Biochemistry A look at the Structure and Function of Organic & Inorganic Compounds.

BiochemistryA look at the Structure and Function of

Organic & Inorganic Compounds

Organic compounds – ALL organic compounds contain the elements carbon and hydrogen always!

– Carbon & Hydrogen together = Organic

Inorganic compounds – Any of Earth’s elements combined but will rarely contain carbon and hydrogen together.

– Carbon & Hydrogen not together = Not Organic

Types of Compounds

1. Water (H2O)

2. Methane (CH4)

3. Carbon Dioxide (CO2)

4. Salts (NaCl)

5. Carbonic Acid (CH2O3)

6. Sugar (C6H12O6)

7. Ozone (O3)

Organic or Inorganic Compound?

Which compound has the most stored energy in its bonds? Why?

Finish & Review Biochemistry Packet

Do Now 4

1. Which compound has the most stored energy? Why?a) CH3(CH2)20COOH

b) C12H24O12

c) C3H7O2N

2. Where is chemical energy stored?

3. How is an organic compound different from an inorganic compound?

4. What are 4 common elements in living things?

WATER! H2O Living things consist of 60-98% water. Important for transport and chemical reactions

Polar molecule (like a magnet!)

More positive (+) on one sideMore negative (-) on opposite side

Why is this important (turn the page)

Important INORGANIC compound

http://www.zo.utexas.edu/faculty/sjasper/images/WaterStructure.swf

Why is it important that water has a positive and negative side? Gives water special properties:

1. Cohesion - water sticks together 2. Adhesion – water sticks to other surfaces3. Water is the universal solvent!

Importance of Water being Polar

http://www.zo.utexas.edu/faculty/sjasper/images/WaterTransport.swf

Many substances in the body dissolve in waterSolvent:

Substance that is present in a greater amount and dissolves another substance (solute)

Solute: Substance that is dissolved

Put salt in water… what is the solute and solvent?

Hint to remember difference*

Solvent?

Water is good at dissolving substances with a charge. Here is sodium chloride (table salt).

Sodium has a positive charge because chlorine took one of sodium's electrons. Chlorine is now negative because it has an extra electron.

The negative end of water pulls on the sodium atom and the positive end of other water molecules pull on the negatively charged chlorine.

CheckpointWe now know:

Elements, atoms, protons, neutrons, electrons, ionsHow atoms work

Molecules, macromolecules, compounds, organic, inorganicHow atoms interact

Water, polar, adhesion, cohesion, solvent, solute Why water is a special and important inorganic molecule

Now we know some chemistry, lets look at organic molecules and their structure and function in organisms

Major Organic Macromolecules

1. Carbohydrates

2. Proteins

3. Nucleic Acids

4. Lipids

Organic MacromoleculesThe molecules found in living things are composed of hundreds of atoms, sometimes more (macromolecules).

Cells create macromolecules by joining monomers (smaller molecules) in to long chains of monomers called polymers.

Monomers and Polymers

Polymers are made up of many monomers

Dimer = Two unitsMonomer = One unit.

Polymer = Several units bonded together.

CarbohydratesCarbohydrates contain the elements:

1. Carbon C2. Hydrogen H3. Oxygen O

Carbon, Hydrogen, Oxygen atoms are in the ratio 1:2:1 (C:H:O)

What does this mean?•There are always 2 Oxygen for 1 Hydrogen•O:H ratio = 2:1

Carbohydrates

How are carbohydrates created?– Made by plants (autotrophs)

How do carbohydrates look? Single ring-like compound (monomer)Many single rings bonded together (polymer)

Major functions:Energy and energy storage in organisms Structural support in plant cell wall

Do Now1. Describe these prefixes or suffixes:

a) Mono c) Polyb) Di d) Saccharide

2. What is the ratio of C:H:O atoms in a sugar?

3. What does the structure of sugar look like?

4. What foods contain carbohydrates?

Carbohydrates

Basic forms of Carbohydrates:1. Monosaccharides (“one” – “sugar”)2. Disaccharides (“two” – “sugar”)3. Polysaccharides (“many” – “sugar”)

Carbohydrates are made of monomers called monosaccharides

A

B

Types of CarbohydratesMonosaccharides: simple sugars (monomers)

– Glucose C6H12O6

Disaccharides: 2 sugars bonded together– Sucrose (table sugar)– Lactose (milk sugar)

CarbohydratesPolysaccharide: more than 2 sugars bonded together

– Starch – energy storage in plants – Example: potatoes

– Cellulose – provides structural support in cell walls

– Glycogen – used for energy storage in animals (liver/muscles)

What kind of “saccharide”1. Glucose + Glucose =

2. Glucose + Glucose + Glucose =

3. Starch + Glucose =

4. Cellulose =

5. Glucose =

What do you notice about the names for most sugars?

Glucose

Fructose

Maltose

Sucrose

Galactose

Cellulose

Identify the molecules Use vocabulary you know!

1

2

3

What kind of “saccharide”1. Glucose + Glucose =

2. Glucose + Glucose + Glucose =

3. Starch + Glucose =

4. Cellulose =

5. Glucose =

6. Maltose =

Do compounds change?

What’s going on in the picture?How is the left side different from the right side?What is missing on the right side that is on the left side?

Monomers are brought together to make Polymers

Building Polymers– Dehydration synthesis: process of synthesizing large,

complex molecules (polymers) from smaller molecules (monomers) by removing water!

Dehydration Synthesis

Literally means:

Dehydration Synthesis

Summary

1.Does water influence (have an effect) on chemical reactions?

2.How are macromolecules synthesized?

1. Is the molecule organic or inorganic?

a) Water (H2O)

b) Methane (CH4)

c) Carbon Dioxide (CO2)

d) Sugar (C6H12O6)

e) Ozone (O3)

2. Explain what is happening and fill-in the blank:

a) Glucose + Glucose = ________________

a) Process = ______________________

b) Starch + Glucose = ____________________

a) Process = _______________________

Is the molecule organic or inorganic?

a) Water (H2O)

b) Methane (CH4)

c) Carbon Dioxide (CO2)

d) Sugar (C6H12O6)

e) C10H18O2

What’s going on in the picture?How is the left side different from the right side?What is missing on the left side that is on the right side?

How do you break larger molecules apart?Simply add water!Hydrolysis – Polymers are broken down into monomers when water is introduced (added)

Hydrolysis

Literally means:

Hydro Lysis

What is going on in the picture?1

2

LipidsContain the elements:

Carbon, Hydrogen, Oxygen NOT a 1:2:1 ratio! H:O ratio = greater than 2:1 H:O ratio

Function:1. Energy Storage

Stores more energy than other types of molecules2. Large part of cell membrane structure

Are lipids organic? Why?

Lipids

Examples of Lipids:1. Fats2. Oils3. Waxes4. Steroids (Cholesterol)

Lipids are non-polar Do lipids and water mix? NO! Lipids are considered hydrophobic Hydro phobic -

Lipid StructureNo “ring” structure

Only in steroids (you don’t have to know)

Building Blocks (Also known as monomers)1. Glycerol backbone

Holds the fatty acids together 2. Fatty Acids

Long chains of H-C bonds

Common lipid Triglyceride

Glycerol backbone and 3 fatty acids

Lipid Structure

Common lipid Triglyceride

Glycerol backbone and 3 fatty acids

+ =

What’s going on here?

Complete your Lipid Chart

Lipid Words and Examples

Elements found in Lipids

Monomers Polymer

Examples:

Brought together by:

Broken down by:

Functions of Lipids Found in what foods

Carbohydrate or Lipid?1. C12H24O2

2. C6H12O6

3. C10H18O2

4. C11H22O11

5.

6. 7.8.

Proteins Elements in Proteins:

CarbonHydrogenOxygenNitrogen (N) Some contain (P, S)

Are proteins organic? Why?

ProteinsProteins have several very important functions:

Hormones (insulin)Enzymes (speed up chemical reactions)ReceptorsMembrane transportAntibodiesCell structureMuscle contraction

And more…

They help cells communicate and get things done!

Building Blocks are amino acidsPolymer = Protein (Polypeptide)Monomers = Amino AcidsProteins are long chains of amino acids

Proteins

Amino Acid Amino Acid Amino Acid

Amino AcidHow can I make these amino acids a protein?

Proteins: made of amino acidsAmino Acids

There are 20 different Amino Acids

Amino acids combine to form unlimited types of proteins – Just like the 26 letters in the alphabet

AMINO ACID SEQUENCE (order) DETERMINES : Protein SHAPE (how it folds) and protein FUNCTION

Proteins: made of amino acids

Peptide bonds – join amino acids together

Polypeptide = Another name for a protein

a.a.

a.a.

a.a.

a.a.

Peptide Bond

Proteins

Nucleic AcidsFound: In the nucleus Is the macromolecule that makes-up your genetic code!Blueprints for every trait, protein in your body!

Elements:All contain: C,H,O, N and Phosphorus (P)

2 kinds of Nucleic Acids:1. Deoxy-ribo-nucleic-acid (DNA)2. Ribo-nucleic-acid (RNA)

Nucleic Acids

Building Blocks (monomers):Nucleotides

Nucleic Acids: Made of nucleotides

Put many small nucleotides (small pieces) together, you get a big nucleic acid (polymer).

Nucleic Acids: Made of nucleotides5 types of nucleotides (bases):

1. Adenine 2. Guanine 3. Cytosine 4. Thymine (only DNA)5. Uracil (only RNA)

The sequence of your nucleotides CGATTCGATCGCCTAGCAACTCGATCIs your genetic code. It makes you, YOU!

Nucleotides (where the elements come from)

Made up of:1. Sugar (Deoxyribose or Ribose)2. Phosphate 3. Base (5 types)

The Molecules of LifeKnow the Building Blocks of Macromolecules

• Carbohydrates (monosaccharides)

• Lipids (fatty acids)

• Proteins (amino acids)

• Nucleic Acids (nucleotides)

Review For Test