A clerodane diterpene inhibit adipogenesis by cell cycle arrest and ameliorate obesity in C57BL/6 mice

This article appeared in a journal published by Elsevier. The attachedcopy is furnished to the author for internal non-commercial researchand education use, including for instruction at the authors institution

and sharing with colleagues.

Other uses, including reproduction and distribution, or selling orlicensing copies, or posting to personal, institutional or third party

websites are prohibited.

In most cases authors are permitted to post their version of thearticle (e.g. in Word or Tex form) to their personal website orinstitutional repository. Authors requiring further information

regarding Elsevier’s archiving and manuscript policies areencouraged to visit:

http://www.elsevier.com/authorsrights

http://www.elsevier.com/authorsrights

Author's personal copy

A clerodane diterpene inhibit adipogenesis by cell cycle arrest andameliorate obesity in C57BL/6 miceMuheeb Beg a, Kripa Shankar a, Salil Varshney a, Sujith Rajan a,b, Suriya Pratap Singh c,Pankaj Jagdale d, Anju Puri e, Bhushan P. Chaudhari d, Koneni V. Sashidhara c,*,Anil Nilkanth Gaikwad a,b,**a Division of Pharmacology, CSIR-Central Drug Research Institute, Lucknow 226031, Indiab Academy of Scientific and Innovative Research, CSIR-Central Drug Research Institute, Lucknow 226031, Indiac Division of Medicinal and Process Chemistry, CSIR-Central Drug Research Institute, Lucknow 226031, Indiad Pathology Laboratories, CSIR-Indian Institute of Toxicology Research, M.G. Road, Lucknow 226001, Indiae Division of Biochemistry, CSIR-Central Drug Research Institute, Lucknow 226031, India

A R T I C L E I N F O

Article history:Received 27 May 2014Received in revised form 3 September 2014Accepted 23 September 2014Available online 22 October 2014

Keywords:Clerodane diterpeneStatins3T3-L1 adipocyteObesityOrlistat

A B S T R A C T

A clerodane diterpene, 16α-Hydroxycleroda-3, 13 (14) Z-dien-15, 16-olide (compound 1) isolated fromPolyalthia longifolia had previously been reported as a new structural class of HMG-CoA reductase in-hibitor apart from statins. Statins are known to be anti-adipogenic in nature. The distant structural similaritybetween compound 1 and lovastatin (polyketide class of compound) prompted us to investigate effectsof diterpene compound 1 on adipogenesis and thereby obesity. High content microscopy proved diterpenecompound 1 exhibits better anti-adipogenic activity and less toxicity in differentiating adipocytes. More-over, it reduced expression levels of PPARγ, C/EBPα and GLUT4 during differentiation in a time andconcentration dependent manner. Diterpene compound 1 during early differentiation reduced MDI induced-Akt/mTOR phosphorylation and expression of cell cycle proteins, and thereby halted mitotic clonalexpansion, the decisive factor in early adipogenesis. Further, its anti-adipogenic activity was validatedin murine mesenchymal cell-line C3H10T1/2 and human mesenchymal stem cell models of adipogenicdifferentiation.

When compound 1 was administered along with HFD, for another 8 weeks in 2 month HFD fed over-weight mice (with BMI > 30 and impaired glucose tolerance), it attenuated weight gain and epididymalfat accumulation. It improved body glucose tolerance, reduced HFD induced increase in total cholester-ol and leptin/adiponectin ratio. All these effects were comparable with standard anti-obesity drug Orlistatwith added edge of potently decreasing circulating triglyceride levels comparable with normal chow fedgroup. Histological analysis shows that compound 1 inhibit adipocyte hypertrophy and decreased ste-atosis in hepatocytes. Both in vivo and in vitro results demonstrate a potential value of compound 1 as anovel anti-adipogenic and anti-obesity agent.

© 2014 Elsevier Ireland Ltd. All rights reserved.

1. Introduction

Obesity is one of the most prevalent forms of disorder wide-spread throughout the globe. It is the key contributing factor forvarious pathological states such as type 2 diabetes, hyperlipid-emia, hypertension and arteriosclerosis and metabolic syndrome

(Kopelman, 2000). The widely used measure of obesity is body massindex (BMI) that has to be greater than 30 kg/m2 (Calle et al., 2003).Both adipocyte hyperplasia and hypertrophy are determinant factorsfor obesity caused by imbalance of energy intake and expenditure(Spiegelman and Flier, 1996).

For in vitro experiments, 3T3-L1 pre-adipocyte has served as anexcellent model system to study different aspects of adipogenesis.In this model, upon hormonal induction, C/EBPβ is rapidly ex-pressed, and growth arrested cells synchronously re-enter the cellcycle traversing the G1–S checkpoints to initiate Mitotic clonalexpansion (Tang et al., 2003a). C/EBPβ is thought to mediate theexpression of PPARγ and C/EBPα (Hishida et al., 2009; Yeh et al.,1995). Both the proteins are pleiotropic transcriptional activatorsthat coordinate to induce expression of adipocyte genes to driveadipogenesis (White and Stephens, 2010).

* Corresponding author. BS 10/1, Sector 10, CSIR-Central Drug Research Institute,Jankipuram Extension, Lucknow 226031, Uttar Pradesh, India. Tel.: +91 522 2771940# 4683; fax: +91-522-2771941.

E-mail address: [email protected] (K.V. Sashidhara).** Corresponding author. BS 10/1, Sector 10, CSIR-Central Drug Research Institute,

Jankipuram Extension, Lucknow 226031, Uttar Pradesh, India. Tel.: +91 522 2771940# 4876; fax: +91-522-2771941.

E-mail address: [email protected] (A.N. Gaikwad).

http://dx.doi.org/10.1016/j.mce.2014.09.0240303-7207/© 2014 Elsevier Ireland Ltd. All rights reserved.

Molecular and Cellular Endocrinology 399 (2015) 373–385

Contents lists available at ScienceDirect

Molecular and Cellular Endocrinology

journal homepage: www.elsevier.com/ locate /mce


Prominent among the factors that modulate adipogenesis in theearly stage, is mTOR pathway that is required for differentiation ofpre-adipocyte and primary cells (Xiang et al., 2011). Rapamycin, aknown mTORC1 inhibitor, inhibits mitotic clonal expansion, de-creases expression of PPARγ and C/EBPα and inhibits adipogenesis(Gagnon et al., 2001). Knockdown of Raptor leads to reduction inmTOR as well as adipogenesis (Polak et al., 2008). Increased mTORactivity play a permissive role in adipogenesis by augmentingupregulation of PPARγ and C/EBPα (Zhang et al., 2009). mTOR, alsopositively regulate mitochondrial oxygen consumption in mam-malian cells (Schieke et al., 2006). Mitochondrial oxygen consumptionand overall ROS level increases during early events of mesenchy-mal stem cell adipogenesis. N-acetyl cysteine (NAC) and reactiveoxygen species (ROS) reducing agent supplementation decrease adi-pogenesis (Tormos et al., 2011). These studies underscore theimportance of mTOR and ROS in early adipogenesis.

There are currently few FDA approved anti-obesity drugs in themarket including Sibutramine (appetite suppressor), Orlistat (gas-trointestinal lipase inhibitor), and fibrates (PPARα agonists) (Padwaland Majumdar, 2007). Despite these available options, worldwideincidences of obesity are increasing at the alarming rate. Naturalproducts provide a rich source of chemical diversity that can be usedto design and develop new drug leads. Some of the natural prod-ucts including epigallocatechin gallate (EGCG), berberine andcurcumin, are known to suppress adipogenesis and proved usefulin obesity management in animal models (Ejaz et al., 2009; Hu andDavies, 2010; Lee et al., 2013; Meydani and Hasan, 2010).

P. longifolia var. pendula Linn. belongs to the family Annonaceaeand has shown various pharmacological properties (Jothy et al., 2012;Malairajan et al., 2008; Mandal et al., 2012; Manjula et al., 2010).Phytochemical studies on the ethanolic extract of the leaves ofP. longifolia have led to the characterization of various clerodanediterpenes. Recent studies from our group have demonstrated thatditerpene 16α-hydroxycleroda-3, 13 (14)Z-dien-15, 16-olide (com-pound 1) isolated from Polyalthia longifolia var. pendula leaves is amajor hypolipidemic constituent (Sashidhara et al., 2011). The phar-macokinetic study demonstrated that compound 1 shows rapidgastro-intestinal absorption and was in the systemic circulation for48 h following a single dose oral administration (Bhatta et al., 2012).In vitro assays demonstrated significant HMG-CoA reductase inhi-bition and molecular docking studies proved this clerodane diterpeneto be comparable with lovastatin. Recently, we have observedco-existence of anti-dyslipidemic/hypolipidemic activities with anti-adipogenic activity for various flavanoids although both activitiesare distinct (Varshney et al., 2014). Further to this, some of the statinclasses of compounds were also reported for anti-adipogenicactivity (Nakata et al., 2006). These observations prompted us toundertake studies on anti-adipogenic effect of compound 1 (thediterpene class) and comparative assessment with another statinclass of compounds (Polyketide class).

Our results show, diterpene compound 1 although belonging toa distinct chemical class, possess anti-adipogenic activity similar tostatin classes of compounds. The activity is mediated through modu-lations of early signaling, resulting in Mitotic clonal expansion arrest,followed by suppression of adipogenic regulators. Anti-adipogenicactivity was also confirmed using other in vitro models of adipo-genesis including a mouse stromal stem cell line C3H10T1/2, andhMSCs. Compound 1 also demonstrated in vivo anti-obesity activ-ity similar to Orlistat, the FDA approved anti-obesity drug.

2. Material and methods

2.1. Plant material extraction and isolation

Polyalthia longifolia var. pendula leaves were collected fromLucknow in 2005. The identity of the plant was confirmed and a

voucher specimen (No. 6381) has been deposited in the herbari-um of the Botany Division, CSIR-Central Drug Research Institute(CSIR-CDRI), Lucknow, India. Compound 1 isolation (Sashidhara et al.,2011), spectrophotometric and HPLC purity analysis were per-formed as briefly mentioned in supporting information.

2.2. Cell culture

3T3-L1 mouse embryo fibroblasts were obtained from Ameri-can Type Culture Collection (Manassas, VA) and cultured inDulbecco’s modified Eagle’s medium (DMEM) supplemented with10% fetal bovine serum (FBS) (GIBCO, Grand Island, NY). Two daysafter confluence, the cells differentiated with DMEM containing 10%FBS, 5 μg/ml insulin, 0.5 μM IBMX, and 250 nM Dexamethasone for2-days. After that 10% FBS/DMEM with 5 μg/ml insulin for 2-days,followed by culturing with 10% FBS/DMEM for an additional 2-days.On the 6th day of MDI induction, >90% of cells showed lipid drop-lets indicative of adipogenic differentiation. All media containedpenicillin/streptomycin antibiotic solution (Invitrogen, Carlsbad,CA). Cells were maintained at 37 °C in a humidified 5% CO2atmosphere. Characterized human mesenchymal stem cells (hMSCs)were procured from Stempeutics Research Pvt. Ltd. (Banglore, India).

2.3. Oil red-O staining

In brief, cell monolayer was washed twice with PBS stained withORO (0.36% in 60% Isopropanol) for 20 min. After wash with PBS,dye was extracted using 100% Isopropanol and measured absor-bance at 492 nm (Goel et al., 2013).

2.4. High content microscopy and image analysis

After differentiation in presence or absence of compound 1 andvarious statins Lovastatin, Atrovastatin, Simvastatin and Rosuastatin(Sigma) at 5, 10 and 20 μM, cells were stained with Lipidtox Red(Invitrogen) for Lipid content and Hoechst-33342 (Invitrogen)for nucleus as per manufacturer’s protocol and image were takenon Cellomics Array Scan VTi. Due to higher toxicity of some statins,maximum concentration cells were washed out during experimen-tal period. Image analysis of no of lipid droplets and no. of nucleiwas performed by CELL PROFILER software.

2.5. MTT assay

Performed as mentioned previously (Dave et al., 2012).

2.6. Cell cycle analysis

Performed as mentioned previously (Kwon et al., 2012) exceptexperiment on BD, FACS Calibur and cell cycle analysis was per-formed using Modfit.

2.7. Measurement of ROS

ROS were detected with the peroxide-sensitive fluorophore 2′,7′-dichlorodihydrofluorescein diacetate (DCF-DA) (Sigma). DCF-DA dissolved in Ethanol and added to cells at 10 μM concentrationsin PBS. After incubation for 30 min at 37 °C under an atmosphere,including 5% CO2, 3T3-L1 cells were washed twice with PBS and flu-orescence reading were taken on fluorimeter (POLARstar Galaxy;BMG Labtech, Mount Eliza, VIC, Australia).

2.8. Western blotting

Protein levels were analyzed in whole-cell lysates obtained usingcell lysis buffer (Mammalian cell lysis buffer, Gbiosciences cat no.

374 M. Beg et al./Molecular and Cellular Endocrinology 399 (2015) 373–385


786-180) supplemented with 0.5 M EDTA, protease inhibitor andphosphatase inhibitor (Sigma). Protein concentration was deter-mined using the Bicin-choninic acid method (Sigma) and equalquantity of samples was resolved on a SDS polyacrylamide gel. Tar-geted protein was analyzed by immunoblotting with respectiveantibodies. HRP-conjugated secondary antibodies were detectedusing a western Chemiluminescence detector (Millipore) accord-ing to the manufacturer’s protocol on Image Quant LAS 4000. Tovalidate equal loading, actin was used as an internal loading control.

2.9. Quantitative real-time RT-PCR

Cells were harvested in Trizol reagent (Invitrogen) and RNA wasextracted. cDNA synthesis was performed with the AppliedBiosystem cDNA Synthesis kit. Real-time PCR was performed usingSYBR Green master mix on Light Cycler 480 (Roche Diagnostics). Therelative mRNA transcript levels were calculated according to the2-DDCt method. Oligonucleotide primers for RT-PCR are summa-rized in Table 1. GAPDH mRNA was also measured as an invariantcontrol.

2.10. Animal care and treatment

All experimental procedures were approved by the institu-tional ethics committee for animal study and were conducted inaccordance with the guidelines of the Committee for the purposeof Control and Supervision of Experiments on Animals (CPCSEAs),India. Male C57BL/6 mice, 6–8 weeks old, weighing 15–20 g, werehoused in polypropylene cages in the animal house, with temper-ature 23 ± 2 °C; humidity 50–60%; light 300 Lux at floor level withregular 12 h light cycle. Twenty four C57BL/6 mice were housed (sixmice/cage) and given water ad libitum. After acclimation for 1 week,mice were randomly assigned to one of the four groups with equalmean body weight between groups. Mice on a normal diet (ND)group were fed a standard chow diet and mice in high-fat diet (HFD)groups were fed a HFD (60% of calories derived from fat; ResearchDiets Inc, New Brunswick, NJ). After 8 weeks, when mice were sig-nificantly obese and glucose intolerant compared with Normal dietfed mice, treatment regimen was started. Both compound 1 andpositive control (Orlistat) was dissolved in 1% gum acacia and weregiven daily at 50 mg/kg/day by oral gavage for 8 weeks. Mice inHFD + Vehicle group were given an equal volume of 1% gum acacia.Food intake and body weight were measured twice per month. After16 weeks, the mice were fasted for 16 h, and euthanized using deep

anesthetic ether. Organs for immunoblotting were harvested andfrozen immediately in liquid nitrogen and stored at −80 °C.

2.11. Oral glucose tolerance test and lipid profile

The normal chow fed or HFD fed animals (with or without drugtreatment groups) were subjected for oral glucose tolerance test.Blood samples were collected by tail-cut method before subject-ing to treatment. Glucose (2 g/kg) was administered orally in theanimals and blood glucose levels were determined after 30, 60, 90and 120 min using Accu-check® glucometer (Roche Diagnostics). Thegraph glucose concentration vs time following administr-ation was plotted using PRISM GraphPad® software and AUC0-120

were taken for calculation purpose.Blood was collected and serum was separated by centrifuga-

tion at (4000 rpm for 10 min). Enzymatic assays for total cholesteroland serum triglyceride were performed using a COBAS Integra 400plus analyzer (Roche Diagnostics).

2.12. Leptin and adiponectin ELISA

Serum leptin and adiponectin were measured as per manufa-cturer’s protocol (R&D System).

2.13. Histological staining

The sections of epididymal adipose tissue and liver were fixedin 10% formalin, dehydrated, and embedded in paraffin. Adiposetissue and liver sections were stained with hematoxylin and eosin(HE) to examine the morphology.

2.14. Statistical analysis

For in vitro studies, data were expressed as means ± SD andStudent t test was used for statistical significance. For in vivo studies,data were expressed as mean ± SEM. Comparisons between the treat-ment groups and control were performed by one way analysis ofvariance (ANOVA) followed by Bonferroni’s multiple comparison test.Data were analyzed on Graph Pad Prism (Version3.00, Graph padSoftware Inc., San Diego, CA). For all tests probability value of P < 0.05was used as the criterion for statistical significance.

3. Results

Recently we have shown observed inter-dependence of anti-dyslipidemic and anti-adipogenic activities in many of the flavonoidclass of compounds (Varshney et al., 2014). Some of the statin classesof anti-dyslipidemic compounds also exhibit anti-adipogenicactivities. Taking clues from these studies, we screened in housenatural product library showing anti-dyslipidemic activities and iden-tified compound 1 as potential anti-adipogenic hit molecule.

3.1. Comparative anti-adipogenic profiling of compound 1and statins

A diterpenoid, compound 1 has distant structural analogy tolovastatin, which is a polyketide class of compound (Fig. 1A). Wehave shown anti-dyslipidemic activity of compound 1 that is com-parable with lovastatin (Sashidhara et al., 2011). In our efforts tocompare anti-adipogenic activity of compound 1 with the other statinclasses of compounds – simvastatin, lovastatin, rosuvastatin andatorvastatin – we took high content screening (HCS) approach. First,we investigated the toxicity of compound 1 along with various statins(Fig. 1B). MTT data showed relative toxicity of most of statins andcompound 1 after 48 h supplemented in differentiation media. Underthese conditions the fully confluent adipocyte are under influence

Table 1List of primer used for RT PCR.

Gene name Primer(s) – forward (F) reverse (R)

LPL F 5′tttgtgaaatgccatgacaag3′R 5′cagatgctttcttctcttgtttgt3′

FABP4 F 5′gaaaacgagatggtgacaacg3R 5′gccctttcataaactcttgtgg3

SREBP-1c F 5′ttcctcagactgtaggcaaatct3′R 5′agcctcagtttacccactcct3′

FAS F 5′caacatgggacaccctgag3′R 5′gttgtggaagtgcaggttagg3′

PPARγ F 5′aagacaacggacaaatcacaa3′R 5′gggggtgatatgtttgaacttg3′

CEBPα F 5′aaacaacgcaacgtggaga3′R 5′gcggtcattgdcactggtc3′

Wnt3a F 5′gagacatggggacacagtca3′R 5′Gggaatcagatgggtcctg3′

GATA2 F 5′cacccctatcccgtgaatc3′R 5′cagcagtagagagtaagagacacca3′

GAPDH F 5′tgttaccaactgggacgaca3′R 5′ggggtgttgaaggtctcaaa3′

375M. Beg et al./Molecular and Cellular Endocrinology 399 (2015) 373–385


Fig. 1. High content comparative analysis of Statins and compound 1. (A) Structure of clerodane diterpene: 16α-hydroxycleroda-3, 13 (14) Z-dien-15, 16-olide (1). (B) MTTassay was performed exposing 3T3-L1 cells to MDI containing different concentrations of compound 1 and statins for 48 h. (C) 3T3–L1 pre-adipocytes were cultured anddifferentiated in MDI medium containing 20 μM compound 1 and 10 μM Atorvastatin for 6 days. The differentiated cells were stained with nuclear stain Hoestch-33342and lipid droplets stain-Lipidtox Red. Images were acquired on Cellomics Array scan VTi platform at the same exposure and intensity settings. Representative merged imagesshowing the decreased number of lipid droplets in Atorvastatin and compound 1 supplemented MDI during differentiation. (D) Quantitative and comparative post differ-entiation analysis of lipid droplet and nuclei counts in adipocyte exposed to different statins and compound 1 in a concentration dependent manner. The exposure concentrationsfrom the 0 to 20 μM range were decided based on toxicity profiling. For each experiment condition three wells were used, from each well 12 images were acquired at 20×magnification on the Cellomics ArrayScan VTi platform at the same exposure and intensity settings. Such two independent experiments were performed. Image analysiswas performed using CellProfiler software. The data shown here are mean ± SD of total counts per treatment condition.



of differentiation inducing hormonal cocktail and thus this may notnecessarily be considered as general toxicity test. After differenti-ation period, in the presence or absence of compounds, adipocyteswere stained using Hoechst-33342 and LipidToxRed, the nuclear andlipid droplets stains respectively (Fig. 1C). The averages of 12 images/condition from three independent wells were acquired on CellomicsArrayscan VTi platform and images were analyzed using Cellprofilersoftware. As shown in Fig. 1D, all statins except rosuvastatin showedsignificant and concentration dependent decrease in lipid dropletand nuclei counts, while compound 1 reduced lipid droplet countwithout affecting nuclei count. This indicates that compound 1 isnon-toxic to differentiating adipocytes, while concentration depen-dent lesser nuclei count and increased floating cells were observedin MDI supplemented with statin classes of compounds. On the basisof given data, we can interpret that compound 1 demonstrates con-centration dependent anti-adipogenic activity. Atorvastatin at lowerconcentrations is relatively better anti-adipogenic compound on thebasis of nuclei and lipid droplet counts so we used it as positivecontrol (10 μM) in our experiments.

Apart from preadipocyte cell line 3T3-L1, Our results indicate thatcompound 1 inhibited adipogenic differentiation in mouse andhuman mesenchymal stem cells. We confirmed these results by OROstaining of lipid droplet. Compound 1 exhibited a significant de-crease in lipid droplet accumulation ranging from 5 to 20 μM similarto positive control atorvastatin (Fig. 2A and B). Similar differenti-ation studies were performed using murine mesenchymal cellline C3H10T1/2 and hMSC, and compound 1 confirmed robust anti-adipogenic activity (Fig. 2C–F). This is indicative that compound 1is capable to inhibit adipocyte hypertrophy as well as adipogeniccommitment under hormonal influence. The anti-adipogenicactivity of compound 1 and atorvastatin further confirmed con-centration dependent reduced mRNA expression of PPARγ, C/EBPαand FABP4 by qPCR, PPARγ and GLUT4 by immunoblotting in 3T3-L1 cells (Fig. 3A–E and G). Compound 1 also significantlysuppressed PPARγ target genes LPL, FAS and SREBP-1c (Fig. 3H). Anti-adipogenic effect was also confirmed by compound exposure timedependent, i.e. day 2, 4 and 6, decrease in PPARγ, C/EBPα and GLUT4(Fig. 3G). Adipocyte differentiated in the presence of both com-pound 1 and atorvastatin, significantly reduced adiponectin releasein culture supernatant indicating decreased adipogenesis (Fig. 3F).Taken together, compound 1 inhibits adipogenic commitment, lipiddroplet accumulation and adipogenesis associated marker gene orprotein expression levels in vitro.

3.2. Compound 1 suppresses mitotic clonal expansion in the earlyphase of adipogenesis

Our next objective was to investigate specific stage of adipo-genesis inhibition. Adipogenic inhibition occurs at various stagesof adipogenesis i.e. early, mid and late. To determine the stage ofadipogenic inhibition by compound 1, we supplemented it for days0–2, 0–4, 0–6, 2–4, 2–6, and 4–6 during adipogenic differentia-tion. Compound 1 significantly inhibited adipogenesis irrespectiveof phase it was added during differentiation, but its addition, duringthe early phase of differentiation (i.e. Day 0–2) brought the mostsignificantly reduced lipid accumulation. This indicates com-pound 1 has a major role to play during early differentiation thatcoincides with mitotic clonal expansion (Fig. 4A and B).

During mitotic clonal expansion, a significant portion ofthe MDI-treated 3T3-L1 growth arrested preadipocytes appearedto be in the S-phase at 16 h, and a greater number of cells ap-peared to be in the G2/M phases at 24 h. Flow cytometry analysisresults showed, MDI treatment increased cells in S-phase from8.27% to 32.39% in 16 h, which was reduced up to 14.7% when MDIwas supplemented with compound 1. By the end of 24 h, 21.71%of the cells were in S-phase in MDI treated cells, while in the case

of the compound 1 supplementation, S-phase cells were in-creased to 40.33%. This indicates S-phase arrest that cor-responds with mitotic clonal expansion inhibition. Compound 1treatment in fully confluent un-induced non differentiatedcells did not alter % cell population in various cell cycle phases.This indicates that compound 1 has specific S-phase cell cyclearrest effect during MDI induced mitotic clonal expansion (Fig. 4Cand D).

3.3. Compound 1 inhibited MDI induced C/EBPβ expression,Akt/mTOR, ROS level in the early phase of adipogenesis

After determining the early phase adipogenesis inhibition by com-pound 1, we evaluated its capability to perturb MDI induced signalingthat takes place in the time window of 16–24 h. Compound 1 treat-ment exhibited noticeable decreases in MDI induced C/EBPβexpression at 24 h time point (Fig. 4E). It reduced MDI induced Akt,mTOR, P70S6K phosphorylation at 16 and 24 h (Fig. 4F). We furtherconfirmed concentration dependent mTOR and P70S6K suppres-sion upon compound 1 treatment. (Fig. 4G).

Following MDI induction, positive correlation between mTOR andmitochondrial metabolism culminate into ROS production leadingto adipocyte differentiation (Kanda et al., 2011; Lee et al., 2009;Tormos et al., 2011). MDI induction significantly increases ROS levelin post-confluent cells in 24 h exposure and compound 1 additionsuppresses it significantly (Fig. 4H). Taken together, it is indicativethat compound 1 inhibited MDI induced Akt/mTOR signaling, reducesC/EBPβ expression and ROS level, which can be attributed toblockade of mitotic clonal expansion during early adipogenesis(Fig. 4).

3.4. Compound 1 reduces cell cycle marker, augmentedanti-adipogenic Wnt3a/β-catenin and GATA2 pathway

Early phase mitotic clonal expansion arrest needs to be sub-stantiated with the associated gene and protein level expressions.Compound 1 arrests cells in S-phase and reduces expression of CDK2,CDK4, CDK6 and cyclin D. It also stabilized expression of p27 protein,the negative regulators of CDKs (Fig. 4F). Among negative regula-tor of early adipogenesis, Wnt/β-catenin and GATA mediatedpathway is prominent (Beg et al., 2013; Jung et al., 2013; Kawai et al.,2007; Perobner et al., 2012). Compound 1 treatment stabilizedβ-catenin expression in 16 and 24 h (Fig. 4F). It also increases themRNA expression of Wnt3 and GATA2 by 27 and 119 fold respec-tively as estimated by qPCR studies at 48 h which otherwise aresuppressed post-MDI differentiation (Fig. 4I).

3.5. Compound 1 ameliorates HFD induced obesity and obesityrelated parameter in C57BL/6

There are strong literature evidence established for correlationof adipogenesis and obesity (Nishimura et al., 2007). C57BL/6 micewere fed HFD (60% kCal) for 8 weeks. This lead to increased weightgain, increased BMI and impaired glucose tolerance in mice com-pared with their normal chow diet fed group. At this time point,HFD fed animals were divided in three groups, and were fed on HFDalone, HFD + orlistat, HFD + compound 1 for another 8 weeks (givenin experimental outline, Fig. 5A). Photographic images showed thatthe administration of compound-1 and Orlistat both causes less obesephenotype compared with high fat diet group, which might be as-sociated with decreased fat accumulation (Fig. 5B). Comparativeassessment was made between these groups for studying the effectof compound 1.



3.6. Dietary consumption, body weight, blood glucose,lipid parameter and epidydimal fat

Apparently there was no significant difference in diet intake ofgroups due to administration of compound 1/orlistat (Fig. 5C). Asexpected, mice fed with HFD had significantly higher body weights(48%), epididymal fat (60%) compared with ND group (Fig. 5D and I).After gaining BMI > 30 in HFD fed C57BL/6 mice after 8 weeks offeeding (Fig. 5E), compound 1/orlistat at 50 mg/kg dose adminis-

tration with HFD significantly attenuated weight gain and glucoseintolerance (Fig. 5D and F).

Compound 1 showed 73% reduction and orlistat showed 66% re-duction in HFD induced increased total cholesterol levels (Fig. 5G).Compound 1 showed an edge over orlistat with dramatic reduc-tion of HFD induced increased triglyceride levels. Wherein,compound 1 showed almost 100% reduction and brought triglyc-eride levels similar to normal chow fed animals, orlistat showed only20% reduction in increased triglyceride level (Fig. 5H). This is an

Fig. 2. Compound 1 inhibits adipogenesis. (A) 3T3–L1 preadipocytes were cultured in the differentiation medium containing 0, 5, 10, and 20 μM of compound 1 and 10 μMof Atorvastatin for 6 days. Post-differentiation cells were stained with ORO and images were acquired on a Nikon Ti microscope (10× objectives). (B) Accumulated ORO wasextracted and absorbance was measured at 490 nM on BMG PolarStar plate reader. The data shown here are concentration dependent relative % ORO accumulation changein lipid droplets in adipocyte treated with compound 1 or 10 μM Atorvastatin. Data are mean ± SD of three independent experiments. (C) C3H10T1/2 cells were differen-tiated in MDI supplemented with 1 μM Rosiglitazone with or without compound 1 at 20 μM and stained with ORO and images were taken with a Nikon Ti microscope at20× magnification. (D) ORO was extracted from lipid droplets of C3H10T1/2 adipocyte and mean ± SD actual absorbance readings were plotted. (E) hMSCs were differen-tiated using MDI containing 1 μM Rosiglitazone with or without 20 μM compound 1. Postdifferntiation adipocyte were stained with ORO and images were taken with aNikon Ti microscope at 20× magnification and (F) ORO was extracted from lipid droplets of hMSC adipocyte and mean ± SD actual absorbance readings were plotted forexperiment performed two independent experiments. Statistically significant change *P 0.05, **P 0.01, ***P 0.001 vs. untreated control.



Fig. 3. Molecular markers of adipogenesis. The cells were differentiated in the presence of treatment conditions depicted in the figure, mRNA was isolated and whole celllysates were prepared. (A) Concentration dependent relative mRNA gene expression changes of PPARγ, C/EBPα and FABP4 in 6 days differentiated adipocyte subjected withcompound 1 or Atorvastatin supplementation in MDI. (B and C) Representative western blot of relative protein expression level changes in PPARγ and GLUT4, the majoradipocyte markers in adipocyte differentiated with MDI with or without compound 1 and atorvastatin supplementation. (D and E) Relative and quantitative densitometryanalysis of PPARγ and GLUT4 performed with Image J software and data normalization with β actin. The data shown here are mean ± SD of three independent experiments.(F) Secreted adiponectin levels of fully differentiated adipocyte with or without compound 1 and atorvastatin at 20 and 10 μM respectively. Data mentioned here are mean ± SDof triplicate wells. Data are representative of two independent experiments giving similar results. (G) Time dependent protein expression changes in adipogenic markerproteins PPARγ, C/EBPα and GLUT4 with or without compound 1 in western blot. (H) PPARγ target gene LPL, FAS, and SREBP-1c expression changes with or without 20 μMof compound 1. Immunoblots are representative of three independent experiments. Data are expressed as the mean ± SD. *P 0.05, **P 0.01, ***P 0.001 vs. Control.



Fig. 4. Compound 1 effect on mitotic clonal expansion. Further we examined the effect of compound 1 at different stages of differentiation for which (A) 3T3–L1 preadipocyteswere cultured in MDI containing 20 μM compound 1 exposed for days 0–2, 0–4, 0–6, 2–4, 2–6, 4–6 days during differentiation. The cells were stained with ORO and imageswere taken with a Nikon Ti microscope. (B) Treatment conditions were similar as mentioned above in 24 well plate performed in triplicate and accumulated ORO was ex-tracted and absorbance readings were plotted as mean ± SD in each treatment condition. (C) Two day post confluent 3T3–L1 preadipocytes were cultured in the differentiationmedium containing 20 μM compound 1 for 16 and 24 h, stained with propidium iodide solution, and analyzed by flow cytometry. (D) The percentage of cell population ateach stage of the cell cycle in treatment conditions given as mentioned in the figure was determined by Modfit software. (E) C/EBPβ protein expression after MDI inductionat 4–24 h in the presence or absence of compound 1. (F) Effects of compound 1 on MDI-induced Akt/mTOR, cell cycle signaling and ß-catenin expression in 3T3-L1 cells at0, 16 and 24 h time points in the presence of MDI alone and supplemented with compound 1. (G) Compound 1 concentration dependent changes in MDI induced mTORand P70S6K phosphorylation. (H) Basal and MDI induced ROS measurement in presence of compound 1 for 24 h and fluorescence was measured excitation at 485 nm andemission at 520 nm. The graph represents relative Mean ± SD % change performed in three independent experiments. (I) Compound 1 mediated relatively increased mRNAlevel expression of negative regulator of adipogenesis Wnt3a and GATA2 at 48 h of MDI induction. The data are representative of three independent experiments. Data areexpressed as the mean ± SD. *P 0.05, **P 0.01, ***P 0.001 vs. Controls.



interesting observation as hypertriglyceridemia is at present beingobserved as separate therapeutic indication. Compound 1 oral feed-ing to HFD fed animals reduced gain up to 50% in body weight aswell epididymal fat weight (Fig. 5I). Moreover, all of these effectsof compound 1 were comparable with standard anti-obesity drugOrlistat.

3.7. Serum leptin and adiponectin level and adipogenesismarker expression

Leptin:Adiponectin ratio was elevated dramatically in HFD fedmice, but reduced in the presence of compound 1 and orlistat treat-ment (Fig. 5J). The serum leptin level is directly proportional tovisceral obesity and has been taken as a marker parameter ofadipocyte inflammation as well as obesity assessment in severalexperimental animal models and humans (Maffei et al., 1995; Wanget al., 2010).

Following high fat diet feeding, initially adipocyte hypertrophyobserved due to excessive lipid accumulation and then adipocytehyperplasia sets in. Both PPARγ and C/EBPα expressions transactivateeach other and are required for lipid accumulation in adipocyte. Al-though we see increased expression of C/EBPα in high fat diet fedanimals, it is lacking in orlistat and compound-1 treatment groups.Although precise interdependence of these transcription factors andchronology of appearance during the course of in vitro adipogen-esis is well reported in literature, yet it is unclear in vivo, owing tomigratory and other resident cell types in adipose tissue. We ob-served suppression of both PPARγ, C/EBPα and downstream adipocytespecific marker GLUT4 in orlistat and compound 1 treatment groupthat compared with high fat diet treatment groups (Fig. 5K). Al-though, not directly, this is indicative of decreased lipid accumulationas well as decreased adipogenesis.

3.8. Histological analysis of liver and adipocytes

Hepatic steotosis was observed in histological section of HFD fedmice liver, which was not observed in Compound-1 and Orlistattreated group. The histological sections of Compound-1 treated groupwere almost similar to normal chow fed animal liver sections. Sim-ilarly HFD fed mice showed adipocyte hypertrophy, while adipocytephenotype of Compound-1 treated group was similar to normal chowdiet fed animals. Interestingly Orlistat did not have any apparenteffect on adipocyte size (Fig. 5L).

4. Discussion

In our recent work we reported observed inter-relationshipbetween compounds reported for in vitro anti-adipogenic activityalso demonstrating anti-dyslipidemic activity in vivo (ref). Al-though our earlier reported study covered mainly flavonoid classof compounds (Varshney et al., 2014), interestingly statin class ofcompounds were also reported for exhibiting anti-adipogenic ac-tivity. Taking clues, we reverse screened our compound librarymolecules demonstrating anti-dyslipidemic activity for anti-adipogenic activity. Compound 1 was identified as a hit moleculefrom this exercise. Compound-1 anti-adipogenic activity was con-firmed in different in-vitro adipocyte differentiation models. It alsoinhibited adipogenic commitment of stem cells as well as reducedlipid accumulation in pre-adipocytes under influence of MDI.Adipogenic inhibition was likely to be associated with the repres-sion of MDI induced cellular signaling and mitotic clonal expan-sion blockade. Further in vivo studies showed, Compound-1attenuated HFD induced increased: (i) body weight gain,(ii) serum total cholesterol and total triglycerides, a (iii) leptin/

adiponectin ratio and improved glucose tolerance. Moreover, Com-pound 1 ameliorates pathological signs in adipose and liver tissuedeveloped due to high fat diet. These in-vivo activities of the Com-pound 1 were found to be comparable with FDA approvedanti-obesity drug Orlistat.

We studied major pro-adipogenic transcription factors and theirdownstream targets PPARγ, C/EBPα FABP4, GLUT4 and SREBP-1c, FAS,and LPL, which were reduced significantly in presence of com-pound 1. Adipocyte hyperplasia is triggered by signaling factors thatinduced lineage commitment of mesenchymal stem cells (MSCs)to preadipocytes and terminal differentiation into adipocytes (Tangand Lane, 2012). Compound 1 also inhibited adipogenic commit-ment in murine mesenchymal stem cell line C3H10T1/2 and humanbone marrow stem cells under influence of adipogenic stimuli. Theseresults indicate that Compound 1 halts adipogenic commitment,differentiation and hypertrophy.

In preadipocyte, adipogenesis initiates following differentia-tion induction, where early events play pivotal roles. Our temporalstudies concluded compound 1 had inhibited maximum lipid ac-cumulation when it was supplemented during early phase ofdifferentiation. This included-MDI induced phosphorylation of Akt/mTOR pathway, C/EBPβ expression, mitotic clonal expansion andassociated characteristic cell cycle regulation (Cole et al., 2004;Prestwich and Macdougald, 2007; Zhang et al., 2009). Curcumin,Resveratrol and Piceatannol were reported to inhibit early MDI-induced signaling, particularly at levels of C/EBPβ, cell cycle proteinsand modulations of mitotic clonal expansion (Kim et al., 2011; Kwonet al., 2012). In order to study effect on compound 1 in early phaseof differentiation where it impacted most, we decided to study indetail its effects on insulin signaling and MDI induced mitotic clonalexpansion.

Compound 1 mediated adipogenic inhibition was likely to be as-sociated with the repression of MDI induced mitotic clonal expansionand Akt/mTOR/P70S6k signaling, ROS generation (Jung et al., 2013;Lee et al., 2009; Ross et al., 2002; Tang et al., 2003b; Tormos et al.,2011; Yu et al., 2008). Natural compound Fisetin and Cordycepinwere reported to inhibit adipogenesis by targeting mTOR and as-sociated signaling (Jung et al., 2013; Takahashi et al., 2012). mTORis rapidly activated upon MDI induction that in turn regulate C/EBPβwhich through intricate orchestration of PPARγ and C/EBPα initi-ate lipid accumulation (Lefterova et al., 2008; Takahashi et al., 2012).During early phase, MDI induced ROS production by mitochon-dria metabolism is important for driving mitotic clonal expansionthat finally culminate into adipocyte differentiation (Kanda et al.,2011; Lee et al., 2009; Tormos et al., 2011). Compound-1 treat-ment leads to reduction of MDI induced Akt, mTOR, P70S6Kphosphorylation and C/EBPβ expression at 16 and 24 h, the timepoints coincides with mitotic clonal expansion. MDI induced ROSgeneration was significantly reduced in presence of Compound-1.Taken together, Compound-1 is capable of modulating early phasesignaling,

During mitotic clonal expansion progression, growth arrested cellsundergo G1 to S phase that requires the coordinated activation ofCDK4/CDK6 and CDK2. The CIP1/KIP1 family, proteins i.e. p21, p27,and p57, inhibits CDKs and thereby its activation or stabilizationmight be one of the factors contributing to mitotic clonal expan-sion arrest (Sherr and Roberts, 1995). Resveratrol, picetanolol arrestmitotic clonal expansion in S-phase, and Genistein, Garcinol andPterostilbene cause G2/M phase arrest (Hsu et al., 2012; Kwon et al.,2012). Similarly, Compound-1 causes mitotic clonal expansion block-ade by delayed entry of growth arrested cells into S-Phase in 16 h,and further remained arrested in S-phase up-to 24 h. Reduced ex-pression of cell cycle proteins CDK2, 4, 6 and cyclin D1 and sustainedexpression of CDK inhibitor P27 proved Compound-1 primarily actsby inhibiting mitotic clonal expansion by S-phase cell cycle arrest(Fig. 4F).





Following differentiation induction, Wnt/βcatenin and GATA me-diated pathways are suppressed in order to initiate adipogenicprogram (Jung et al., 2013; Kawai et al., 2007; Perobner et al., 2012).Berberine decreases the expression of PPARγ and C/EBPα, throughincreased expression of GATA-2 and GATA-3 (Hu and Davies, 2009).Curcumin have anti-adipogenic effect through Wnt/βcateninupregulation (Ahn et al., 2010); similarly, addition of Compound-1to MDI results in increased expression of GATA2, Wnt3a and βcatenin.This shows that Compound-1 addition either maintains or leads toaugment of anti-adipogenic mechanisms during differentiation.

There are strong literature evidence established for correlationof adipogenesis and obesity (Nishimura et al., 2007). Berberine,curcumin, Foenumoside B and Cocoa polyphenols has been re-ported to inhibit adipogenesis both in cellular and animal modelsof obesity (Ejaz et al., 2009; Hu and Davies, 2010; Min et al., 2013;Seo et al., 2012). The effects of preventive therapy are desired foroverweight subjects for those either approached or approaching to

abnormal BMI. The aim of therapy is to prevent further aggravationof obesity and reduction in weight toward corrective BMI. We de-signed our experimental strategy to address a few of these concernsrelated to obesity (Fig. 5A), therefore it was pertinent to use orlistat,an FDA approved anti-obesity agent as a standard positive control.

After gaining BMI > 30 in HFD fed C57BL/6 mice after 8 weeksof feeding, Compound 1/Orlistat administration with HFD attenu-ated further aggravation of metabolic disturbance such as increasein weight gain, glucose intolerance. The weight as well as adipogenicdifferentiation markers PPARγ, C/EBPα and GLUT4 in epididymal fatwere reduced to levels comparable with normal chow fed mice.These results supported the fact that like in vitro experiments, com-pound 1 treatment reduced adipocyte hypertrophy and hyperplasiain vivo too.

One noted observation in Compound 1 fed group was markedreduction in circulating triglyceride level. Guidelines from the Na-tional Cholesterol Education Program and the American Heart

Fig. 5. Effects of Compound 1 on HFD-induced obesity in C57BL/6 mice. Total duration of the experimental window was 16 weeks during which C57BL/6 mice were fed onnormal diet or HFD for comparative analysis. Compound 1 or Orlistat (50 mg/kg) were gavaged orally for the last 8 weeks along with HFD diet in the treatment group. (A)Experimental outline. (B) Representative photographic images of mice from different treatment/feeding groups at the time of sacrifice. (C) Compound 1 has no significantdifference in diet intake compared with HFD alone and Orlistat treatment group. (D) Effect body weight gain: all HFD fed group showed an insignificant difference up to 8weeks, compound 1 and Orlistat treatment initiated after 56 days and show the significant body weight gain in HFD alone fed group, while compound 1 and Orlistat treatedgroups attenuate weight gain significantly. (E) OGTT was performed after an overnight fast of HFD group and normal diet (ND) group after 8 weeks of normal chow vs HFDfed groups. The baseline blood glucose level was monitored at 0 min, followed by an Oral glucose load of 2 g/kg body weight. The blood glucose levels were again checkedat 30, 60, 90, and 120 min post-glucose administration. At the end of the experimental period, OGTT Blood glucose levels, as determined by the AUC0-120. (F) OGTT per-formed after 8 week post treatment of the Compound-1 and Orlistat showing a significant decrease in treatment groups. (G) Blood serum was collected and total cholesterolvalues were estimated. Compound 1 and Orlistat significantly reduces total cholesterol compared with HFD group. (H) From above-mentioned, serum, total triglyceridevalues were estimated from all groups. Compound 1 and Orlistat show significant reduction in total triglycerides compared with only HFD fed. (I) Compound 1 and Orlistatsignificantly reduced weight of epididymal fat compared with HFD fed group. (J) HFD induced elevated Leptin/Adiponectin ratio, reduced by treatment with compound 1or Orlistat. (K) Western blots of adipogenic biomarker PPARγ, GLUT4 and C/EBPα in epididymal fat. (L) Histopathological images of liver and adipocyte in normal, HFD, andcompound 1 and orlistat treatment groups shown by H E staining. The data represented in values are expressed as means ± SEM of different treatment groups (n = 6).

Fig. 6. Schematic representation of in vitro and in vivo anti-obesity action of compound 1.



Association have identified a role for triglyceride control and di-agnosis of metabolic syndrome in the management of dyslipidemia(Oh and Lanier, 2007). Vascepa and Trilipix are FDA approved drugsin market for hypertriglyceridemia indication. Apart from these,statins, fibrates, niacin, and fish oil reduce 20–50% of triglycer-ides. Considering Compound 1 reduction of triglyceride level in HFDgroup similar to normal chow fed group, the molecule is worth ex-ploring further for its overall impact on metabolic disorders.

Histological analysis revealed a greater number of hypertro-phied cells in the epididymal adipose tissue of the HFD group, atypical sign of obese adipose tissue. Compound 1 administrationin HFD group led to modulation of size of adipocyte as observedin normal diet fed animals. Orlistat group had no noticeable reduc-tion in hypertrophied fat cell size. Histological analysis of liversections of the HFD group exhibited an accumulation of numer-ous fatty droplets, a typical sign of fatty liver strongly associatedwith obesity (Fabbrini et al., 2010). Liver sections of the Com-pound 1 treatment group display almost normal histology asobserved in normal chow fed group while Orlistat group showsmoderate effect in attenuating Steotosis. These results indicatethat administration of Compound 1 can dramatically suppresspathological sign in liver and adipose tissue.

Serum leptin level is directly proportional to visceral obesity andhas been taken as parameter of obesity assessment in several ex-perimental animal models and humans (Maffei et al., 1995; Wanget al., 2010). Clinically Leptin:Adiponectin ratio is considered as po-tential biomarker of insulin resistance as well as atherogenic indexin obese and T2D patient (Finucane et al., 2009; Satoh et al., 2004).Leptin:Adiponectin ratio was elevated dramatically in HFD fed micebut reduced in presence of Compound 1 and Orlistat treatment(Fig. 5J). Apart from this, compound 1 treatment also seems to de-crease ROS production and inflammation in adipose tissue (pleaserefer supplementary information), mechanisms that could be im-plicated in the insulin resistance and adipose tissue failure duringobesity. Our experimental results show overall beneficial in vivoeffects of Compound 1 comparable with Orlistat.

Although it is beyond the scope of this manuscript, it would beinteresting to study locomotor, metabolic and excretory param-eters. These studies would provide further mechanistic insightsregarding the abilities of compound 1 to improve these param-eters without affecting diet intake in HFD fed mice. It has beenhypothesized that adipogenesis inhibition might cause insulin re-sistance as less number of adipocytes is available to store excesslipids and glucose (Stephens, 2012). This possibility can be ruledout in this particular case, as we have observed improved glucosetolerance in HFD fed obese mice and no effect on glucose uptakein mature 3T3 L1 adipocyte (data not shown).

5. Conclusion

In summary, our studies provide the first evidence that Com-pound 1 inhibits adipogenesis in 3T3-L1 cells by blocking early MDIinduced signaling. Furthermore Compound 1 like Orlistat amelio-rates obesity, weight gain, impaired glucose tolerance, inflammatorymarkers and lipid parameters when given in-vivo (Fig. 6). Taken to-gether, earlier reported anti-dyslipidemic alongwith anti-adipogenicand anti-obesity activities observed herewith, Compound 1 is a goodtranslational lead candidate for metabolic disorders.

Acknowledgements

Research work is supported by CSIR-CDRI Network project:“Towards holistic understanding of complex diseases: Unravelingthe threads of complex disease (THUNDER, Grant: BSC0102)”.Authors acknowledge experimental support from Flow Cytometry

facility of SAIF-CDRI and Mr. P. K. Singh of CSIR-IITR. This manu-script bears CSIR-CDRI communication number: 8799.

Appendix: Supplementary material

Supplementary data to this article can be found online atdoi:10.1016/j.mce.2014.09.024.

References

Ahn, J., Lee, H., Kim, S., Ha, T., 2010. Curcumin-induced suppression of adipogenicdifferentiation is accompanied by activation of Wnt/beta-catenin signaling. Am.J. Physiol. Cell Physiol. 298, C1510–C1516.

Beg, M., Chauhan, P., Varshney, S., Shankar, K., Rajan, S., Saini, D., et al., 2013. Awithanolide coagulin-L inhibits adipogenesis modulating Wnt/beta-cateninpathway and cell cycle in mitotic clonal expansion. Phytomedicine doi:10.1016/j.phymed.2013.10.009.

Bhatta, R.S., Kumar, D., Chhonker, Y.S., Singh, S.P., Sashidhara, K.V., Jain, G.K., 2012.Simultaneous estimation of 16alpha-hydroxycleroda-3,13(14) Z-dien-15,16-olidefrom Polyalthia longifolia and its metabolite in hamster plasma: application topharmacokinetic study. Biomed. Chromatogr. 26, 559–565.

Calle, E.E., Rodriguez, C., Walker-Thurmond, K., Thun, M.J., 2003. Overweight, obesity,and mortality from cancer in a prospectively studied cohort of U.S. adults. N.Engl. J. Med. 348, 1625–1638.

Cole, K.A., Harmon, A.W., Harp, J.B., Patel, Y.M., 2004. Rb regulates C/EBPbeta-DNA-binding activity during 3T3-L1 adipogenesis. Am. J. Physiol. Cell Physiol. 286,C349–C354.

Dave, S., Kaur, N.J., Nanduri, R., Dkhar, H.K., Kumar, A., Gupta, P., 2012. Inhibition ofadipogenesis and induction of apoptosis and lipolysis by stem bromelain in3T3-L1 adipocytes. PLoS ONE 7, e30831.

Ejaz, A., Wu, D., Kwan, P., Meydani, M., 2009. Curcumin inhibits adipogenesis in 3T3-L1adipocytes and angiogenesis and obesity in C57/BL mice. J. Nutr. 139, 919–925.

Fabbrini, E., Sullivan, S., Klein, S., 2010. Obesity and nonalcoholic fatty liver disease:biochemical, metabolic, and clinical implications. Hepatology 51, 679–689.

Finucane, F.M., Luan, J., Wareham, N.J., Sharp, S.J., O’Rahilly, S., Balkau, B., et al., 2009.Correlation of the leptin:adiponectin ratio with measures of insulin resistancein non-diabetic individuals. Diabetologia 52, 2345–2349.

Gagnon, A., Lau, S., Sorisky, A., 2001. Rapamycin-sensitive phase of 3T3-L1preadipocyte differentiation after clonal expansion. J. Cell. Physiol. 189, 14–22.

Goel, A., Parihar, A., Mishra, P., Varshney, S., Nag, P., Beg, M., et al., 2013. Design andsynthesis of novel pyranone-based insulin sensitizers exhibiting in vivohepatoprotective activity. MedChemComm 4, 1532–1536.

Hishida, T., Nishizuka, M., Osada, S., Imagawa, M., 2009. The role of C/EBPdelta inthe early stages of adipogenesis. Biochimie 91, 654–657.

Hsu, C.L., Lin, Y.J., Ho, C.T., Yen, G.C., 2012. Inhibitory effects of garcinol andpterostilbene on cell proliferation and adipogenesis in 3T3-L1 cells. Food Funct.3, 49–57.

Hu, Y., Davies, G.E., 2009. Berberine increases expression of GATA-2 and GATA-3 duringinhibition of adipocyte differentiation. Phytomedicine 16, 864–873.

Hu, Y., Davies, G.E., 2010. Berberine inhibits adipogenesis in high-fat diet-inducedobesity mice. Fitoterapia 81, 358–366.

Jothy, S.L., Aziz, A., Chen, Y., Sasidharan, S., 2012. Antioxidant activity andhepatoprotective potential of polyalthia longifolia and cassia spectabilis leavesagainst paracetamol-induced liver injury. Evid. Based Complement. Alternat. Med.2012, 561284.

Jung, C.H., Kim, H., Ahn, J., Jeon, T.I., Lee, D.H., Ha, T.Y., 2013. Fisetin regulates obesityby targeting mTORC1 signaling. J. Nutr. Biochem. 24, 1547–1554.

Kanda, Y., Hinata, T., Kang, S.W., Watanabe, Y., 2011. Reactive oxygen species mediateadipocyte differentiation in mesenchymal stem cells. Life Sci. 89, 250–258.

Kawai, M., Mushiake, S., Bessho, K., Murakami, M., Namba, N., Kokubu, C., et al., 2007.Wnt/Lrp/beta-catenin signaling suppresses adipogenesis by inhibiting mutualactivation of PPARgamma and C/EBPalpha. Biochem. Biophys. Res. Commun. 363,276–282.

Kim, C.Y., Le, T.T., Chen, C., Cheng, J.X., Kim, K.H., 2011. Curcumin inhibits adipocytedifferentiation through modulation of mitotic clonal expansion. J. Nutr. Biochem.22, 910–920.

Kopelman, P.G., 2000. Obesity as a medical problem. Nature 404, 635–643.Kwon, J.Y., Seo, S.G., Yue, S., Cheng, J.X., Lee, K.W., Kim, K.H., 2012. An inhibitory effect

of resveratrol in the mitotic clonal expansion and insulin signaling pathway inthe early phase of adipogenesis. Nutr. Res. 32, 607–616.

Kwon, J.Y., Seo, S.G., Heo, Y.S., Yue, S., Cheng, J.X., Lee, K.W., et al., 2012. Piceatannol,natural polyphenolic stilbene, inhibits adipogenesis via modulation of mitoticclonal expansion and insulin receptor-dependent insulin signaling in early phaseof differentiation. J. Biol. Chem. 287, 11566–11578.

Lee, H., Lee, Y.J., Choi, H., Ko, E.H., Kim, J.W., 2009. Reactive oxygen species facilitateadipocyte differentiation by accelerating mitotic clonal expansion. J. Biol. Chem.284, 10601–10609.

Lee, H., Bae, S., Yoon, Y., 2013. The anti-adipogenic effects of (-)epigallocatechin gallateare dependent on the WNT/beta-catenin pathway. J. Nutr. Biochem. 24, 1232–1240.



Lefterova, M.I., Zhang, Y., Steger, D.J., Schupp, M., Schug, J., Cristancho, A., et al., 2008.PPARgamma and C/EBP factors orchestrate adipocyte biology via adjacent bindingon a genome-wide scale. Genes Dev. 22, 2941–2952.

Maffei, M., Halaas, J., Ravussin, E., Pratley, R.E., Lee, G.H., Zhang, Y., et al., 1995. Leptinlevels in human and rodent: measurement of plasma leptin and ob RNA in obeseand weight-reduced subjects. Nat. Med. 1, 1155–1161.

Malairajan, P., Gopalakrishnan, G., Narasimhan, S., Veni, K.J., 2008. Evalution ofanti-ulcer activity of Polyalthia longifolia (Sonn.) Thwaites in experimentalanimals. Indian J. Pharmacol. 40, 126–128.

Mandal, S., Rajani, G.P., Sharma, R.K., Gupta, N., 2012. In vitro antioxidant andanti-inflammatory potential of Polyalthia longifolia in rats. Indian J. Pharmacol.44, 277–278.

Manjula, S.N., Kenganora, M., Parihar, V.K., Kumar, S., Nayak, P.G., Kumar, N., et al.,2010. Antitumor and antioxidant activity of Polyalthia longifolia stem bark ethanolextract. Pharm. Biol. 48, 690–696.

Meydani, M., Hasan, S.T., 2010. Dietary polyphenols and obesity. Nutrients 2, 737–751.Min, S.Y., Yang, H., Seo, S.G., Shin, S.H., Chung, M.Y., Kim, J., et al., 2013. Cocoa

polyphenols suppress adipogenesis in vitro and obesity in vivo by targeting insulinreceptor. Int. J. Obes. (Lond) 37, 584–592.

Nakata, M., Nagasaka, S., Kusaka, I., Matsuoka, H., Ishibashi, S., Yada, T., 2006. Effectsof statins on the adipocyte maturation and expression of glucose transporter 4(SLC2A4): implications in glycaemic control. Diabetologia 49, 1881–1892.

Nishimura, S., Manabe, I., Nagasaki, M., Hosoya, Y., Yamashita, H., Fujita, H., et al.,2007. Adipogenesis in obesity requires close interplay between differentiatingadipocytes, stromal cells, and blood vessels. Diabetes 56, 1517–1526.

Oh, R.C., Lanier, J.B., 2007. Management of Hypertriglyceridemia. Am. Fam. Physician75, 1365–1371.

Padwal, R.S., Majumdar, S.R., 2007. Drug treatments for obesity: orlistat, sibutramine,and rimonabant. Lancet 369, 71–77.

Perobner, I., Karow, M., Jochum, M., Neth, P., 2012. LRP6 mediates Wnt/beta-cateninsignaling and regulates adipogenic differentiation in human mesenchymal stemcells. Int. J. Biochem. Cell Biol. 44, 1970–1982.

Polak, P., Cybulski, N., Feige, J.N., Auwerx, J., Ruegg, M.A., Hall, M.N., 2008. Adipose-specific knockout of raptor results in lean mice with enhanced mitochondrialrespiration. Cell Metab. 8, 399–410.

Prestwich, T.C., Macdougald, O.A., 2007. Wnt/beta-catenin signaling in adipogenesisand metabolism. Curr. Opin. Cell Biol. 19, 612–617.

Ross, S.E., Erickson, R.L., Gerin, I., DeRose, P.M., Bajnok, L., Longo, K.A., et al., 2002.Microarray analyses during adipogenesis: understanding the effects of Wntsignaling on adipogenesis and the roles of liver X receptor alpha in adipocytemetabolism. Mol. Cell. Biol. 22, 5989–5999.

Sashidhara, K.V., Singh, S.P., Srivastava, A., Puri, A., Chhonker, Y.S., Bhatta, R.S., et al.,2011. Discovery of a new class of HMG-CoA reductase inhibitor fromPolyalthia longifolia as potential lipid lowering agent. Eur. J. Med. Chem. 46,5206–5211.

Satoh, N., Naruse, M., Usui, T., Tagami, T., Suganami, T., Yamada, K., et al., 2004.Leptin-to-adiponectin ratio as a potential atherogenic index in obese type 2diabetic patients. Diabetes Care 27, 2488–2490.

Schieke, S.M., Phillips, D., McCoy, J.P., Jr., Aponte, A.M., Shen, R.F., Balaban, R.S., et al.,2006. The mammalian target of rapamycin (mTOR) pathway regulatesmitochondrial oxygen consumption and oxidative capacity. J. Biol. Chem. 281,27643–27652.

Seo, J.B., Park, S.W., Choe, S.S., Jeong, H.W., Park, J.Y., Choi, E.W., et al., 2012.Foenumoside B from Lysimachia foenum-graecum inhibits adipocytedifferentiation and obesity induced by high-fat diet. Biochem. Biophys. Res.Commun. 417, 800–806.

Sherr, C.J., Roberts, J.M., 1995. Inhibitors of mammalian G1 cyclin-dependent kinases.Genes Dev. 9, 1149–1163.

Spiegelman, B.M., Flier, J.S., 1996. Adipogenesis and obesity: rounding out the bigpicture. Cell 87, 377–389.

Stephens, J.M., 2012. The fat controller: adipocyte development. PLoS Biol. 10,e1001436.

Takahashi, S., Tamai, M., Nakajima, S., Kato, H., Johno, H., Nakamura, T., et al., 2012.Blockade of adipocyte differentiation by cordycepin. Br. J. Pharmacol. 167,561–575.

Tang, Q.Q., Lane, M.D., 2012. Adipogenesis: from stem cell to adipocyte. Annu. Rev.Biochem. 81, 715–736.

Tang, Q.Q., Otto, T.C., Lane, M.D., 2003a. CCAAT/enhancer-binding protein beta isrequired for mitotic clonal expansion during adipogenesis. Proc. Natl. Acad. Sci.U.S.A. 100, 850–855.

Tang, Q.Q., Otto, T.C., Lane, M.D., 2003b. Mitotic clonal expansion: a synchronousprocess required for adipogenesis. Proc. Natl. Acad. Sci. U.S.A. 100, 44–49.

Tormos, K.V., Anso, E., Hamanaka, R.B., Eisenbart, J., Joseph, J., Kalyanaraman, B., et al.,2011. Mitochondrial complex III ROS regulate adipocyte differentiation. CellMetab. 14, 537–544.

Varshney, S., Shankar, K., Beg, M., Balaramnavar, V.M., Mishra, S.K., Jagdale, P., et al.,2014. Rohitukine inhibits in vitro adipogenesis arresting mitotic clonalexpansionand improves dyslipidemia in vivo. J. Lipid Res. 55, 1019–1032.

Wang, G., Liu, X., Christoffel, K.K., Zhang, S., Wang, B., Liu, R., et al., 2010. Prediabetesis not all about obesity: association between plasma leptin and prediabetes inlean rural Chinese adults. Eur. J. Endocrinol. 163, 243–249.

White, U.A., Stephens, J.M., 2010. Transcriptional factors that promote formation ofwhite adipose tissue. Mol. Cell. Endocrinol. 318, 10–14.

Xiang, X., Zhao, J., Xu, G., Li, Y., Zhang, W., 2011. mTOR and the differentiation ofmesenchymal stem cells. Acta Biochim. Biophys. Sin. (Shanghai) 43, 501–510.

Yeh, W.C., Cao, Z., Classon, M., McKnight, S.L., 1995. Cascade regulation of terminaladipocyte differentiation by three members of the C/EBP family of leucine zipperproteins. Genes Dev. 9, 168–181.

Yu, W., Chen, Z., Zhang, J., Zhang, L., Ke, H., Huang, L., et al., 2008. Critical role ofphosphoinositide 3-kinase cascade in adipogenesis of human mesenchymal stemcells. Mol. Cell. Biochem. 310, 11–18.

Zhang, H.H., Huang, J., Duvel, K., Boback, B., Wu, S., Squillace, R.M., et al., 2009. Insulinstimulates adipogenesis through the Akt-TSC2-mTORC1 pathway. PLoS ONE 4,e6189.


A clerodane diterpene inhibit adipogenesis by cell cycle arrest and ameliorate obesity in C57BL/6 mice

Documents