1 Fundamentals of Protein Structure Yu (Julie) Chen and Thomas Funkhouser Princeton University CS597A, Fall 2005 Outline Protein structure • Primary • Secondary • Tertiary • Quaternary Protein folding/binding • Forces and factors Levels of Protein Structure Lehninger Principles of Biochemistry (3 rd edition) David L. Nelson, Michael M. Cox Outline Protein structure Primary • Secondary • Tertiary • Quaternary Protein folding/binding • Forces and factors Primary Structure DNA Sequence of Nucleic Acids GGGGCTACGGGGGGTGGGGCTTCGCGCCCCGCCGGCCTAIAAGCGGGCCGCCGCGGCTCCGTGCCQTTGCCGACCTTGCCT GcCGCCGCTGCTGCTTCGCGCCCGTCGCCTCCGCCATGGCTCCCAGGAAGTTCTTCGTGGGTGGCAACTGGAAGATGAACG GCGACAAGAAGAGCTTGGGCGAGCTCATCCACACGCTGAATGGCGCCAAGCTCTCGGCCGACACCGAGGTGGTTTGCGGAG CCCCTTCAATCTACCTTGATTTTGCCCGCCAGAAGCTTGATGCAAAGATTGGAGTTGCAGCACAAAACTGTTACAACGTAC CGAAGGGTGCTTTCACAGGAGAGATCAGCCCAGCAATGATCAAAGATATTGGAGCTGCATGGGTGATCCTGGGCCACTCAG AGCGGAGGCATGTTTTTGGAGAGTCTGATGAGTTGATTGGGCAGAAGGTGGCTCATGCTCMTGCTGAAGGC . . . [Straus85] Primary Structure Transcription and translation (DNA→Protein) http://www.accessexcellence.org
12
Embed
Fundamentals of Protein Structure · Introduction to protein structure (2nd edition) Carl Branden, John Tooze Supersecondary structure / motifs Secondary Structure Visualization Secondary
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
11
Fundamentals ofProtein Structure
Yu (Julie) Chen and Thomas Funkhouser
Princeton University
CS597A, Fall 2005
Outline
Protein structure• Primary• Secondary• Tertiary• Quaternary
Protein folding/binding• Forces and factors
Levels of Protein Structure
Lehninger Principles of Biochemistry (3rd edition)David L. Nelson, Michael M. Cox
Outline
Protein structureØ Primary• Secondary• Tertiary• Quaternary
Transcription and translation (DNA→Protein)First Second Position ThirdPosition ------------------------------------ Position
| U(T) C A G |
U(T) Phe Ser Tyr Cys U(T)Phe Ser Tyr Cys CLeu Ser STOP STOP ALeu Ser STOP Trp G
C Leu Pro His Arg U(T)Leu Pro His Arg CLeu Pro Gln Arg ALeu Pro Gln Arg G
A Ile Thr Asn Ser U(T)Ile Thr Asn Ser CIle Thr Lys Arg AMet Thr Lys Arg G
G Val Ala Asp Gly U(T)Val Ala Asp Gly CVal Ala Glu Gly AVal Ala Glu Gly G
Primary Structure
Transcription and translation (DNA→Protein)
Alanine Ala ACysteine Cys CAspartic Acid Asp DGlutamic Acid Glu EPhenylalanine Phe FGlycine Gly GHistidine His HIsoleucine Ile ILysine Lys KLeucine Leu LMethionine Met MAsparagine Asn NProline Pro P Glutamine Gln QArginine Arg RSerine Ser SThreonine Thr TValine Val VTryptophan Trp WTyrosine Tyr Y
Protein structure description• Primary � amino acid sequence• Secondary � local fold pattern of small subsequence• Tertiary � fold of entire protein chain• Quaternary � complex of multiple chains
Lehninger Principles of Biochemistry (3rd edition)David L. Nelson, Michael M. Cox
Example: Hemoglobin
Chain APrimary structure: 284 residues
Chain ASecondary structure and motifs:
19 Helices50 Helices-helices interacs
14 Beta turns2 gamma turns
Deoxyhemoglobin (alpha chain). Chain: a. Engineered: yes. Mutation: yes. Deoxyhemoglobin (beta chain). Chain: b, d. Engineered: yes. Mutation: yes1C7DE.A.Brucker
Chain A
Tertiary Structure
Deoxyhemoglobin (alpha chain). Chain: a. Engineered: yes. Mutation: yes. Deoxyhemoglobin (beta chain). Chain: b, d. Engineered: yes. Mutation: yes1C7DE.A.Brucker
Deoxyhemoglobin
Quaternary Structure
Example: Hemoglobin
Deoxyhemoglobin (alpha chain). Chain: a. Engineered: yes. Mutation: yes. Deoxyhemoglobin (beta chain). Chain: b, d. Engineered: yes. Mutation: yes1C7DE.A.Brucker
Example: Hemoglobin Outline
Protein structure• Primary• Secondary• Tertiary• Quaternary
Protein folding/bindingØ Forces and factors
1111
Folding/Binding
Factors determining tertiary/quaternary structure:1. Disulfide linkages2. Hydrogen bonding3. Electrostatic interactions4. Hydrophobic interactions5. Van der Waals forces
[http://www.cryst.bbk.ac.uk]
Folding/Binding
Important properties of amino acids:• Size• Charge• Polarity• Aromaticity• Hydrophobicity• Conformational
constraints
Folding/Binding
Important properties of amino acids:Ø Size• Charge• Polarity• Aromaticity• Hydrophobicity• Conformational
constraints
[http://www.cryst.bbk.ac.uk]
Folding/Binding
Important properties of amino acids:• SizeØ Charge• Polarity• Aromaticity• Hydrophobicity• Conformational
constraints
[http://www.cryst.bbk.ac.uk]
Folding/Binding
Important properties of amino acids:• Size• ChargeØ Polarity• Aromaticity• Hydrophobicity• Conformational
constraints
[http://www.cryst.bbk.ac.uk]
Folding/Binding
Important properties of amino acids:• Size• Charge• PolarityØ Aromaticity• Hydrophobicity• Conformational
constraints
[http://www.cryst.bbk.ac.uk]
1212
Folding/Binding
Important properties of amino acids:• Size• Charge• Polarity• AromaticityØ Hydrophobicity• Conformational
constraints
[http://www.cryst.bbk.ac.uk]
Folding/Binding
Important properties of amino acids:• Size• Charge• Polarity• Aromaticity• HydrophobicityØ Conformational
constraints
[http://www.cryst.bbk.ac.uk]
Summary
Protein structure description• Primary � amino acid sequence• Secondary � local fold pattern of small subsequence• Tertiary � fold of entire protein chain• Quaternary � complex of multiple chains
Protein folding/binding• Disulfide linkages• Hydrogen bonding• Electrostatic interactions• Hydrophobic interactions• Van der Waals forces
1tim[Jena]
References
Information and figures were taken from:• Introduction to protein structure (2nd edition)
Carl Branden, John Tooze
• Lehninger Principles of Biochemistry (3rd edition)David L. Nelson, Michael M. Cox
• Biochemistry (5th edition)Jeremy M. Berg, John L. Tymoczko, Lubert Stryer