CD4+CD28null T Cells in Autoimmune Disease: Pathogenic Features and Decreased Susceptibility to Immunoregulation

of June 2, 2013.This information is current as

Susceptibility to ImmunoregulationDisease: Pathogenic Features and Decreased CD4+CD28null T Cells in Autoimmune

Fraussen, Jan Damoiseaux and Piet StinissenMarielle Thewissen, Veerle Somers, Niels Hellings, Judith

http://www.jimmunol.org/content/179/10/65142007; 179:6514-6523; ;J Immunol 

Referenceshttp://www.jimmunol.org/content/179/10/6514.full#ref-list-1

, 15 of which you can access for free at: cites 46 articlesThis article

Subscriptionshttp://jimmunol.org/subscriptions

is online at: The Journal of ImmunologyInformation about subscribing to

Permissionshttp://www.aai.org/ji/copyright.htmlSubmit copyright permission requests at:

Email Alertshttp://jimmunol.org/cgi/alerts/etocReceive free email-alerts when new articles cite this article. Sign up at:

Print ISSN: 0022-1767 Online ISSN: 1550-6606. Immunologists All rights reserved.Copyright © 2007 by The American Association of9650 Rockville Pike, Bethesda, MD 20814-3994.The American Association of Immunologists, Inc.,

is published twice each month byThe Journal of Immunology

by guest on June 2, 2013http://w

ww

.jimm

unol.org/D

ownloaded from

CD4�CD28null T Cells in Autoimmune Disease: PathogenicFeatures and Decreased Susceptibility to Immunoregulation1

Marielle Thewissen,* Veerle Somers,* Niels Hellings,* Judith Fraussen,*Jan Damoiseaux,† and Piet Stinissen2*

To determine the role of expanded CD4�CD28null T cells in multiple sclerosis and rheumatoid arthritis pathology, these cells werephenotypically characterized and their Ag reactivity was studied. FACS analysis confirmed that CD4�CD28null T cells are ter-minally differentiated effector memory cells. In addition, they express phenotypic markers that indicate their capacity to infiltrateinto tissues and cause tissue damage. Whereas no reactivity to the candidate autoantigens myelin basic protein and collagen typeII was observed within the CD4�CD28null T cell subset, CMV reactivity was prominent in four of four HC, four of four rheu-matoid arthritis patients, and three of four multiple sclerosis patients. The level of the CMV-induced proliferative response wasfound to be related to the clonal diversity of the response. Interestingly, our results illustrate that CD4�CD28null T cells are notsusceptible to the suppressive actions of CD4�CD25� regulatory T cells. In conclusion, this study provides several indications fora role of CD4�CD28null T cells in autoimmune pathology. CD4�CD28null T cells display pathogenic features, fill up immunologicalspace, and are less susceptible to regulatory mechanisms. However, based on their low reactivity to the autoantigens tested in thisstudy, CD4�CD28null T cells most likely do not play a direct autoaggressive role in autoimmune disease. The Journal of Immu-nology, 2007, 179: 6514–6523.

T he CD4� T cell displays a variety of helper functionsessential for an efficient adaptive immune response. How-ever, a considerable proportion of peripheral CD4� T

cells is potentially autoreactive. An important tolerance mecha-nism preventing the attack of self-tissues encompasses dominantsuppression of self-reactive T cells by a specialized subset ofCD4�CD25� regulatory T (Treg)3 cells. Both subtypes of CD4�

T cells are believed to be involved in the pathogenesis of variousautoimmune diseases. A number of studies support a pathogenicrole of autoreactive CD4� T cells in the immunopathogenesis ofboth rheumatoid arthritis (RA) and multiple sclerosis (MS) (re-viewed in Refs. 1–3). In addition, Treg cells were shown to befunctionally compromised in both patient groups (4–6).

We and others identified an expanded CD4�CD28null T cellpopulation within a subgroup of RA and MS patients (7–9). TheseT cells have undergone clonal expansion in vivo, have lost theexpression of CD40L, are highly proinflammatory, and express a

variety of killer Ig-like receptors (10–14). An expansion ofCD4�CD28null T cells was also reported for patients with otherautoimmune diseases (13, 15), HIV- and CMV-infected individu-als (16), and people suffering from coronary disease (17). Al-though the role of these cells in disease pathology is not clear,CD4�CD28null T cells could be isolated from the disease site, forexample, from ruptured unstable coronary plaques (18). In addi-tion, anti-TNF-� treatment in RA patients and statin treatment inpatients with unstable angina was associated with a reduction inthe frequency of CD4�CD28null T lymphocytes (19, 20).

During differentiation in response to chronic stimulation, CD4�

T cells gradually lose CD28 from the cell surface, eventually lead-ing to the appearance of CD4�CD28null T cells. In chronic inflam-matory conditions, CD28 gene expression may additionally bedown-regulated by TNF-� (21). To date, the triggers of activationof CD4�CD28null T cells have not been fully elucidated. Severalstudies suggest that CD4�CD28null T cells may be autoreactive Tcells (8, 22, 23). In contrast, van Leeuwen et al. (16) demonstratedthat CD4�CD28null T cells could emerge as a consequence ofCMV infection. Moreover, detailed characterization of CMV-re-active CD4� T cells showed that these cells were largely CD28null

(24).CMV is a persistent activating �-herpesvirus that is present in

�50% of the adult population and 90% of the elderly (25). Inhealthy, immunocompetent hosts, CMV infection is asymptom-atic. However, immunosuppressed individuals may suffer serious,often fatal, consequences as a result of viral re-emergence (26).Maintaining protective immunity against CMV is clearly essential,but may have a significant impact on overall adaptive immunefunction (25, 27).

In this study, we further characterized the CD4�CD28null T cellsubset to gain more insight in the role of this aberrant T cell subsetin the pathogenesis of RA and MS. It is tempting to speculate thatexpansion of CD4�CD28null T cells in a subset of patients with anautoimmune disease, is caused by chronic stimulation with autoan-tigens. This study is the first to test reactivity of CD4�CD28null T

*Hasselt University, Biomedical Research Institute, and School of Life Sciences,Transnationale Universiteit Limburg, Diepenbeek, Belgium; and †Department ofClinical and Experimental Immunology, University Hospital Maastricht, Maastricht,The Netherlands

Received for publication February 28, 2007. Accepted for publication September5, 2007.

The costs of publication of this article were defrayed in part by the payment of pagecharges. This article must therefore be hereby marked advertisement in accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.1 This work was supported by Hasselt University and the Transnationale UniversiteitLimburg.2 Address correspondence and reprint requests to Dr. Piet Stinissen, Hasselt Univer-sity, Biomedisch Onderzoeksinstituut, and School of Life Sciences, TransnationaleUniversiteit Limburg, Agoralaan, Building A, Diepenbeek, Belgium. E-mail address:[email protected] Abbreviations used in this paper: Treg, regulatory T cell; RA, rheumatoid arthritis;MS, multiple sclerosis; HC, healthy control; SF, synovial fluid; ST, synovial tissue;SFMC, SF mononuclear cell; GrA, granzyme A; GrB, granzyme B; MBP, myelinbasic protein; hCII, human collagen type II; PF, proliferating fraction; TT, tetanustoxoid; MFI, mean fluorescence intensity.

Copyright © 2007 by The American Association of Immunologists, Inc. 0022-1767/07/$2.00

The Journal of Immunology

www.jimmunol.org

by guest on June 2, 2013http://w

ww

.jimm

unol.org/D

ownloaded from

cells toward a diverse set of foreign and autoantigens in both pa-tients with an autoimmune pathology (RA or MS) and healthycontrols (HC). In addition, the cells were analyzed for their tissue-infiltrating and tissue-damaging potential. This study provides newinformation on the potential role of CD4�CD28null T cells in au-toimmune diseases.

Materials and MethodsStudy population and patient material

To study Ag reactivity, peripheral blood was obtained from four MS pa-tients, four RA patients, and four HC. Patients and controls selected for thisstudy had a CD4�CD28null T cell population �5%, which was essential toobtain the minimal amount of cells needed for the experiment. Ab reac-tivity in plasma against CMV was determined at the serology unit of theVirga Jesse Hospital Hasselt with the AxSYM CMV IgM and IgG assay(Abbott Diagnostics) according to the manufacturer’s instructions. MS andRA patients fulfilled the criteria described elsewhere (28, 29). Character-istics of patients and controls are shown in Table I.

In addition, paired blood-synovial fluid (SF) samples were receivedfrom six other RA patients. From two of these patients, synovial tissue (ST)samples were obtained after total knee/hip arthroplasty. Cells were ex-truded from the ST samples via dissection and sieve homogenization.PBMC and SF mononuclear cells (SFMC) were isolated from the bloodand SF, respectively, by Ficoll Hypaque density gradient centrifugation(Sigma-Aldrich). This study was approved by the local medical ethicalcommittee. Informed consent was obtained from all study subjects.

FACS analysis

Percentages of CD4�CD28null T cells in paired blood-SF-ST samples weredetermined by flow cytometric analysis. PBMC-, SFMC-, or the ST-de-rived cells were stained with FITC-labeled anti-CD4, PE-labeled anti-CD28, and PerCP-labeled anti-CD3 Abs (BD Biosciences).

CD4�CD28null and CD4�CD28� T cells were identified using PerCP-labeled Ab directed against CD4- and PE-labeled anti-CD28 Ab (both BDBiosciences) or FITC-labeled anti-CD28 Ab (ImmunoTools). Additionalphenotypical characterization was performed by surface staining with PE-or FITC-conjugated mAbs specific for CD25, CD45RO, CD62L, TCR��(all BD Biosciences), CD11a, CD27, CD44, CD45RA, or CD49d (all Im-munoTools). Intracellular staining was performed with FITC-labeled gran-zyme A (GrA), PE labeled granzyme B (GrB), or FITC-labeled perforin(all ImmunoTools). Cells were washed twice and analyzed on a FACS-Calibur flow cytometer (BD Biosciences).

Isolation and CFSE labeling of sorted T cells

FITC-labeled anti-CD28 Ab (ImmunoTools), PE-labeled anti-CD28 or anti-CD25 Ab, and PerCP-labeled anti-CD4 Ab (BD Biosciences) were used tostain PBMC. CD4�CD28null, CD4�CD28�, and CD4�CD25high T cellpopulations were sorted using a high-speed FACSAria cell sorter (BDBiosciences).

Isolated CD4� T cell subsets were labeled with 1 �M CFSE (VybrantCFDE cell tracer kit; Molecular Probes/Invitrogen Life Technologies) inPBS (Cambrex Bio) for 7 min at 37°C followed by a 15-min incubation at37°C in RPMI 1640 medium supplemented with L-glutamine, 10 mM

HEPES buffer, 1 mM sodium pyruvate, 1% nonessential amino acids (allobtained from Invitrogen Life Technologies), 50 U/ml penicillin, 50 �g/mlstreptomycin (Invitrogen Life Technologies), and 10% heat-inactivatedFBS (HyClone). Cells were washed and resuspended in an appropriatevolume of culture medium.

CFSE-based proliferation assay

Ag specificity of sorted CD4�CD28null T cells was determined in a CFSE-based proliferation assay. Ag reactivity of CD4�CD28� T cells was ana-lyzed in parallel to confirm high sensitivity of the assay. CFSE-labeledCD4�CD28null T cells were cultured in culture medium supplemented withIL-2 (0.5 U/ml) in U-bottom 96-well plates (Nunc). Autologous PBMCwere loaded with tetanus toxoid (TT; 20 limit of flocculation/ml; RIVM),myelin basic protein (MBP; 100 �g/ml, purified from white matter of hu-man brain as described (30)), human collagen type II (hCII, 100 �g/ml;Morwell Diagnostics), or CMV (7 �g/ml; BD Biosciences/BD Pharmin-gen). The CMV peptide pool consisted of 138 peptides of 15-aa residuesthat completely span the pp65 protein sequence of the AD-169 strain, with11 aa overlaps (31). Because CMV peptides were dissolved in DMSO,DMSO was included in the assay as a control condition. CFSE-labeledresponder cells (2–5 � 104) were stimulated with 1.5 � 105 Ag-loadedirradiated PBMC. Unloaded PBMC were used in the positive and negativecontrol conditions. As a positive control, anti-CD3 mAb (2 �g/ml, house-made clone 2G3) was added. After 5 days of culture, IL-2 (2 U/ml) wasadded to the cell cultures. Eight days after set-up, a fraction of the cells waspelleted for subsequent molecular analyses and another fraction of the cellswas used for FACS analysis. PE-conjugated anti-CD28 Ab and 7-amino-actinomycin D (BD Biosciences) were used to evaluate the proliferativeresponses of living CD4�CD28null T cells. The � proliferating fraction(�PF) was calculated as the percentage of divided cells in a specific con-dition minus the percentage of proliferated cells in the unstimulated con-dition (background proliferation).

Analysis of TCR BV gene usage and CDR3 fragment length ofCMV-reactive CD4�CD28null T cells

Semiquantitative TCR BV analysis was performed on CMV- or anti-CD3mAb-stimulated CD4�CD28null T cells. RNA isolation (Roche Diagnos-tics) and cDNA synthesis (Promega) were performed according to the man-ufacturer’s recommendations. The oligonucleotide sequences of the TCRBV-specific primers are shown in Table II. These primer pairs amplify the23 functional TCR BV genes and are adapted to the current nomenclature(32). PCR amplification was performed with 1 of 23 TCR BV gene-specificprimer pairs or a TCR BC gene-specific primer pair. PCR contained 50 ngof cDNA, 1� PCR buffer, 0.2 mM dNTP, 2 pmol TCR BV gene-specificforward primer, 2 pmol BV gene-specific reverse primer, and 1 U of TaqPolymerase in a total volume of 20 �l. The amplification consisted of 35cycles of 95°C for 20 s, 61°C for 20 s, and 72°C for 40 s. PCR ampliconswere subjected to electrophoresis, visualized by staining with ethidiumbromide, and DNA band intensities were analyzed with Quantity One soft-ware (Bio-Rad). Band intensities of all analyzed TCR BV genes weresummed and the relative expression of each TCR BV gene was calculatedto this total expression value. The PCR amplicons that were subjected toCDR3 fragment length analysis were reamplified for 25 cycles using a BVgene-specific forward primer (Table II) and a FAM-labeled TCR BC re-verse primer (5�-FAM-GT GGC CAG GCA CAC CAG TGT GGC C-3�).

Table I. Characteristics of patients and controlsa

Age (Years) Gender (M/F)Disease Duration

(Years)CD4�CD28null

T Cells (%)Anti-CMVIgG (U/ml) Medication

HC1 30 M 5.3 �250HC2 33 M 10.7 239.8HC3 30 F 9.4 �250HC4 48 M 11.7 �250RA1 76 M 19 6.5 219.9 ColchicineRA2 59 F 7 9.6 �250 Anti-TNF�, MTXRA3 64 F 5 10.5 �250 MTXRA4 71 F 16 11.8 113.6 SSZMS1 39 F 10 7.4 �250MS2 50 F 2 8.1 NA TyroxineMS3 50 F 2 5.5 NAMS4 51 M 9 5.7 243.6

a M, Male; F, female; %, percentage; NA, not analyzed; MTX, methotrexate; SSZ, sulfasalazine.

6515The Journal of Immunology

by guest on June 2, 2013http://w

ww

.jimm

unol.org/D

ownloaded from

PCR mixtures (50 �l) contained 1� PCR buffer, 5 pmol primers, 0.2 mMdNTP, 2 U of Taq polymerase, and 1 �l of PCR product. Fluorescentlylabeled PCR products were analyzed on the ABI Prism 310 Genetic Anal-yser (Applied Biosystems).

Suppression assay

For three HC, the suppressive capacity of CD4�CD25high Treg cells to-ward CD4�CD28null T cells was measured using a coculture assay. FACS-sorted, CFSE-labeled CD4�CD28null or CD4�CD28� responder cells (2 �104/well) were cultured with 1 � 105 irradiated, autologous PBMC in thepresence (1:1 ratio) or absence (1:0 ratio) of FACS-sorted Treg cells. Cellswere stimulated with 2 �g/ml anti-CD3 mAb and 0.1 U/ml IL-2. All con-ditions were performed in triplicate. After 5 days of coculture, proliferationwas measured by analyzing the CFSE signal on a FACSCalibur flow cy-tometer. Proliferation in all conditions was expressed relative to theproliferation in the 1:0 condition.

Detection of IFN-� and GrB by ELISA

Cell-free culture supernatants from the suppression assays and the Ag-specificity assays were collected. IFN-� and/or GrB production were mea-sured by ELISA using CytoSets (BioSource International) and a commer-cially available GrB Ab pair (Mabtech), respectively. Assays wereperformed according to the manufacturer’s instructions. OD were mea-sured at 450 nm using an ELISA reader (Bio-Rad). Background levels(unstimulated conditions) of IFN-� and GrB production were subtractedfrom the cytokine levels measured in the Ag-stimulated conditions. In thecoculture experiment, IFN-� production in the 1:0 ratio (only respondercells) was set at 100%. IFN-� production in the other conditions was ex-pressed relative to the IFN-� production in the 1:0 condition.

Statistical analysis

Statistical analyses were performed using Graphpad Prism version 4.00. Tocompare the expression of molecules between CD4�CD28null andCD4�CD28� T cells, data were analyzed by Wilcoxon matched-pairssigned-ranks test. Differences between study groups were calculated byKruskal-Wallis test. Dunn’s multiple comparison test was used as post-hoctest. A p value �0.05 was considered statistically significant.

ResultsPhenotypical characterization of CD4�CD28null T cells

The expression of CD45RO, TCR��, CD27, and CD25 onCD4�CD28null T cells of five HC, five RA, and five MS patientswas analyzed by flow cytometry. Representative dot plots areshown in Fig. 1A. Like their CD28� counterparts, the majority of

CD4�CD28null T cells expresses CD45RO and a TCR consistingof an �� heterodimer (Fig. 1, B and C). In contrast toCD4�CD28� T cells, CD4�CD28null T cells have lost the expres-sion of another costimulatory molecule CD27. In addition,CD4�CD28null T cells do not express the IL-2R �-chain (CD25)direct ex vivo, whereas CD25 is variably expressed byCD4�CD28� T cells (Fig. 1, B and C).

To study the expression of cytotoxic markers in CD4�CD28null

T cells, PBMC were intracellularly stained for the presence ofvarious cytotoxic molecules. In contrast to their CD28� counter-parts, the majority (�75%) of CD4�CD28null T cells have cyto-plasmic stores of GrA, GrB, and perforin. Representative dot plotsare shown in Fig. 1D.

These results demonstrate that CD4�CD28null T cells are Ag-experienced, terminally differentiated cells, equipped with an ex-tensive cytolytic machinery. CD4�CD28null T cells of HC, RA,and MS patients did not differ for the expression of the studiedproteins.

CD4�CD28null T cell infiltration in inflamed tissues

To study whether CD4�CD28null T cells are equipped to infiltrateinto tissues, expression of the adhesion molecules CD11a, CD44,CD49d, and CD62L was examined. Representative dot plots forthe expression of these markers in CD28� and CD28null CD4� Tcells are shown in Fig. 2A. Nearly all CD4�CD28� andCD4�CD28null T cells express CD44 and integrin �L (CD11a; Fig.2, B and C). However, as indicated by the mean fluorescence in-tensity (MFI), CD4�CD28null T cells express significantly higherlevels of CD11a than their CD28� counterparts ( p � 0.01, Fig. 2,D and E). In contrast to CD4�CD28� T cells, all CD4�CD28null

T cells express integrin �4 (CD49d), a molecule that enables in-teraction with the extracellular matrix (Fig. 2, B and C). As com-pared with CD28� T cells, a smaller fraction of CD4�CD28null Tcells expresses the lymph node homing receptor CD62L and alsothe level of expression is decreased in this T cell subset (Fig. 2,B–E). Remarkably, CD62L was expressed by a smaller fraction ofCD4� T cells in MS patients as compared with HC ( p � 0.05).Overall, these results clearly show that CD4�CD28null T cells ex-press molecules that allow tissue infiltration. Besides, for CD62L,

Table II. Sequences of TCR BV gene-specific primer pairs

BV Sequence 5� 3 3� (Forward) Sequence 5� 3 3� (Reverse)

2 CACAGATGGGACAGGAAGTGATC GTCCTCCAGCTTTGTGGACCG3 CCAAAATACCTGGTCACACAG CCAGGGAATTGATGTGAAGATT4 CATGGGAATGACAAATAAGAAGTCT TGGCTGCAGGGCGTGTAGGTG5 GATCAAAACGAGAGGACAGCA AGCACCAAGGCGCTCACATTCA6 TGAAGACAGGACAGAGCATGACA CACAGATGTCTGGGAGGGAGC7 CTCAGGTGTGATCCAATTTCA CCCCCGCTCTGTGCGCTGGAT9 AAGCACCTGATCACAGCAACT TAGTTCAGAGTGCAAGTCAGG10 CAAGACACAAGATCACAGAGACA GGCAGCAGACTCCAGAGTGAG11 CCCAGATATAAGATTACAGAGAAA CTGGATCTTGAGAGTGGAGTC12 CCCCGCCATGAGGTGACAGAG GAGTCCCTGGGTTCTGAGGGC13 AAGAGGGAAACAGCCACTCTG CAGCTCCAAGGAGCTCATGTT14 GTTCCCCAGCCACAGCGTAATA CAGTTCTGCAGGCTGCACCTT15 CCAAGATACCAGGTTACCCAGTTT CAGGCCTGGTGAGCGGATGTC16 AAAACATCTTGTCAGAGGGGAA TGAATCCTCAAGCTTCGTAGC18 AGACACCTGGTCAGGAGGAGG TGCCGAATCTCCTCGCACTAC19 GTCCCCAAAGTACCTGTTCAGA AGCTGTCGGGTTCTTTTGGGC20 GGTTATCTGTAAGAGTGGAACCT AGGATGGGCACTGGTCACTGT24 TCACAAAGACAGGAAAGAGGATT GGGGATGGCAGACTCTAGGGA25 TTATAGGGACAGGAAAGAAGATC ATGTGAGGGCCTGGCAGACTC27 ACCCAAGATACCTCATCACAGTG AGAGGTCTGGTTGGGGCTGGG28 TCGAGATATCTAGTCAAAAGGACG GGTGCTGGCGGACTCCAGAAT29 AAGCAGGGATATCTGTCAACGT TTCAGGGCTCATGTTGCTCAC30 GACCCTGGTGCAGCCTGTG GAGGAGGAGCTTCTTAGAACT

6516 CD4�CD28null T CELLS IN AUTOIMMUNE DISEASE

by guest on June 2, 2013http://w

ww

.jimm

unol.org/D

ownloaded from

no differences in the expression of the studied adhesion moleculeswere found between the HC (n � 5), RA (n � 5), and MS patients(n � 5) tested.

We then analyzed whether CD4�CD28null T cells could indeedbe detected at (disease relevant) tissue sites. Despite elevated per-centages (�4%) of CD4�CD28null T cells in the blood of three ofsix RA patients, CD4�CD28null T cells could not be detected inthe SF of any of the studied patients (Fig. 2F). However,CD4�CD28null T cells were present in both ST samples studied,3.7 and 11.1%, respectively. These results illustrate thatCD4�CD28null T cells can infiltrate and reside in the ST.

Survival and proliferation of CD4�CD28null T cells in vitro

To allow analyses of Ag reactivity, the optimal in vitro cultureconditions of CD4�CD28null T cells were determined. Survivaland proliferation of CFSE-labeled CD4�CD28� andCD4�CD28null T cells were evaluated in the presence of variousconcentrations (0, 0.1, and 2 U/ml) of IL-2. We showed thatCD4�CD28null T cells do not express the IL-2R complex direct exvivo (Fig. 1, A and C). Nevertheless, we found that addition ofIL-2 to the culture medium was essential for survival and prolif-eration of the CD4�CD28null T cells and that the effect was dosedependent (Fig. 3). Upon stimulation, CD4�CD28null T cells up-regulate CD25 expression (data not shown). However, because oftheir deficient IL-2 production (10), they depend on externalsources of IL-2 for survival and proliferation.

In contrast to CD4�CD28� T cells, �20% of theCD4�CD28null T cells proliferate in the absence of costimulation(condition without feeders). The addition of autologous feederssignificantly increased proliferation (PF � 95%) in both cell sub-sets. Representative dot plots demonstrating the in vitro culturebehavior of both CD28� and CD28null CD4� T cells are shown inFig. 3. Obviously, CD4�CD28� and CD4�CD28null T cells be-have different in in vitro cultures and addition of low levels of IL-2to in vitro CD4�CD28null T cell cultures is essential.

Reactivity of CD4�CD28null T cells to candidate autoantigensin MS and RA

To determine whether CD4�CD28null T cells show reactivity toautoantigens, sorted CD4�CD28null T cells were stimulated withhCII or MBP, two putative autoantigens in RA and MS, respec-tively. TT was included in the assay as a foreign recall control Ag.Also, reactivity of CD4�CD28null T cells toward CMV was eval-uated because CMV infection has been associated with the expan-sion of CD4�CD28null T cells (7, 16). We included DMSO as acontrol condition, because CMV peptides were dissolved inDMSO. However, in none of the studied subjects was proliferationof CD4�CD28null T cells induced when DMSO only was added.Example histogram plots illustrating the proliferative responses ofboth CD4�CD28� and CD4�CD28null T cells toward differentstimuli are shown in Fig. 4A. In a subset of patients and controls,MBP- and/or hCII-reactive CD4�CD28� T cells could be detectedwhich illustrates that the sensitivity of this assay is sufficient todetect autoantigen-reactive T cells (data not shown). If present,this assay should be able to detect MBP- or hCII-reactiveCD4�CD28null T cells. Fig. 4B shows the proliferative responsesof both patients and controls to the tested Ags. In only one HC(HC1: hCII) and one MS patient (MS1: hCII and MBP), a smallproportion of proliferating CD4�CD28null T cells (�PF � 15%)could be detected upon stimulation with candidate autoantigens.TT-specific proliferation was observed in CD4�CD28null T cellsof one HC (HC1, �PF � 17%), one RA patient (RA3, �PF � 6%),and one MS patient (MS1, �PF � 34%). Interestingly, specificproliferation of a fraction of CD4�CD28null T cells was observedupon CMV stimulation in four of four RA patients, three of fourMS patients, and four of four controls (Fig. 4B). In addition, wetested plasma samples for the presence of CMV-specific Abs andfound reactivity in all subjects tested (Table I). Despite the pres-ence of anti-CMV Abs, no reactivity of CD4�CD28null T cellsagainst CMV or any of the other studied Ags was observed inMS4. Fig. 4C shows the fraction of CD4�CD28null T cells with no

FIGURE 1. Phenotypical characterization of CD4�

CD28null T cells. A, The expression of CD45RO,TCR��, CD27, and CD25 on CD4�CD28null andCD4�CD28� T cells was analyzed by flow cytometry.PBMC of five HC, five RA, and five MS patients werefluorescently stained with Abs directed to CD28, CD4,and one of the indicated molecules. Representative dotplots, gated on CD4� lymphocytes, are shown. B, Thepercentage of CD4�CD28� T cells, expressingCD45RO, TCR��, CD27, and CD25, is shown. Barsindicate the mean of five subjects, error bars indicateSEM. C, The percentage of CD4�CD28null T cells,expressing CD45RO, TCR��, CD27, and CD25, isshown. Bars indicate the mean of five subjects; errorbars indicate SEM. ��, p � 0.01 as compared withCD4�CD28� T cells. D, Intracellular deposits of cy-totoxic molecules in CD4�CD28null and CD4�

CD28� T cells. PBMC were surface stained with fluo-rescently labeled Abs to CD4 and CD28. Additionally,cells were intracellularly stained with Abs directed toGrA, GrB, or perforin.

6517The Journal of Immunology

by guest on June 2, 2013http://w

ww

.jimm

unol.org/D

ownloaded from

dilution in their CFSE content upon CMV stimulation for everystudy subject. These cells represent CMV-unresponsive cells. Incontrast to RA patients and HC, a substantial fraction(55.1–99.4%) of CD4�CD28null T cells of the MS patients appearsto be CMV unresponsive. In Fig. 4D, the �PF in the CMV-stim-ulated condition is expressed relative to the �PF in the anti-CD3mAb-stimulated condition. In the RA patients and HC, but not in

the MS patients, the level of the CMV response was comparable tothe proliferation induced by anti-CD3 mAb stimulation illustratingthat almost all responsive cells were CMV reactive.

In addition, IFN-� and GrB secretion in the culture supernatantswas determined by ELISA. In general, these data confirmed theresults of the proliferation assay. In the majority of patients andcontrols, CD4�CD28null T cells secreted large amounts (�500 pg/

FIGURE 2. Tissue-infiltrating properties of CD4�

CD28null T cells. The expression of CD11a, CD44,CD49d, and CD62L on CD4�CD28null and CD4�CD28�

T cells was analyzed by flow cytometry. PBMC werestained with fluorescently labeled Abs directed to CD28,CD4, and one of the indicated adhesion molecules. Gatingwas performed on CD4� lymphocytes. A, Dot plots, rep-resentative of five HC, five RA, and five MS patients areshown. B, The percentage of CD4�CD28� T cells, ex-pressing CD11a, CD44, CD49d, and CD62L, is shown.Bars indicate the mean of five subjects; error bars indicateSEM. �, p � 0.05 as compared with HC. C, The percent-age of CD4�CD28null T cells, expressing CD11a, CD44,CD49d, and CD62L, is shown. Bars indicate the mean offive subjects; error bars indicate SEM. **, p � 0.01 ascompared with CD4�CD28� T cells. �, p � 0.05 as com-pared with HC. D, The MFI of CD11a, CD44, CD49d, andCD62L on CD4�CD28� T cells is shown. Bars indicatethe mean of five subjects; error bars indicate SEM. E, TheMFI of CD11a, CD44, CD49d, and CD62L onCD4�CD28null T cells is shown. Bars indicate the mean offive subjects, error bars indicate SEM. ��, p � 0.01 ascompared with CD4�CD28� T cells. F, The percentage ofCD4�CD28null in paired peripheral blood, synovial fluidand synovial tissue samples of RA patients. Percentages ofCD28null cells within the total CD4� T cell populationwere determined by means of FACS analysis. Paired sam-ples are connected by a line.

FIGURE 3. In vitro culture conditions of CD4�CD28null and CD4�CD28� T cells. CD4�CD28null and CD4�CD28� T cells were isolated by meansof FACS sorting. Cell subsets were labeled with CFSE and cultured under different conditions. Cells were cultured in the presence or absence of autologousirradiated PBMC (feeders), unstimulated or stimulated with anti-CD3 Ab, and cultured with various concentrations of IL-2 (U/ml). After a culture periodof 5 days, CFSE dilution was determined by flow cytometric analysis. Histogram plots representative for two HC are shown. Numbers in the histogramplots illustrate the proliferated fraction (PF) in the corresponding condition.

6518 CD4�CD28null T CELLS IN AUTOIMMUNE DISEASE

by guest on June 2, 2013http://w

ww

.jimm

unol.org/D

ownloaded from

ml) of IFN-� and GrB upon CMV stimulation (Table III). Despitethe presence of some CD4�CD28null proliferating cells, no IFN-�or GrB release could be detected in MS1 upon stimulation withMBP or hCII. An interesting observation was the low, but detect-able, IFN-� and/or GrB excretion in response to collagen type IIstimulation in three of four RA patients and three of four HC.Additionally, TT and MBP induced small amounts of GrB and/orIFN-� excretion in various study subjects.

Altogether, these data show that CD4�CD28null T cells of RAand MS patients are not reactive to the autoantigens tested in thisstudy. CD4�CD28null T cells appear to be mainly CMV reactivecells in both RA patients and HC. Of note is that a fraction of theCD4�CD28null T cells in MS patients might show reactivity toother Ags than those tested in this study.

TCR BV analysis of the CMV-specific T cell response

To evaluate the diversity of the CMV-specific T cell response, asemiquantitative TCR BV PCR analysis was performed on CMV-stimulated CD4�CD28null T cells. In general, a relatively broad setof TCR BV genes was expressed within CMV-reactiveCD4�CD28null T cells. However, in some individuals (HC2, RA3,MS1, MS2, and MS3) one single predominant TCR BV family,

constituting more than one-third of the expressed TCR BV reper-toire, could be identified (Fig. 5) and this appeared to be associatedwith a diminished CMV-induced immune response (Fig. 4D). Inall patients and controls, two to five overexpressed BV genes wereidentified which indicates that several CMV epitopes are recog-nized. These BV families each represent �10% of the expressedBV genes. To demonstrate the presence of CD4�CD28null T cellsthat are not CMV reactive, TCR BV gene analysis was also per-formed for anti-CD3-stimulated CD4�CD28null T cells for onesubject from each study group. In the anti-CD3-stimulatedCD4�CD28null T cells of the RA patient and HC, the repertoire ofexpressed TCR BV genes largely corresponded with that of theCMV-stimulated cells (Fig. 5). In contrast, in the MS patient, someTCR BV genes which were expressed in the anti-CD3-stimulatedCD4�CD28null T cells could not be detected in the CMV-stimu-lated cells. This could implicate that a fraction of theCD4�CD28null T cells is not CMV specific.

In addition, a subset of TCR BV genes overexpressed in theCMV-stimulated condition were subjected to CDR3 fragmentlength analysis. Results demonstrated that the overexpressed TCRBV families mostly displayed a monoclonal (14 of 22) or oligo-clonal (5 of 22) CDR3 length profile which illustrates that

FIGURE 4. Antigenic reactivity of CD4�CD28null T cells. A, Representative dot plots showing the proliferative response of both CD4�CD28null andCD4�CD28� T cells in response to various stimuli. FACS-sorted CD4�CD28null and CD4�CD28� T cells were labeled with CFSE and stimulated withAg-pulsed irradiated PBMC. After 8 days, CFSE dilution was analyzed by FACS analysis. B, Proliferative response of CD4�CD28null T cells to anti-CD3,TT, MBP, hCII, and CMV in four HC, four RA patients, and four MS patients. The �PF was determined for every stimulus in all subjects studied. A �PF �0, illustrates a specific proliferative response. Every bar represents an individual. C, The fraction of CMV-unresponsive CD4�CD28null T cells. For everyindividual tested, the fraction of CMV unresponsive cells was determined. These cells did not dilute their CFSE content upon CMV stimulation. D, Thelevel of the CMV-specific response of CD4�CD28null T cells in four HC, four RA patients, and four MS patients. The �PF of CMV-stimulatedCD4�CD28null T cells was expressed relative to the �PF of anti-CD3 stimulated CD4�CD28null T cells within every study subject. A relative CMVresponse of 1.0 indicates that the immune response to CMV was comparable to that induced by anti-CD3 stimulation.

6519The Journal of Immunology

by guest on June 2, 2013http://w

ww

.jimm

unol.org/D

ownloaded from

CD4�CD28null T cells are clonally expanded cells (results are in-corporated in Fig. 5).

The data illustrate that the CMV-induced CD4�CD28null T cellresponse is polyclonal, but more specifically, the cells involved in theCMV-response are clonally expanded. In addition, a fraction of theCD4�CD28null T cells in MS patients appears to be non-CMVreactive.

Suppressive capacity of CD4�CD25high Treg cells towardCD4�CD28null T cells

CD4�CD25� Treg cells are an important arm of the immune sys-tem that down-regulates potentially harmful effector immune re-sponses. In vitro studies showed that Treg cells are anergic and cansuppress proliferation and cytokine production of activated

FIGURE 5. Expression of TCR BV genes in CMV or anti-CD3 Ab stimulated CD4�CD28null T cells. Expression of TCR BV genes was determined bysemi quantitative PCR analysis. DNA band intensities were analyzed with Quantity One software. Band intensities of all analyzed TCR BV genes wereadded and the relative expression of each TCR BV gene was calculated. The TCR BV expression profile upon CMV stimulation is shown for four HC, fourRA patients, and three MS patients. The TCR BV expression profile upon anti-CD3 Ab stimulation is shown for HC 3, RA 1, and MS 2. In addition, a subsetof overexpressed TCR BV genes was subjected to CDR3 fragment length analysis. Analyzed TCR BV genes displaying a monoclonal, oligoclonal, orpolyclonal CDR3 fragment length profile are indicated.

Table III. Cytokine response of sorted CD4�CD28null T cells to various stimulia

anti-CD3 TT MBP hCII CMV

IFN-� GrB IFN-� GrB IFN-� GrB IFN-� GrB IFN-� GrB

HC1 �� �/ �� ��� ���HC2 �� �� ���HC3 �� ��� � � �/ �/ �/ ��� ���HC4 �� ��� �/ ��� ���RA1 �� �� �/ � �� ���RA2 � ��� �/ �� ���RA3 � �/ �/ � �� ��RA4 � �/ �/ �/ �/ � ��MS1 ��� ��� � � ��� ���MS2 ��� ��� �/ �� ��MS3 �� �� � �MS4 �� ���

a IFN-� and GrB secretion were measured by means of ELISA in the culture supernatants of CD4�CD28null T cells stimulated with various Ags. Theamount of secreted IFN-� or GrB was divided arbitrarily into five levels: , �25 pg/ml; �/, 25–100 pg/ml; �, 100–500 pg/ml; ��, 500–1000 pg/ml;and ���, �1000 pg/ml.

6520 CD4�CD28null T CELLS IN AUTOIMMUNE DISEASE

by guest on June 2, 2013http://w

ww

.jimm

unol.org/D

ownloaded from

CD4�CD25 T cells (reviewed by Shevach (33)). To investigatewhether potentially pathogenic CD4�CD28null T cells can be con-trolled by Treg cells, a CFSE-based suppression assay was per-formed. According to their CD25 expression, CD4�CD25high Tregcells were FACS sorted from PBMC of three HCs (HC1–HC3).Intracellular FACS staining showed that 80, 62, and 84% of thesorted CD4�CD25high Treg cells of HC1–3, respectively wereFOXP3 positive. We have demonstrated before that the addition ofIL-2 is crucial for studying in vitro CD4�CD28null T cell cultures(Fig. 3). Therefore, we first tested the ability of Treg cells to sup-press CD4�CD28�CD25 responder cells in the presence of 0.1U/ml IL-2. Fig. 6, A and B, demonstrate that CD4�CD25high Tcells were able to inhibit both proliferation and cytokine produc-tion of responder CD4�CD28�CD25 T cells in a cell dose-de-pendent manner in the presence of 0.1 U/ml IL-2. Proliferation ofresponder cells, cultured with an equal amount of Treg cells, wassuppressed by 65 9%, whereas IFN-� production was sup-pressed by 84 14%. These results illustrate that Treg cells iso-lated from donors with an expanded CD4�CD28null T cell subsetare fully competent and can suppress responder cell proliferationin the presence of a low dose of IL-2.

In parallel, Treg cells were cocultured with CFSE-labeledCD4�CD28null T cells. Fig. 6C shows that Treg cells are not ableto suppress anti-CD3-induced proliferation of CD4�CD28null Tcells. In contrast, IFN-� production of CD4�CD28null T cells wassuppressed by 56 13% by regulatory CD4�CD25high T cells(Fig. 6D). Suppression of IFN-� production by Treg cells is sig-nificantly less in CD4�CD28null T cells as compared with that inCD4�CD28�CD25 T cells ( p � 0.01). These results demon-strate that cytokine production but not proliferation ofCD4�CD28null T cells can be inhibited by CD4�CD25high Tregcells.

DiscussionCD4�CD28null T cells are chronically activated cells that have losttheir classical helper function. We studied various characteristicsof these cells to reveal their potential role in the pathogenesis of

autoimmune diseases. We previously demonstrated that these cellsare expanded in one in three RA patients and one in four MSpatients (7). Our results indicate that CD4�CD28null T cells dis-play several features of pathogenic cells and are less susceptible toregulation by CD4�CD25high Treg cells. However, we were un-able to demonstrate reactivity to the candidate autoantigens MBPand hCII within the CD4�CD28null T cell subset of MS and RApatients.

Phenotypic characterization showed that CD4�CD28null T cellsare resting (CD25) effector memory cells. The absence of bothCD28 and CD27 surface expression and their dependence on ex-ogenous IL-2 indicates that CD4�CD28null T cells are terminallydifferentiated cells. However, the profound proliferative and cyto-kine response observed in our study shows that these cells are notreplicatively exhausted as was suggested before (10). A fraction ofthe CD4�CD28null T cells can even proliferate in the absence ofcostimulation showing that costimulatory molecules other thanCD28 are involved in complete activation of CD4�CD28null Tcells.

In a CFSE-based proliferation assay, we investigated whetherautoantigens like hCII or MBP could be responsible for the ex-pansion of CD4�CD28null T cells in RA and MS patients. In thisstudy, we found no evidence for autoreactivity of CD4�CD28null

T cells. Ratts et al. (34) did demonstrate that CD8� T cell differ-entiation and associated CD28 loss could be caused by chronicstimulation with myelin Ags. But they also showed that the ma-jority of the CD4� T cell response to myelin Ags wasCD28�CD57 in both MS patients and HC. Our results are, how-ever, in contrast to the data reported by Markovic-Plese and co-workers (8). Using a different approach, they demonstrated thepresence of MBP-reactive cells within the CD4�CD28null T cellsubset. Nevertheless, we believe that the high sensitivity of theassay used in our study together with the strong clonal nature ofCD4�CD28null T cells should have enabled us to detect autoreac-tive CD4�CD28null T cells, if present.

Our results clearly demonstrated that CMV was the drivingforce behind the differentiation of CD4� T cells in RA patients and

FIGURE 6. Suppressive capacity of CD4�CD25high

Treg cells toward CD4�CD28�CD25 T cells andCD4�CD28null T cells. A, Suppression of proliferationof CD4�CD28�CD25 T cells. CFSE-labeledCD4�CD28�CD25 responder T cells were culturedwith varying amounts of Tregs. All conditions were per-formed in triplicate. Proliferation in the 1:0 ratio (re-sponders alone) was set at 100%. Proliferation ofCD4�CD28�CD25 T cells in coculture with varyingamounts of Treg cells was calculated relative to prolif-eration in the 1:0 ratio. B, Suppression of cytokine pro-duction of CD4�CD28�CD25 T cells. IFN-� excre-tion in the culture supernatants was measured byELISA. Cytokine excretion in the various responder toTreg ratios was expressed relative to the cytokine pro-duction in the 1:0 ratio. Bars indicate the mean for threeHC; error bars indicate the SEM. C, Suppression of pro-liferation of CD4�CD28null T cells. D, Suppression ofcytokine production of CD4�CD28null T cells.

6521The Journal of Immunology

by guest on June 2, 2013http://w

ww

.jimm

unol.org/D

ownloaded from

HC. The CMV-specific CD4�CD28null T cell proliferative re-sponse was directed to several CMV epitopes and appeared to bestronger when the number of epitopes recognized was larger. Wedemonstrated that a large proportion of CD4�CD28null T cells inMS patients was not reactive to CMV or any of the other Agstested in this study. Therefore, the antigenic specificity of theseCMV-unresponsive cells remains speculative. In one MS patient, aminor fraction of the CD4�CD28null T cells was TT reactive. Re-activity toward other CMV Ags, other self-Ags (myelin oligoden-drocyte glycoprotein, phospholipid protein, . . . ) or other viruses,like, for example, EBV, could be responsible for our observations.Several studies revealed that EBV infection could be linked withboth MS and CD4� T cell differentiation (35, 36).

In general, it has been extremely difficult to demonstrate T cellreactivity against joint derived autoantigens such as hCII in RApatients. One cause may reside in the observed T cell hyporespon-siveness toward recall Ags in RA patients (37, 38). Otherwise, apartial tolerization to hCII may account for the absence of a pro-liferative response toward hCII in RA patients. Several studieshave therefore used cytokine production instead of proliferation asparameter of response (39). Despite the secretion of small amountsof IFN-� and/or GrB upon stimulation with hCII, it is quite clearthat the majority of the highly differentiated CD4�CD28null T cellsin RA patients are CMV-reactive cells.

Although CD4�CD28null T cells do not appear to be autoreac-tive cells, their enrichment in 33% of the RA patients and 24% ofthe MS patients supports their involvement in autoimmune patho-genesis (7). In some individuals, CD28null T cells make up morethan half of the CD4� T cell population, in this way diminishingimmunological space and survival factors that are otherwise avail-able for functional T cells, including Treg cell subsets. This changemay cause a breakdown in tolerance and contribute to autoaggres-sive immune manifestations. In addition, it cannot be excluded thatCMV-reactive CD4�CD28null T cells are cross-reactive to self-Ags, other than hCII and MBP which were tested in this study.Indeed, Brok et al. (40) described that the human CMV-UL86peptide 981–1003 shares a cross-reactive T cell epitope with theencephalitogenic myelin oligodendrocyte glycoprotein peptide34–56. Nevertheless, the degeneracy in both the TCR and MHCpeptide-binding motifs make it very hard to predict cross-reactivityof CMV-reactive CD4�CD28null T cells toward a self-peptide(41). Also, it should be noted that this and other studies focused onperipheral CD4�CD28null T lymphocytes. It is possible that thedisease-relevant CD4�CD28null T cells are located within thetissues expressing other TCR specificities.

Based on the surface expression of several adhesion molecules,CD4�CD28null T cells posses the capacity to infiltrate into tissues.This finding was confirmed by the detection of these cells in thesynovial tissue of RA patients. In addition, we showed thatCD4�CD28null T cells contain cytoplasmic granules of granzymesand perforin which are depleted upon TCR triggering. In a previ-ous study, Nakajima et al. (18) demonstrated that CD4�CD28null

T cells from patients with unstable angina can kill endothelial cellsthrough the release of the pore-forming enzyme perforin. It isknown that CMV can infect many different types of cells, includ-ing epithelial cells, endothelial cells, macrophages, fibroblasts,neuronal cells, smooth muscle cells, and hepatocytes (42). Ourpreliminary data indicate that CD4�CD28null T cells can kill dis-ease relevant cell types, like synovial fibroblasts and oligodendro-glial cells, cell types involved in RA and MS pathology, respec-tively (data not shown). In this way, CD4�CD28null T cells maycontribute to tissue damage and the release of self-Ags. In addi-tion, activation of CD4�CD28null T cells can create a proinflam-

matory, cytotoxic environment in which autoreactive T cells maybe activated in a nonspecific manner (bystander activation).

This study shows that CD4�CD28null T cells are only partiallysusceptible to the regulatory capacities of Treg cells. Fully com-petent Treg cells can diminish the proinflammatory properties ofthe CD4�CD28null T cells, but cannot prevent their expansion. Inmice, it has also been shown that Treg cells may suppress effectorcell function but not proliferation (43). Apparently, proliferationand cytokine production are regulated independently. In humans, atarget of Treg suppression seems to be transcriptional control ofIL-2 in effector cells (44). However, CD4�CD28null T cells havebeen described to have a deficient IL-2 production (10) and maytherefore be resistant to the regulatory properties of Treg cells. Thefailure of Treg cells to suppress CD4�CD28null T cell proliferationmay contribute to the expansion of this aberrant cell population.The ability of Treg cells to down-regulate immune responses sug-gests that these cells may have therapeutic applications for thetreatment of human autoimmune diseases (45). Results from thisstudy may have implications for the efficacy of Treg therapy inautoimmune diseases as target cells may not be vulnerable to thesuppressive capacities of Tregs.

CD4�CD28null T cells of RA and MS patients do not differsignificantly from CD4�CD28null T cells in HC. This may indicatethat these cells do not contribute to pathology, and are potentiallyan epiphenomenon of the disease. However, it may also indicatethat the mere presence of these cells is not sufficient to cause pa-thology but that these cells are involved in the disease in an indi-rect manner. For instance, it was shown that reactivation of CMVis linked to activation of the immune system (46). In the case ofRA, joint trauma may initiate joint inflammation. This inflamma-tory microenvironment may then result in reactivation of the latentCMV virus, activation of CD4�CD28null T cells, and a sustainedimmune response against the virus and consequently the joint be-cause the immune system cannot eliminate the viral infection. Inthis way, CD4�CD28null T cells could play an indirect role insustaining the chronic inflammation in the joints.

In conclusion, this study demonstrates that CD4�CD28null Tcells have pathogenic capacities, fill up immunological space, andare less vulnerable to regulatory mechanisms. Our data provideseveral indications for a role of CD4�CD28null T cells in autoim-mune pathology, although a direct autoaggressive involvement inthe pathogenesis is unlikely.

AcknowledgmentsWe thank patients and controls for their blood donations and Prof.P. Geusens, Dr. R. Medaer, Dr. J. van Hoof, and Anne Bogaers for assis-tance in collecting the blood samples. We also thank Henk van Rie andJozien Jaspers-Spits of the Department of Clinical and Experimental Im-munology, University Hospital Maastricht, for the expert sorting of specificT cell subsets and the staff of the Serology Unit (head: Dr. J.-L. Rummens)of the Virga Jesse Hospital Hasselt for performing CMV serology.

DisclosuresThe authors have no financial conflict of interest.

References1. Skapenko, A., J. Leipe, P. E. Lipsky, and H. Schulze-Koops. 2005. The role of

the T cell in autoimmune inflammation. Arthritis Res. Ther. 7(Suppl. 2): S4–S14.2. Sospedra, M., and R. Martin. 2005. Immunology of multiple sclerosis. Annu. Rev.

Immunol. 23: 683–747.3. Hellings, N., J. Raus, and P. Stinissen. 2002. Insights into the immunopathogen-

esis of multiple sclerosis. Immunol. Res. 25: 27–51.4. Viglietta, V., C. Baecher-Allan, H. L. Weiner, and D. A. Hafler. 2004. Loss of

functional suppression by CD4�CD25� regulatory T cells in patients with mul-tiple sclerosis. J. Exp. Med. 199: 971–979.

5. Venken, K., N. Hellings, K. Hensen, J. L. Rummens, R. Medaer, M. B.D’hooghe, B. Dubois, J. Raus, and P. Stinissen. 2006. Secondary progressive incontrast to relapsing-remitting multiple sclerosis patients show a normal

6522 CD4�CD28null T CELLS IN AUTOIMMUNE DISEASE

by guest on June 2, 2013http://w

ww

.jimm

unol.org/D

ownloaded from

CD4�CD25� regulatory T-cell function and FOXP3 expression. J. Neurosci.Res. 83: 1432–1446.

6. Ehrenstein, M. R., J. G. Evans, A. Singh, S. Moore, G. Warnes, D. A. Isenberg,and C. Mauri. 2004. Compromised function of regulatory T cells in rheumatoidarthritis and reversal by anti-TNF� therapy. J. Exp. Med. 200: 277–285.

7. Thewissen, M., V. Somers, K. Venken, L. Linsen, P. van Paassen, P. Geusens,J. Damoiseaux, and P. Stinissen. 2007. Analyses of immunosenescent markers inpatients with autoimmune disease. Clin. Immunol. 123: 209–218.

8. Markovic-Plese, S., I. Cortese, K. P. Wandinger, H. F. McFarland, and R. Martin.2001. CD4�CD28 costimulation-independent T cells in multiple sclerosis.J. Clin. Invest. 108: 1185–1194.

9. Fasth, A. E., D. Cao, R. van Vollenhoven, C. Trollmo, and V. Malmstrom. 2004.CD28nullCD4� T cells–characterization of an effector memory T-cell populationin patients with rheumatoid arthritis. Scand. J. Immunol. 60: 199–208.

10. Appay, V., J. J. Zaunders, L. Papagno, J. Sutton, A. Jaramillo, A. Waters,P. Easterbrook, P. Grey, D. Smith, A. J. McMichael, et al. 2002. Characterizationof CD4� CTLs ex vivo. J. Immunol. 168: 5954–5958.

11. Snyder, M. R., L. O. Muegge, C. Offord, W. M. O’Fallon, Z. Bajzer,C. M. Weyand, and J. J. Goronzy. 2002. Formation of the killer Ig-like receptorrepertoire on CD4�CD28null T cells. J. Immunol. 168: 3839–3846.

12. Yen, J. H., B. E. Moore, T. Nakajima, D. Scholl, D. J. Schaid, C. M. Weyand, andJ. J. Goronzy. 2001. Major histocompatibility complex class I-recognizing re-ceptors are disease risk genes in rheumatoid arthritis. J. Exp. Med. 193:1159–1167.

13. Duftner, C., C. Goldberger, A. Falkenbach, R. Wurzner, B. Falkensammer,K. P. Pfeiffer, E. Maerker-Hermann, and M. Schirmer. 2003. Prevalence, clinicalrelevance and characterization of circulating cytotoxic CD4�CD28 T cells inankylosing spondylitis. Arthritis Res. Ther. 5: R292–R300.

14. Nakajima, T., O. Goek, X. Zhang, S. L. Kopecky, R. L. Frye, J. J. Goronzy, andC. M. Weyand. 2003. De novo expression of killer immunoglobulin-like recep-tors and signaling proteins regulates the cytotoxic function of CD4 T cells inacute coronary syndromes. Circ. Res. 93: 106–113.

15. Komocsi, A., P. Lamprecht, E. Csernok, A. Mueller, K. Holl-Ulrich, U. Seitzer,F. Moosig, A. Schnabel, and W. L. Gross. 2002. Peripheral blood and granulomaCD4�CD28 T cells are a major source of interferon-� and tumor necrosis fac-tor-� in Wegener’s granulomatosis. Am. J. Pathol. 160: 1717–1724.

16. van Leeuwen, E. M., E. B. Remmerswaal, M. T. Vossen, A. T. Rowshani,P. M. Wertheim-van Dillen, R. A. van Lier, and I. J. ten Berge. 2004. Emergenceof a CD4�CD28 granzyme B�, cytomegalovirus-specific T cell subset afterrecovery of primary cytomegalovirus infection. J. Immunol. 173: 1834–1841.

17. Gerli, R., G. Schillaci, A. Giordano, E. B. Bocci, O. Bistoni, G. Vaudo,S. Marchesi, M. Pirro, F. Ragni, Y. Shoenfeld, and E. Mannarino. 2004.CD4�CD28 T lymphocytes contribute to early atherosclerotic damage in rheu-matoid arthritis patients. Circulation 109: 2744–2748.

18. Nakajima, T., S. Schulte, K. J. Warrington, S. L. Kopecky, R. L. Frye,J. J. Goronzy, and C. M. Weyand. 2002. T-cell-mediated lysis of endothelial cellsin acute coronary syndromes. Circulation 105: 570–575.

19. Bryl, E., A. N. Vallejo, E. L. Matteson, J. M. Witkowski, C. M. Weyand, andJ. J. Goronzy. 2005. Modulation of CD28 expression with anti-tumor necrosisfactor � therapy in rheumatoid arthritis. Arthritis Rheum. 52: 2996–3003.

20. Brugaletta, S., L. M. Biasucci, M. Pinnelli, G. Biondi-Zoccai, G. Di Giannuario,G. Trotta, G. Liuzzo, and F. Crea. 2006. Novel anti-inflammatory effect of statins:reduction of CD4�CD28null T lymphocyte frequency in patients with unstableangina. Heart 92: 249–250.

21. Bryl, E., A. N. Vallejo, C. M. Weyand, and J. J. Goronzy. 2001. Down-regulationof CD28 expression by TNF-�. J. Immunol. 167: 3231–3238.

22. Schmidt, D., J. J. Goronzy, and C. M. Weyand. 1996. CD4� CD7 CD28 Tcells are expanded in rheumatoid arthritis and are characterized by autoreactivity.J. Clin. Invest. 97: 2027–2037.

23. Zal, B., J. C. Kaski, G. Arno, J. P. Akiyu, Q. Xu, D. Cole, M. Whelan, N. Russell,J. A. Madrigal, I. A. Dodi, and C. Baboonian. 2004. Heat-shock protein 60-reactive CD4�CD28null T cells in patients with acute coronary syndromes. Cir-culation 109: 1230–1235.

24. Fletcher, J. M., M. Vukmanovic-Stejic, P. J. Dunne, K. E. Birch, J. E. Cook,S. E. Jackson, M. Salmon, M. H. Rustin, and A. N. Akbar. 2005. Cytomegalo-virus-specific CD4� T cells in healthy carriers are continuously driven to repli-cative exhaustion. J. Immunol. 175: 8218–8225.

25. Olsson, J., A. Wikby, B. Johansson, S. Lofgren, B. O. Nilsson, andF. G. Ferguson. 2000. Age-related change in peripheral blood T-lymphocyte sub-populations and cytomegalovirus infection in the very old: the Swedish longitu-dinal OCTO immune study. Mech. Ageing Dev. 121: 187–201.

26. Pawelec, G., A. Akbar, C. Caruso, R. Solana, B. Grubeck-Loebenstein, andA. Wikby. 2005. Human immunosenescence: is it infectious? Immunol. Rev. 205:257–268.

27. Pawelec, G., A. Akbar, C. Caruso, R. Effros, B. Grubeck-Loebenstein, andA. Wikby. 2004. Is immunosenescence infectious? Trends Immunol. 25:406–410.

28. Poser, C. M., D. W. Paty, L. Scheinberg, W. I. McDonald, F. A. Davis,G. C. Ebers, K. P. Johnson, W. A. Sibley, D. H. Silberberg, andW. W. Tourtellotte. 1983. New diagnostic criteria for multiple sclerosis: guide-lines for research protocols. Ann. Neurol. 13: 227–231.

29. Arnett, F. C., S. M. Edworthy, D. A. Bloch, D. J. McShane, J. F. Fries,N. S. Cooper, L. A. Healey, S. R. Kaplan, M. H. Liang, H. S. Luthra, et al. 1988.The American Rheumatism Association 1987 revised criteria for the classifica-tion of rheumatoid arthritis. Arthritis Rheum. 31: 315–324.

30. Deibler, G. E., R. E. Martenson, and M. W. Kies. 1972. Large scale preparationof myelin basic protein from central nervous tissue of several mammalian spe-cies. Prep. Biochem. 2: 139–165.

31. Maecker, H. T., H. S. Dunn, M. A. Suni, E. Khatamzas, C. J. Pitcher, T. Bunde,N. Persaud, W. Trigona, T. M. Fu, E. Sinclair, et al. 2001. Use of overlappingpeptide mixtures as antigens for cytokine flow cytometry. J. Immunol. Methods255: 27–40.

32. Rowen, L., B. F. Koop, and L. Hood. 1996. The complete 685-kilobase DNAsequence of the human � T cell receptor locus. Science 272: 1755–1762.

33. Shevach, E. M. 2000. Regulatory T cells in autoimmunity. Annu. Rev. Immunol.18: 423–449.

34. Ratts, R. B., N. J. Karandikar, R. Z. Hussain, J. Choy, S. C. Northrop,A. E. Lovett-Racke, and M. K. Racke. 2006. Phenotypic characterization of au-toreactive T cells in multiple sclerosis. J. Neuroimmunol. 178: 100–110.

35. Haahr, S., and P. Hollsberg. 2006. Multiple sclerosis is linked to Epstein-Barrvirus infection. Rev. Med. Virol. 16: 297–310.

36. Appay, V. 2004. The physiological role of cytotoxic CD4� T-cells: the holygrail? Clin. Exp. Immunol. 138: 10–13.

37. Seitz, M., I. Napierski, and H. Kirchner. 1988. Depressed PPD and tetanus toxoidpresentation by monocytes to T lymphocytes in patients with rheumatoid arthritis:restoration by interferon �. Rheumatol. Int. 8: 189–196.

38. Verwilghen, J., S. Vertessen, E. A. Stevens, J. Dequeker, and J. L. Ceuppens.1990. Depressed T-cell reactivity to recall antigens in rheumatoid arthritis.J. Clin. Immunol. 10: 90–98.

39. Berg, L., J. Ronnelid, C. B. Sanjeevi, J. Lampa, and L. Klareskog. 2000. Inter-feron-� production in response to in vitro stimulation with collagen type II inrheumatoid arthritis is associated with HLA-DRB1(*)0401 and HLA-DQ8. Ar-thritis Res. 2: 75–84.

40. Brok, H. P., L. Boven, M. van Meurs, D. R. Kerlero, L. Celebi-Paul, Y. S. Kap,A. Jagessar, R. Q. Hintzen, G. Keir, J. Bajramovic, et al. 2007. The humanCMV-UL86 peptide 981–1003 shares a crossreactive T-cell epitope with theencephalitogenic MOG peptide 34–56, but lacks the capacity to induce EAE inrhesus monkeys. J. Neuroimmunol. 182: 135–152.

41. Kohm, A. P., K. G. Fuller, and S. D. Miller. 2003. Mimicking the way to auto-immunity: an evolving theory of sequence and structural homology. Trends Mi-crobiol. 11: 101–105.

42. Britt, W. J., and M. Mach. 1996. Human cytomegalovirus glycoproteins. Inter-virology 39: 401–412.

43. DiPaolo, R. J., D. D. Glass, K. E. Bijwaard, and E. M. Shevach. 2005.CD4�CD25� T cells prevent the development of organ-specific autoimmunedisease by inhibiting the differentiation of autoreactive effector T cells. J. Immu-nol. 175: 7135–7142.

44. Shevach, E. M. 2002. CD4� CD25� suppressor T cells: more questions thananswers. Nat. Rev. Immunol. 2: 389–400.

45. Tang, Q., and J. A. Bluestone. 2006. Regulatory T-cell physiology and applica-tion to treat autoimmunity. Immunol. Rev. 212: 217–237.

46. Soderberg-Naucler, C. 2006. Does cytomegalovirus play a causative role in thedevelopment of various inflammatory diseases and cancer? J. Intern. Med. 259:219–246.

6523The Journal of Immunology

by guest on June 2, 2013http://w

ww

.jimm

unol.org/D

ownloaded from