Differentiation of Cryptococcus neoformans varieties and Cryptococcus gattii using CAP59-based loop-mediated isothermal DNA amplification S. Lucas 1 , M. da Luz Martins 1,2 , O. Flores 3 , W. Meyer 4 , I. Spencer-Martins 2, * and J. Ina ´cio 2 1) Institute of Hygiene and Tropical Medicine, New University of Lisbon, 1349-008 Lisbon, 2) Centro de Recursos Microbiolo ´gicos (CREM); DCV, Faculty of Sciences and Technology, New University of Lisbon, 2829-516 Caparica, 3) STAB Vida Lda., Apartado 89, 2781-601 Oeiras, Portugal and 4) Molecular Mycology Research Laboratory, Westmead Millennium Institute, University of Sydney Western Clinical School at Westmead Hospital, Westmead, NSW 2150, Australia Abstract Members of the Cryptococcus species complex (C. neoformans and C. gattii) are opportunistic pathogens responsible for frequently fatal cases of meningoencephalitis. These yeasts have been classified into five serotypes. Serotypes A and D are assigned to C. neoformans var. grubii and C. neoformans var. neoformans, respectively, Serotype AD strains are hybrids and serotype B and C strains are considered to belong to the related but distinct species C. gattii. Previous stud- ies have identified ‘serotype-associated’ alleles of several genes in the Cryptococcus species complex. We developed a loop-mediated isothermal DNA amplification method using CAP59 allele-specific primers to identify the serotypes A, D and B/C of the Cryptococcus species complex. Keywords: Cryptococcus gattii, Cryptococcus neoformans, loop- mediated isothermal DNA amplification Original Submission: 24 November 2008; Revised Submis- sion: 14 January 2009; Accepted: 22 January 2009 Editor: M. Arendrup Article published online: 20 August 2009 Clin Microbiol Infect 2010; 16: 711–714 10.1111/j.1469-0691.2009.02919.x Corresponding author and reprint requests: J. Ina ´cio, Laborato ´- rio Nacional de Investigac ¸a ˜o Veterina ´ria (LNIV—INRB I.P.), Estrada de Benfica, 701, 1549—011 Lisboa, Portugal E-mail: [email protected] *Recently deceased, I. Spencer-Martins was a notable microbiologist to whom the other authors would like do dedicate the present work as a tribute. The Cryptococcus species complex contains the two species, Cryptococcus neoformans and Cryptococcus gattii. Cryptococcus neoformans is a medically important yeast responsible for fre- quently fatal cases of meningoencephalitis, mainly in immuno- compromised hosts [1]. Traditionally, C. neoformans has been classified into three serotypes, i.e. A (C. neoformans var. gru- bii), D (C. neoformans var. neoformans) and AD (hybrids of serotypes A and D which have antigens of the polysaccharide capsule related to those of the former) [2]. The species C. gattii contains the serotypes B and C which were previ- ously known as a variety of C. neoformans (C. neoformans var. gattii). Currently, the members of these two serotypes, which are true pathogens, are considered to belong to a phylogenetically related but distinct species, C. gattii [3]. Loop-mediated isothermal DNA amplification (LAMP) involves the utilization of an isothermal step for DNA amplifi- cation, thus avoiding the need for sophisticated equipment. This technique was first described by Notomi et al. [4]. It relies upon an auto-cycling strand displacement DNA synthesis, using specially designed primer sets and a DNA polymerase with strand-displacement activity. There is an increasing num- ber of recent reports on the utilization of LAMP for the detec- tion and identification of organisms of clinical relevance, including fungi [5,6]. Previous studies have identified ‘serotype- associated’ alleles for several genes in the Cryptococcus species complex, including the virulence, capsule-associated gene CAP59 [7–9]. We describe a simple LAMP-based method, using serotype A, D and B/C CAP59 allele-specific primers, for the identification of strains of the Cryptococcus species complex. Yeast strains used in this study are listed in Table 1, including strains of control species. Serotypes were deter- mined using the Crypto Check kit (Iatron Laboratories, Tokyo, Japan). For DNA extraction, two loopfuls of culture grown on agar medium were suspended in lysis buffer to which the volume equivalent of 200 lL of glass beads was added, according to Ina ´cio et al. [6]. After vortexing for 2 min, the tubes were incubated for 1 h at 65°C and vor- texed again. The suspensions were centrifuged and the su- pernatants, diluted in sterilized double-distilled water (1:300), were used directly for DNA amplification. Three sets of LAMP primers were designed according to Notomi et al. [4], targeting relatively variable sequences within the CAP59 gene: set ‘A3’ (F3-CN2, AGAAGTCTTTGACTCGGTCG; B3- CN2, GAAAGGCGCATTCTCGAGC; FIP-A3, GCATTC TGTCTCCTACTCTGCCAATTGCGTGGACGACTTGCTC; and BIP-A3, CTGTCCCCCCCTGTTATTCATTATCGTA GAATACAGGAGCACCCTAG), set ‘D3’ (F3-CN2, B3-CN2, FIP-D3, CCTACTCTGCCAAATCAACTCGAGCGATATCT TGCCCTGTGTCG; and BIP-D3, CTGCTTCCGGTTG TGTTTAGTACTGGCACCCTATGTAGTCATGTGG), and ª2009 The Authors Journal Compilation ª2009 European Society of Clinical Microbiology and Infectious Diseases RESEARCH NOTE MYCOLOGY
Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Related Documents
