pot, B., Kersters, K., Lauwers, S. and Haesebrouck, F.

(1996) Acidification of methyl-alpha-D-glucopyranoside: a useful

test to differentiate Enterococcus casseliflavus and Enterococcus gallin-

arum from Enterococcus faecium species group and from Enterococcus

faecalis. Journal of Clinical Microbiology 34, 2607–2608.

Devriese, L.A., Vancanneyt, M., Descheemaeker, P., Baele, M., Van

Landuyt, H.W., Gordts, B., Butaye, P., Swings, J. et al. (2002)

Differentiation and identification of Enterococcus durans, E. hirae and

E. villorum. Journal of Applied Microbiology 92, 821–827.

Domig, K.J., Mayer, H.K. and Kneifel, W. (2003) Methods used for

the isolation, enumeration, characterisation and identification of

Enterococcus spp. 2. Pheno- and genotypic criteria. International

Journal of Food Microbiology 88, 165–188.

Dunny, G.M. (1990) Genetic functions and cell-cell interactions in the

pheromone-inducible plasmid transfer system of Enterococcus fae-

calis. Molecular Microbiology 4, 689–696.

Dunny, G.M., Leonard, B.A. and Hedberg, P.J. (1995) Pheromone

inducible conjugation in Enterococcus faecalis: interbacterial and host-

parasitechemicalcommunication.JournalofBacteriology177,871–876.

Dupre, I., Zanetti, S., Schito, A.M., Fadda, S. and Sechi, L.A. (2003)

Incidence of virulence determinants in clinical Enterococcus faecium

and Enterococcus faecalis isolates collected in Sardinia (Italy). Journal

of Medical Microbiology 52, 491–498.

Dutka-Malen, S., Evers, S. and Courvalin, P. (1995) Detection of

glycopeptide resistance genotypes and identification to the species

level of clinically relevant enterococci by PCR. Journal of Clinical

Microbiology 33, 24–27.

Eaton, T.J. and Gasson, M.J. (2001) Molecular screening of Entero-

coccus virulence determinants and potential for genetic exchange

between food and medical isolates. Applied and Environmental

Microbiology 67, 1628–1635.

Farber, J.M., Cai, Y. and Ross, W.H. (1996) Predictive modeling of the

growth of Listeria monocytogenes in CO2 environments. International

Journal of Food Microbiology 32, 133–144.

Franz, C.M., Holzapfel, W. and Stiles, M.E. (1999) Enterococci at the

crossroads of food safety?. International Journal of Food Microbiology

47, 1–24.

Franz, C.M., Muscholl-Silberhorn, A.B., Yousif, N.M., Vancanneyt,

M., Swings, J. and Holzapfel, W.H. (2001) Incidence of virulence

factors and antibiotic resistance among enterococci isolated from

food. Applied and Environmental Microbiology 67, 4385–4389.

Giraffa, G. (2002) Enterococci from foods. FEMS Microbiology

Reviews 26, 163–171.

Giraffa, G., Olivari, A.M. and Neviani, E. (2000) Isolation of

vancomycin-resistant Enterococcus faecium from Italian cheeses. Food

Microbiology 39, 2354–2355.

Haas, W. and Gilmore, M.S. (1999) Molecular nature of a novel

bacterial toxin: the cytolysin of Enterococcus faecalis. Medical

Microbiology and Immunology 187, 183–190.

Heaton, M.P., Discotto, L.F., Pucci, M.J. and Handwerger, S. (1996)

Mobilization of vancomycin resistance by transposon-mediated

fusion of a VanA plasmid with an Enterococcus faecium sex

pheromone-response plasmid. Gene 171, 9–17.

Jett, B., Huycke, M.M. and Gilmore, M.S. (1994) Virulence of

enterococci. Clinical Microbiology Reviews 7, 462–478.

Ke, D., Picard, F.J., Martineau, F., Menard, C., Roy, P.H., Ouellette,

M. and Bergeron, M.G. (1999) Development of a PCR assay for

rapid detection of enterococci. Journal of Clinical Microbiology 37,

3497–3503.

Klein, G. (2003) Taxonomy, ecology and antibiotic resistance of

enterococci from food and the gastro-intestinal tract. International

Journal of Food Microbiology 88, 123–131.

Klein, G., Pack, A. and Reuter, G. (1998) Antibiotic resistance patterns

of enterococci and occurrence of vancomycin-resistant enterococci in

raw minced beef and pork in Germany. Applied and Environmental

Microbiology 64, 1825–1830.

Knudtson, L.M. and Hartman, P.A. (1993) Antibiotic resistance

among enterococcal isolates from environmental and clinical sources.

Journal of Food Protection 56, 486–492.

Leclercq, R. (1997) Enterococci acquire new kinds of resistance.

Clinical Infectious Diseases 24, S80–S84.

Leclercq, R., Derlot, M., Weber, J., Duval, J. and Courvalin, P. (1989)

Transferable vancomycin and teicoplanin resistance in Enterococcus

faecium. Antimicrobial Agents and Chemotherapy 33, 10–15.

Lowe, A.M., Lambert, P.A. and Smith, A.W. (1995) Cloning of an

Enterococcus faecalis endocarditis antigen: homology with adhesins

from some oral streptococci. Infection and Immunity 63, 703–

706.

Mannu, L., Paba, A., Daga, E., Comunian, R., Zanetti, S., Dupre, I.

and Sechi, L.A. (2003) Comparison of the incidence of virulence

determinants and antibiotic resistance between Enterococcus faecium

strains of dairy, animal and clinical origin. International Journal of

Food Microbiology 88, 291–304.

Morrison, D., Woodford, N. and Cookson, B. (1997) Enterococci as

emerging pathogens of humans. Journal of Applied Microbiology.

Symposium Supplement 83, 89S–99S.

Mundy, L.M., Sahm, D.F. and Gilmore, M.S. (2000) Relationship

between enterococcal virulence and antimicrobial resistance. Clinical

Microbiology Reviews 13, 513–522.

Murray, B.E. (1990) The life and times of the Enterococcus. Clinical

Microbiology Reviews 3, 46–65.

NCCLS (2002) Performance Standards for Antimicrobial Susceptibility

Testing; Twelfth Informational Supplement. NCCLS document

M100-S12.940. Wayne, PA: National Committee for Clinical

Laboratory Standards.

Niemi, R.M., Niemela, S.I., Bamfort, D.H., Hantula, J., Hyvarinen,

T., Forsten, T. and Raateland, A. (1993) Presumptive fecal

streptococci in environmental samples characterized by one-dimen-

sional sodium dodecyl sulphate-polyacrylamide gel electrophoresis.

Applied and Environmental Microbiology 59, 2190–2196.

Noble, W.C., Virani, Z. and Cree, R.G. (1992) Co-transfer of

vancomycin and other resistance genes from Enterococcus faecalis

NCTC 12201 to Staphylococcus aureus. FEMS Microbiology Letters

72, 195–198.

Peters, J., Mac, K., Wichmann-Schauer, H., Klein, G. and Ellerbroek,

L. (2003) Species distribution and antibiotic resistance patterns of

enterococci isolated from food of animal origin in Germany.

International Journal of Food Microbiology 88, 311–314.

BIODIVERSITY OF ENTEROCOCCI FROM FERMENTED SAUSAGES 1189

ª 2005 The Society for Applied Microbiology, Journal of Applied Microbiology, 98, 1177–1190, doi:10.1111/j.1365-2672.2005.02555.x

Poyart, C., Quesnes, G. and Trieu-Cuot, P. (2000) Sequencing the

gene encoding manganese-dependent superoxide dismutase for rapid

species identification of enterococci. Journal of Clinical Microbiology

38, 415–418.

Quednau, M., Ahrne, S., Petersson, A.C. and Molin, G. (1998)

Antibiotic-resistant strains of Enterococcus isolated from Swedish and

Danish retailed chicken and pork. Journal of Applied Microbiology 84,

1163–1170.

Reuter, G. (1995) Culture media for enterococci and group D-

streptococci. In Culture Media for Food Microbiology Progress in

Industrial Microbiology ed. Corry, J.E.L., Curtis, G.D.W. and Baird,

R.M. pp. 51–61. Philadelphia, PA: Elsevier Health Sciences.

Robredo, B., Singh, K.V., Baquero, F., Murray, B.E. and Torres, C.

(2000) Vancomycin-resistant enterococci isolated from animals and

food. International Journal of Food Microbiology 54, 197–204.

Semedo, T., Almeida, M., Silva Lopes, M.F., Figueiredo Marques,

J.J., Barreto Crespo, M.T. and Tenreiro, R. (2003) Virulence factors

in food, clinical and reference enterococci: a common trait in the

genus? Systematic and Applied Microbiology 26, 13–22.

Shankar, V., Baghdayan, A.S., Huycke, M.M., Kindahl, G. and

Gilmore, M.S. (1999) Infection-derived Enterococcus faecalis strains

are enriched in esp, a gene encoding a novel surface protein. Infection

and Immunity 67, 193–200.

Singh, K.V., Coque, T.M., Weinstock, G.M. and Murray, B.E. (1998)

In vivo testing of an Enterococcus faecalis efaA mutant and use of efaA

homologs for species identification. FEMS Immunology and Medical

Microbiology 21, 323–331.

Swenson, J.M., Bertha, C.H. and Thornsberry, C. (1989) Problems

with the disk diffusion test for detection of vancomycin resistance in

enterococci. Journal of Clinical Microbiology 27, 2140–2142.

Temmerman, R., Pot, B., Huys, G. and Swings, J. (2003) Identification

and antibiotic susceptibility of bacterial isolates from probiotic

products. International Journal of Food Microbiology 81, 1–10.

Teuber, M., Meile, L. and Schwarz, F. (1999) Acquired antibiotic

resistance in lactic acid bacteria from food. Antonie van Leeuwenhoek

76, 115–137.

Vancanneyt, M., Lombardi, A., Andrighetto, C., Knijff, E., Torriani,

S., Bjorkroth, K.J., Franz, C.M.A.P., Moreno, M.R.F. et al. (2002)

Intraspecies genomic groups in Enterococcus faecium and their

correlation with origin and pathogenicity. Applied and Environmental

Microbiology 68, 1381–1391.

Wegener, H.C., Aarestrup, F.M., Jensen, L.B., Hammerum, A.M.

and Bager, F. (1999) Use of antimicrobial growth promoters in

food animals and Enterococcus faecium resistance to therapeutic

antimicrobial drugs in Europe. Emerging Infectious Diseases 5, 329–

335.

1190 B. MARTIN ET AL.

ª 2005 The Society for Applied Microbiology, Journal of Applied Microbiology, 98, 1177–1190, doi:10.1111/j.1365-2672.2005.02555.x