Top Banner
1 Central Dogma of Molecular Biology
38

Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the

Apr 20, 2018

Download

Documents

phungtu
Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Page 1: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the

1

Central Dogma of Molecular Biology

Page 2: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the

1

Central Dogma of Molecular Biology

• DNA is merely the blueprint

Page 3: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the

1

Central Dogma of Molecular Biology

• DNA is merely the blueprint

• Shared spatially (eyes, ears, heart etc.)

Page 4: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the

1

Central Dogma of Molecular Biology

• DNA is merely the blueprint

• Shared spatially (eyes, ears, heart etc.) and temporally (from cradle

to tomb)

Page 5: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the

1

Central Dogma of Molecular Biology

• DNA is merely the blueprint

• Shared spatially (eyes, ears, heart etc.) and temporally (from cradle

to tomb)

• What changes is what exactly

Page 6: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the

1

Central Dogma of Molecular Biology

• DNA is merely the blueprint

• Shared spatially (eyes, ears, heart etc.) and temporally (from cradle

to tomb)

• What changes is what exactly, and how much, each cell “produces”

at any given moment

Page 7: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the

1

Central Dogma of Molecular Biology

• DNA is merely the blueprint

• Shared spatially (eyes, ears, heart etc.) and temporally (from cradle

to tomb)

• What changes is what exactly, and how much, each cell “produces”

at any given moment

• To “first order” the products are proteins

Page 8: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the

1

Central Dogma of Molecular Biology

• DNA is merely the blueprint

• Shared spatially (eyes, ears, heart etc.) and temporally (from cradle

to tomb)

• What changes is what exactly, and how much, each cell “produces”

at any given moment

• To “first order” the products are proteins and the two-stage process

involves

• transcription: an imprint of the DNA is taken by mRNA

Page 9: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the

1

Central Dogma of Molecular Biology

• DNA is merely the blueprint

• Shared spatially (eyes, ears, heart etc.) and temporally (from cradle

to tomb)

• What changes is what exactly, and how much, each cell “produces”

at any given moment

• To “first order” the products are proteins and the two-stage process

involves

• transcription: an imprint of the DNA is taken by mRNA

• translation: the mRNA is used to guide the assembly of proteins

Page 10: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the

1

Central Dogma of Molecular Biology

• DNA is merely the blueprint

• Shared spatially (eyes, ears, heart etc.) and temporally (from cradle

to tomb)

• What changes is what exactly, and how much, each cell “produces”

at any given moment

• To “first order” the products are proteins and the two-stage process

involves

• transcription: an imprint of the DNA is taken by mRNA

• translation: the mRNA is used to guide the assembly of proteins

• Protein production can be regulated by transcription factors which

• bind to specific DNA sites (Transcription Factor Binding Sites)

Page 11: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the

1

Central Dogma of Molecular Biology

• DNA is merely the blueprint

• Shared spatially (eyes, ears, heart etc.) and temporally (from cradle

to tomb)

• What changes is what exactly, and how much, each cell “produces”

at any given moment

• To “first order” the products are proteins and the two-stage process

involves

• transcription: an imprint of the DNA is taken by mRNA

• translation: the mRNA is used to guide the assembly of proteins

• Protein production can be regulated by transcription factors which

• bind to specific DNA sites (Transcription Factor Binding Sites)

• regulate transcription rate of proximal genes

Page 12: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the

2

Transcription initiation of the glnA gene in E. coli

Page 13: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the

3

Motif finding

• Do these sequences share a common TFBS?

• tagcttcatcgttgacttctgcagaaagcaagctcctgagtagctggccaagcgagctgcttgtgcccggctgcggcggttgtatcctgaatacgccatgcgccctgcagctgctagaccctgcagccagctgcgcctgatgaaggcgcaacacgaaggaaagacgggaccagggcgacgtcctattaaaagataatcccccgaacttcatagtgtaatctgcagctgctcccctacaggtgcaggcacttttcggatgctgcagcggccgtccggggtcagttgcagcagtgttacgcgaggttctgcagtgctggctagctcgacccggattttgacggactgcagccgattgatggaccattctattcgtgacacccgacgagaggcgtccccccggcaccaggccgttcctgcaggggccaccctttgagttaggtgacatcattcctatgtacatgcctcaaagagatctagtctaaatactacctgcagaacttatggatctgagggagaggggtactctgaaaagcgggaacctcgtgtttatctgcagtgtccaaatcctat

Page 14: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the

3

Motif finding

• Do these sequences share a common TFBS?

• tagcttcatcgttgacttctgcagaaagcaagctcctgagtagctggccaagcgagctgcttgtgcccggctgcggcggttgtatcctgaatacgccatgcgccctgcagctgctagaccctgcagccagctgcgcctgatgaaggcgcaacacgaaggaaagacgggaccagggcgacgtcctattaaaagataatcccccgaacttcatagtgtaatctgcagctgctcccctacaggtgcaggcacttttcggatgctgcagcggccgtccggggtcagttgcagcagtgttacgcgaggttctgcagtgctggctagctcgacccggattttgacggactgcagccgattgatggaccattctattcgtgacacccgacgagaggcgtccccccggcaccaggccgttcctgcaggggccaccctttgagttaggtgacatcattcctatgtacatgcctcaaagagatctagtctaaatactacctgcagaacttatggatctgagggagaggggtactctgaaaagcgggaacctcgtgtttatctgcagtgtccaaatcctat

Page 15: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the

4

If only life could be that simple

• The binding sites are almost never excatly the same

• A more likely sample is:

tagcttcatcgttgactttTGaAGaaagcaagctcctgagtagctggccaagcgagctgcttgtgcccggctgcggcggttgtatcctgaatacgccatgcgccCTGgAGctgctagaccCTGCAGccagctgcgcctgatgaaggcgcaacacgaaggaaagacgggaccagggcgacgtcctattaaaagataatcccccgaacttcatagtgtaatCTGCAGctgctcccctacaggtgcaggcacttttcggatgCTGCttcggccgtccggggtcagttgcagcagtgttacgcgaggttCTaCAGtgctggctagctcgacccggattttgacggaCTGCAGccgattgatggaccattctattcgtgacacccgacgagaggcgtccccccggcaccaggccgttcCTaCAGgggccaccctttgagttaggtgacatcattcctatgtacatgcctcaaagagatctagtctaaatactacCTaCAGaacttatggatctgagggagaggggtactctgaaaagcgggaacctcgtgtttattTGCAttgtccaaatcctat

Page 16: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the

5

The dual face of motif finding

• Motif finding really consists of two problems:

Page 17: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the

5

The dual face of motif finding

• Motif finding really consists of two problems:

• finding the most pronounced motifs in the text

Page 18: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the

5

The dual face of motif finding

• Motif finding really consists of two problems:

• finding the most pronounced motifs in the text

• statistical significance: are they merely artifacts of the size of the

data?

Page 19: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the

5

The dual face of motif finding

• Motif finding really consists of two problems:

• finding the most pronounced motifs in the text

• statistical significance: are they merely artifacts of the size of the

data?

• In the remaining few minutes I will touch on the second problem

Page 20: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the

6

Assessing the significance of a putative motif

Page 21: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the

6

Assessing the significance of a putative motif

• Begin with the aligning the motif occurrences:

tTGaAGCTGgAGCTGCAGCTGCAGCTGCttCTaCAGCTGCAGCTaCAGCTaCAGtTGCAt

Page 22: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the

6

Assessing the significance of a putative motif

• Begin with the aligning the motif occurrences:

tTGaAGCTGgAGCTGCAGCTGCAGCTGCttCTaCAGCTGCAGCTaCAGCTaCAGtTGCAt

then create the alignment matrix:

A 3 1 9

C 8 8

G 7 1 8

T 2 10 1 2

Page 23: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the

6

Assessing the significance of a putative motif

• Begin with the aligning the motif occurrences:

tTGaAGCTGgAGCTGCAGCTGCAGCTGCttCTaCAGCTGCAGCTaCAGCTaCAGtTGCAt

then create the alignment matrix:

A 3 1 9

C 8 8

G 7 1 8

T 2 10 1 2

which you then summarize with the

entropy score:

•I :=

∑column i

∑letter j

nij lognij/n

qj(n = 10)

Page 24: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the

7

What’s in a score?

• By itself, the entropy score s of a particular motif has limited use

Page 25: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the

7

What’s in a score?

• By itself, the entropy score s of a particular motif has limited use

• we cannot compare scores of alignments with varying depth or

width

Page 26: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the

7

What’s in a score?

• By itself, the entropy score s of a particular motif has limited use

• we cannot compare scores of alignments with varying depth or

width

• The solution is to assess the statistical significance of s

Page 27: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the

7

What’s in a score?

• By itself, the entropy score s of a particular motif has limited use

• we cannot compare scores of alignments with varying depth or

width

• The solution is to assess the statistical significance of s

• This is often accomplished by computing the p-value of the

observed score:

Page 28: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the

7

What’s in a score?

• By itself, the entropy score s of a particular motif has limited use

• we cannot compare scores of alignments with varying depth or

width

• The solution is to assess the statistical significance of s

• This is often accomplished by computing the p-value of the

observed score:

. assuming the observed columns are randomly drawn from

the background frequencies {qa, qc, qg, qt}

Page 29: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the

7

What’s in a score?

• By itself, the entropy score s of a particular motif has limited use

• we cannot compare scores of alignments with varying depth or

width

• The solution is to assess the statistical significance of s

• This is often accomplished by computing the p-value of the

observed score:

. assuming the observed columns are randomly drawn from

the background frequencies {qa, qc, qg, qt}. what is P0(I ≥ s)?

Page 30: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the

7

What’s in a score?

• By itself, the entropy score s of a particular motif has limited use

• we cannot compare scores of alignments with varying depth or

width

• The solution is to assess the statistical significance of s

• This is often accomplished by computing the p-value of the

observed score:

. assuming the observed columns are randomly drawn from

the background frequencies {qa, qc, qg, qt}. what is P0(I ≥ s)?

• This is not as simple as it might look at first sight

Page 31: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the

8

Can I submit two different answers?

MEME E-values compared with Consensus E-values (log10 scale)

Page 32: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the

8

Can I submit two different answers?

MEME E-values compared with Consensus E-values (log10 scale)

• MEME is consistently pessimistic when compared with Consensus (by

a factor of over 500 at times)

Page 33: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the

8

Can I submit two different answers?

MEME E-values compared with Consensus E-values (log10 scale)

• MEME is consistently pessimistic when compared with Consensus (by

a factor of over 500 at times)

• Who’s right?

Page 34: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the

9

Our work

Page 35: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the

9

Our work

• We developed a method that borrows ideas from large-deviation theory

to compute a reliable answer reasonably fast

Page 36: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the

9

Our work

• We developed a method that borrows ideas from large-deviation theory

to compute a reliable answer reasonably fast

• The same underlying idea can be used for other fundamental statistical

problems

Page 37: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the

9

Our work

• We developed a method that borrows ideas from large-deviation theory

to compute a reliable answer reasonably fast

• The same underlying idea can be used for other fundamental statistical

problems

• Joint work with: Neil Jones (Ph.D. student at UCSD)

Page 38: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the

9

Our work

• We developed a method that borrows ideas from large-deviation theory

to compute a reliable answer reasonably fast

• The same underlying idea can be used for other fundamental statistical

problems

• Joint work with: Neil Jones (Ph.D. student at UCSD), Niranjan

Nagarajan (Ph.D. student here)