45 Supplementary Materials: Supplemental Material 831 Table S1. B. subtilis strains and plasmids 832 833 834 Strain or plasmid Relevant genotype or characteristics Source or reference B. subtilis strains JH642 trpC2 pheA1(parental strain) James Hoch MH5636 trpC2 pheA1 rpoC-His10 cat (41) ORB3834 trpC2 pheA1 spx::neo (30) ORB5853 trpC2 pheA1 sigA(L366A) neo rpoC-His10 cat This study ORB6122 trpC2 pheA1 rpoA(Y263A) rpoC-His10 cat This study ORB7276 trpC2 pheA1 spx::neo thrC::pDYR9(trxB-lacZ) amyE::pSN56(Pspankhy-spx DD ) (32) ORB7843 trpC2 pheA1 spx::neo thrC::pDYR9(trxB-lacZ) amyE::pAL45(Pspankhy-spxCHA) This study ORB7844 trpC2 pheA1 spx::neo thrC::pDYR9(trxB-lacZ) amyE::pAL50 (Pspankhy-spxcMyc) This study ORB7850 trpC2 pheA1 spx::neo amyE::pDR111 This study ORB7852 trpC2 pheA1 spx::neo yjbH::tetforward This study ORB7857 trpC2 pheA1 spx::neo amyE::pAL45(Pspankhy-spxCHA) This study ORB7858 trpC2 pheA1 spx::neo amyE::pAL50(Pspankhy-spxcMyc) This study ORB7865 trpC2 pheA1 spx::neo yjbH::tetforward thrC::pDYR9(trxB-lacZ) amyE::pSN56(Pspankhy-spx DD ) This study ORB7868 trpC2 pheA1 spx::neo yjbH::tetforward thrC::pDYR9(trxB-lacZ) amyE::pAL45(Pspankhy-spxCHA) This study ORB7869 trpC2 pheA1 spx::neo yjbH::tetforward thrC::pDYR9(trxB-lacZ) amyE::pAL50(Pspankhy-spxcMyc) This study ORB8094 trpC2 pheA1 rpoA(Y263A) rpoC-His10 cat sigA(L366A) This study ORB8121 trpC2 pheA1 amyE::pAL45(Pspankhy-spxCHA) This study ORB8129 trpC2 pheA1 rpoC-His10 cat amyE::pAL45(Pspankhy-spxCHA) This study ORB8130 trpC2 pheA1 rpoC-His10 cat spx::pAL81 (spxC-neo) amyE::pAL45(Pspankhy- spxCHA) This study Plasmids pAL39 pUC18 with cMyc tag This study pAL40 pUC18 with HA tag This study pAL42 pUC18 with spxCHA This study pAL45 pDR111 with spxCHA This study pAL46 pTYB4 with spxCHA This study pAL47 pUC18 with spxcMyc This study pAL50 pDR111 with spxcMyc This study pAL51 pTYB4 with spxcMyc This study pAL73 pTYB4 with spx C10A CHA This study pAL74 pTYB4 with spx G52R CHA This study pAL75 pTYB4 with spx R60E CHA This study
14
Embed
831 Supplementary Materials: Supplemental Material · 45 831 Supplementary Materials: Supplemental Material 832 Table S1. B. subtilis strains and plasmids 833 834 Strain or plasmid
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
45
Supplementary Materials: Supplemental Material 831
Table S1. B. subtilis strains and plasmids 832 833 834 Strain or plasmid
Relevant genotype or characteristics Source or reference
B. subtilis strains JH642 trpC2 pheA1(parental strain) James Hoch MH5636 trpC2 pheA1 rpoC-His10 cat (41) ORB3834 trpC2 pheA1 spx::neo (30)
ORB5853 trpC2 pheA1 sigA(L366A) neo rpoC-His10 cat This study ORB6122 trpC2 pheA1 rpoA(Y263A) rpoC-His10 cat This study
Plasmids pAL39 pUC18 with cMyc tag This study pAL40 pUC18 with HA tag This study pAL42 pUC18 with spx CHA This study pAL45 pDR111 with spx CHA This study pAL46 pTYB4 with spx CHA This study pAL47 pUC18 with spxcMyc This study pAL50 pDR111 with spxcMyc This study pAL51 pTYB4 with spxcMyc This study pAL73 pTYB4 with spxC10A CHA This study pAL74 pTYB4 with spxG52R CHA This study pAL75 pTYB4 with spxR60E CHA This study
46
pAL78 pUC19 with spx upstream chromosomal region and spx C
This study
pAL79 pUC19 with spx downstream chromosomal region This study pAL80 pUC19 with spx upstream chromosomal region,
spx C, and neo This study
pAL81 pUC19 with spx upstream chromosomal region, spx C, neo, and downstream sequence
This study
PDG783(ECE94) vector with KmR(NeoR) cassette (13) pDG793 thrC integration vector with promoter-less lacZ
reporter (12)
pDR111 amyE integration vector with Pspankhy promoter (3) pDYR9 pDG793 with trxB(-115~+47)-lacZ (45) pMMN470 pTYB4 with spx (34)
pSN56 pDR111 with with spxDD (36)
pSN64 pTYB4 with sigA (29) pTYB4 E. coli expression vector for IMPACTTM system New England
BioRads pUC18 cloning vector pUC19 cloning vector
835 836 837 838 839 840 841 Table S2. oligonucleotides used in this study 842 oligonucleotide Sequence purpose oAL29 CGCGGATCCGAGCAGAAATTAATATCAGAAGAGGATTTGTA