-
Pandey at Alii Ethanol re-precipitation removes PCR
inhibitors
Physical Anthropology 167 172
Ethanol re-precipitation removes PCR
inhibitors from Ancient DNA extract
Rajeev Kumar Pandey 1 2, Deepankar Pratap Singh 3 5,
Godi Sudhakar 2, Vadlamudi Raghavendra Rao 1 4 *
AbstractOne of the major problems in ancient DNA work is the
presence of inhibitory substances, which hampers Taq polymerase
activity. Therefore analysis of ancient DNA sample is very
challenging. Here we describe a simple and competent ethanol
re-precipitation based protocol for the purification of DNA from
ancient bones and tissues. The efficiency of this procedure has
been demonstrated on 600 years old biological samples provided by
Anthropological Survey of India (Himalaya region). This suggests
that re-precipitation of ancient DNA extracts removes PCR
inhibitors and increases the success rate of amplification.
Key words: PCR inhibitors, Ancient DNA, Re-precipitation,
PCR
INTRODUCTION
Analysis of contemporary organisms can provide indirect evidence
of the evolutionary history, and the reconstructions remain
tentative if they cannot be checked against fossil records.
Although working with ancient samples could unravel the molecular
evolution, there are several technical limitations that make the
study extremely difficult. Very small amount of DNA, the decay of
molecules over time, post-mortem modifications and contamination
with DNA from other organisms has proven to be considerable hurdles
for these studies (Hansen et al. 2006; Zhang and Wu 2005; Paabo
1989; Paabo. et al. 2004; Binladen et al. 2005; Hanni et al. 1995;
Tbor Kalmar et al. 2000; Willerslev and Cooper 2005; Hebsgaard et
al.2005; Kaestle. and Horsburgh. 2002). A major factor, which
affects PCR amplification, is the presence of inhibitors, which
vary between state of preservation. These inhibitors are result of
contaminants from the surrounding environment of samples in the
form of humic acid,
1 Anthropological survey of India, Mysore, India 2 Department of
Human Genetics, Andhra University, Visakhapatnam 530003, India3 S2
Functionnel Genomics,IBENS, UMR8197,Ecole Normale Superieure 46,
rue d'Ulm, 75005 Paris, France4 Department of Anthropology,
University of Delhi, Delhi 110007, India
5 Centre for Cellular and Molecular Biology, Uppal Road,
Hyderabad-500007,India* Correspondence author: Dr. V.R.Rao,
Department of Anthropology, University of Delhi; email:
[email protected]
Antrocom Online Journal of Anthropology 2011, vol. 7. n. 2 ISSN
1973-2870 173
-
Pandey at Alii Ethanol re-precipitation removes PCR
inhibitors
fulvic acid, hydroxi-apatite, tannin and contaminating DNA, or
from degradation in the biological sample itself. This could also
be due to influence of terrestrial heat (Hansen et al. 2006; Zhang
and Wu 2005; Paabo et al. 2004; Shinoda et al.2006). Various
oxidative processes, which modify the ancient DNA, are responsible
for the low recovery rate of undamaged DNA from the archeological
remains. Collagen type-I and Maillard products are the inhibitory
factors of PCR amplification in case of bone (Paabo 1989; Paabo et
al. 2004; Willerslev and Cooper 2005; Kemp . and Smith et al.2005;
Kaestle. and Horsburgh 2002).In most of the published protocols
almost the extraction procedures are same (Binladen et al. 2005;
Hanni et al. 1995; Ovchinnikov and Goodwin et al. 2001; Cappellini
et al.2004). After extraction the aqueous phase was concentrated
with micro concentrators, precipitated by silica suspension/glass
milk (Gene Clean Spin Wash) (Shinoda et al.2006; Thomas et al.
2004). Some commercial kits are also available which are dedicated
for the extraction of ancient DNA such as Gene Clean Spin Kit for
Ancient DNA (BIO101). Another study shows that
sodium-acetate-isopropanol extraction was possibly better than
phenol-chloroform method which gives three times more yield than
glass milk method (Hanni et al. 1995). One more protocol was
published, in which Dextran blue is used, for removing PCR
inhibitors with selective ethanol precipitation (Kalmar et al.
2000).Despite the availability of several methods for the analysis
of ancient DNA samples, still the problems of extraction and
amplification remains obscure. The efficiency of every protocol has
its own limitations, depending upon the condition of the
experimental specimen. We have observed that the main problem
dealing with ancient DNA is the unsuccessful/irreproducible
amplification. Sometimes we succeed to amplify some samples;
however, these samples are not reproducible after some hours. This
may be due to generation of some sort of inhibitors in the DNA
solution over the time. Even if one gets the fair amount of DNA, no
one can predict that it can be amplified owing to accumulation of
several PCR inhibitors. Every extract coming from these precious
specimens is worthy and we cannot thrust them aside. Therefore, we
have been trying to develop a simple protocol to overcome the PCR
problem and successfully developed a simple and efficient
re-precipitation method for ancient DNA amplification. A very
simple and efficient re-precipitation method is described in this
study for the purification of DNA from ancient bone samples. In our
adjudication this protocol is better in so many perspectives like;
re-use of the extracts which were not giving amplification but DNA
is there, loss of DNA in the process is very less, no involvement
of hazardous organic solvents, special devices, or enzymes which
increases the possibility of contamination and DNA degradation.
MATERIALS AND METHODS
Ancient specimensAncient Human bone samples were kindly provided
by Anthropological Survey of India and all experiment was performed
in ancient DNA laboratory of the Centre for Cellular and Molecular
Biology (CCMB), Hyderabad. These samples are derived from Himalayan
region of India and was preserved at 4C for further work
Contamination PrecautionsStandard contamination precautions
strictly followed in ancient DNA studies were performed during the
experiments (Paabo et al. 2004; Kalmar et al. 2000; Willerslev and
Cooper 2005; Kemp. and Smith et al.2005; Kaestle and Horsburgh
2002; Cappellini et al.2004; Shinoda et al.2006; Thomas et al.2004;
Kemp and Smith 2005; Willerslev , Hansen . and Poinar 2004).
DNA ExtractionAbout 3 mm of cortical bone surface is removed
with a sterile scalpel from all samples, followed by immersion in
10% bleach solution for 10 min and washing with 70% alcohol. The
cleaned bone
Antrocom Online Journal of Anthropology 2011, vol. 7. n. 2 ISSN
1973-2870 174
-
Pandey at Alii Ethanol re-precipitation removes PCR
inhibitors
fragments were mechanically pulverized into a fine meal in
sterile pestle-mortar. The samples (500mg) were then soaked in 5ml
of 0.5M EDTA (pH 8.0) with 200l of 20mg/ml Proteinase K and 120l of
10% SLS (Sodium Lauryl Sulphate) at 55C for overnight. Two
different methods were employed for the extraction of DNA from the
powdered samples. In the first method decalcified samples were
lysed in 2ml of Lysis buffer (10mM tris HCl ph 8.0, 1mM NaCl) at
60C for 24 hrs, which later subjected to followed by phenol,
phenol-chloroform, chloroform-isoamyl alcohol extraction. At last,
the aqueous phase was concentrated by centrifugation driven
dialysis using Centricon-30 micro concentrators from Amicon. The
concentrate, which was about 0.7ml, purified by Gene Clean Spin Kit
and later eluted in 0.1m Tris-EDTA. In the second method extraction
was done with Gene Clean Kit for Ancient DNA (BIO 101). The pellet
of decalcified bone samples were used for DNA extraction with kit.
Approximately 40l of DNA extract was obtained and visualized on 1%
agarose gel (Figure 1).
Fig. 1
Agarose DNA electrophoresis (1%): [Lane 1: phage DNA marker,
lane 2: DNA sample extracted by Gene Clean Kit, lane 3: Blank,
lane
4: DNA sample extracted by phenol- Chloroform method].
Re-precipitation of DNA extractsAs we found that the DNA samples
extracted using the above methods failed with PCR amplification, we
have introduced a re-precipitation protocol for purification. For
the handiness, volume of extract was made up to 200l and equal
volume of chloroform-iso-amyl alcohol was added to extract. The
aqueous phase, after centrifugation at 12,000 rpm for 15 min, was
transferred to 1.5ml eppendorf s tube and 1/23rd volume of
3M-sodium acetate, 2 volume of ethanol was added and kept at -20C
for overnight. To pellet, solution was centrifuged at 14,000 rpm
for 15 min. supernatant discarded and pellet washed with 85%
ethanol and spin again at 14,000 rpm for 10 min. Supernatant
discarded and allowed to dry and dissolved in 40-50 l of 0.1M
Tris-EDTA.
PCR and SequencingThe PCR amplification was carried out in 20l
reaction volume containing 1L of re-precipitated template, 100M
each of dNTPs, 4 pM of each primer, 1X PCR buffer [100mM Tris-HCL,
pH 8.3 (at 250C), 500mM KCl, 15 mM MgCl2, 0.01%(w/v) gelatin,
bovine serum albumin (BSA) (10 mg/ml) (New England Bio Labs) and
0.5 units of AmpliTaq Gold (Applied Biosystems). Bovine serum
albumin was used as it can bind to various types of PCR inhibitors
that might have carried during extraction. Amplification of
Hypervariable Region (HV region) of bone samples was carried out
using the primers listed (Table 1).In order to sequence, the
amplicons were treated with exonuclease-1 and Shrimp Alkaline
Phosphatase (USB, Cleveland, OH) and sequenced using an automated
ABI 3730 DNA Analyzer (Applied Biosystems).
Antrocom Online Journal of Anthropology 2011, vol. 7. n. 2 ISSN
1973-2870 175
-
Pandey at Alii Ethanol re-precipitation removes PCR
inhibitors
RESULTS AND DISCUSSION
Since the commencement of ancient DNA work several methods have
been demonstrated to make them easily extractable, amplifiable and
inhibitors free (Hanni et al. 1995; Kalmar et al. 2000). However,
still there is no such protocol, which fulfills all these demands
in one. One, which passes one hurdle, fails in second. Hanni et al.
1995, published an isopropanol-based precipitation method (Hanni et
al. 1995) that eliminates time-consuming dialysis and
microconcentrator step. Kalmar et al. 2000 demonstrated that
precipitation of sample with Dextran blue removes PCR inhibitors as
well as save the time of decalcification step (Kalmar et al. 2000).
Hanni et al. 1995, noticed the presence of blurring blue
florescence (derived from Maillard products of reducing sugars),
which migrates at the level of 500bp DNA molecule, and they
correlated them with PCR inhibitors activity. In our case we didnt
get such type of florescence at 500bp (Figure 1) level in our
samples, but still they were showing inhibitory activity. We have
demonstrated that 1l of ancient DNA extract can inhibit the PCR
reaction using modern DNA as a template. If the ancient DNA extract
is progressively diluted (1/10, 1/7, 1/5, 1/2) and added to the
reaction mixture containing contemporary DNA AmpliTaq Gold
polymerase activity was gradually restored. It means that
inhibitors are present in fair amount and with gradual dilution
inhibition was decreased. The same sample was introduced for
amplification with mitochondrial DNA primers (Table n. 1)
Table 1Primer Name Primer Sequence
F15996 5CTCCACCATTAGCACCCAAAGC 3
R16410 5GCGGGATATTGATTTCACGG 3
Sequences of the primer designed for the ancient DNA study
Which was purified by the present method and good yield of PCR
product (5l were loaded on 2% agarose gel) was clearly seen that
the re-precipitated extract gives amplified products of the
expected size after amplification (Figure 2). So, the method works
for the samples, which were in much battered condition and proves
to be very effective method for ancient DNA.
Fig. 2
Agarose DNA electrophoresis (2%) of PCR reaction. [Lane 1: phage
DNA marker (L), lanes 2-7: Positive control (P), lanes 8-16:
negative control samples (N), lane 17: ancient DNA sample
(S13)].
Antrocom Online Journal of Anthropology 2011, vol. 7. n. 2 ISSN
1973-2870 176
-
Pandey at Alii Ethanol re-precipitation removes PCR
inhibitors
There was no need of two consecutive PCR amplification i.e.
re-amplification, as we were getting good yield in first
amplification (40 cycles). The original extract has not given any
amplification but the re-extracted samples has given proper
amplification and interestingly we succeeded to amplify a long
stretch of 424 base pairs which is not usual case with ancient DNA
samples (Kalmar et al. 2000). This could be because of proper
purification of DNA, which removed prominent PCR inhibitors
efficiently. This will reduce the time and labour in PCR and
sequencing of two overlapping sets into a single amplicon stretch
of same size. All the amplified PCR products of varied lengths were
successfully sequenced and assembled with Cambridge reference
sequence (r-CRS) using autoassembler (ABI), which shows
mitochondrial identity (Figure 3).
Fig. 3
A
B
Assembly of ancient Sample with r-CRS: Two Polymorphism were
found in our ancient sample (A) g.16147: C>T; (B) g.16223:
C>T
In this paper we have not demonstrated any full-length
extraction protocol but a very simple and well-organized
re-precipitation method, which is capable of purifying ancient DNA
extract with a little loss during purification. We also proved
efficiency of this method on the extracts, which have enough amount
of DNA but were not amplifiable; moreover we succeed to get an
amplification of 424 base pairs long stretch which proves the
efficiency of this method. This could be very useful for the
purification of ancient DNA extracts and getting long stretch
amplification from ancient DNA.
Antrocom Online Journal of Anthropology 2011, vol. 7. n. 2 ISSN
1973-2870 177
-
Pandey at Alii Ethanol re-precipitation removes PCR
inhibitors
Acknowledgment
The authors thank Dr K.Thangaraj, Scientist, Centre for Cellular
and Molecular Biology, Uppal Road, Hyderabad, India for providing
all the lab facilities. The financial assistance of Anthropological
survey of India is gratefully acknowledged.
References
Binladen J., Wiuf C., Thomas M., Gilbert P., Bunce M., Barnett
R., Larson G., Greenwood A., Haile J.,
Simon Y. W. Ho, Hansen A. and Willerslev E. (2005): Assessing
the fidelity of ancient DNA sequences
amplified from nuclear genes, Genetics, 172: 733741.
Cappellini E., Chiarelli B., Sineo L., Casoli A. (2004):
Biomolecular study of the human remains from
tomb 5859 in the Etuscan necropolis of Monterozzi, Tarquinia
(Viterbo, Italy), Journal of Archaeological
Science.31:603-612.
Hanni C., Brousseaul T., Laudet V. and Stehelin D. (1995):
Isopropanol precipitation removes PCR
inhibitors from ancient bone extracts, Nucleic Acids Research.
23: 881-882.
Hansen A. J., Mitchell D. L., Wiuf C., Paniker L., Brand T. B.,
Binladen J., Gilichinsky D. A., Rnn R.,
and Willerslev E. (2006): Crosslinks rather than strand breaks
determine access to ancient DNA
sequences from frozen sediments. Genetics 173:11751179.
Hebsgaard M. B., Phillips J. M. and Willerslev E. (2005):
Geologically ancient DNA: fact or artefact?
Trends in Microbiology. 13: 212-220.
Kaestle. F.A. and Horsburgh K. A., (2002): Suppl, Ancient DNA in
Anthropology: methods,
applications, and ethics, Am. J. Phys. Anthropology. 35:
92-130.
Kalmar T, Bachrati C. Z., Marcsik A. and Rasko I. (2000): A
simple and efficient method for PCR
amplifiable DNA extraction from ancient bones, Nucleic Acids
Research. 28: e67.
Kemp B. M. and Smith D. G., (2005): Use of bleach to eliminate
contaminating DNA from the surface
of bones and teeth, Forensic Science international. 154:
53-61.
Ovchinnikov I. and Goodwin W. (2001): The Isolation and
identification of Neanderthal Mitochondrial DNA
Antrocom Online Journal of Anthropology 2011, vol. 7. n. 2 ISSN
1973-2870 178
-
Pandey at Alii Ethanol re-precipitation removes PCR
inhibitors
Profiles in DNA, www.promega.com; 7-9.
Paabo S. (1989): Ancient DNA; extraction, characterization,
molecular cloning and enzymatic
amplification, Proc. Natl. Acad. Sci. USA, 86: 1939-1943.
Paabo S., Poinar H., Serre D. ,Despres V., Juliane H., Rohland
N. ,Kuch M., Krause J., Vigilant L.,
Hofreiter M. (2004:) Genetic analyses from ancient DNA. Annu.
Rev. Genet. 38:645-79.
Shinoda Kaiser. I., Adachi N., Guillen S. and Shimada I. (2006):
Mitochondrial DNA Analysis of
ancient Peruvian Highlanders, Am. J. Phys. Anthropology.
131:98-107.
Thomas M., Gilbert P., Cuccui J., White W., Lynnerup N., Titball
R. W., Cooper A. and Prentice M. B.,
(2004): Absence of yersinia pestis-specific DNA in human teeth
from five European excavations of
putative plague victims, Microbiology. 150:341-354.
Willerslev E., Andres H. J. and Poinar H. N. (2004:) Isolation
of nucleic acids and cultures from fossil
ice and permafrost, Trends in Ecology and Evolution.
19:141-147.
Willerslev E. and Cooper A., Ancient DNA. (2005): Pro. R. Soc.
B. 272: 3-16.
Zhang L. and Wu Q. (2005): Single gene retrieval from thermally
degraded DNA, J. Bio. Sci, 30:599
604.
Antrocom Online Journal of Anthropology 2011, vol. 7. n. 2 ISSN
1973-2870 179