An Arabidopsis Fip1HomologInteractswithRNAand ... · timing regulatory protein FCA to promote alternative polyadenylation of FCA-encoding RNAs and consequently to regulate flower

An Arabidopsis Fip1 Homolog Interacts with RNA andProvides Conceptual Links with a Number of OtherPolyadenylation Factor Subunits*□S

Received for publication, October 7, 2005, and in revised form, November 2, 2005 Published, JBC Papers in Press, November 10, 2005, DOI 10.1074/jbc.M510964200

Kevin P. Forbes, Balasubrahmanyam Addepalli, and Arthur G. Hunt1

From the Plant Physiology, Biochemistry, and Molecular Biology Program, Department of Plant and Soil Sciences,University of Kentucky, Lexington, Kentucky 40546-0312

The protein Fip1 is an important subunit of the eukaryotic poly-adenylation apparatus, since it provides a bridge of sorts betweenpoly(A) polymerase, other subunits of the polyadenylation appara-tus, and the substrate RNA. In this study, a previously unreportedArabidopsis Fip1 homolog is characterized. The gene for this pro-tein resides on chromosome V and encodes a 1196-amino acidpolypeptide. Yeast two-hybrid and in vitro assays indicate that theN-terminal 137 amino acids of the Arabidopsis Fip1 protein inter-act with poly(A) polymerase (PAP). This domain also stimulates theactivity of the PAP. Interestingly, this part of the Arabidopsis Fip1interacts with Arabidopsis homologs of CstF77, CPSF30, CFIm-25,and PabN1. The interactions with CstF77, CPSF30, and CFIm-25are reminiscent in various respects of similar interactions seen inyeast and mammals, although the part of the Arabidopsis Fip1 pro-tein that participates in these interactions has no apparent counter-part in other eukaryotic Fip1 proteins. Interactions between Fip1and PabN1 have not been reported in other systems; this may rep-resent plant-specific associations. The C-terminal 789 amino acidsof the Arabidopsis Fip1 protein were found to contain an RNA-bindingdomain; this domain correlatedwith an intact arginine-richregion and had a marked preference for poly(G) among the fourhomopolymers studied. These results indicate that the ArabidopsisFip1, like its human counterpart, is an RNA-binding protein.More-over, they provide conceptual links between PAP and several otherArabidopsis polyadenylation factor subunit homologs.

The polyadenylation of messenger RNAs in the nucleus is an impor-tant step in the biogenesis of mRNAs in eukaryotes. This RNA process-ing reaction adds an essential cis element, the poly(A) tail, to the 3�-endof a processed pre-mRNA. This process is also coupledwithmany othersteps in mRNA biogenesis (1). Thus, some polyadenylation factors areassociatedwith transcription factors and recruit parts of the polyadenyl-ation apparatus to the transcription initiation complex (2). Polyadenyl-ation is linked to pre-mRNA splicing in a number of ways. For example,interactions between the polyadenylation and splicing machineries areimportant for the definition of 3�-terminal exons in animal cells (3, 4).Other interactions help to modulate different processing fates forpre-mRNAs, thus contributing to the scope of alternative splicing and

polyadenylation in eukaryotes. The polyadenylation apparatus interactswith the C-terminal domain of the large subunit of RNA polymerase II(5–9) and with factors that play roles in transcription termination (10);these interactions suggest a central role for 3�-end processing in thetermination of transcription by RNA polymerase II and subsequentrecycling of polymerase II for new rounds of initiation.Polyadenylation is mediated by a multifactor complex in yeast and

mammals. This complex recognizes the polyadenylation signal in thepre-mRNA, cleaves the pre-mRNA at a site that is defined by the ciselements, and adds a defined tract of poly(A) to the processedpre-mRNA. In mammals, the factors involved in this process have beenclassified according to chromatographic and biochemical behaviors,and termed cleavage and polyadenylation specificity factor (CPSF),2

cleavage-stimulatory factor (CstF), and cleavage factors I and II (CFImand CFIIm, respectively) (1). Each of these factors in turn consists ofseveral distinct subunits.With the exception of CFIm (the two subunitsof which are not obviously apparent in the yeast proteome), yeast pos-sesses a similar array of polyadenylation factor subunits that form asomewhat different set of chromatographically distinct factors, namelycleavage and polyadenylation factor and cleavage factor I (1). Interest-ingly, the enzyme that adds poly(A) (poly(A) polymerase, or PAP) is partof the cleavage and polyadenylation factor in yeast nuclear extracts butfractionates largely as a separate protein in mammalian extracts.Whereas there are differences in the chromatographic behaviors of thecomplexes in mammals and yeast, most of the functions of the individ-ual subunits seem to be similar. Besides the PAPs, this includes RNAbinding by CPSF160, CPSF30, and CstF64 and their yeast counterparts(Yhh1p, Yth1p, and Rna15p, respectively) (11–17) and bridgingbetween factors (CstF77 and its yeast counterpart RNA14p, hFip1p andthe yeast counterpart Fip1p) (18–22). Of particular interest are theprotein Fip1p and its human counterpart, hFip1. In yeast, Fip1p appearsto be the principal means by which PAP is linked with the rest of thecleavage and polyadenylation factor. Fip1p is the only polyadenylationfactor subunit that has been shown to interact with PAP (23). Fip1p alsointeracts with Yhh1p, Yth1p, Pfs2p, and RNA14, components of the twomajor polyadenylation complexes (cleavage and polyadenylation factorand cleavage factor I) in yeast (13, 22). The human homolog, hFip1,interacts with PAP and CPSF160 (the mammalian counterpart ofYhh1p) and has been recently recognized as an authentic subunit of

* This report is based on work supported by United States Department of Agriculture NRIGrant 99-35301-7904 and by National Science Foundation Grant 0313472. The costsof publication of this article were defrayed in part by the payment of page charges.This article must therefore be hereby marked “advertisement” in accordance with 18U.S.C. Section 1734 solely to indicate this fact.

□S The on-line version of this article (available at http://www.jbc.org) contains supple-mental material on recombinant DNA manipulations.

1 To whom correspondence should be addressed: Dept. of Plant and Soil Sciences, Uni-versity of Kentucky, 301A Plant Science Bldg., 1405 Veterans Dr., Lexington, KY 40546-0312. Tel.: 859-257-5020 (ext. 80776); Fax: 859-257-7125; E-mail: [email protected].

2 The abbreviations used are: CPSF, cleavage and polyadenylation specificity factor; PAP,poly(A) polymerase; CPSF30, CPSF73, CPSF100, and CPSF160, 30-, 73-, 100-, and 160-kDa subunit of CPSF, respectively; CstF, cleavage-stimulatory factor; CstF50, CstF64,and CstF77, 50-, 64-, and 77-kDa subunit of CstF, respectively; hFip, human Fip; MBP,maltose-binding protein; CBD, calmodulin binding domain; CAT, chloramphenicolacetyltransferase; GST, glutathione S-transferase; RT, reverse transcription; AD, acti-vation domain; BD, binding domain; FUE, far upstream element; NUE, near upstreamelement; CS, cleavage/polyadenylation site; CaMV, cauliflower mosaic virus; MES,2-(N-morpholino)ethanesulfonic acid.

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 281, NO. 1, pp. 176 –186, January 6, 2006© 2006 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.

176 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281 • NUMBER 1 • JANUARY 6, 2006

by guest on April 30, 2020

http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

CPSF (18). The yeast and human Fip (factor interacting with poly(A)polymerase) proteins have somewhat contrasting properties; the yeastprotein lacks an RNA-binding domain and inhibits the nonspecificactivity (24) (e.g. activity on RNA substrates that do not possess authen-tic polyadenylation signals) of PAP, whereas the human Fip1 can bindRNA and stimulates PAP activity (18). Kaufmann et al. (18) have sug-gested that these contrasting properties may reflect the differing RNA-binding abilities of the two proteins and that the yeast protein, in con-cert with other components of cleavage and polyadenylation factor,maystimulate PAPmuch as does the human Fip1. In this light, the function-ing of Fip in the two systems may be relatively conserved, serving topromote PAP activity via some sort of tethering to the RNA substrate.Plant polyadenylation signals have beenwell characterized and found

to be distinct in many ways from their mammalian and fungal counter-parts (25, 26). However, the properties of the plant polyadenylationapparatus are less well understood. Bioinformatic analysis of the Arabi-dopsis genome indicates that plants possess genes that encode most ofthe subunits of themammalian polyadenylation complex.3 Insertions intwo of these (encoding homologs of CPSF100 andCPSF73, respectively)lead to embryo lethality (27, 28). The Arabidopsis CPSF100 proteininteracts with at least one of the four PAPs (29), an interaction thatseems to be unique to the plant polyadenylation machinery. There is adegree of novelty in the properties of the Arabidopsis homologs of theCstF subunits, in that one of the three proteins (AtCstF50) does notinteract with AtCstF77 (30), in contrast to what has been shown in themammalian complex (31). The CstF64-CstF77 interaction does seem tobe evolutionarily conserved (30). Arabidopsis possesses four PAP-en-coding genes (32). Three of the corresponding PAP isoforms are similarin size to each other, whereas the fourth is much smaller, lacking anobvious nuclear localization signal. An Arabidopsis homolog of theyeast polyadenylation factor subunit Pfs2p (the Arabidopsis protein hasbeen termed FY) has been shown to act in concert with the flower-timing regulatory protein FCA to promote alternative polyadenylationof FCA-encoding RNAs and consequently to regulate flower timing(33).As mentioned above, the yeast and mammalian Fip1 proteins are

important bridging factors in the polyadenylation complex, providinglinks between PAP, RNA, and other multisubunit complexes. Theselinks presumably recruit PAPor stabilize the association of PAPwith theapparatus and may contribute to the differential recognition of variousRNAs by the 3�-processingmachinery. In this report, we present a char-acterization of an Arabidopsis Fip1 isoform (geneid At5g58040, termedAtFip1(V)). We find that this protein binds RNA; interacts with theArabidopsis polyadenylation factor subunits AtPAP, AtCstF77,AtCPSF30, AtCFI-25m, and AtPabN1; and stimulates nonspecific PAPactivity. The abilities to bind RNA; interact with AtPAP, AtCstF77, andAtCPSF30; and stimulate PAP activity are properties that the AtFip1(V)shares with its human counterpart. The interaction with AtCFIm-25may also be analogous to a recently reported CFIm-hFip1 interaction(47). However, the interaction with AtPabN1 has not been reported inother systems and may reflect a unique aspect of the plant polyadenyl-ation machinery. Taken together, these results indicate that AtFip1(V)coordinates a number of polyadenylation factor subunits with PAP andwith RNA.

EXPERIMENTAL PROCEDURES

PlantMaterials—Arabidopsis thaliana seedwas obtained fromLehleSeeds. Seeds were germinated and plants were cultivated in the green-

house or growth room for 3–4 weeks. Plants were harvested before aswell as after the flowering stage. Leaves, stems, and flowerswere used fortotal RNA isolation (see below). Root material was gathered from seed-lings that were grown in liquid culture under lights with shaking. 50 mlof germinationmedium (500mg of sucrose, 215.5 mg ofMurashige andSkoog Basal Medium (Sigma), and 25 mg of MES was inoculated with30–40 sterilized seeds and grown for 2–3 weeks at room temperatureunder a 12-h light, 12-h dark cycle. For scoring T-DNA insertion plants,this medium was supplemented with kanamycin (50 �g/ml).

PCR Genotyping of Salk T-DNA Lines—The T-DNA insertion line,SALK_087117, was generated by the Salk Institute (available on theWorldWideWeb at signal.salk.edu/cgi-bin/tdnaexpress), and seed wasobtained from the Arabidopsis Biological Resource Center. Seeds fromthe stock center were germinated, and the plants were allowed to self-fertilize so as to generate a bulk stock of seed. Seeds from this bulkedpopulation were germinated, and plants were cultivated in the green-house or growth room. DNA from single leaves was extracted using arapid homogenization plant leaf DNA amplification kit (Cartagen).Extracted DNA was used in a typical PCR (see supplemental materials)with AtFip1(V)-specific primers 5� GFIP and 3� INT (Table 1), yieldinga 1-kb genomic DNA fragment, and with a combination of AtFip1(V)-and T-DNA- specific primers (AtFip1(V)-specific primer 5� INT and aT-DNA-specific primer LBb1, yielding a �500-bp fragment) for verify-ing the presence and location of the T-DNA insertion.

RNA Isolation fromArabidopsis andGeneration of First Strand cDNA—Total RNA was isolated from Arabidopsis leaves using either an SVTotal RNA Isolation Kit (Promega), RNeasy� Plant Mini Kit (Qiagen),or Trizol (Invitrogen), following the manufacturers’ instructions.Reverse transcription experimentswere conducted using the total RNA,oligo(dT) and Superscript RT II (Invitrogen), oligo(dT) with the ProS-TAR™ Ultra HF RT-PCR system (Stratagene), or random primers usinga RETROscriptTM First Strand Synthesis kit (Ambion).

Isolation and Characterization of Arabidopsis AtFip1(V) cDNAs—cDNAsderived from the Arabidopsis AtFip1(V) gene were isolated by PCRand RT-PCR. Potential Fip1-encoding genes were identified in theArabidopsis genome (available on the World Wide Web atwww.Arabidopsis.org/home.html) with TBLASTN and BLASTP(34) using the human and yeast Fip1 amino acid sequences as searchqueries. Based on the results, primers were designed to amplify thecDNA coding region of the AtFip1(V) gene (Table 1). Various com-binations of these primers were used in PCRs with first strand cDNAor with a 3–6-kb cDNA expression library for Arabidopsis (CD4-16;ABRC-DNA Stock Center (35)) as templates. PCR products weresubcloned into pGEM-T Easy vector and sequenced by automatedsequencing (ABI Prism 310 Genetic Analyzer; PerkinElmer Life Sci-ences) using the BigDye Terminator Cycle Sequencing Ready Reac-tion kit (ABI prism) and T7 and SP6 primers.Three pGEMclones that represent the 5�-end (bases 1–1478),middle

region (bases 1220–2692), and 3�-end (bases 2672–3588) of the full-length coding region, respectively, were generated. Full-length cloneswere assembled in pGEM using common restriction enzyme sites; theC-terminal domain of AtFip1(V) was amplified and subcloned usingfull-length cDNAs. One clone containing the 5�-end of AtFip1(V) con-tained a premature stop codon after residue 137 of the protein, presum-ably due to a PCR error. This stop codon conveniently delimits thehighly divergent part of the N terminus of AtFip1(V) (Fig. 1A); for thisreason, it was selected to produce yeast two-hybrid and protein expres-sion clones. Cloning details are provided in supplemental materials.For expression analysis of AtFip1 genes in different Arabidopsis tis-

sues, PCR amplification was done with 1.5 �l of first strand cDNA3 Q. Q. Li and A. G. Hunt, unpublished observations.

Interactions Involving Arabidopsis Fip1

JANUARY 6, 2006 • VOLUME 281 • NUMBER 1 JOURNAL OF BIOLOGICAL CHEMISTRY 177


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

(ProSTAR; Stratagene) added to 100 ng of each primer, 0.8 mM dNTPs,5.0 �l of Ultra HF PCR buffer (Stratagene), and 2.5 units of Pfu TurboDNA polymerase (Stratagene) in a 50-�l reaction.

Cloning of Arabidopsis cDNAs Encoding Arabidopsis PolyadenylationFactor Subunits—Data base searches of the Arabidopsis genome usingTBLASTNandBLASTPwith the yeast Pfs2 andhumanCstF50, -64, and

-77 subunits as well as mammalian CFIm-25 and PabN1 as search que-ries identified potential homologs for each subunit. Based on thesequence information, primers were designed to amplify the cDNAcoding regions of these genes (Table 1). Clones were generated by PCRor RT-PCR, subcloned in pGEM, and sequenced. In cases where partialclones were produced, full-length cDNAs were assembled using com-

TABLE 1List of oligonucleotides used for PCR and sequencing

Gene or usePrimer

designation Sequence (5�–3�)AtFip1(V) 5�FL CCGCATGGAAGAGGACGATGAGTTCGGA

5�INT CCCGGATCCGAGTTAGCTGCAGCAACAGGGGCA5�INT1 CCCAGATCTGGTTCCGAAGATCGATCATCAAGG3�INT GCGAATTCACCCGAGGGTTCATCCTCATG3�INT1 CCCGAATTCTTGATGATCGATCTTCGGAACCTC3�INT2 CTAGTTTTGAGGAAATGGATGATG3�FL TTATGCGTATTCCCTCCCTATTCTTACACA5�GW GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATG

GAAGAGGACGATGAGTTC5�GW1 GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGAGTT AGCTGCAGCA3�GW GGGGACCACTTTGTACAAGAAAGCTGGGTATCAAC

CCGAGGGTTCATCCTC3�GW1 GGGGACCACTTTGTACAAGAAAGCTGGGTATTATG

CGTATTCCCTCCCTATTCTTACACA5�GFIP GTCTACTCTGTGCTTAGGA

AtCstF50 5�FL CGCGAATTCATGGGGAATAGTGGAGATTTG5�INT CCAGATCTTTCTTCGACTTCTCCAAAACCACGGCT3�INT GTTATGGTTAGAAGGCCACTTTGCCACTTT3�FL CCGGAATTCTTAAACGGATTCCTTCCAGAACCGAAT5�GW GGGGACAAGTTTGTACAAAAAAGCAGGCTGGATGG

GGAATAGTGGAGATT3�GW GGGGACCACTTTGTACAAGAAAGCTGGGTCCTTAAA

CGGATTCCTTCCAGAAAtCstF64 5�FL GGAGATCTGCCATGGCCATGGCTTCATCATCATCC

3�FL CCAGATCTATCGATTGAAGGCTGCATCATGTGG5�GW GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGC

TTCATCATCATCCCA3�GW GGGGACCACTTTGTACAAGAAAGCTGGGTAGTGAAG

GCTGCATCATGTGGTAtCstF77 5�FL ATGGCTGATAAGTACATCGTCGAG

3�INT TTCCAGAAAGTGCTTCTTTCATTC3�FL TTAGCCAGTGCTACCAGAAAGCTCGCCAGA5�GW GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGC

TGATAAGTACATCGTC5�GW1 GGGGACAAGTTTGTACAAAAAAGCAGGCTTCTTAAG

CACGTTACCAGTTGA3�GW GGGGACCACTTTGTACAAGAAAGCTGGGTCTTAGCC

AGTGCTACCAGAAAGAtPfs2p 5�FL ATGTACGCCGGCGGCGATATGCACAGG

5�INT AGTGTTTGGGATCTTGCATGGCATCCT3�INT AAGAACATCTCGGGGATTATCTGCAGG3�FL CTACTGATGTTGCTGATTGTTGTTTGG5�GW GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGTA

CGCCGGCGGCGATATG3�GW GGGGACCACTTTGTACAAGAAAGCTGGGTACTACTG

ATGTTGCTGATTGTTAtPAP(IV) 5�MR CCGAGATCTTTCATCATCTTGCATGATATATTGGCT

3�MR CCGAGATCTACTGCCGAGGCCTTCGATATCCATTAG5�GW GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATGGT

GGGTACTCAAAATTTAGGTGGT3�GW GGGGACCACTTTGTACAAGAAAGCTGGGTCCTAGCT

CTGTCTTCCGACTTCTCCATCAtCFI-25 5�FL ATGGGTGAAGAAGCTCGAGCGTTAGATATGGAG

3�FL CATATCTCCATCATGTTGAAGGAGAATTTCGAAAG5�GW GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATG

GGTGAAGAAGCTCGAGCGTT3�GW GGGGACCACTTTGTACAAGAAAGCTGGGTACATA

TCTCCATCATGTTGAAGGAGAtPABN1 5�FL CCAGATCTATGCCGGTGCACGATGAGC

3�FL CCAGATCTTCAGTACGGTCTGTAGCGCT-DNA LBb1 GCGTGGACCGCTTGCAACTCaMV RNAs1, 2, 3 T7-STS TAATACGACTCACTATAGGGAAACACGCTGAAATCACCAGTCTCTCT4 T7-NUE TAATACGACTCACTATAGGGAAAATACTTCTATCAATAAAATTTCT1, 4 CaMV61/80R TCTCGTGTCTGGTTTATATT3 CaMV20/1R AGGAATTAGAAATTTTATTGAT2 CaMV 50/70R TATAAATACAAATACATACTAAGG

rbcS-E9 RNA T7-E9 TAATACGACTCACTATAGGGAGTATTATGGCATTGGGAAE9 61–80 AAATGTTTGCATATCTCTTA




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

mon restriction enzyme sites. Full-length clones were used to produceyeast two-hybrid and protein expression clones. Cloning details are pro-vided in supplementalmaterials. Clones encoding theArabidopsis chro-mosome IV-encoded PAP have been described elsewhere (32).

Yeast Two-hybrid Assay—AGal4-based two-hybrid system was usedas described previously (36). The yeast strain used was PJ69-4, and theexpression vectors were pGAD-C (1) and pGBD-C (1) for activationdomain (AD) and binding domain (BD), respectively.Clones encoding the relevant protein-coding regions were cloned

into AD and BD expression vectors using GatewayTM cloning technol-ogy (Invitrogen). For this, the appropriate coding sequenceswere ampli-fied by PCR using 5�GW/3�GWprimers listed in Table 1 and the ampli-fication products mobilized into pDONR 201 according to themanufacturer’s instructions. The various protein-coding regions werethen mobilized into Gateway-compatible versions of pGAD-C (1) andpGBD-C (1) (generated as recommended by the manufacturer). Theresulting expression clones were sequenced to ensure that the genefusions were in the correct reading frame. The pGAD-C (1) andpGBD-C (1) clones of AtCPSF factors used in this experiment wereobtained from Drs. Ruqiang Xu and Quinn Li (Miami University,Oxford, OH).Yeast cells were transformed with plasmid DNA using the polyethyl-

ene glycol/lithium acetate method (37). Two-hybrid analysis was car-ried out by plating yeast transformants on defined media containingglucose as a carbon source and lacking the nutritional supplementssuited for selection of transformants (leucine and tryptophan) and foridentification of interactions (adenine) (LW andALWmedium, respec-tively). Positive interactions were those in which the colony numbers onALW medium were 50% or more than those seen on LW medium.Negative interactions were those that yielded less than 10% of the colo-nies on ALW plates compared with LW medium. With negative con-trols (e.g. experiments with “empty” two-hybrid vectors as well as thosein which one test plasmid was co-transformed with the complementary“empty vector”), the numbers of colonies growing on ALW selectivemedia were invariably less than 2% (and usually 0%) of the numbers seenon LWmedium. Positive samples (such as the combination using clonesfor the Arabidopsis orthologues for CstF77 and CstF64, which havebeen reported elsewhere to interact (30) andwhich in our hands is a verystrong two-hybrid interaction) yielded, on ALW medium, from 50 to200% of the colonies seen on LWmedium.

Production of Recombinant Proteins—To produce recombinant pro-teins in Escherichia coli, the coding regions for respective AtFip1(V)-derived proteins were mobilized into pDEST15 and pDEST17 using LRClonase and the respective entry clones (see above). This would enablethe production of GST- or histidine-tagged proteins, respectively. Inaddition, AtCstF77, AtCPSF30, and AtPabN1 were subcloned intopMAL-C2x (New England Biolabs) so as to produce maltose-bindingprotein fusions. AtCFIm-25 was cloned into a Gateway-converted formof pCal-kc (Stratagene), using the corresponding Gateway-compatibleentry clone and LR Clonase. The resulting recombinant plasmids wereintroduced into Rosetta(D3) cells (Novagen) for the production ofprotein.Extracts containing the appropriate fusion protein were prepared

after induction of Rosetta(D3) cells (Novagen). Briefly, overnight 10-mlcultures of LB(�) (LB plus 100 �g/ml ampicillin and 25 �g/ml chlor-amphenicol) were used to inoculate 200 ml of LB(�) media, and cellswere grown at 37 °C until an A600 of 1.0–1.2. Expression of the fusionprotein genes was then induced by the addition of 200 �l of 1 M isopro-pyl 1-thio-�-D-galactopyranoside. After additional growth for 2 h at37 °C, cells were harvested and resuspended in 5 ml of lysis buffer (50

mM Tris-HCl, pH 8.0, 150 mM NaCl, 1 mM EDTA, 1 mM phenylmeth-ylsulfonyl fluoride). Cells were disrupted by sonication (three bursts,30 s each), and debris was removed by centrifugation. Extracts werestored as 1-ml aliquots at �80 °C.To produce the histidine-tagged FipN protein, extracts were pre-

pared after induction of Rosetta(D3) cells (Novagen) containing recom-binant pDEST-17 construct. Cells were grown, and expression wasinduced as described above. Cells were harvested and resuspended in 5ml of binding buffer (20 mM Tris-HCl, pH 7.9, 500 mMNaCl, and 5 mM

imidazole). Cells were disrupted by sonication (three bursts, 30 s each),debris was removed by centrifugation, and lysates were passed througha nitrocellulose filter (0.45-�m pore size). The filtrate was then loadedonto a His-Bind resin column (Novagen) equilibrated with bindingbuffer. The matrix was washed with binding buffer containing 40 mM

imidazole. Histidine-tagged proteins were then eluted with bindingbuffer containing 125 mM imidazole. The eluted proteins were dialyzedagainst NEB (40 mM KCl, 25 mM HEPES-KOH, pH 7.9, 0.1 mM EDTA,1mM dithiothreitol, 1mM phenylmethylsulfonyl fluoride, and 10% glyc-erol). Protein quantities were estimated by 10% SDS-PAGE and stainingwith Coomassie Brilliant Blue using bovine serum albumin as a stand-ard, and immunoblotting for His-tagged FipN was done with anti-Hisantibodies (Invitrogen).To produce theGST-FipC fusion protein, 10-ml overnight cultures of

recombinant BL21-SI cells (Invitrogen)were used to inoculate 200ml ofmedia, and cells were grown at 37 °C until an A600 of 0.8. Expression ofthe fusion protein genes was then induced by the addition of NaCl to afinal concentration of 0.3 M. After additional growth for 3 h at 37 °C,cells were harvested and resuspended in 5 ml of lysis buffer. Cells weredisrupted by sonication (three bursts, 30 s each), and debris wasremoved by centrifugation. To purify GST fusion proteins, lysates werethen incubated for 1 h with glutathione-Sepharose beads (that had beenequilibrated with lysis buffer) with gentle agitation. After incubation,the glutathione-Sepharose beads were pelleted by brief centrifugationand washed twice with lysis buffer containing 2 M NaCl and finally twomore times with lysis buffer alone. Proteins bound to the beads wereeluted with glutathione elution buffer (20 mM reduced glutathione, 50mM Tris-HCl, pH 8.0) and then dialyzed overnight with NEB.For the poly(G) affinity purification of GST-FipC, 100 �l of poly(G)-

agarose (Sigma) was pelleted, washed three times with NEB, and brieflypelleted by centrifugation. The pellet was then incubated with �30 �gof GST-FipC (in 100 �l of NEB) at 30 °C for 20 min. The agarose wasthen briefly pelleted and washed three times with NEB. Thirty �l ofSDS-sample bufferwas added to the agarose, boiled for 10min, and thenbriefly pelleted. Twenty �l of the sample was separated by SDS-PAGE.

In Vitro Determination of Protein-Protein Interactions—To measureprotein-protein interactions, 20-�l aliquots of E. coli cell extracts con-taining maltose-binding protein (MBP) or CBD fusion proteins weremixedwith 10�l of cell extract containing theGST-tagged target fusionprotein; reactions were brought to a final volume of 100 �l with controlE. coli lysate. All reactions had 0.1%Nonidet P-40. After 30min at 30 °C,these mixtures were added to amylose beads (New England Biolabs) orcalmodulin affinity resin (Stratagene) that had been pretreated (for 30min) with control cell extract, 100 �g/ml bovine serum albumin, and0.1% Nonidet P-40. After 5 min, the matrix was collected and washedfive times with lysis buffer containing 0.1% Nonidet P-40, and proteinsthat were retained were analyzed by SDS-PAGE and immunoblotting.GST fusion proteins were detected using alkaline phosphatase-conju-gated anti-GST antibodies (Sigma).

Electrophoretic Mobility Shift Assays—For electrophoretic mobilityshift assays, RNA and proteins were incubated at 30 °C in NEB supple-




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

mented with KCl (final concentration 60mM) andMgCl2 (final concen-tration 1.2 mM). After 20 min, 0.1 volume of gel loading buffer II(AMBION) diluted in NEB (1:40 ratio of GLBII to NEB) was added tothe reactions, and samples were loaded onto nondenaturing gels (4%acrylamide, 0.08% bisacrylamide, cast in TBE). After electrophoresis,gels were transferred to Whatmann paper and dried under vacuum.Dried gels were developed on a storage phosphor screen and visualizedby ImageQuant.RNA containing the rbcS-E9 polyadenylation signal was made from

pBLUESCRIPT derivatives (38, 39). Uniformly labeled RNA was gener-ated using a Ampliscribe transcription kit (Epicenter) with [�-32P]ATP.RNAhomopolymerswere purchased from (Sigma), and yeast tRNAwasfrom Invitrogen. Unlabeled RNAs derived from the cauliflower mosaicvirus genome were produced using the Ampliscribe kit (Epicenter),using PCR-generated templates encoding the regions depicted in Fig. 8.

Poly(A) Polymerase Assay—PAP assays were conducted as describedelsewhere (32, 40, 41), except that the RNA used was a synthetic 14-mer(obtained from Dharmacon RNA Technologies). Briefly, recombinantArabidopsis poly(A) polymerase (the product of At4g32850 (32)) andthe histidine-tagged N-terminal 137 amino acids of AtFip1(V) wereassayed for incorporation of label from [�-32P]ATP into poly(A). Reac-tions were performed in a volume of 30 �l at 30 °C for the times indi-cated. Reactions were terminated by incubating with 2.5 �l of STOPsolution (2.5% SDS, 135mMEDTA, 5mg/ml Proteinase K) for 10min at37 °C, and the labeled RNAs were recovered and separated on sequenc-

ing gels. Dried gels were exposed to a phosphorimaging screen, autora-diographs were developed, and the quantities of labeled polymer weredetermined with ImageQuant software (Amersham Biosciences). Theresults were plotted as arbitrary values against time.

RESULTS

To identify possible Arabidopsis counterparts of Fip1, a BLASTsearch of theArabidopsis genomewas conducted using the human Fip1amino acid sequence as a query. This process yielded two candidategenes located on chromosomes 5 (At5g58040) and 3 (At3g66652). Thechromosome 3 gene had been identified earlier as a possible Fip1 hom-olog (18), but the chromosome 5 gene had not been commented on inthe earlier study. Amino acid sequence alignments (not shown) andconsideration of the general putative domain organization of the twoArabidopsis proteins and hFip1 (Fig. 1A) suggested that the chromo-some 5 gene (At5g58040) encoded a likely Fip1 homolog (AtFip1(V)).Accordingly, this gene was selected for the studies that follow. As aprelude, cDNAs that span the open reading frame encoded by this genewere cloned and sequenced; this process allowed revision of the predic-tion of the protein encoded by this gene (Fig. 1B) as well as the intron/exon structure (Fig. 2A). This gene encodes a primary transcript thatincludes eight exons and a polypeptide of 1196 amino acids. The char-acteristic Fip1 domain inAtFip1(V) shows amino acid sequence identityof 26% and similarity of 40% to the corresponding domain of hFip1 and38% identity and 56% similarity to the conserved domain in the yeast

FIGURE 1. Alignment of peptide domains foundin Fip1 proteins. A, schematic alignment ofAtFip1(V) (At5g58040), AtFip1[III] (AtFip1 genethat resides on chromosome III; At3g66652), yeastFip1p (Fip1p; GenBankTM accession numberNP_012626), and human Fip1 (hFip1; Tremblaccession number tr�Q9H077) proteins. All fourwere aligned according to the conserved Fip1domain. The patterns used for the conserved Fip1domain and the arginine-rich regions are depictedon the right. The AtFip1 motifs were determinedby PROSITE (Motif-Scan) (52), and the hFip1 andFip1p domains were adapted from Kaufmann et al.(18). B, amino acid sequence of AtFip1(V). The con-served Fip1 domain (amino acids 336 –398) isframed and in uppercase lettering, predicted bipar-tite nuclear localization signals (nls) are under-lined, and the arginine-rich region is set apart withuppercase boldface lettering. The internal aminoacids that delimit the N-terminal and C-terminaldomains (residues 137 and 407, respectively) aredouble underlined. C, alignment of the Fip1domains of the yeast (Fip1p), human (hFip1), andArabidopsis (At-V and At-III, denoting the chromo-some V and chromosome III-encoded proteins,respectively) Fip1 proteins. Positions of sequenceidentity in all four proteins are noted with blackboxes and white uppercase lettering. Conservedpositions (similar amino acid side chains, presentin three of the four proteins) are noted with grayboxes and uppercase lettering.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Fip1 protein (Fig. 1C). The sequence similarity outside of this domain ismuchmoremodest (not shown). However, several identifiable trends inother parts of the protein could be identified, and these trends corre-spond to some degree to domains that are present in hFip1 and its yeastcounterpart (Fig. 1A).RT-PCR analysis of RNA isolated from leaves, stems, flower tissues,

and roots indicated that this gene is expressed in all of these tissues (Fig.2B). Retrieval and inspection of the expression data of this gene fromGenevestigator (available on the World Wide Web www.genevestiga-tor.ethz.ch (42)) corroborated the RT-PCR data; specifically, there waslittle difference in the expression of this gene in the different tissuesanalyzed in the microarray data set that is available (not shown). Thesedata indicate that At5g58040 is expressed ubiquitously in Arabidopsis.A T-DNA insertion within theAtFip1(V) locus, SALK_087117, could

be found in the Salk Institute T-DNA insertion library data base (avail-able on the World Wide Web at signal.salk.edu/cgi-bin/tdnaexpress(43)). According to the data base, the T-DNA insertion lies within thesixth exon (Fig. 2A); this was confirmed using primers (illustrated in Fig.2A) situated within the T-DNA and in the expected flanking sequencesof the AtFip1(V) gene (not shown). PCR genotyping of 42 progenyderived from self-crosses of kanamycin-resistant individuals from theABRC, using pairs of primers specific for AtFip1(V) that flank theT-DNA insert revealed that all 42 plants had at least one of thewild-typealleles. Further screeningwas performed by plating seeds from several ofthese plants on kanamycin-containing media; this would identify indi-viduals containing the complete T-DNA and serve as a phenotypic con-firmation of the PCR genotyping. Media containing the selectablemarker associated with the T-DNA. Seeds from 23 lines were germi-nated on the selectable media. Of these 23 lines, 15 were heterozygousfor the selectablemarker, and eight lines showedwild-type (kanamycin-sensitive) background. These results indicate thatAtFip1(V) is an essen-tial gene.In mammals and yeast, Fip1 interacts with a subset of other poly-

adenylation factor subunits (18, 23). To examine this aspect of Fip1function in Arabidopsis, the ability of AtFip1(V) to interact with a bat-tery of other Arabidopsis polyadenylation factor subunits was meas-ured. For these assays, two parts of AtFip1(V) were cloned into yeasttwo-hybrid vectors; one part consisted of the N-terminal 137 aminoacids of the protein, whereas the other consisted of the C-terminal 789amino acids. These portions were tested for interactions with the Ara-bidopsis homologs of CstF77, CstF64, CstF50, CPSF160, CPS100,CPSF73 (both homologs; (28)), CPSF30, FY, PabN, and PAP (specifi-cally, the isoform encoded by the Arabidopsis PAP gene situated onchromosome IV (32)). In these assays, no interactions involving theC-terminal portion of AtFip1(V) could be ascertained (not shown).However, these assays also suggested that the first 137 amino acids ofAtFip1(V) interact with the Arabidopsis homologs of PAP, CPSF30,

CstF77, CFIm-25, and PabN1 (summarized in Table 2). In contrast, nodiscernible interaction was observed with the Arabidopsis homologs ofCPSF160, CPSF100, CPSF73 (neither of the two distinctive isoforms),CstF64, CstF50, and FY (Table 2). To account for the possibility thatthese negative results might be due to the omission of the central part ofAtFip1(V), the assays with the Arabidopsis homologs of CPSF160,CPSF100, CPSF73 (both isoforms), CstF64, CstF50, and FY wererepeated with another AtFip1(V) construct containing the N-terminal492 amino acids of AtFip1(V). Again, no discernible interactions wereobserved. With the exception of FY, all of the partners for which nega-tive resultswere obtainedwithAtFip1(V) have yielded positive results inother tests, indicating that the two-hybrid constructs enable the pro-duction of functional proteins in yeast. In addition, all of the interactingpartners identified in this screen (e.g. CPSF30, CstF77, CFIm-25, andPabN1) have yielded negative results when tested in other combina-tions, indicating that these various proteins have specificity with respectto the proteins with which they interact in yeast cells.The positive results of the two-hybrid assays were corroborated with

a second measure, namely the measurement of copurification ofAtFip1(V) with other polyadenylation factor subunits. Initial focus wasplaced on PAP, since this interaction is central to the functioning of Fip1in yeast and mammals (18, 23, 44). For these assays, E. coli extractscontaining a fusion protein (GST-PAP in Fig. 3A) that contains aminoacids 130–503 of the Arabidopsis chromosome IV-encoded PAP weremixedwith extracts containing anMBP fusion with theN-terminal partof AtFip1(V) that was implicated in the two-hybrid assays (MBP-FipN;Fig. 3A). (This part of the PAP is the most highly conserved among the

TABLE 2Summary of results obtained in two-hybrid assays for pairwiseinteractions involving AtFip1(V)

Polyadenylationfactor subunit

A. thaliana genedesignationa

Interaction withFip1Nb

CPSF160 At5g51660 �CPSF100 At5g23880 �CPSF73(I) At1g61010 �CPSF73(II) At2g01730 �CPSF30 At1g30460 �CstF77 At1g17760 �CstF64 At1g71800 �CstF50 At5g60940 �FY At5g13480 �CFIm-25 At4g29820 �PabN1 At5g51120 �PAP(IV) At4g32850 �

a Arabidopsis gene designation for the protein denoted in the leftmost column.b Interaction in the yeast two-hybrid assay using the N-terminal 137 amino acids ofAtFip1(V). �, no interaction (e.g. the number of colonies growing after 5 days onALW-selective medium was less than 10% of those seen on LW medium after 3days). �, positive for the interaction (e.g. the number of colonies growing after 5days on ALW-selective medium was between 50 and 200% of those seen on LWmedium after 3 days).

FIGURE 2. A, intron-exon map of the AtFip1 gene that resides on chromosome V. The thin lines represent introns, and the thick lines indicate exons. The arrows indicate the locationsof oligonucleotide primers used in B. The location of the T-DNA insert within the gene is located above. B, RT-PCR analysis of AtFip1-V expression. RNA isolated from the indicatedtissue (labeled above; flower (F), leaf (L), stem (S), and root (R)) was analyzed by RT-PCR, with primers (5INT1 and 3INT2 in A) that flank the last intron of chromosome V Fip1. Forcomparison, primers specific for the Arabidopsis tubulin gene (At5g62690) were used. When reverse transcriptase was omitted from these reactions, no amplification products weremade (data not shown).




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

fourArabidopsis PAP isoforms (32).) Control reactions containedMBP.After purification using amylose resin, the copurification of AtPAP[IV]with theMBP “baits” was evaluated by immunoblotting, using anti-GSTantibodies. The results of this experiment corroborated those of thetwo-hybrid analysis. Specifically, GST-AtPAP[IV] copurified withMBP-FipN but notMBP (Fig. 3B, row of samples designatedGST-PAP).TheGST-AtPAP[IV] proteinwas not retained in experiments using justMBP, indicating that the copurification was not due to interactionsinvolving theMBP portion of the baits. GST itself did not copurify withMBP-FipN (Fig. 3B, row of samples designated GST), ruling out thepossibility that the copurification of GST-AtPAP[IV] and MBP-FipNwas due to interactions involving the GST part of the GST-AtPAP[IV]fusion protein. The absence of copurifying GST-AtPAP[IV] in theMBPsample was not due to a low quantity of MBP in the experiments, sinceample quantities of the bait proteins could be detected after SDS-PAGEand staining (Fig. 3B, row of samples designated stained proteins).For other assays, extracts containing a GST-AtFip1(V) fusion protein

(GST-FipN in Fig. 4A) that contained the N-terminal domain impli-cated in the two-hybrid tests were mixed with extracts containingMBPfusions with CPSF30, CstF77, or PabN1 (MBP-CstF77, MBP-CPSF30,andMBP-PABN1; Fig. 4A) or extracts containing a calmodulin-bindingprotein (CBD)-CFIm-25 fusion (CFI-25-CBD in Fig. 4A). Control reac-tions contained MBP or a CBD-chloramphenicol acetyltransferasefusion (CAT-CBD in Fig. 4A). After purification using amylose resin,the copurification of AtFip1(V)with this battery of “baits” was evaluatedby immunoblotting, using anti-GST antibodies. The results of theseexperiments corroborated those of the two-hybrid analysis. Thus, GST-FipN copurified with MBP-CstF77, MBP-CPSF30, MBP-PabN1, andCFI25-CBD after purification of the latter fusions on their respectiveaffinity matrices (Fig. 4B, row of samples designated GST-FipN). TheGST-FipN protein was not retained in experiments using just MBP orCAT-CBD, indicating that the copurification with the other “baits” wasnot due to interactions involving theMBP or CBD portions of the baits.GST itself did not copurify with MBP-CstF77, MBP-CPSF30, MBP-PabN1, and CFI25-CBD (Fig. 4B, row of samples designated GST), rul-ing out the possibility that the copurification of GST-FipN was due tointeractions involving the GST part of the GST-FipN fusion protein.The absence of copurifying GST-FipN in theMBP and CAT-CBD sam-ples was not due to a low quantity of the bait proteins in the experi-ments, since ample quantities of the various bait proteins could bedetected after SDS-PAGE and staining (Fig. 4B, row of samples desig-nated stained proteins).

The C-terminal part of the human Fip1 protein contains an arginine-rich region that is suggestive of an RNA-binding protein; consistentwith this, the human Fip1 protein does bind RNA and shows a prefer-ence for U-rich sequences (18). The C-terminal part of AtFip1(V) alsocontains an arginine-rich region, raising the possibility that the Arabi-dopsis protein also binds RNA. To test this, the C-terminal portion ofAtFip1(V) (Fig. 5A) was produced as a GST fusion protein and assayedfor RNA binding activity. The protein that was produced in E. coli washeterogeneous, with some full-sized polypeptide as well as several GST-containing polypeptides that were apparently truncated at the C termi-nus of the AtFip1(V) part of the fusion protein (based on the mobilitiesof these forms and their cross-reactivities with anti-GST antibodies(Fig. 5A)). This heterogeneity could not be reduced beyond a point withany of a number of strategies (not shown), so the preparations shown inFig. 5Awere analyzed for RNAbinding. For this, uniformly labeled RNA

FIGURE 4. AtFip1(V) interacts with several Arabidopsis polyadenylation factor sub-units. A, illustration of the structures of the GST-FipN and the MBP and CBD fusionproteins that were used as baits. B, results of in vitro interaction assays. The top andmiddle panels show immunoblots developed with anti-GST antisera; the bottom panelsshow stained gels showing the quantities of MBP and CBD fusion proteins present in theexperiments. Roughly 70% of the input GST sample for each experiment is shown underinput. The panels under baits show the GST-tagged proteins that copurify with the vari-ous MBP- or CBD-tagged baits. Copurification of GST and MBP or CBD-CAT was nottested, since GST did not bind to the other baits used in the experiment. nd, experimentwas not performed.

FIGURE 3. AtFip1(V) interacts with PAP in vitro. A, illustration of the structure of the GST-PAP and MBP-FipN fusion proteins. B, results of in vitro interaction assays. The top and middlepanels show immunoblots developed with anti-GST antiserum; the bottom panels show stained gels showing the quantities of MBP and MBP-FipN present in the experiment. Roughly70% of the input GST sample for each experiment is shown under input. The panels under baits show the GST-tagged proteins that copurify with MBP or MBP-FipN, respectively.Copurification of GST and MBP was not tested, since GST did not bind to MBP-FipN. In the bottom panel for the MBP-FipN samples, bands denoted with an asterisk indicate the majorfull-sized MBP-FipN polypeptides, as determined by immunoblotting with anti-MBP antiserum (not shown), present after the affinity purification. nd, experiment was notperformed.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

was incubated with purified protein preparations for 20 min at 30 °Cand aliquots of the bindingmixtures separated on nondenaturing acryl-amide gels. The RNAused in these studies contains a functional poly(A)site derived from the pea rbcS-E9 gene. As shown in Fig. 5B, purifiedGST-AtFip1(V) was able to bind this RNA; in contrast, purified GSTlacked this activity. To assess possible sequence preferences of FipC forRNA binding, a range of excesses of each of the four homopolymers(poly(A), poly(C), poly(G), and poly(U)) was added to binding reactions.As shown in Fig. 6, RNA binding was inhibited by evenmodest excessesof poly(G). Slight inhibition was seen with large excesses of poly(A), butpoly(U) and poly(C) did not inhibit binding to the labeled RNA.The array of GST-AtFip1(V) polypeptides that can be detected in

E. coli extracts represent a “deletion” series of a sort, in that they definea set of polypeptides that share a common N terminus (the GST part ofthe fusion protein) and differ at their C termini. This afforded an oppor-tunity to map, to a first approximation, the amino acid sequences in theC terminus that are required for RNAbinding. Accordingly, themixtureof GST-AtFip1(V) polypeptides was incubatedwith poly(G)-Sepharose,and proteins that boundwere analyzed by SDS-PAGE and immunoblot-ting. The results showed that a subset of the GST-AtFip1(V) proteinswere able to bind poly(G)-Sepharose (Fig. 7). Based on the mobilities ofthose polypeptides that bound as well as those that did not, it is con-cluded that RNA binding requires the arginine-rich domain ofAtFip1(V).Plant polyadenylation signals consist of a distinctive set of cis ele-

ments, elements situated relatively far 5�, or upstream of, the poly(A)site (FUEs), elements situated within 30 nt of the poly(A) site (NUEs),and the cleavage/polyadenylation site itself (CS). To examine the possi-ble preference ofAtFip1(V) for any of these classes of elements, differentparts of the cauliflower mosaic virus (CaMV) polyadenylation signalwere tested for the ability to compete with the labeled rbcS-E9 RNA forbinding to AtFip1(V). The CaMV poly(A) signal was chosen, because,unlike most plant 3�-untranslated regions, the CaMV signal directsmRNA 3�-end formation at a single site and thus consists of a relativelysimple array of cis elements (45, 46). Four RNAs were tested as compet-itors for binding of AtFip1(V) to the labeled rbcS-E9 RNA. One of thecompetitors (1 in Fig. 8A) contained all sequences extending from 181nt 5� to 80 nt 3� of the CaMV polyadenylation site. A second site (2)contained sequences from181 to 50 nt 5� of the poly(A) site; this portioncontains the FUE but lacks the NUE and poly(A) site itself. A third RNA

(3) extended from 181 nt 5� of the poly(A) site to the poly(A) site itself.A fourth RNA (4) included sequences from 30 nt 5� to 80 nt 3� of thepoly(A) site. As seen in Fig. 8, B andC, a 50-foldmolar excesses of RNAs1, 2, and 3 all reduced binding of AtFip1(V) to the labeled RNA (thereduction is apparent as a dramatic increase in the quantity of free RNAin the experiment). In contrast, a similar excess of RNA 4 had no effecton the binding of the labeled RNA. This experiment indicates thatAtFip1(V) has a decided preference for CaMV-derived RNAs that con-tain the FUE of the polyadenylation signal.The humanFip1 protein is able to stimulate the nonspecific activity of

PAP, and both the N-terminal (PAP-binding) and C-terminal (RNA-binding) portions of the protein are required for this stimulation (18).Attempts to recapitulate this aspect of the AtFip1(V)-AtPAP interac-tion were not successful, because full-length AtFip1(V) consistently co-purified with E. coli nucleases to an extent that precluded the assay ofPAP activity. However, in light of the observation that amino acids1–137 of AtFip1(V) interacted with PAP, the effects of this domain onPAP activity were examined. For this, recombinant FipN was producedas a histidine-tagged protein (Fig. 9A). The Arabidopsis PAP(IV) polya-denylates the RNA template, and the quantity of product increases overtime (Fig. 9B). In the presence of FipN, the overall quantities of productwere greater at all times, when compared with the PAP alone (Fig. 9B).This indicates that the N-terminal domain of AtFip1(V) that interactswith PAP can also stimulate the activity of PAP.

DISCUSSION

The results described in this paper indicate that an Arabidopsis Fip1homolog (AtFip1(V)) possesses two distinct and separable domains.One of these, situated within the N-terminal 137 amino acids of theprotein, is involved in interactions with a number of other polyadenyl-ation factor subunits, the Arabidopsis counterparts of PAP, CstF77,CPSF30, CFIm25, and PabN1. The other, located roughly in the C-ter-minal 789 amino acids of the protein, possesses an RNA-bindingdomain that has a preference for poly(G) among the four homopoly-mers. This RNA-binding domain includes an arginine-rich region.Some of these properties are reminiscent of those of the human Fip1protein (hFip1). The latter interacts with PAP (through as yet unidenti-fied domains) and binds to RNA through an arginine-rich C-terminaldomain (much as does AtFip1(V)). It has been proposed that these twoproperties are manifest in a singular function of hFip1, to tether PAP toa cleaved polyadenylation substrate, thereby overcoming the inherentlylow affinity of PAP for RNA. It is tempting to suggest a similar action forAtFip1(V).The various protein-protein interactions involving the N terminus of

AtFip1(V) are of interest for a number of reasons. First and foremost,these interactions provide a conceptual link between PAP and severalother Arabidopsis homologs of eukaryotic polyadenylation factor sub-units. Three of these interactions (between AtFip1(V) and PAP, CstF77,and CPSF30) have been reported in mammals and/or yeast (18, 23, 44)and are likely to be diagnostic of evolutionarily conserved functions.Interestingly, no interactions between AtCPSF160 and AtFip1(V) wereapparent in the assays performed here. The significance of this obser-vation is unclear at this time; it is possible that this particular interactioncannot be recapitulated in yeast cells, or it may be that, in contrast towhat has been reported in mammals (18), these two proteins do notinteract in plants.An interaction analogous to that described here between AtFip1(V)

andAtCFIm-25 has not been noted inmammalian systems. However, ithas recently been reported that the CFIm polyadenylation factor canrecruit CPSF to RNAs that contain sequence motifs recognized by

FIGURE 5. The C-terminal 789 amino acids of AtFip1(V) bind RNA. A, GST and GST-tagged FipC fusion proteins (amino acids 407–1196) were separated by SDS-PAGE. Onegel was stained with Coomassie Brilliant Blue (left, designated Coomassie), and a secondwas blotted to nitrocellulose and probed with anti-GST antiserum (right, labeled Immu-noblot). Protein size standards are indicated on the left. The arrow on the right representsthe full-length GST-FipC. B, 97 ng of uniformly labeled RNA containing the polyadenyl-ation signal of the pea rbcS-E9 gene was incubated with GST (4 �g) and GST-FipC (4 �g).The reactions were analyzed on a native 4% polyacrylamide gel. A sample containingRNA but no protein was similarly analyzed (denoted RNA). The positions of free RNA andthe RNA-protein complexes are noted on the far left.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

CFIm (47). Moreover, CFIm and hFip1 can act together with PAP topromote sequence-specific polyadenylation of RNAs containing pre-ferred CFIm binding sites (UGUAN) (47). Thus, there is precedence ofa sort for the interaction between AtFip1(V) and AtCFIm-25. Whetherthis precedent extends to functions analogous to those reported forCFIm is unclear. It is possible that, as in mammals, CFIm in plantsrecognizes motifs related to UGUAN; such elements occur often inFUEs, and it has been proposed that CFIm in mammals recognizespositionally analogous sequences upstreamof the canonical polyadenyl-ation signal AAUAAA (47). This would be interesting, since AtFip1(V)itself has a modest preference for the FUE (Fig. 8); the presence ofmultiple FUE-recognizing proteins in a single complex would be con-sistent with the redundant nature of FUEs in plant polyadenylationsignals (39, 45). However, as discussed below, there are other possibili-ties that must be considered. Resolution of these various scenarios willrequire further study.The interactions involving the Arabidopsis PabN1 is at this time

unprecedented, having not been reported in other systems. The signif-icance of this is unclear, since it is possible that analogous interactionshave not been assayed as has been done in this study. It is possible,however, that plant Fip1 proteinsmay engage in interactions that do notoccur in other eukaryotes. Regardless, at this time, it is hard to ascertainthe functional significance of the interaction between AtPabN1 andFip1[V] inArabidopsis. Inmammals, PabN1 interacts directly with PAPand controls both the processivity of the enzyme and length of theadded poly(A) tail (48, 49); neither of these biochemical propertiesrequire Fip1. Whether the Arabidopsis PabN1 is tethered to PAP

through AtFip1(V) or has unanticipated functions in addition to (orbesides) poly(A) length control is an issue for future investigation.A surprising aspect of the set of interactions reported here is that they

all involve a relatively small part of AtFip1(V). It seems unlikely that allfive of the interacting proteins identified in this study can bind to theN-terminal 137 amino acids of AtFip1(V) at the same time. Rather, twoalternative explanations for these interactions seem more plausible. Itmay be that all six proteins can and do reside in a single multimericcomplex, albeit one that can be assembled throughmore than one com-bination of protein-protein interactions. Thus, for example, PabN1might be held in such a hypothetical complex via interactions withAtFip1(V) or PAP. Alternatively, there may be more than one configu-ration of a complex that involves AtFip1(V), none of which wouldinclude all of the proteins identified in this study as AtFip1(V)-interact-ing partners. The different possible configurations might reflect a pro-gression of sorts through the cleavage and polyadenylation process, withdifferent proteins being recruited, through AtFip1(V), to the reaction atdifferent steps. It is also possible that there exists different stable com-plexes that include AtFip1(V). Different complexes might be responsi-ble for recognition of different sets of polyadenylation signals or forlinking 3�-end formation with other processes within the nucleus.The RNA binding properties of AtFip1(V) are interesting. This pro-

tein displays a marked preference for poly(G) among the four RNAhomopolymers. Of the three components of a plant polyadenylationsignal, only the so-called FUE has a bias toward G content (those FUEsthat have been experimentally determined are rich in UG-containingmotifs (25, 26)). Thus, one interpretation of the homopolymer compe-tition studies is that AtFip1(V) binds to the FUE in a plant polyadenyl-ation signal. This hypothesis is supported by the different abilities of theCaMV-derived RNAs used in this study to bind to AtFip1(V). Specifi-cally, RNAs that contain the FUE of the CaMV poly(A) signal wereeffective competitors with the labeled rbcS-E9 RNA for binding, but anRNA that lacked the FUE was unable to compete. This observationsuggests thatAtFip1(V) is an FUE-binding protein and that itmay be theFUE recognition factor for polyadenylation in plants. The possibilitythat AtFip1(V) is an FUE-binding factor in turn suggests that one ormore of its interacting protein partners may be involved in recognitionof the NUE and/or cleavage site, the other two known cis elements forpolyadenylation of plant mRNAs. Two of the interacting proteins iden-tified in this study, AtCPSF30 and AtPabN1, are probably RNA-bindingproteins. Additionally, AtCstF77 interacts with AtCstF64 (30), which isexpected to bind RNA. In mammals, CFIm, which contains the mam-malian homolog of AtCFI-25, is an RNA-binding factor, and the 25-kDa

FIGURE 6. AtFip1(V) has a preference forpoly(G). Ninety-seven ng of uniformly labeledRNA containing the polyadenylation signal of thepea rbcS-E9 gene was incubated with GST-FipC (4�g) with no additional RNA (no competitor) or inthe presence of 5-, 25-, and 125-fold weightexcesses of the homopolymers indicated beloweach panel. The reactions were analyzed on anative 4% polyacrylamide gel. A sample contain-ing RNA but no protein was similarly analyzed(denoted “no protein”). The positions of free RNAand the RNA-protein complexes are noted on thefar left.

FIGURE 7. RNA binding by GST-FipC requires the bulk of the arginine-rich domain. Asample of GST-FipC was further purified using poly(G)-Sepharose, and the proteinsretained on poly(G)-Sepharose were compared with those in the original sample byimmunoblotting with anti-GST antiserum. The results are arranged around a depiction ofthe GST-FipC fusion protein, with the approximate locations of the end points of theprotein degradation products depicted with jagged lines (for the unpurified proteins)and dark lines (for the poly(G)-purified protein).




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

subunit contacts the RNA (50, 51). None of the corresponding plantfactors have been correlated with any of the three poly(A) signal ciselements; however, the convergence of so many possible RNA-bindingactivities on AtFip1(V) raises the possibility that one or more of theseinteracting partners may be involved in recognition of NUEs and cleav-age sites.Neither of the two functional domains identified in this study

includes the conserved sequence signature that is found in Fip1 inmam-mals and yeast. This raises a question as to the function of this conservedmotif. In yeast, the Fip1 signature is part of, or adjacent to, the part ofFip1p that is involved in interactions with Yth1p, the yeast counterpartof CPSF30 (44). The Fip1 signature is not essential for the interactionbetween AtFip1(V) and AtCPSF30, but our results do not address the

possibility that additional contacts may be made between these twoproteins via the Fip1 motif. There is no obvious sequence similaritybetween the N-terminal 137 amino acids of AtFip1(V) and the yeastFip1p, but it remains a possibility that Yth1p also might engage in mul-tiple contact with Fip1p.Interestingly, the N-terminal domain of AtFip1(V) is, by itself, capa-

ble of stimulating the activity of the Arabidopsis PAP (Fig. 9). Althoughthis characteristic is similar in some respects to the stimulatory effects ofthe humanFip1 protein, it is different in the sense that the stimulation ofPAP by the human Fip1 requires both the N-terminal PAP-interactingpart and the C-terminal RNA-binding domain (18). Technical difficul-ties preclude an analysis of the effects of the completeAtFip1(V) proteinon PAP activity. However, if one aspect of the functioning of Fip1 pro-

FIGURE 8. AtFip1(V) has a preference for RNAs containing FUEs. A, illustration of the unlabeled competitor RNAs used in the experiment. At the top is a depiction of the cauliflowermosaic virus polyadenylation signal. The FUE is represented with a black bar within the gray box, the NUE is shown as a vertical black line, and the poly(A) site is shown with the ticklabeled An. The numbers represent the nucleotide coordinates with respect to the poly(A) site. Below this depiction is shown the parts contained in the four competitor RNAs (labeled1– 4, respectively). B, results of electrophoretic mobility shift assays. Ninety-seven ng of uniformly labeled RNA containing the polyadenylation signal of the pea rbcS-E9 gene wasincubated with GST-FipC (4 �g) with no additional RNA (no competitor) or in the presence of 50-fold molar excesses of the competitors indicated below each panel. The reactions wereanalyzed on a native 4% polyacrylamide gel. A sample containing RNA but no protein was similarly analyzed (denoted no protein). The positions of free RNA and the RNA-proteincomplexes are noted on the far left. C, summary of duplicate experiments such as that shown in B. Binding was quantitated as the percentage of RNA found in complexes andnormalized so that the values measured in the absence of competitor (no competitor in B) were 100%. Values are the average of two determinations, and the S.D. values are denotedby the error bars. The identity of the competitor RNA used in each case is indicated below the plot, with the numbers corresponding to the molecules depicted in A.

FIGURE 9. AtFip1(V) stimulates nonspecific PAP activity. A, recombinant His6-tagged AtFip1-V (FipN; amino acids 1–137) was separated by SDS-PAGE, stained with CoomassieBrilliant Blue (lane 1), and probed with anti-His after transfer to nitrocellulose (lane 2). The arrow on the left indicates the recombinant His6-AtFip1-V (FipN). Protein size standards areindicated on the right. B, poly(A), with a length of 14 bases (220 pmol), was incubated with 10 pmol of His6-AtPAP(IV) either alone or together with 6 pmol of His6-AtFip1-V (FipN) inPAP assays (see “Experimental Procedures”). At the time points indicated, reactions were stopped, RNA was precipitated and resolved, and poly(A) product was quantitated byautoradiograph (see “Experimental Procedures”). Autoradiographs were quantitated, and activity, expressed in terms of arbitrary units, was plotted as a function of time.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

teins is to tether PAP to the RNA substrate (as has been proposed byKaufmann et al. (18)), then our results suggest that PAP stimulationmaybe a multifaceted property, depending on RNA binding by Fip1 and ondirect Fip1-PAP contacts for a modification of the inherent activity ofPAP.In summary, theAtFip1(V) protein possesses two functional domains

that are distinct from the conserved Fip1 motif that it shares with othereukaryotic Fip1 proteins. One of these is involved in a number of inter-actionswith otherArabidopsis polyadenylation factor subunits and pro-vides conceptual links between these subunits and PAP. The other is anRNA-binding domain that binds with a preference for RNAs that con-tain functional FUEs. The properties of these two domains lend them-selves to a model whereby the AtFip1(V) protein interacts with the FUEin the primary transcript and acts, through either a succession of differ-ent complexes or one of several distinct complexes, to effect the cleav-age and polyadenylation of RNAs in the nucleus.

Acknowledgments—We are grateful for the technical assistance of Carol VonLanken and thank Dr. Quinn Li (Miami University, Oxford, OH) for the gen-erous gifts of plasmids with genes for Arabidopsis CPSF subunit homologs.

REFERENCES1. Proudfoot, N., and O’Sullivan, J. (2002) Curr. Biol. 12, R855–8572. Dantonel, J. C.,Murthy, K. G.,Manley, J. L., andTora, L. (1997)Nature 389, 399–4023. Lutz, C. S., and Alwine, J. C. (1994) Genes Dev. 8, 576–5864. Wassarman, K. M., and Steitz, J. A. (1993) Genes Dev. 7, 647–6595. Barilla, D., Lee, B. A., and Proudfoot, N. J. (2001) Proc. Natl. Acad. Sci. U. S. A. 98,

445–4506. Dichtl, B., Blank, D., Ohnacker, M., Friedlein, A., Roeder, D., Langen, H., and Keller,

W. (2002)Mol. Cell 10, 1139–11507. McCracken, S., Fong, N., Yankulov, K., Ballantyne, S., Pan, G., Greenblatt, J., Patter-

son, S. D., Wickens, M., and Bentley, D. L. (1997) Nature 385, 357–3618. Hirose, Y., and Manley, J. L. (2000) Genes Dev. 14, 1415–14299. Bentley, D. (2002) Curr. Opin. Cell Biol. 14, 336–34210. Aranda, A., and Proudfoot, N. (2001)Mol. Cell 7, 1003–101111. Keller, W., Bienroth, S., Lang, K. M., and Christofori, G. (1991) EMBO J. 10,

4241–424912. Jenny, A., and Keller, W. (1995) Nucleic Acids Res. 23, 2629–263513. Barabino, S. M., Hubner, W., Jenny, A., Minvielle-Sebastia, L., and Keller, W. (1997)

Genes Dev. 11, 1703–171614. Gross, S., and Moore, C. L. (2001)Mol. Cell. Biol. 21, 8045–805515. Barabino, S. M., Ohnacker, M., and Keller, W. (2000) EMBO J. 19, 3778–378716. Dichtl, B., and Keller, W. (2001) EMBO J. 20, 3197–320917. Dichtl, B., Blank, D., Sadowski, M., Hubner, W., Weiser, S., and Keller, W. (2002)

EMBO J. 21, 4125–413518. Kaufmann, I., Martin, G., Friedlein, A., Langen, H., and Keller,W. (2004) EMBO J. 23,

616–62619. Takagaki, Y., Ryner, L. C., and Manley, J. L. (1989) Genes Dev. 3, 1711–1724

20. Gilmartin, G. M., and Nevins, J. R. (1989) Genes Dev. 3, 2180–219021. Gross, S., and Moore, C. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 6080–608522. Preker, P. J., Ohnacker, M., Minvielle-Sebastia, L., and Keller, W. (1997) EMBO J. 16,

4727–473723. Preker, P. J., Lingner, J.,Minvielle-Sebastia, L., andKeller,W. (1995)Cell 81, 379–38924. Zhelkovsky, A., Helmling, S., and Moore, C. (1998)Mol. Cell. Biol. 18, 5942–595125. Hunt, A. (1994) Annu. Rev. Plant Physiol. Plant Mol. Biol. 45, 47–6026. Rothnie, H. M. (1996) Plant Mol. Biol. 32, 43–6127. Meinke, D. W., Meinke, L. K., Showalter, T. C., Schissel, A. M., Mueller, L. A., and

Tzafrir, I. (2003) Plant Physiol. 131, 409–41828. Xu, R., Ye, X., and Quinn Li, Q. (2004) Gene (Amst.) 324, 35–4529. Elliott, B. J., Dattaroy, T., Meeks-Midkiff, L. R., Forbes, K. P., and Hunt, A. G. (2003)

Plant Mol. Biol. 51, 373–38430. Yao, Y., Song, L., Katz, Y., and Galili, G. (2002) J. Exp. Bot. 53, 2277–227831. Takagaki, Y., and Manley, J. L. (2000)Mol. Cell. Biol. 20, 1515–152532. Addepalli, B., Meeks, L. R., Forbes, K. P., and Hunt, A. G. (2004) Biochim. Biophys.

Acta 1679, 117–12833. Simpson, G. G., Dijkwel, P. P., Quesada, V., Henderson, I., and Dean, C. (2003) Cell

113, 777–78734. Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W., and

Lipman, D. J. (1997) Nucleic Acids Res. 25, 3389–340235. Kieber, J. J., Rothenberg, M., Roman, G., Feldmann, K. A., and Ecker, J. R. (1993) Cell

72, 427–44136. James, P., Halladay, J., and Craig, E. A. (1996) Genetics 144, 1425–143637. Gietz, D., St. Jean, A., Woods, R. A., and Schiestl, R. H. (1992) Nucleic Acids Res. 20,

142538. Mogen, B. D., MacDonald, M. H., Graybosch, R., and Hunt, A. G. (1990) Plant Cell 2,

1261–127239. Mogen, B. D.,MacDonald,M.H., Leggewie, G., andHunt, A. G. (1992)Mol. Cell. Biol.

12, 5406–541440. Das Gupta, J., Li, Q., Thomson, A. B., and Hunt, A. G. (1995) Plant Sci. 110, 215–22641. Hunt, A. G., Meeks, L. R., Forbes, K. P., Das Gupta, J., and Mogen, B. D. (2000)

Biochem. Biophys. Res. Commun. 272, 174–18142. Zimmermann, P., Hirsch-Hoffmann, M., Hennig, L., and Gruissem, W. (2004) Plant

Physiol. 136, 2621–263243. Alonso, J. M., Stepanova, A. N., Leisse, T. J., Kim, C. J., Chen, H., Shinn, P., Stevenson,

D. K., Zimmerman, J., Barajas, P., Cheuk, R., Gadrinab, C., Heller, C., Jeske, A.,Koesema, E., Meyers, C. C., Parker, H., Prednis, L., Ansari, Y., Choy, N., Deen, H.,Geralt, M., Hazari, N., Hom, E., Karnes, M., Mulholland, C., Ndubaku, R., Schmidt, I.,Guzman, P., Aguilar-Henonin, L., Schmid,M.,Weigel, D., Carter, D. E.,Marchand, T.,Risseeuw, E., Brogden, D., Zeko, A., Crosby,W. L., Berry, C. C., and Ecker, J. R. (2003)Science 301, 653–657

44. Helmling, S., Zhelkovsky, A., and Moore, C. L. (2001)Mol. Cell. Biol. 21, 2026–203745. Rothnie, H. M., Reid, J., and Hohn, T. (1994) EMBO J. 13, 2200–221046. Sanfacon, H., Brodmann, P., and Hohn, T. (1991) Genes Dev. 5, 141–14947. Venkataraman, K., Brown, K. M., and Gilmartin, G. M. (2005) Genes Dev. 19,

1315–132748. Bienroth, S., Keller, W., and Wahle, E. (1993) EMBO J. 12, 585–59449. Kerwitz, Y., Kuhn, U., Lilie, H., Knoth, A., Scheuermann, T., Friedrich, H., Schwarz,

E., and Wahle, E. (2003) EMBO J. 22, 3705–371450. Ruegsegger, U., Beyer, K., and Keller, W. (1996) J. Biol. Chem. 271, 6107–611351. Brown, K. M., and Gilmartin, G. M. (2003)Mol. Cell 12, 1467–147652. Falquet, L., Pagni, M., Bucher, P., Hulo, N., Sigrist, C. J., Hofmann, K., and Bairoch, A.

(2002) Nucleic Acids Res. 30, 235–238




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Kevin P. Forbes, Balasubrahmanyam Addepalli and Arthur G. Huntwith a Number of Other Polyadenylation Factor Subunits

Fip1 Homolog Interacts with RNA and Provides Conceptual LinksArabidopsisAn

doi: 10.1074/jbc.M510964200 originally published online November 10, 20052006, 281:176-186.J. Biol. Chem.

10.1074/jbc.M510964200Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here

Supplemental material:

http://www.jbc.org/content/suppl/2005/11/18/M510964200.DC1

http://www.jbc.org/content/281/1/176.full.html#ref-list-1

This article cites 52 references, 26 of which can be accessed free at


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M510964200

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;281/1/176&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/281/1/176

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=281/1/176&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/281/1/176

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/content/suppl/2005/11/18/M510964200.DC1

http://www.jbc.org/content/281/1/176.full.html#ref-list-1

http://www.jbc.org/

An Arabidopsis Fip1HomologInteractswithRNAand ... · timing regulatory protein FCA to promote alternative polyadenylation of FCA-encoding RNAs and consequently to regulate flower

Documents