Axonal transport of neural membrane protein 35 mRNA increases axon growth

Axonal Transport of Neural Membrane Protein 35 mRNA Increases Axon Growth

Tanuja T. Merianda1, Deepika Vuppalanchi2, Soonmoon Yoo3, Armin Blesch4,5,

and Jeffery L. Twiss1

1 Department of Biology, Drexel University, Philadelphia, PA 10104, USA

2 Dept. of Pharmacology and Toxicology and SNRI, Indiana University School of Medicine,

Indianapolis, IN 46202, USA

3 Nemours Biomedical Research, Alfred I. duPont Hospital for Children, Wilmington, DE 19803,

USA

4 Spinal Cord Injury Center, University Hospital Heidelberg, 69118 Heidelberg, Germany

5 Department of Neurosciences, University of California, San Diego, La Jolla, CA 92093, USA

Corresponding Author: Jeffery L. Twiss, MD, PhD Department of Biology Drexel University 3245 Chestnut Street, PISB 123 Philadelphia, PA 19104 US phone – 215-895-2624, fax – 215-895-1273 email – [email protected]

Running Title: Axonal translation of NMP35 increases axon growth

Word Count: Summary = 145 Introduction, Results, Discussion, Methods & Figure legends = 9533

Figures: 6 Figures, 5 Supplemental Figures, and 2 Supplemental Videos

© 2012. Published by The Company of Biologists Ltd.Jo

urna

l of C

ell S

cien

ceA

ccep

ted

man

uscr

ipt

JCS online publication date 24 October 2012

SUMMARY

Many neuronal mRNAs are transported from cell bodies into axons and dendrites. Localized

translation of the mRNAs brings autonomy to these processes that can be vast distances from

the cell body. For axons, these translational responses have been linked to growth and injury

signaling, but there has been little information about local function of individual axonally

synthesized proteins. Here, we show that axonal injury increases levels of the mRNA encoding

neural membrane protein 35 (NMP35) in axons with a commensurate decrease in the cell body

levels of NMP35 mRNA. The 3’UTR of NMP35 is responsible for this localization into axons.

Previous studies have shown that NMP35 protein supports cell survival by inhibiting Fas-ligand

mediated apoptosis; however, these investigations did not distinguish functions of the locally

generated NMP35 protein. Using axonally targeted vs. cell body restricted NMP35 constructs,

we show that NMP35 supports axonal growth and overexpression of an axonally targeted

NMP35 mRNA is sufficient to increase axonal outgrowth.

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

3

INTRODUCTION

Polarized eukaryotic cells transport mRNAs from the nucleus to subcellular domains,

providing a precise spatial and temporal control of protein levels (Jung et al., 2012). For rodent

neurons, the ends of their processes can be centimeters distance from the cell body. mRNAs

are actively transported into these distal processes by microtubule-based transport mechanisms

(Donnelly et al., 2010). Although mRNAs and translational machinery were initially detected in

the post-synaptic processes of the neuron (i.e., dendrites), it is now clear that the pre-synaptic

or axonal processes also have the capacity to synthesize proteins (Jung et al., 2012). This has

been particularly evident in growing axons, both for developing and regenerating axons, but

there are several publications supporting the notion that mRNAs and ribosomes are present in

mature axons of neurons in the peripheral nervous system (PNS) prior to injury (Ben-Yaakov et

al., 2012; Hanz et al., 2003; Koenig et al., 2000; Perlson et al., 2005; Yudin et al., 2008; Zelena,

1970). Studies of cutaneous nerve terminals also suggest that translation of mRNAs can be

triggered by pain invoking stimuli (Jimenez-Diaz et al., 2008; Melemedjian et al., 2010). In

developing axons, translation of new proteins is needed for response to some guidance cues

(Jung et al., 2011). However, a study from the Letourneau lab raised questions on this need for

localized protein synthesis in developing axons (Roche et al., 2009). Thus, despite that mRNA

translation has been demonstrated in axons, questions remain on what the locally generated

proteins do in the axon.

Neurons have proven a particularly appealing model to study mRNA localization. Even

in cultured neurons, axons can extend millimeters from the cell body making it possible to

physically isolate these processes to purity (Willis and Twiss, 2011). RNA profiling studies of

axonal processes in cultured neurons have shown increasing complexity, such that hundreds of

different mRNAs are now known to be transported into axons (Gumy et al., 2011; Taylor et al.,

2009; Zivraj et al., 2010). It is not known if such a complex population of mRNAs is similarly

transported into axons in vivo. We have recently used a transgenic approach to show that β-

actin mRNA is transported into axons of neurons in the peripheral and central nervous systems

(CNS) (Willis et al., 2011). Moreover, localized translation of β-actin and GAP-43 mRNAs

support regeneration of PNS axons (Donnelly et al., 2011). It seems likely that protein products

of other axonal mRNAs also contribute to regeneration of axons. Consistent with this, mice

lacking the β-actin gene apparently showed normal development and regeneration of motor

axons (Cheever et al., 2011). This could indicate that β-actin is not needed for regeneration, or

that other locally synthesized proteins can compensate for the loss of β-actin. Thus, in depth

analyses for regulation and function of other axonal mRNAs are needed.

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

4

The axonal transcriptome of cultured dorsal root ganglion (DRG) neuron includes

several transmembrane and secreted proteins (Gumy et al., 2011; Willis et al., 2007). Although

the classic ultrastructure of rough endoplasmic reticulum (RER) and Golgi apparatus has not

been identified in axons, we have previously shown that growing axons have functional

equivalents of RER and Golgi apparatus for secretion of locally synthesized proteins (Merianda

et al., 2009). However, evidence for membrane insertion or secretion of individual axonally

synthesized proteins has been lacking. Here, we have focused on neural membrane protein 35

(NMP35), which we previously identified by cDNA array hybridization as an axonal mRNA in

cultured adult DRG neurons (Gumy et al., 2011; Willis et al., 2007). NMP35 is a

transmembrane protein that was initially cloned in attempts to identify developmentally regulated

genes in peripheral nerve, but as its name implies its expression is limited to neurons

(Schweitzer et al., 2002; Schweitzer et al., 1998). NMP35 has also been termed as the Fas

apoptosis inhibitor protein 2 (FAIM2) and Lifeguard (LFG) (Beier et al., 2005; Fernandez et al.,

2007). The designations FAIM2 and LFG stemmed from studies showing that this protein can

prevent apoptosis triggered by Fas ligand (FasL) (Beier et al., 2005; Fernandez et al., 2007).

However, these studies did not take into account the possibility that NMP35 protein may be

synthesized locally. In the studies here, we have used RNA targeting constructs to test functions

of cell body vs. axonally synthesized NMP35 protein.

NMP35’s sequence was also shown to have homology to the glutamate binding subunit

of the rat and Drosophila NMDA receptor (GRINA1; previously termed glutamate binding protein

and dNMDARA1, respectively) (Schweitzer et al., 2002). Previous immuno-electron microscopy

studies showed NMP35 protein to be present in post-synaptic processes, but the protein was

also detected in efferent processes of spinal motor neurons (Schweitzer et al., 2002). Here, we

show that NMP35 mRNA localizes to axons as well as dendrites of cultured neurons. This

mRNA is targeted to PNS axons in vivo, and the 3’ untranslated region (UTR) of NMP35 mRNA

is both necessary and sufficient for its transport into axons. Axonal localization of NMP35

mRNA increases after axonal injury. Moreover, expression studies indicate that axonal

transport of NMP35 mRNA with subsequent localized translation provides a function in axonal

growth that is distinct from cell body restricted NMP35 (FAIM2, LFG) previously used for

overexpression studies (Beier et al., 2005; Fernandez et al., 2007).

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

5

RESULTS

Differential localization of membrane protein mRNAs in the axons.

Although initial cloning of NMP35 mRNA focused on identifying Schwann cell gene

products (Schweitzer et al., 1998), NMP35 protein expression was shown to be restricted to

neurons (Schweitzer et al., 2002). We detected NMP35 as an axonal mRNA using cDNA arrays

to profile transcripts from cultures of injury-conditioned adult DRGs (Willis et al., 2007). The

transport of NMP35 mRNA into axons of DRG neurons was not significantly affected by

neurotrophins, semaphorin, or myelin-associated glycoprotein, stimuli that we previously

showed trigger robust changes in transport of other axonal mRNAs (Willis et al., 2007). Thus,

we asked if the injury conditioning could affect the axonal levels of NMP35 mRNA. For this, we

cultured DRG neurons on porous membranes to isolate axonal processes (Zheng et al., 2001).

Reverse transcriptase coupled polymerase chain reaction (RT-PCR) confirmed purity of the

axonal preparations showing amplification of β-actin mRNA from the axonal preparions but not

the cell body restricted γ-actin and MAP2 mRNAs (Fig. 1A). Both standard and quantitative RT-

PCR (RTqPCR) showed increased NMP35 mRNA levels in the axons from the injury-

conditioned compared to naïve DRGs (Fig. 1B,C). Although the overall levels of NMP35 mRNA

did not appreciably change in these DRG cultures (Suppl. Fig. S1A), the cell body levels of

NMP35 mRNA in the injury-conditioned DRG cultures was significantly decreased compared to

naïve cultures (Fig. 1B,C). By fluorescence in situ hybridization (FISH), NMP35 mRNA showed

granular signals in the axon shaft of the cultured DRG neurons that extended distally into the

growth cones (Fig. 1D). Scrambled probes and no probe controls showed minimal background

labeling (Supplemental Fig. S1B). Comparing processes of injury-conditioned to naïve DRG

neurons, axonal NMP35 mRNA levels showed a significant increase and cell body NMP35

mRNA showed a significant decrease (Fig. 1D,F) consistent with the RT-PCR results above.

Furthermore, immunolabeling showed a significant increase in axonal signals and decrease in

the cell body signals for NMP35 protein with injury conditioning (Fig. 1E,G).

Since NMP35 mRNA increased in axons of injury-conditioned neurons in vitro, we asked

if a similar increase in axonal NMP35 mRNA and protein might be seen in vivo after axonal

injury. Confocal imaging of DRG and sciatic nerve sections that were processed for RNA-FISH

showed clear cell body and axonal signals for NMP35 mRNA (Fig. 2A,C). NMP35 mRNA and

protein appeared overall more abundant in the injured nerves and less abundant in the DRG

compared with signals in uninjured tissues at seven days after nerve crush (Fig. 2B,D). Since

NMP35 mRNA was only seen in the cell bodies and axons by these FISH analyses, we used

RT-PCR to compare levels of NMP35 mRNA in nerves at seven days after a unilateral sciatic

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

6

nerve crush. Axons in the crushed sciatic nerves showed four fold more NMP35 mRNA than

those in the uninjured nerves (Fig. 2E,F). Moreover, NMP35 mRNA levels were three fold lower

in L4-5 DRGs ipsilaterial to the injury compared to contralateral uninjured ganglia (Fig. 2E,F).

Taken together, these data indicate that axotomy by nerve crush injury triggers a shift in NMP35

mRNA localization, with increased levels of NMP35 mRNA and protein in injured or

regenerating vs. uninjured axons.

NMP35 protein has been shown to concentrate in post-synaptic terminals of mature,

neurons (Schweitzer et al., 2002). The DRG neurons used here only extend Tau-positive,

MAP2-negative axonal processes in culture and both the centrally- and distally-projecting

processes of these sensory neurons show axonal features in vivo (Zheng et al., 2001). Thus,

we asked if NMP35 mRNA also localizes into axonal processes of fully polarized CNS neurons.

By FISH analyses, NMP35 mRNA is seen in both the dendritic and axonal processes of cultured

cortical neurons (Supplemental Fig. S2), indicating that NMP35 mRNA can localize into both

pre-synaptic and post-synaptic compartments consistent with previous analyses of its protein

localization (Schweitzer et al., 2002).

NMP35 mRNA’s 3’UTR drives axonal localization in DRG neurons.

Given the potential shift in transport of NMP35 mRNA with axonal injury, we asked how

this mRNA is localized into axons. UTRs, particularly the 3’UTR, are frequently sites for

localization elements (Andreassi and Riccio, 2009). Thus, we asked if NMP35 mRNA’s 3’UTR

is sufficient for localizing a heterologous mRNA into axons of cultured DRG neurons. For this,

we generated a diffusion-limited GFPmyr reporter (Aakalu et al., 2001) carrying the 3’UTR of

NMP35 mRNA (GFPmyr3’NMP35). The myristoylation element in GFP coding sequence

decreases its diffusion compared to non-modified GFP such that fluorescence recovery after

photobleaching (FRAP) can be used to test for localized translation events by comparing

recovery with and without active protein synthesis (Vuppalanchi et al., 2010; Yudin et al., 2008).

Without a localizing UTR, the GFPmyr mRNA is restricted to the neuronal cell body (Aakalu et al.,

2001; Akten et al., 2011; Ben-Yaakov et al., 2012; Perry et al., 2012; Vuppalanchi et al., 2010;

Willis et al., 2007; Yudin et al., 2008).

DRG neurons transfected with GFPmyr3’NMP35 showed robust GFP fluorescence in foci

along the axon shaft and in the terminal axon/growth cone (Fig. 3A), suggesting that the

localization of the endogenous NMP35 mRNA that we had seen by FISH analyses can be

driven by the 3’UTR of NMP35 mRNA. Upon photobleaching, the distal axon showed recovery

of GFP fluorescence that began to reach statistical significance at 12 min post-bleach (Fig 3B).

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

7

This kinetics of recovery is consistent with our previous studies where increase in fluorescence

after photobleaching in axons at ≥ 750 µm from cell body, as used here, occurs before new GFP

protein could be transported from the neuronal cell body (Akten et al., 2011; Vuppalanchi et al.,

2010; Willis et al., 2007; Yudin et al., 2008). To test if protein synthesis contributed to this

recovery, DRG cultures were pre-treated with translation inhibitor anisomycin for 30 min prior to

photobleaching. There was no increase in the axonal GFP fluorescence above post-bleach

levels in the presence of anisomycin (Fig. 3A,B), indicating that the recovery seen above is

protein synthesis dependent. Furthermore, FISH showed that axonal GFP mRNA was only

detected if the 3’UTR of NMP35 was included in the reporter constructs (see Fig 6A below).

These data indicate that the 3’UTR of NMP35 mRNA is sufficient for mRNA localization into the

axons of cultured DRG neurons.

Since the 3’UTR of NMP35 mRNA could localize mRNA into axons of cultured neurons,

we asked if it might also be sufficient for axonal localization in vivo. For this, we constructed

NMP35-AcGFP fusion protein/reporters with the 3’UTR of NMP35 or AcGFP; we refer to the

monomeric AcGFP as simply ‘GFP’ throughout the remainder of this text. These constructs

were used to generate lentivirus (LV) for in vivo expression (LV-NMP35-GFP-3’NMP35 and LV-

NMP35-GFP-3’GFP, respectively). To test for axonal mRNA translation in vivo, LV-NMP35-

GFP-3’NMP35 and LV-NMP35-GFP-3’GFP were used to transduce the L4-5 DRGs in adult rats.

Ten days after injecting LV preparations, animals were subjected to unilateral sciatic nerve

crush injury at mid-thigh level, approximately 4.5 cm from the site of LV injection. GFP signals

were then assessed at the site of injection, in the DRG, and in the distal axon proximal to the

crush site (or comparable level in the uninjured nerve). Tissue sections were evaluated by

immunolabeling for GFP and neuronal markers using confocal microscopy. At the injection site,

GFP signals were seen in Schwann cells and in axons for both LV preparations (Supplemental

Fig. S3). GFP signals were clearly visible in the naïve and injured DRG for LV-NMP35-GFP-

3’GFP and LV-NMP35-GFP-3’NMP35 transduced animals, indicating in vivo transduction of

these neurons by LV (Fig. 4A-H). In examining the distal nerve just proximal to the crush site,

GFP signals were only seen in the LV-NMP35-GFP-3’NMP35 transduced animals (Fig. 4G,H).

Despite the enhanced detection afforded by anti-GFP immunolabeling, we saw no GFP signals

in the nerves of the LV-NMP35-GFP-3’GFP transduced animals (Fig. 4C,D). The absence of

any GFP signals in the nerves of the LV-NMP35-GFP-3’GFP transduced animals and the

distance separating the injection and injury sites (> 4 cm) argues that the axonal GFP signals

seen when 3’UTR of NMP35 mRNA was included in the LV construct are the result of localized

protein synthesis rather than transport or diffusion of NMP35-GFP protein from the cell body into

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

8

the axonal compartment. Taken together, these data indicate that the 3’UTR of NMP35

transcript is both necessary and sufficient for axonal localization in sensory neurons both in vitro

and in vivo.

The FRAP experiments above did not allow us to distinguish changes in localized

synthesis of NMP35 in axons of injury-conditioned vs. naïve neurons, since the transfected

constructs required at least 2 days for optimal expression. Over this incubation period, the

naïve neurons begin to transition from an arborizing growth to an elongating axonal growth is

similar to the injury-conditioned phenotype (Smith and Skene, 1997). These in vivo experiments

brought an opportunity to use GFP protein fluorescence as a surrogate for comparing NMP35

3’UTR-dependent effects on axonal GFP mRNA levels in injured and naïve neurons.

Quantification of the axonal GFP signals confirmed a significant increase in GFP intensity in the

LV-NMP35-GFP-3’NMP35 transduced animals after injury compared to the uninjured animals

(Fig. 4H). There was no axonal GFP signal detected above background in nerves from the LV-

NMP35-GFP-3’GFP transduced animals (Fig 4G). In contrast to the endogenous NMP35

mRNA, we saw no decrease in GFP levels in the DRG after injury in the LV-NMP35-GFP-

3’NMP35 transduced animals but there was an increase in DRG GFP levels in the LV-NMP35-

GFP-3’GFP transduced animals (Fig. 4I-K). This may be attributed to overexpression of the

NMP35-GFP fusion protein compared to the endogenous NMP35 mRNA.

The NMP35-GFP fusion protein used in these latter studies also allowed us to assess

potential for localization of NMP35 protein in axons . In the DRGs of the LV transduced

animals, NMP35-GFP signals were concentrated along the periphery of the neurons for both LV

preparations, suggestive of membrane localization of the fusion protein (Fig. 4). Projection of

confocal image stacks of distal nerve into YZ planes also showed enhanced signals along the

periphery of several axons in the LV-NMP35-GFP-3’NMP35 transduced preparations (Fig.

4G,H, inset panels). Finally, teased nerve preparations showed GFP signals that were enriched

along the periphery of individual axons in the LV-NMP35-GFP-3’NMP35 transduced animals

(Supplemental Fig. S4C, D). The LV-NMP35-GFP-3’GFP transduced animals again showed no

detectable GFP signals in these teased nerve preparations (Supplemental Fig. S4A,B). Taken

together, these data support the conclusion that the locally translated NMP35, which is targeted

to axons through its 3’UTR, is inserted into the axoplasmic membrane.

Although the above data are consistent with an increase in transport of NMP35 mRNA

into axons after injury, a shift in the stability of the transcript would also account for the

increased levels of NMP35 mRNA and protein in the axons of injured DRG neurons. Since

severed DRG axons rapidly undergo Wallerian degeneration even in culture (Zheng et al.,

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

9

2001), we could not test survival of NMP35 mRNA directly in the isolated axons. Thus, we used

Cyclosporin A (CsA) to delay the degeneration of severed axons. Barrientos et al. (2011)

showed that inhibition of the mitochondrial membrane permeability transition pore with CsA

extends the survival of severed axons (Barrientos et al., 2011). Using RNA isolated from CsA-

treated axons of naïve and injury conditioned DRG cultures as a template for RT-PCR, the

endogenous NMP35 and GAPDH mRNAs were easily detected up to 6 hours after severing

(Suppl. Fig. S5). In contrast to the axonal GAPDH mRNA that did not change with injury

conditioning, the overall levels of NMP35 mRNA were more abundant in the axons of the injury

conditioned vs. naïve neurons at every time point. However, there was no difference in stability

of the NMP35 mRNA when the injury conditioned and naïve RNA levels at 4 and 6 hour

samples were normalized to the 2 hour time point (Suppl. Fig. S5B). These data suggest that a

change in stability of NMP35 mRNA does not explain the increase in axonal NMP35 mRNA

levels after injury.

Axonally synthesized NMP35 mRNA increases axon outgrowth.

Our experiments suggest that transport of NMP35 mRNA into axons is regulated by

injury and/or axonal growth, with the axonally generated NMP35 protein localizing to the

axoplasmic membrane. This led us to ask if the locally synthesized NMP35 protein contributes

to growth of axons. For this, we used small interfering RNAs (siRNA) to deplete adult DRG

cultures of NMP35 mRNA overall. Transfection with a siRNA pool to the NMP35 sequence

depleted both the transcript and protein by approximately 75% compared to cultures transfected

with non-targeting siControl (Fig. 5A,B). Non-targeting siRNAs (siControl) had no effect on

NMP35 mRNA levels compared with non-transfected cultures (data not shown). Depletion of

NMP35 mRNA significantly decreased axonal outgrowth in the DRG cultures (Fig. 5C,D). This

suggests that NMP35 contributes to axonal outgrowth, but did not distinguish effects of NMP35

synthesis overall from axonally synthesized NMP35. To address this question, we performed

rescue experiments using siRNA-resistant NMP35 constructs that were cell body restricted vs.

axonally targeted. We separately tested each siRNA of the siRNA pool used above (data not

shown). From this, the target sequence of a single siRNA oligonucleotide that gave maximal

NMP35 mRNA depletion was used to generate siRNA-resistant NMP35-GFP constructs. By

RT-PCR, siNMP35 significantly depleted NMP35 mRNA when the neurons were co-transfected

with GFP, but co-transfection with siRNA-resistant NMP35-GFP constructs resulted in NMP35

mRNA levels comparable to siControl transfected neurons (Fig. 5E). Immunoblotting confirmed

expression of NMP35-GFP fusion proteins and GFP at near equivalent levels (Fig. 5E).

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

10

Depletion of NMP35 did not appear to affect cell survival since cell numbers for these co-

transfections were statistically the same (data not shown). Consistent with the results above,

siNMP35 transfection resulted in a significant depletion of axonal outgrowth compared to

siControl-transfected neurons, and co-transfection with GFP alone did not rescue this growth

deficit (Fig. 5F). Co-transfection of NMP35-GFP, either the cell body restricted or axonally

localizing form, rescued the axonal growth deficit with siNMP35; however, axons were

significantly longer when the axonally localizing NMP35-GFP-3’NMP35 was used (Fig. 5F).

These siRNA studies suggested that simply increasing levels of NMP35 mRNA in axons

might be sufficient to support increased axonal outgrowth. To directly test this possibility, we

used the LV preparations to overexpress cell body restricted vs. axonally localizing NMP35-GFP

mRNA in DRG cultures without altering endogenous NMP35 levels. FISH for GFP mRNA

confirmed axonal localization of the NMP35-GFP-3’NMP35 mRNA, but not NMP35-GFP-3’GFP,

in the LV-transduced cultures (Fig 6A,B). Cell bodies of the transduced neurons showed no

significant differences in GFP mRNA with the different LV preparations (Fig. 6A,C). Axons of

neurons transduced with the LV-NMP35-GFP-3’NMP35 were significantly longer than control

neurons transduced with LV-NMP35-GFP-3’GFP (Fig. 6D,E). The average axon lengths with

expression of the cell body restricted NMP35-GFP-3’GFP were not significantly different than

cultures transduced with LV-GFP (Fig. 6D,E). Thus, consistent with the siRNA rescue

experiments above, increasing axonal levels of NMP35, but not just simply the overall

expression of NMP35, is sufficient for increased axonal outgrowth.

DISCUSSION

Several studies in different neuronal preparations have now shown that axons of

cultured neurons contain hundreds of mRNAs (Gumy et al., 2011; Taylor et al., 2009; Willis et

al., 2007; Zivraj et al., 2010). We previously showed that transport of mRNAs into axons

cultured from the adult rats used here can be regulated by stimulation with axonal growth-

promoting and growth-inhibiting cues; however, transport of several mRNAs into DRG axons did

not respond to neurotrophins, semaphorin, or myelin-associated glycoprotein (Willis et al.,

2007). This suggested that either the appropriate stimulus was not tested or these mRNAs are

constitutively transported into axons. Some of these transcripts, such as Importin β1, RanBP1,

and Stat3α mRNAs, are resident in mature PNS axons with their local translation in axons being

triggered by injury (Ben-Yaakov et al., 2012; Hanz et al., 2003; Yudin et al., 2008). Here, we

show that NMP35 mRNA is also regulated by injury. However, our data suggest that transport

of NMP35 mRNA into axons rather than its translation within axons is injury-dependent. Axonal

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

11

levels of NMP35 mRNA are increased after axonal injury with no change in its overall

expression of the transcript. Moreover, the locally generated NMP35 protein enhances axonal

growth. Thus, this shift in NMP35 mRNA levels from cell body predominant in naïve neurons to

axon predominant in axotomized neurons suggests that injury triggers an inherent change in the

neuron’s ability to localize this mRNA.

Transport of mRNAs from the cell body into axons is an active process, driven by

specific RNA elements that serve as binding sites for RNA binding proteins (RBP). These

structural elements have proven difficult to predict based on primary sequence alone, but have

most frequently been documented within the 3’UTRs of localized mRNAs (Andreassi and Riccio,

2009). Consistent with this, NMP35 mRNA’s 3’UTR shows no clear homology to known

localization elements. The localizing 3’UTRs of calreticulin and grp78/BiP mRNAs show striking

interspecies sequence identity among vertebrates (Ben-Yaakov et al., 2012; Kislauskis et al.,

1994; Vuppalanchi et al., 2010). In contrast, the 3’UTR of rat NMP35 mRNA shows 83%

identity with mouse, less than 75% identity with primate, and essentially no identity with other

available vertebrate NMP35 3’UTR sequences. Nonetheless, the rat NMP35 mRNA’s 3’UTR

was sufficient for localizing GFP reporter mRNA in cultured neurons and was necessary for

localizing an NMP35-GFP fusion protein mRNA into adult peripheral axons in vivo. Similar to

NMP35 mRNA, CGRP mRNA shifts from cell body to axons in injured DRG neurons (Toth et al.,

2009) and sensorin mRNA shifts from cell body to neurites in Aplysia sensory neurons upon

synapse formation (Andreassi et al., 2010; Lyles et al., 2006; Natera-Naranjo et al., 2010). The

overall levels of NMP35 mRNA do not change with injury, only the ratio of axonal to cell body

mRNA increases comparing compared injured and naive DRG neurons. With CGRP showing

similar regulation (Toth et al., 2009), it is appealing to hypothesize the existence of a cohort of

axonal mRNAs that share RBPs for enhanced targeting after axotomy. Future studies will be

needed to determine the RBP(s) that bind to NMP35’s 3’UTR for localizing this transcript, but

this shift in axonal levels of NMP35 mRNA without an apparent change in overall expression of

the transcript likely reflect either an increase in availability or activity of this RBP after axotomy.

Such a shift in availability could be secondary to decreased levels of other mRNAs as we have

recently shown for GAP-43 and β-actin mRNAs competing for limited quantities of ZBP1

(Donnelly et al., 2011). However, in contrast to ZBP1, overexpression of the axonally localizing

NMP35-GFP-3’NMP35 resulted in increased axonal growth suggesting that the level of the

RBP(s) needed for axonal localization of NMP35 mRNA is not limiting.

Functions of locally synthesized proteins have largely been extrapolated from what is

known of the overall functions of these proteins, but the locally generated proteins have been

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

12

found to have distinct functions in some circumstances. For example, the microfilament protein

β-actin allows for directional migration rather than overall motility of migrating fibroblasts when it

is locally generated (Shestakova et al., 2001). Axonal translation of Importin β1 and RanBP1 is

used to generate an Importin α/β heterodimer for transporting axonal signaling proteins to the

cell body, with introduction of these proteins providing a precise temporal indicator of axon injury

(Ben-Yaakov et al., 2012; Hanz et al., 2003; Perry et al., 2012; Yudin et al., 2008). Although

NMP35 mRNA was initially cloned from developing sciatic nerve (Schweitzer et al., 1998) and

NMP35 protein concentrates at synapses in post-mitotic neurons (Schweitzer et al., 2002), the

possibility for localization of NMP35 mRNA was not considered in these early expression

studies. Our data linking increased axonal levels of NMP35 mRNA to increased axonal growth

likely accounts for the initial cloning of NMP35 mRNA from sciatic nerve.

NMP35 was independently isolated by other groups as FAIM2 or LFG and has been

functionally implicated in cell survival (Beier et al., 2005; Fernandez et al., 2007). Depletion of

FAIM2/LFG from neurons increases sensitivity to Fas-mediated apoptosis and developmental

cell death, while overexpression of FAIM2/LFG was protective from effects of FasL-mediated

death of neurons (Beier et al., 2005; Fernandez et al., 2007; Hurtado de Mendoza et al., 2011).

Although no role in neurite or axonal growth was detected for the overexpressed FAIM2/LFG

proteins, these constructs did not contain the 3’UTR that we have shown localizes NMP35

mRNA into neuronal processes based on primers and ESTs used for their cloning.

Consequently, the overexpression studies used by Beier et al. (2005) and Fernandez et al.

(2007) did not examine the effects of the locally synthesized protein that we show here plays a

role in axonal growth. Thus, we have uncovered a previously unrecognized function of NMP35

in promoting axonal growth that is distinct for the locally synthesized NMP35.

A similarly named but unrelated mRNA, FAIM (GenBank accession # NM_080895),

encodes a protein that also protects neurons and other cell types from FasL-induced apoptosis

(Segura et al., 2007; Sole et al., 2004). Interestingly, an alternatively spliced form of FAIM

mRNA generates a shorter protein that lacks 22 N-terminal amino acids (FAIMs) (Zhong et al.,

2001). Similar to the axonally localizing NMP35 studied here, overexpression of FAIMs

increases neurite outgrowth (Sole et al., 2004). However, it should be emphasized that NMP35

and FAIMs show no sequence homology at the RNA or protein level and the alternatively spliced

FAIMs alters the 5’ end of the transcript. Furthermore, unlike NMP35/FAIM2, both long and

short forms of FAIM are cytoplasmic proteins without any predicted transmembrane domains

(Segura et al., 2007; Sole et al., 2004).

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

13

In our hands, we do not see increased cell death with depletion of NMP35 from the DRG

cultures under standard culture conditions; thus, it is not clear if the role in axonal growth is

linked to NMP35’s inhibition of Fas signaling. There have been studies showing that Fas

activation can support neurite growth. FasL was shown to increase neurite branching in

hippocampal cultures, neurite outgrowth from DRG explants, and axonal regeneration after

sciatic nerve crush (Desbarats et al., 2003; Zuliani et al., 2006). These studies could argue that

NMP35 has some function beyond Fas inhibition, since NMP35 is known to inhibit Fas signaling

and our data indicate that NMP35 supports rather than attenuates axon growth. However, Fas

activation through FasL was recently shown to increase secretion of NGF in Schwann cells

(Mimouni-Rongy et al., 2011). Thus, the data from Desbarats et al. (2003) on FasL supporting

nerve regeneration may be a secondary effect of FasL on the Schwann cells. Further studies

will be needed to determine molecular mechanisms that NMP35 utilizes to support growth of

axons. Nonetheless, our work clearly shows axonal targeting of an mRNA encoding a

transmembrane protein can be used to modulate axonal growth from adult neurons. Moreover,

these studies point to a previously unrecognized mechanism that neurons can use to modify

axonal transport of mRNAs beyond the extracellular stimuli-induced transport and competition

for RBPs that we have previously published (Donnelly et al., 2011; Vuppalanchi et al., 2010;

Willis and Twiss, 2010). For NMP35 mRNA transport, the axonal injury must either increase the

levels or activity of the RBP(s) needed for targeting the transcript for transport from the cell body

into distal axons.

MATERIALS AND METHODS

Animal care and surgery – All animal experiments were conducted under IACUC approved

protocols at Alfred I duPont Hospital for Children and Drexel University. For nerve injury,

animals were subjected to a conditioning sciatic nerve crush at mid-thigh level as previously

described (Twiss et al., 2000).

Cell culture – For DRG culture, L4-6 ganglia were isolated from adult male Sprague Dawley

rats and dissociated using collagenase (500 U/ml - Sigma, St. Louis, MO) and trypsin-EDTA

(0.05 % - Cellgro, Manassas, VA) (Twiss et al., 2000). Cells were washed with DMEM/F12 and

then resuspended in DMEM/F12 medium containing N1 supplement (Sigma), 10% horse serum

(Hyclone, Salt Lake City), and 10 µM cytosine arabinoside (Sigma). Cells were cultured on

poly-L-lysine (Sigma) + laminin (Millipore, Billerica, MA) coated surfaces at 37ºC with 5% CO2.

For isolation of axons, dissociated cells were plated at moderate density on polyethylene-

tetrathalate (PET) membrane (8 μm pores; BD Falcon) inserts (Zheng et al., 2001); for FISH

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

14

analyses, immunofluorescence, and neurite outgrowth assays, dissociated cells were plated at

low density on coated glass cover slips.

DRG cultures were transfected immediately after dissociation using the AMAXA

Nucleofector apparatus (Lonza, Allendale, NJ). For this, dissociated ganglia were pelleted at

100 x g for 5 min and resuspended in transfection solution from the Rat Neuron Nucleofector kit

(Lonza). 3-5 µg of each plasmid DNA was transfected using G-013 program. Cells were

resuspended in culture media and plated; medium was replaced 4 and 24 hours later. For in

vivo transduction with LV, an MOI of 100 was added to the dissociated DRGs 3-4 hours after

plating cells; media was replaced the next day; LV was tittered as described (Vuppalanchi et al.,

2010).

For culturing cortical neurons, cortices were dissected from P1-4 rat pups, incubated in

papain for 30 min, and then dissociated by trituration in Hibernate E media (Brainbits,

Springfield, IL). After gentle centrifugation, dissociated cortices were plated on poly-L-lysine

coated glass coverslips in Neurobasal medium with 10% fetal bovine serum, B27 supplement, 2

mM glutamine (Invitrogen, Grand Island, NY), and penicillin/ streptomycin (Cellgro) at 37ºC and

5% CO2 (Vuppalanchi et al., 2010).

Isolation of axons – DRG neurons cultured on PET membranes for 16-20 hours were used

for axon isolation. For this, the upper membrane surface containing cell bodies and non-

neuronal cells was scraped using a cotton tipped applicator as previously described (Willis and

Twiss, 2010). For analysis of cell body, the axonal processes were scraped from the upper

membrane surface. RNA was then isolated from the cellular elements remaining on the

membrane as outlined below. These isolated axonal preparations were tested for purity by RT-

PCR for γ-actin, β-actin, and MAP2 mRNAs (Merianda et al., 2009; Willis et al., 2005).

DNA and viral constructs – All PCR products used for cloning were sequence verified as

individual clones. RNA from adult rat DRGs was used as template for reverse transcription

using iScript (Biorad, Hercules, CA); Pfu DNA polymerase (Stratagene, La Jolla, CA) was used

for PCR amplifications.

Diffusion limited GFP reporter constructs (GFPmyr) (Aakalu et al., 2001) were used to test

for axonal localizing ability of NMP35 RNA sequences. 3’UTR of NMP35 (GenBank accession

NM_144756) with terminal Not1 and Apa1 restriction sites was PCR-amplified with the following

primers: sense, 5’ GCGGCCGCAACCGGGAATGAGGAGCCCTCC 3’ and anti-sense, 5’

GGGCCCGACTGAGGGGACATGGCTGGAACTTG 3’. PCR products were cloned into pTOPO

2.1 (Invitrogen), and then sub-cloned into Not1 and Apa1 sites of the GFPmyr expression vector

replacing the 3’UTR of αCAMKII (Aakalu et al., 2001).

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

15

For expression of NMP35 coding sequence, constructs were generated to encode an

NMP35-GFP fusion protein using pAcGFP1-N3 (Clontech, Mountain View, CA). For this the

complete 5’UTR through coding sequence (i.e., next to last codon) was using the following

primers, constructed with EcoR1 and BamH1 restriction sites for cloning: sense, 5’

GAATTCGAGACGCAGGCAGGCTGCGGTGA 3’ and anti-sense, 5’

GGATCCAGCTTTTTGGCACCAACCGGGAA 3’. This generated a plasmid encoding an mRNA

with NMP35-GFP fusion protein and 3’UTR of GFP (pNMP35-GFP-3’GFP). The GFP 3’UTR

was then replaced with NMP35’s 3’UTR to generate pNMP35-GFP-3’NMP35. NMP35’s 3’UTR

was generated as above, but with terminal Not1 sites for cloning downstream of GFP.

For generating LV, we first used QuickChange XL Site-Directed Mutagenesis kit to

mutate the polyadenylation signals in the NMP35 and GFP 3’UTRs (Vuppalanchi et al., 2010).

After sequence verification, the cDNA cassettes containing the CMV promoter, 5'UTR, NMP35-

GFP fusion protein coding sequence were subcloned into the pENTR shuttle vector (Invitrogen).

NMP35-GFP sequence was then recombined into a Gateway-compatible derivative of the

pCDH-CMV–MCS1-Ef1α-copGFP (SBI System Biosci., Mountain View, CA) as described

(Vuppalanchi et al., 2010). LV was generated as described (Blesch, 2004). Serial dilutions

were used to determine MOI of these LV preparations in DRG cultures.

To generate siRNA resistant NMP35-GFP constructs, 4 nucleotides in the siRNA-

targeted regions (CCGTATTCTTTGCAACATA) were mutated as above using the following

primers: sense, 5' GGGCATCCTATGCCGTG*TTCTTC*GCAACG*TACCTGACTCTGGCTT 3'

and anti-sense, 5' AAGCCAGAGTCAGGTAC*GTTGCG*AAGAAC*ACGGCATAGGATGCCC 3'

(* indicates mutated nucleotides).

RNA isolation and analyses – Total RNA was extracted from the fractionated DRG cultures

using RNAqueous Micro kit (Ambion, Austin, TX) per the manufacturer's protocol. For tissue

preparations, RNA was isolated using the RNAqueous kit (Ambion) per the manufacturer's

protocol. Isolated RNA was quantified using the VersaFluor fluorometer (BioRad) with

RiboGreen assay (Invitrogen) (Willis et al., 2005). Tissue samples were normalized for RNA

content. For the axonal preparations, flow-through from the affinity-based RNA isolation was

used to measure the protein content of the isolates by fluorometry using the NanoOrange

reagent (Invitrogen). Axonal RNA preparations were then normalized for protein content to

control for axon yield (Merianda et al., 2009; Willis et al., 2005; Willis et al., 2007). Normalized

RNA samples (60 ng each) were used for reverse transcription (RT) using iScript RT (BioRad).

Standard PCR was performed using HotstarTaq Mastermix (Qiagen, Valencia, CA).

RNA isolated from adult rat brain was used as a positive control for RT-PCR. Negative control

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

16

consisted of PCR using RT reactions processed without the addition of enzyme (‘no RT’).

Cycling parameters for standard PCR were: 15 min ‘hotstart’ at 95ºC and then 45 sec at 95ºC,

45 sec at 58ºC, and 3 min at 72ºC for 30 cycles.

Reverse transcribed pure axonal RNA samples were further processed for quantitative

PCR (qPCR) using 2X Ssofast Evagreen Supermix on CFX 384 Touch qPCR instrument

(Biorad). For the qPCR on axonal samples, we used signals for the 12S mitochondrial rRNA to

normalize RNA content and RT efficiency between samples by differential cycle threshold (ΔCt)

calculations (Willis and Twiss, 2010). Primers for rat γ-actin, β-actin, and MAP2 mRNAs and

12S mitochondrial rRNA have been published (Willis et al., 2005). Other primers used were as

follows: glyceraldehyde-3-phosphate dehydrogenase (GAPDH; GenBank acc. NM_017008) –

sense, 5’ GGAGAAACCTGCCAAGTATG 3’ and antisense, 5’ AGACAACCTGGTCCTCAGTG

3’; NMP35 – sense, 5’ ACCTGACTCTGGCTTGCTGT 3’ and antisense, 5’

CGAGGAGGAGTCCACTGAAG 3’.

Axonal mRNA decay analyses – Naïve and injury-conditioned DRGs were cultured on PET

membranes for 16 hours and then treated with 20 µM Cyclosporin A (CsA; LC Laboratories).

After 20 mins, cell bodies and non-neuronal cells were removed as described above; severed

axons were incubated at 37ºC, 5% CO2 for up to 6 hr. Axonal RNA was then isolated and

processed for RT-PCR as described above. The qPCR analyses were performed in

quadruplicate over at least 3 separate experiments.

In situ hybridization and immunofluorescence analyses – Digoxigenin-labeled

oligonucleotide or cRNA probes were used for FISH. Oligonucleotide probes were used to

detect endogenous mRNAs as previously described (Vuppalanchi et al., 2010). Antisense

oligonucleotides to nucleotides 842-891 and 980-1029 of rat NMP35 (GenBank accession

NM_144756) were designed using Oligo6 software (Molecular Biology Insights, Cascade, CO).

BLAST analyses showed no homology to rat mRNAs deposited into GenBank. These were

synthesized with 5'-amino C6 modifier C6 at four thymidines per oligonucleotide, and then

labeled with digoxigenin succinamide ester (Roche, Indianapolis, IN) per manufacturer's

protocol. Digoxigenin-labeled, scrambled probes were used for specificity control. cRNA

probes were used to detect GFP reporter mRNA. These were generated by in vitro transcription

from linearized pcDNA3-eGFP (Addgene, Plasmid 13031) with SP6 or T7 RNA polymerases

and digoxigenin-labeled nucleotide mixture (Roche). Oligonucleotide probes were used at 1.66

ng/µl for cultured neurons and 50 ng/µl for tissue sections (Vuppalanchi et al., 2010). cRNA

probes were used at 5 ng/µl probes. After hybridization and washing, samples were processed

for immunofluorescence as previously described (Vuppalanchi et al., 2010). The following

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

17

primary antibodies were used: chicken anti-neurofilament H (1:1,000; Millipore), mouse anti-

digoxigenin (1:200; Jackson ImmunoRes., West Grove, PA), and Cy3-conjugated mouse anti-

digoxigenin (1:200; Jackson ImmunoRes.). After vigorous washing, secondary antibodies were

applied for 2 hours. The following secondary antibodies were used: FITC-conjugated donkey

anti-chicken (1:200; Jackson ImmunoRes) or AMCA-conjugated anti-chicken (1:200; Jackson

ImmunoRes.) and Cy3-conjugated anti-mouse (1:200; Jackson ImmunoRes.). After series of

washes, samples were mounted with Prolong Gold Antifade (Invitrogen).

Immunofluorescence was performed as previously published (Merianda et al., 2009),

with the exception of either 4% paraformaldehyde or cold methanol fixed samples were used for

cultures (methanol fixation was used to visualize NMP35 protein in cultured neurons). Tissue

sections were equilibrated in PBS and then incubated in 20 mM Glycine followed by 0.25 M

NaBH4 for 30 min to quench autofluorescence (Vuppalanchi et al., 2010). The antibody to rat

NMP35 was generated in chicken using a synthetic NMP35 peptide (SYEEATSGEGLKAGAF;

Swissport # AAC32463) by GeneTel Labs (Madison, WI); this antibody was used at 1:200

dilutions. Mouse anti-neurofilament antibody cocktail (1:400; Sigma) was used to detect axons;

GFP antibody (1:200, Abcam) to enhance GFP signals. Secondary antibodies were FITC or

Texas red conjugated donkey anti-chicken, -rabbit or -mouse antibodies (1:300; Jackson

Immunores.). After vigorous washes, samples were mounted as above. Cultured neurons were

imaged with Leica DMRXA2 or Zeiss Axioplan epifluorescent microscopes fitted with ORCA-ER

CCD camera (Hamamatsu, Bridgewater, NJ). All images were matched for acquisition

parameters and post-processing. Tissue sections were imaged using Leica TCS/SP2 or Zeiss

LSM700 laser scanning confocal microscope.

Protein isolation, Electrophoresis and Immunoblotting – DRG cultures were lysed for 20

min at 4ºC in RIPA buffer supplemented with protease inhibitor cocktail (Sigma). Lysates were

cleared of debris by centrifugation at 16,000 xg for 15 min at 4ºC and then normalized for

protein content using Bradford assay (BioRad). Normalized lysates were precipitated overnight

with acetone at -80ºC, and then resuspended and denatured in Laemmli sample buffer.

Samples were resolved by standard SDS-PAGE and then electrophoretically transferred to

PVDF membranes (Millipore). Membranes were rinsed in Tris-buffered saline with 0.1% Tween

20 (TBST) and then blocked in 5% nonfat dry milk. Blots were incubated in the following

antibodies overnight at 4ºC: rabbit anti-LFG (1:500; Pro Sci, Poway, CA) or rabbit anti-GFP

(1:2000; Abcam, Cambridge, MA). Blots were rinsed several times in TBST and then incubated

with HRP-conjugated anti-rabbit IgG (1:5,000; Millipore) in the blocking buffer for 1 h at room

temperature. Blots were washed for 30 min in TBST and developed with ECLplus (GE

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

18

Healthcare, Piscataway, NJ).

Fluorescence Recovery after Photobleaching – FRAP was used to test for axonal

translation of GFPmyr reporter mRNAs with NMP35 3’UTR as described (Vuppalanchi et al.,

2010). For this, DRG cultures that had been transfected with GFPmyr3’NMP35 were initially

evaluated for GFP expression by epifluorescence microscopy. 40x oil immersion objective (0.7

NA) on an inverted Leica TCS/SP2 confocal microscope with an environmental chamber

maintained at 37ºC was used with pinhole was set at 4 AU. For baseline fluorescence intensity,

neurons were imaged every 30 sec over 2 min with 488 nm laser line set at 15% power before

bleaching. For photobleaching, ≥ 150 µm2 ROI comprising the terminal 70-120 µm of distal

axon was exposed to 100% power of the 488 nm laser line for 40 frames at 1.6 sec intervals.

Recovery was then monitored every 30 sec over 30 min using 15% power of 488 nm laser line

and GFP emission was collected over band filter of 498-530 nm with PMT energy, offset, and

gain matched for all collection sets. To assess role of protein synthesis in this recovery,

cultures were pre-treated with 80 µM anisomycin for 30 min prior to photobleaching. Image J

(www.rsbweb.nih.gov/ij) was used to calculate average pixels/µm2 in the ROIs of the raw

confocal images, which was then normalized to baseline intensity to calculate percent recovery.

Mean for this normalized intensity for each post-bleach interval was calculated.

siRNA-based depletion – A pool of four synthetic siRNAs targeting rat NMP35 mRNA was

designed using Dharmacon’s siDESIGN Center (www.dharmacon.com/sigenome/default.aspx).

For siRNA transfection, dissociated DRGs were cultured and then transfected with 200 nM

siRNA after 24 hours using DharmaFECT3 transfection reagent in serum free medium per

manufacturer’s protocol (Dharmacon, Chicago, IL). Transfection efficiency for siRNAs was

monitored by co-transfection with a stable, fluorescent, non-targeting control siRNA with RISC-

free modification (siGLO, Dharmacon). To test for non-specific effects of siRNA transfection,

cultures were transfected with non-targeting siCONTROL (Dharmacon). Efficiency of siRNA-

based depletion was quantitated by RTqPCR for NMP35 mRNAs at 72 hours after transfection

as outlined above.

in vivo Expression of NMP35-GFP – For testing localization of NMP35-GFP in vivo, L4-5

DRGs were transduced with LV preparations as outlined above. 40 MOI (10 µl) of each LV

preparation was injected into the L4-5 nerve roots adjacent to the DRG. 10 days later, animals

were subjected to sciatic nerve crush injury at mid-thigh as previously described (Twiss et al.,

2000). The L4-5 DRGs, nerve roots (injection site) and sciatic nerve (0.5 cm proximal to 0.5 cm

distal to the crush site) were dissected fixed in 4% paraformaldehyde and processed for

cryosectioning. Cryostat sections were immunolabeled as described above with anti-

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

19

neurofilament (1:750; Millipore) and anti-GFP (1:200; Abcam) antibodies. Teased nerve

preparations were generated from a segment of fixed sciatic nerve that was equilibrated in PBS.

A 30-ga needle was used to strip away the epineurium and teased apart the nerve into

individual fibers. Teased nerves were air dried on Superfrostplus glass slides (Fisher, Pittsburgh,

PA), hydrated in PBS, and then processed for immunostaining. Teased nerves were mounted

under coverslips with Prolong Gold Antifade and analyzed by confocal microscopy. Mean for

GFP protein intensity (pixels/µm2) in DRG, distal and proximal nerves (both naïve and injured)

was calculated using Image J.

Axon outgrowth assays – Axonal length was assessed after 72 hours in culture by

immunostaining with neuronal markers as above. Length of longest axon of randomly captured

images was measured by a blinded observer using Image J as described (Donnelly et al.,

2011). At least three separate culture preparations were analyzed for each condition.

Fluorescence intensity studies – Intensity was calculated from digital images that were

matched for exposure time, gain, offset, and post-processing parameters. mRNA and protein

signals in cell body and axons was analyzed for intensity for n ≥ 15 for cell body and n ≥ 20 for

axons from at least 3 separate experiments. Neurofilament signals were used to trace neuronal

cell body and axons. Image J was then used to calculate the average pixels/μm2 in these areas

as recently described (Vuppalanchi et al., 2012).

Statistical Analyses – GraphPad Prism 4 software package (La Jolla, CA) was used for

statistical analyses. Students T test was used to compare two means of independent groups.

These included fluorescent intensities from FISH and immunofluorescence images calculated

using Image J. One-way ANOVA with Bonferroni post-hoc test was used to test for significance

the FRAP studies where more independent groups were compared as previously published

(Akten et al., 2011; Ben-Yaakov et al., 2012; Perry et al., 2012; Vuppalanchi et al., 2010;

Vuppalanchi et al., 2012; Yudin et al., 2008).

ACKNOWLEDGEMENTS: The initial studies in this work were funded by the Paralyzed

Veterans of America Spinal Cord Research Foundation (PVA # 2520 to TTM). Additional grant

funding came from NIH (R01-NS041596 to JLT), the Miriam and Sheldon G. Adelson Medical

Research Foundation, and the International Foundation for Research in Paraplegia (P116 to

JLT).

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

20

REFERENCES

Aakalu, G., Smith, W. B., Nguyen, N., Jiang, C. and Schuman, E. M. (2001). Dynamic visualization of local protein synthesis in hippocampal neurons. Neuron 30, 489-502. Akten, B., Kye, M. J., Hao le, T., Wertz, M. H., Singh, S., Nie, D., Huang, J., Merianda, T. T., Twiss, J. L., Beattie, C. E. et al. (2011). Interaction of survival of motor neuron (SMN) and HuD proteins with mRNA cpg15 rescues motor neuron axonal deficits. Proc Natl Acad Sci USA 108, 10337-42. Andreassi, C. and Riccio, A. (2009). To localize or not to localize: mRNA fate is in 3'UTR ends. Trends Cell Biol 19, 465-74. Andreassi, C., Zimmermann, C., Mitter, R., Fusco, S., Devita, S., Saiardi, A. and Riccio, A. (2010). An NGF-responsive element targets myo-inositol monophosphatase-1 mRNA to sympathetic neuron axons. Nat Neurosci 13, 291-301. Barrientos, S. A., Martinez, N. W., Yoo, S., Jara, J. S., Zamorano, S., Hetz, C., Twiss, J. L., Alvarez, J. and Court, F. A. (2011). Axonal degeneration is mediated by the mitochondrial permeability transition pore. J Neurosci 31, 966-78. Beier, C. P., Wischhusen, J., Gleichmann, M., Gerhardt, E., Pekanovic, A., Krueger, A., Taylor, V., Suter, U., Krammer, P. H., Endres, M. et al. (2005). FasL (CD95L/APO-1L) resistance of neurons mediated by phosphatidylinositol 3-kinase-Akt/protein kinase B-dependent expression of lifeguard/neuronal membrane protein 35. J Neurosci 25, 6765-74. Ben-Yaakov, K., Dagan, S., Segal-Ruder, Y., Shalem, O., Vuppalanchi, D., Willis, D. E., Yudin, D., Rishal, I., Blesch, A., Pilpel, Y. et al. (2012). Axonal Transcription Factors Signal Retrogradely In Lesioned Peripheral Nerve. EMBO J 31, 1350-63. Blesch, A. (2004). Lentiviral and MLV based retroviral vectors for ex vivo and in vivo gene transfer. Methods 33, 164-72. Cheever, T. R., Olson, E. A. and Ervasti, J. M. (2011). Axonal regeneration and neuronal function are preserved in motor neurons lacking ss-actin in vivo. PloS ONE 6, e17768. Desbarats, J., Birge, R. B., Mimouni-Rongy, M., Weinstein, D. E., Palerme, J. S. and Newell, M. K. (2003). Fas engagement induces neurite growth through ERK activation and p35 upregulation. Nat Cell Biol 5, 118-25. Donnelly, C. J., Fainzilber, M. and Twiss, J. L. (2010). Subcellular communication through RNA transport and localized protein synthesis. Traffic 11, 1498-505. Donnelly, C. J., Willis, D. E., Xu, M., Tep, C., Jiang, C., Yoo, S., Schanen, N. C., Kirn-Safran, C. B., van Minnen, J., English, A. et al. (2011). Limited availability of ZBP1 restricts axonal mRNA localization and nerve regeneration capacity. EMBO J 30, 4665-4677. Fernandez, M., Segura, M. F., Sole, C., Colino, A., Comella, J. X. and Cena, V. (2007). Lifeguard/neuronal membrane protein 35 regulates Fas ligand-mediated apoptosis in neurons via microdomain recruitment. J Neurochem 103, 190-203. Gumy, L. F., Yeo, G. S., Loraine Tung, Y. C., Zivraj, K. H., Willis, D., Coppola, G., Lam, B. Y., Twiss, J. L., Holt, C. E. and Fawcett, J. W. (2011). Transcriptome analysis of embryonic and adult sensory axons reveals changes in mRNA repertoire localization. RNA 17, 85-98. Hanz, S., Perlson, E., Willis, D., Zheng, J. Q., Massarwa, R., Huerta, J. J., Koltzenburg, M., Kohler, M., van-Minnen, J., Twiss, J. L. et al. (2003). Axoplasmic importins enable retrograde injury signaling in lesioned nerve. Neuron 40, 1095-104. Hurtado de Mendoza, T., Perez-Garcia, C. G., Kroll, T. T., Hoong, N. H., O'Leary, D. D. and Verma, I. M. (2011). Antiapoptotic protein Lifeguard is required for survival and maintenance of Purkinje and granular cells. Proc Natl Acad Sci USA 108, 17189-94. Jimenez-Diaz, L., Geranton, S. M., Passmore, G. M., Leith, J. L., Fisher, A. S., Berliocchi, L., Sivasubramaniam, A. K., Sheasby, A., Lumb, B. M. and Hunt, S. P. (2008). Local translation in primary afferent fibers regulates nociception. PLoS ONE 3, e1961.

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

21

Jung, H., O'Hare, C. M. and Holt, C. E. (2011). Translational regulation in growth cones. Curr Opin Gen Dev 21, 458-64. Jung, H., Yoon, B. C. and Holt, C. E. (2012). Axonal mRNA localization and local protein synthesis in nervous system assembly, maintenance and repair. Nat Rev Neurosci 13, 308-24. Kislauskis, E. H., Zhu, X. and Singer, R. H. (1994). Sequences responsible for intracellular localization of beta-actin messenger RNA also affect cell phenotype. J Cell Biol 127, 441-51. Koenig, E., Martin, R., Titmus, M. and Sotelo-Silveira, J. R. (2000). Cryptic peripheral ribosomal domains distributed intermittently along mammalian myelinated axons. J Neurosci 20, 8390-8400. Lyles, V., Zhao, Y. and Martin, K. C. (2006). Synapse formation and mRNA localization in cultured Aplysia neurons. Neuron 49, 349-56. Melemedjian, O. K., Asiedu, M. N., Tillu, D. V., Peebles, K. A., Yan, J., Ertz, N., Dussor, G. O. and Price, T. J. (2010). IL-6- and NGF-Induced Rapid Control of Protein Synthesis and Nociceptive Plasticity via Convergent Signaling to the eIF4F Complex. J Neurosci 30, 15113-23. Merianda, T. T., Lin, A. C., Lam, J. S., Vuppalanchi, D., Willis, D. E., Karin, N., Holt, C. E. and Twiss, J. L. (2009). A functional equivalent of endoplasmic reticulum and Golgi in axons for secretion of locally synthesized proteins. Mol Cell Neurosci 40, 128-42. Mimouni-Rongy, M., White, J. H., Weinstein, D. E., Desbarats, J. and Almazan, G. (2011). Fas ligand acts as a counter-receptor in Schwann cells and induces the secretion of bioactive nerve growth factor. J Neuroimmunol 230, 17-25. Natera-Naranjo, O., Aschrafi, A., Gioio, A. E. and Kaplan, B. B. (2010). Identification and quantitative analyses of microRNAs located in the distal axons of sympathetic neurons. RNA 16, 1516-29. Perlson, E., Hanz, S., Ben-Yaakov, K., Segal-Ruder, Y., Seger, R. and Fainzilber, M. (2005). Vimentin-dependent spatial translocation of an activated MAP kinase in injured nerve. Neuron 45, 715-26. Perry, R. B.-T., Doron, E., Iavnilovitch, E., Rishal, I., Dagan, S., Tsoory, M., Copolla, G., Gomes, C., McDonald, M., Geschwind, D. et al. (2012). Subcellular Knockout of Importin β1 Perturbs Axonal Retrograde Signaling. Neuron 75, 294-305. Roche, F. K., Marsick, B. M. and Letourneau, P. C. (2009). Protein synthesis in distal axons is not required for growth cone responses to guidance cues. J Neurosci 29, 638-52. Schweitzer, B., Suter, U. and Taylor, V. (2002). Neural membrane protein 35/Lifeguard is localized at postsynaptic sites and in dendrites. Brain Res Mol Brain Res 107, 47-56. Schweitzer, B., Taylor, V., Welcher, A. A., McClelland, M. and Suter, U. (1998). Neural membrane protein 35 (NMP35): a novel member of a gene family which is highly expressed in the adult nervous system. Mol Cell Neurosci 11, 260-73. Segura, M. F., Sole, C., Pascual, M., Moubarak, R. S., Perez-Garcia, M. J., Gozzelino, R., Iglesias, V., Badiola, N., Bayascas, J. R., Llecha, N. et al. (2007). The long form of Fas apoptotic inhibitory molecule is expressed specifically in neurons and protects them against death receptor-triggered apoptosis. J Neurosci 27, 11228-41. Shestakova, E. A., Singer, R. H. and Condeelis, J. (2001). The physiological significance of beta -actin mRNA localization in determining cell polarity and directional motility. Proc Natl Acad Sci USA 98, 7045-50. Smith, D. S. and Skene, P. (1997). A transcription-dependent switch controls competence of adult neurons for distinct modes of axon growth. J. Neurosci. 17, 646-658. Sole, C., Dolcet, X., Segura, M. F., Gutierrez, H., Diaz-Meco, M. T., Gozzelino, R., Sanchis, D., Bayascas, J. R., Gallego, C., Moscat, J. et al. (2004). The death receptor

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

22

antagonist FAIM promotes neurite outgrowth by a mechanism that depends on ERK and NF-kapp B signaling. J Cell Biol 167, 479-92. Taylor, A. M., Berchtold, N. C., Perreau, V. M., Tu, C. H., Li Jeon, N. and Cotman, C. W. (2009). Axonal mRNA in uninjured and regenerating cortical mammalian axons. J Neurosci 29, 4697-707. Toth, C. C., Willis, D., Twiss, J. L., Walsh, S., Martinez, J. A., Liu, W. Q., Midha, R. and Zochodne, D. W. (2009). Locally Synthesized Calcitonin Gene-Related Peptide Has a Critical Role in Peripheral Nerve Regeneration. J Neuropathol Exp Neurol 68, 326–337. Twiss, J., Smith, D., Chang, B. and Shooter, E. (2000). Translational control of ribosomal protein L4 is required for rapid neurite extension. Neurobiol Dis 7, 416-428. Vuppalanchi, D., Coleman, J., Yoo, S., Merianda, T. T., Yadhati, A. G., Hossain, J., Blesch, A., Willis, D. E. and Twiss, J. L. (2010). Conserved 3'-untranslated region sequences direct subcellular localization of chaperone protein mRNAs in neurons. J Biol Chem 285, 18025-38. Vuppalanchi, D., Merianda, T., Donnelly, C., Pacheco, A., Williams, G., Yoo, S., Ratan, R., Willis, D. and Twiss, J. (2012). Lysophosphatidic acid differentially regulates axonal mRNA translation through 5' UTR elements. Molec Cell Neurosci 50, 136-46. Willis, D., Li, K. W., Zheng, J. Q., Chang, J. H., Smit, A., Kelly, T., Merianda, T. T., Sylvester, J., van Minnen, J. and Twiss, J. L. (2005). Differential transport and local translation of cytoskeletal, injury-response, and neurodegeneration protein mRNAs in axons. J Neurosci 25, 778-91. Willis, D. E. and Twiss, J. L. (2010). Regulation of protein levels in subcellular domains through mRNA transport and localized translation. Mol Cell Proteomics 9, 952-962. Willis, D. E. and Twiss, J. L. (2011). Profiling Axonal mRNA Transport. Methods Mol Biol 714, 335-352. Willis, D. E., van Niekerk, E. A., Sasaki, Y., Mesngon, M., Merianda, T. T., Williams, G. G., Kendall, M., Smith, D. S., Bassell, G. J. and Twiss, J. L. (2007). Extracellular stimuli specifically regulate localized levels of individual neuronal mRNAs. J Cell Biol 178, 965-80. Willis, D. E., Xu, M., Donnelly, C. J., Tep, C., Kendall, M., Erenstheyn, M., English, A. W., Schanen, N. C., Kirn-Safran, C. B., Yoon, S. O. et al. (2011). Axonal Localization of Transgene mRNA in Mature PNS and CNS Neurons. J Neurosci 31, 14481-7. Yudin, D., Hanz, S., Yoo, S., Iavnilovitch, E., Willis, D., Segal-Ruder, Y., Vuppalanchi, D., Ben-Yaakov, K., Hieda, M., Yoneda, Y. et al. (2008). Localized regulation of axonal RanGTPase controls retrograde injury signaling in peripheral nerve. Neuron 59, 241-52. Zelena, J. (1970). Ribosome-like particles in myelinated axons of the rat. Brain Res 24, 359-363. Zheng, J.-Q., Kelly, T., Chang, B., Ryazantsev, S., Rajasekaran, A., Martin, K. and Twiss, J. (2001). A functional role for intra-axonal protein synthesis during axonal regeneration from adult sensory neurons. J Neurosci 21, 9291-9303. Zivraj, K. H., Tung, Y. C., Piper, M., Gumy, L., Fawcett, J. W., Yeo, G. S. and Holt, C. E. (2010). Subcellular Profiling Reveals Distinct and Developmentally Regulated Repertoire of Growth Cone mRNAs. J Neurosci 30, 15464-15478. Zuliani, C., Kleber, S., Klussmann, S., Wenger, T., Kenzelmann, M., Schreglmann, N., Martinez, A., del Rio, J. A., Soriano, E., Vodrazka, P. et al. (2006). Control of neuronal branching by the death receptor CD95 (Fas/Apo-1). Cell Death Differ 13, 31-40.

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

23

FIGURE LEGENDS

Fig. 1: NMP35 mRNA and protein are enriched in axons of injury-conditioned neurons in

culture. Dissociated DRG cultures prepared from naïve and injured rats at 7 days following

sciatic nerve crush were used for fractionation of cell bodies and axons (A-C) or for FISH and

immunofluorescence (D-G) after 24 hours in vitro. A-C, By RT-PCR, β-actin was detected only

in the axonal processes, but γ-actin and MAP2 mRNAs were restricted to the cell body samples

showing purity of the axonal preparations (A). By both standard (B) and quantitative RT-PCR

(C) NMP35 mRNA levels shift from cell body to axon predominance the neurons from the

injured animals. Amplification of GAPDH shows equivalent levels of total RNA in the standard

RT-PCR; 12S rRNA was used for normalization of the RTqPCR. D-E, By FISH (D) and

immunofluorescence (E), both NMP35 mRNA and protein appear more abundant in the axons

(arrows) and less in cell bodies of DRG neurons cultured from injury-conditioned compared with

naïve animals. The cell body images in D and E show XYZ maximum projections from

constructed from 10 optical planes taken at 0.5 µm intervals; the inset panels show only the

NMP35 mRNA or protein signals. F-G, Quantification of FISH (F) and immunofluorescence (G)

signals for axons and cell bodies from matched exposure images as in D-E are shown. All

image pairs of naïve and injury-conditioned neurons are matched for exposure, gain, offset and

post-processing (n ≥ 15 for cell body and n ≥ 20 for axons from at least 3 separate experiments;

** = p ≤ 0.01, *** = p ≤ 0.001 by student’s T test) [Scale bars = 10 µm].

Fig. 2: Axotomy increases axonal localization of NMP35 mRNA in vivo.

NMP35 mRNA and protein levels were examined in naïve vs. crush-injured sciatic nerve at 7

days after injury. Nerve was sampled just proximal to the crush injury with a corresponding

level of naïve nerve sampled; L4-5 DRGs are illustrated. A, Representative exposure matched

confocal image pairs of naïve vs. injured nerve for FISH/IF show increased signal for NMP35

mRNA in axons of the injured sciatic nerve (arrows) and a decrease in NMP35 mRNA signal in

the neuronal cell bodies of L4-5 DRGs compared to uninjured nerve and DRG. B,

Representative exposure matched confocal image pairs as in ‘A’ show a similar increased

signal for NMP35 protein in the sciatic nerve (arrows) and decreased signal for NMP35 protein

in the L4-5 DRG neuronal cell bodies at 7 days after injury compared to uninjured nerve and

DRG. C, Quantification of NMP35 mRNA intensity that overlapped with NF H protein signal in

naïve and injured sciatic nerve and DRG sections is shown. D, Quantification of NMP35 protein

intensity overlapping with NF H signal in uninjured and injured sciatic nerve vs. DRG is shown.

E-F, RNA was purified from sciatic nerve and L4-5 DRGs, both naïve and at 7 days post crush

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

24

injury, and used for RT-PCR to gain a more quantitative estimate of changes in NMP35 mRNA

levels. Standard RT-PCR amplification of β-actin and GAPDH mRNAs shows relative equivalent

loading between samples; absence of MAP2 mRNA in the sciatic nerve is consistent with the

axonal nature of the neuronal processes in the sciatic nerve (E). NMP35 mRNA appears to

increase in the nerve and decrease in the DRG following crush injury. RTqPCR similarly shows

increase NMP35 mRNA in sciatic nerve and decrease in DRG (F). 12S rRNA was used to

normalize RTqPCR data (n ≥ 20 from at least 3 separate experiments; *** = p ≤ 0.001 by

student’s T test for indicated data pairs) [Scale bars = 5 µm for DRG images and 10 µm for

sciatic nerve images].

Fig. 3: 3’ UTR of NMP35 mRNA is sufficient for axonal mRNA localization in vitro.

DRGs were transfected with diffusion limited GFPmyr plus 3’UTR of NMP35 mRNA to test for

axonal localizing ability of this non-translated region. A, Representative images from FRAP

sequences are shown for indicated pre-bleach and post-bleach intervals for control (top row)

and 80 µM anisomycin treated cultures (bottom row). GFP fluorescence is displayed as a

spectrum as indicated; the boxed area represents the region of interest (ROI) for the terminal

axon that was subjected to bleaching. Recovery of GFP signals in the ROI, only occurs when

protein synthesis is intact [Scale bar = 25 µm]. B, Quantification of fluorescence in the ROI over

indicated time period is shown for N ≥ 7 neurons analyzed over at least 3 separate transfection

experiments. Average fluorescence is shown as a percentage of pre-bleach signals within each

image sequence; error bars represent SEM for each experiment (* = p ≤ 0.05, ** = p ≤ 0.01, and

*** = p ≤ 0.001 by one-way ANOVA compared to t = 0 min).

Fig. 4: 3’UTR of NMP35 mRNA is needed for localization into sensory sciatic nerve.

To determine if the 3’UTR of NMP35 mRNA is needed for axonal localization in vivo, L4-5

DRGs were transduced with LV that express NMP35-GFP fusion protein carrying the 3’UTR of

NMP35 or GFP mRNAs (NMP-GFP-3’NMP35 and NMP-GFP-3’GFP, respectively). A-H,

Representative exposure matched confocal images for GFP signals (green) and NF H (red) are

shown for sections of L4-5 DRGs and sciatic nerves for naïve and 7 day crush injured nerves

and DRGs are shown as indicated. Large panels show merged images and inset panels show

only GFP channel. The right hand strips for panels C, D, G and H show YZ images of merged

GFP and NF signals for first strip, and GFP signals only for second strip. GFP signals are seen

along the periphery of DRG cell bodies (arrows) for both NMP35-GFP-3’GFP (A,B) and NMP35-

GFP-3’NMP35 transduced animals (E,F). This suggests membrane localization of NMP35-GFP

protein. Sections of distal sciatic nerve show GFP signals only in the NMP35-GFP-3’NMP35

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

25

transduced animals (G,H), with a clear increase in GFP signals in the injured nerve (arrows).

The nerves in the NMP35-GFP-3’NMP35 transduced animals are also suggestive of focal

NMP35-GFP signals along the periphery of the axon. This is also seen in YZ projections of

image stacks that show intra-axonal NMP35-GFP and signals enriched along the periphery of

the axoplasm (image strips in G and H; also see teased nerve preparations in Suppl. Fig. S4)

[Scale bars = 10 µm]. I-L, GFP signal intensity that overlapped with NF H signals was

quantified over multiple animals and is shown for DRG and sciatic nerves for the NMP35-GFP-

3’GFP (I, J) and NMP35-GFP-3’NMP35 (K, L) transduced animals. These data confirm absence

of sciatic nerve NMP35-GFP signals in the NMP35-GFP-3’GFP transduced animals (J) and

increase in sciatic nerve NMP35-GFP signals with nerve crush injury in the NMP35-GFP-

3’NMP35 transduced animals (L) (n ≥ 25 from at least 3 separate transduced experiments; ** =

p ≤ 0.01 and *** = p ≤ 0.001 by student’s T test).

Fig. 5: Depletion of NMP35 mRNAs in the DRG neurons attenuates axonal outgrowth. A,

DRG cultures transfected with siRNA targeting NMP35 (siNMP35) mRNA or a non-targeting

control (siControl) show reduced NMP35 mRNA and protein at 72 hours post-transfection by

RT-PCR and immunoblotting, respectively. B, RTqPCR, siNMP35 reduced endogenous

NMP35 mRNA levels by approximately 80%. C-D, Depletion of NMP35 mRNA from DRG

cultures decreases axonal growth. Representative NF H stained images are shown in C.

Quantification of average axon length for neurons transfected with siNMP35 vs. siControl after

72 hours in vitro is shown in D [scale bar = 100 µm]. E-F, To test for potential off-target effects

of the siNMP35, neurons were co-transfected with cell body restricted (NMP35-GFP-3’GFP) vs.

axonally targeted (NMP35-GFP-3’NMP35) constructs; transfection with GFP was used as a

control. E shows representative RT-PCR and immunoblotting for NMP35 mRNA and NMP35-

GFP mRNA and proteins. Upon co-transfection with siNMP35 and NMP35-GFP constructs,

NMP35 mRNA levels were rescued to near endogenous levels. GFP mRNA levels were

relatively equivalent for the two NMP35-GFP and the GFP transfections. Immunoblotting

confirmed expression of NMP35-GFP protein. Analysis of axonal growth in these co-

transfection experiments showed the expected reduction in axon length comparing siNMP35 +

GFP and siControl transfections. Both the NMP35-GFP constructs rescued axonal outgrowth

deficit seen with siNMP35, with the axonally targeting NMP35-GFP-3’NMP35 increasing axonal

growth above the siControl transfected cultures. siNMP35 +GFP showed significant reduction in

axonal outgrowth compared to siControl, NMP35-GFP-3’NMP35 and NMP35-GFP-3’GFP

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

26

transfected neurons (n ≥ 25 from at least 3 separate transfection experiments; *** = p ≤ 0.001 by

student’s T test for B, D and F)

Fig. 6: Axonal targeting of NMP35 mRNA is sufficient to increase axonal outgrowth.

To determine if targeting NMP35-GFP fusion protein for axonal synthesis might contribute to

growth, we transduced cultured DRG neurons with the LV preparations used in Fig. 4 to

overexpress axonally targeted vs. cell body restricted NMP35 mRNA (NMP35-GFP-3’NMP35

and NMP35-GFP-3’GFP, respectively). A-C, NMP35-GFP-3’NMP35 and NMP35-GFP-3’GFP

transduced cultures were processed for FISH for GFP mRNA. Representative exposure

matched images of cell bodies and axon shaft are shown in A. Here, GFP mRNA is only seen

in axons of NMP35-GFP-3’NMP35 transduced cultures. Quantification of axonal and neuronal

cell body GFP mRNA signals for multiple cultures is shown in panels B and C, respectively.

There is no GFP mRNA signal above background in the NMP35-GFP-3’GFP transduced

cultures while cell body signals are not significantly different between the NMP35-GFP-3’GFP

and NMP35-GFP-3’NMP35 transduced cultures (** = p ≤ 0.01 by student’s T test). D,

Representative montage images of neurons expressing GFP, NMP35-GFP-3’NMP35, and

NMP35-GFP-3’GFP for 72 hours and then stained for NF H are shown. E, Quantification of

axon length of neurons transduced with GFP, NMP35-GFP-3’NMP35, or NMP35-GFP-3’GFP is

shown (n ≥ 25 neurons in at least 3 separate transduction experiments; ** = p ≤ 0.01; *** = p ≤

0.001 by student’s T test) [Scale bars = 10 µm for A and 200 µm for D].

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

27

SUPPLEMENTAL FIGURES

Fig. S1: Controls for overall NMP35 mRNA levels and FISH on DRG neurons.

A, Despite the shift in axonal levels of NMP35 mRNA with injury-conditioning shown in Fig.

1B,C, by RT-PCR there is no corresponding apparent changes in the overall levels of NMP35

mRNA in the injury-conditioned compared to naïve DRG cultures. B, Representative FISH

images for scrambled probe (controls) and no-probe controls consistently showed no signal in

axons of injury-conditioned neurons in images matched to those in Fig. 1D for exposure, gain,

and offset [Scale bars = 10 µm].

Fig. S2: Endogenous NMP35 mRNA localizes into both axons and dendrites.

Cultured rat cortical neurons at 9 days in vitro were processed for FISH/IF for NMP35 mRNA

and MAP2 or Tau protein as indicated. NMP35 mRNAs is seen in both axons (lower panels)

and dendrites (upper panels, arrows), showing clear granular nature characteristic of

transported mRNAs. Inset panels show only the NMP35 mRNA signal. Scramble probe do not

show any signals in these processes exposure, gain and offset matched images [Scale bars =

5 µm].

Fig. S3: 3’UTR of NMP35 mRNA is needed for localization into sensory sciatic nerve.

L4-5 DRGs were transduced with LV-NMP35-GFP-3’GFP and LV-NMP35-GFP-3’NMP35.

Nerve segments taken near the injection site show GFP signals (green) in the Schwann cells for

both preparations (A-D). E-F show quantification of the GFP protein intensity that overlapped

with NF H signals for sciatic (n ≥ 30 from at least 3 separate experiments; * = p ≤ 0.05 by

student’s T test) [Scale bars = 10 µm].

Fig. S4: 3’UTR of NMP35 mRNA localization in the teased sciatic nerve.

Teased nerve preparations also confirmed the axonal localization of GFP signals in the LV-

NMP35-GFP-3’NMP35 (C,D) transduced animals and lack of signals in the LV-NMP35-GFP-

3’GFP transduced animals (A-B). A and C show XYZ reconstructions of GFP signals, with YZ

projections in the inset panels; B and D show XYZ projections of GFP signals merged with DIC

images. The NMP35-GFP signals are concentrated near the membrane of the axon for the

NMP35-GFP-3’NMP35 transduced samples (arrows) [Scale bars = 10 μm]

Fig. S5: Stability of NMP35 mRNA in axons.

Degeneration of severed axons was delayed by treatment with CsA and NMP35 mRNA levels

were measured in axons from overnight cultures of naïve and 7 day injury conditioned DRG

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

28

neurons. A shows standard RT-PCR for NMP35 and GAPDH mRNAs with increased levels of

NMP35 mRNA in the axons of injury conditioned compared to naïve neurons. B shows results

from RTqPCR over three separate experiments where the NMP35 mRNA was normalized to

12S rRNA and expressed as fold change relative 2 hour time point ± SEM. The signals vary

between time points but there is no significant difference between the 2, 4 and 6 hour values for

the naïve and injury conditioned sequences. RTqPCR analyses also showed significant more

NMP35 mRNA in the axons from injury conditioned than naïve neurons at each time point (p ≤

0.01 at 2 hours and p ≤ 0.001 at 4 and 6 hours by student’s T test).

Supplemental Video 1: Axonal translation of GFPmyr3’NMP35 in DRG neurons.

Representative video of FRAP sequence for DRG neurons transfected with GFPmyr3’NMP35 is

shown. Pre-bleach (2 min.), bleach (1 min.) and post-bleach (30 min.) intervals are shown

consecutively as outlined in the methods. The boxed area represents ROI subjected to

photobleaching. GFP signals are shown as a spectrum as indicated (see Fig. 3A).

Supplemental Video 2: Protein synthesis inhibition prevents translation of

GFPmyr3’NMP35 in DRG axons. Representative FRAP sequence for GFPmyr3’NMP35

transfected DRG neurons as in Suppl. Video 1 where cultures were pretreated with the protein

synthesis inhibitor anisomycin (see Fig. 3B).

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t