THE ROLE OF ARABIDOPSIS AND TOMATO PHYTOHORMONES …ufdcimages.uflib.ufl.edu/UF/E0/00/73/81/00001/block_a.pdf · 2010. 5. 1. · three phytohormones are also involved in the response
Post on 01-May-2021
2 Views
Preview:
Transcript
THE ROLE OF ARABIDOPSIS AND TOMATO PHYTOHORMONES IN THERESPONSE TO BACTERIAL PATHOGENS
By
ANNA KATHERINE BLOCK
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOLOF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OFDOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
2004
Copyright 2004
by
Anna Katherine Block
This thesis is dedicated to my family who support me without question, no matter howunusual they think my choices are.
iv
ACKNOWLEDGMENTS
This work was supported in part by a grant to Harry Klee from the National
Science Foundation (IBN0091064) and the Florida Agricultural Experiment Station. I
thank my advisor Harry Klee and my committee members Jeffrey Jones, John Davis and
Shouguang Jin for their guidance; Eric Schmelz for the measurement of the
phytohormones by GC-MS; the Klee lab for its support and advice; the Jones lab for the
use of its greenhouse and help in tomato plant maintenance and the Settles lab for use of
Arabidopsis growth facilities and other equipment.
v
TABLE OF CONTENTSPage
ACKNOWLEDGMENTS .............................................................................................. iv
LIST OF TABLES ........................................................................................................vii
LIST OF FIGURES......................................................................................................viii
ABSTRACT....................................................................................................................x
CHAPTER
1 INTRODUCTION....................................................................................................1
Plant-Pathogen Interactions ......................................................................................1Pathogenesis-Related (PR) Genes.............................................................................2Bacterial Pathogens ..................................................................................................3The Role of Salicylic Acid in Arabidopsis Defense Responses .................................4The Role of Ethylene in Arabidopsis Defense Responses..........................................7The Role of Jasmonates in Arabidopsis ....................................................................7The Interaction of Tomato and Xcv ...........................................................................8Symptom Development and Systemic Responses in Tomato .................................. 12
2 THE EFFECT OF THE REMOVAL OF SA ON PHYTOHORMONE SIGNALINGNETWORKS IN ARABIDOPSIS INFECTED WITH VIRULENT PST ................ 14
Differences in Disease Progression and Symptom Development in Salicyclic Acid-Deficient Arabidopsis Mutants infected with Pst................................................ 14
SA and Jasmonate Induction in Response to Pst Infection ...................................... 17The Effect of Coronatine Production by Pst ............................................................ 19The Role of Ethylene in SA-Deficient Arabidopsis................................................. 22Discussion.............................................................................................................. 23
3 SYSTEMIC ACQUIRED TOLERANCE IN TOMATO......................................... 28
Introduction............................................................................................................ 28Virulent and Avirulent Xcv Led to Systemic Acquired Tolerance in Tomato........... 31Prior Inoculation with Xcv Led to an Early Production of Ethylene upon Challenge
with Virulent Xcv ............................................................................................... 34
vi
PR Gene Expression Indicated the Necessity of Ethylene and SA in Systemic SignalGeneration. ........................................................................................................ 37
Avirulent Xcv Induced Greater Local and Systemic PR Gene Expression thanVirulent Xcv, but they Result in Similar PR Gene Induction During Challenge .. 39
Discussion.............................................................................................................. 40
4 DISCUSSION ........................................................................................................ 46
Phytohormone Networks in the Responses of Tomato and Arabidopsis to VirulentBacterial Pathogens............................................................................................ 46
The Compatible Tomato-Virulent Xcv Interaction................................................... 48The Compatible Arabidopsis-Virulent Pst Interaction............................................. 49Systemic Responses to Infection............................................................................. 51
5 MATERIALS AND METHODS............................................................................ 53
Plant Materials and Treatments............................................................................... 53Bacterial Culture .................................................................................................... 54Ion Leakage............................................................................................................ 54Ethylene Measurements.......................................................................................... 55SA, Jasmonate and Coronatine Measurements ........................................................ 55RNA Extraction...................................................................................................... 55RNA Gel Blot Analysis .......................................................................................... 56Real-time RT-PCR ................................................................................................. 56MCP Treatment...................................................................................................... 57
LIST OF REFERENCES............................................................................................... 58
BIOGRAPHICAL SKETCH ......................................................................................... 66
vii
LIST OF TABLES
Table page
4-1 Comparative phenotypes of phytohormone mutants in Arabidopsis and tomato.. .... 47
4-2 Comparative phytohormone profiles of Arabidopsis and tomato mutants ............... 47
viii
LIST OF FIGURES
Figure page
1-1 The role of sid2 in SA biosynthesis and nahG in SA removal ...................................6
1-2 Jasmonate biosynthesis.............................................................................................9
1-3 The structure of coronatine..................................................................................... 10
1-4 Ethylene biosynthesis ............................................................................................. 11
2-1 Bacterial growth in Pst DC3000 infected Arabidopsis ............................................ 15
2-2 PR1 and PDF1.2 gene expression in Pst infected Arabidopsis ................................ 16
2-3 SA production in Pst infected Arabidopsis ............................................................. 17
2-4 JA and OPDA production in Pst infected Arabidopsis ............................................ 18
2-5 Coronatine production in Pst infected Arabidopsis ................................................. 19
2-6 Bacterial growth at 72 hpi in Pst DC3000 and Pst DC3661infected Arabidopsis .... 20
2-7 Disease symptom development in Pst infected Arabidopsis .................................... 21
2-8 Ethylene production in Pst infected Arabidopsis..................................................... 23
3-1 Symptom development of Xcv infected tomato ....................................................... 31
3-2 Cell death due to a second infection of tomato with virulent Xcv.. .......................... 32
3-3 Bacterial growth during the first and second infections of tomato with Xcv. ........... 33
3-4 Local ethylene and SA production during the first and second infections of tomatowith Xcv. .............................................................................................................. 35
3-5 Local and systemic PR gene induction in ethylene and SA deficient tomato lines inresponse to infection with virulent Xcv ................................................................. 38
3-6 The measurement of local and systemic PR gene expression in tomato duringinfections with virulent or avirulent Xcv ............................................................... 41
ix
3-7 Induction of PR genes during virulent Xcv infection in tomato plants in the presenceor absence of SAT................................................................................................ 42
4-1 A model for the signaling network in tomato in response to virulent Xcv ................ 49
x
Abstract of Dissertation Presented to the Graduate Schoolof the University of Florida in Partial Fulfillment of theRequirements for the Degree of Doctor of Philosophy
THE ROLE OF ARABIDOPSIS AND TOMATO PHYTOHORMONES IN THERESPONSE TO BACTERIAL PATHOGENS
By
Anna Katherine Block
December 2004
Chair: Harry KleeMajor Department: Plant Molecular and Cellular Biology
Phytohormone networks are used to regulate the plant response to virulent bacterial
pathogens. In this work by the use of salicylic acid (SA) deficient lines it is shown that
SA, a major player in the interaction between Arabidopsis and virulent Pseudomonas
syringae pv. tomato (Pst), down-regulates ethylene and jasmonates. SA influences
ethylene production in an NPR1-independent manner and jasmonate production in an
NPR1-dependent manner. Pst-produced coronatine, a jasmonate mimic, acts
independently of SA and does not compromise SA-dependent basal resistance. These
three phytohormones are also involved in the response of tomato to Xanthomonas
campestris pv. vesicatoria (Xcv). However, the hormone network is dramatically
different to that of Arabidopsis. It is demonstrated, by the use of phytohormone deficient
plants and pathogenesis-related marker gene expression profiling, that a systemic signal
is generated in tomato in response to an infection with virulent Xcv. This signal is SA-
dependent and leads to the development of a systemic acquired tolerance in tomato to
xi
subsequent infections with virulent Xcv. This systemic acquired tolerance is similar to the
systemic response that is generated in response to avirulent Xcv.
1
CHAPTER 1INTRODUCTION
Plant-Pathogen Interactions
The normal growth of a plant can be disrupted due to interactions with pathogenic
organisms such as bacteria, fungi, parasitic higher plants, nematodes, mycoplasmas and
viruses. Pathogens live in or on another organism, from which they derive nutrients.
Substances released by the pathogen, in order to penetrate plant cell walls and make the
nutrients accessible for their use, cause damage to the host tissues. These substances
include enzymes, toxins, growth regulators and polysaccharides, some of which are
induced upon host recognition.
Not all pathogens can cause disease on all hosts as some lack the necessary abilities
to penetrate and survive that host’s endogenous structural and chemical defenses. The
host range of a pathogen is defined as the host plants on which a particular pathogen can
recognize and grow successfully (Agrios, 1988).
Resistant hosts can specifically recognize avirulent pathogens and cause an
incompatible interaction. Incompatible interactions often include a hypersensitive
response HR that consists of a rapid induction of host defenses and the death of cells in
contact with the pathogen. The faster this response occurs, the more resistant the plant is
to the pathogen. Compatible interactions occur between susceptible plants and virulent
pathogens, leading to successful invasion of host tissues (Ausubel et al., 1995;
Hammond-Kosack and Jones, 1996).
2
In both compatible and incompatible interactions the plant attempts to limit damage
and control pathogen growth. This is done by the production of toxic substances around
the site of injury, as well as by the formation of protective layers such as callus and cork.
Some compounds are produced at high enough concentrations to limit pathogen growth.
These compounds include phenolic compounds such as chlorogenic and caffic acids,
oxidation products of phenolic compounds and phytoalexins (Agrios, 1988; Jackson and
Taylor, 1996).
Pathogenesis-Related (PR) Genes
As well as the production of substances and structures, several plant genes are
induced in response to pathogens. PR genes are used as markers of the disease response
in many plant species. They are defined as plant-encoded genes that are only expressed in
the tissue in response to a pathogen or related stress. PR genes are classified by function
and homology; these classes include PR-2 (β-1,3-glucanase), PR-6 (proteinase-inhibitor),
PR-12 (defensin) and PR-1 whose function is unknown (Van Loon and Van Strien,
1999).
Although PR genes are induced during infection, only a few have been shown to
have a direct impact on pathogen growth. The most well characterized of these is the PR-
1 family that has antifungal activities, although the mechanism by which it acts has yet to
be identified (Alexander et al., 1993; Niderman et al., 1995). The combined effect of
many PR gene products may be required to have a significant effect on pathogen growth.
Particular classes of PR genes have been linked to specific phytohormone induction
events. For example the PR gene Thi 2.1 of Arabidopsis is induced during wounding in a
jasmonate dependent manner (Bohlmann et al., 1998). The phytohormones, however,
3
affect one another to such an extent that any direct interpretation of the roles of
phytohormones from PR gene expression is inherently risky.
The responses covered so far are induced at a local level by pathogen infection. The
plant, however, also shows a systemic response to infection that includes some of the
same response as those at the local level. For example pathogen infection can lead to the
production of a systemic signal. This signal can induce resistance in uninfected tissues of
the plant 2-3 days after infection. It can also induce the systemic expression of PR genes.
This systemic induced resistance (SAR) can last several weeks and is effective against a
wide range of normally virulent pathogens.
Bacterial Pathogens
The response to pathogens varies depending on the host-pathogen interaction. To
simplify the study of plant pathogen interactions the focus of this work will be limited to
bacterial pathogens, specifically to Xanthomonas and Pseudomonas. These are
necrotizing biotrophic pathogens that live within the apoplast. They can multiply for
some time within host tissues before causing necrosis. They use a type III secretion
system to introduce substances into host cells that cause the release of nutrients and
suppress host defense responses. They also produce toxins and other extracelluar
substances, which affect the plant and cause disease symptom development (Alfano and
Collmer, 1996).
Xanthomonas and Pseudomonas are rod shaped gram negative bacteria of the
family pseudomonadaceae. They use flagella to move through liquid and can enter host
tissues from water on the surface of the tissue. For example they can enter the leaves
through wounds or stomatal openings. The symptoms these bacteria cause include the
4
formation of necrotic lesions on infected tissues. These lesions are sometimes surrounded
by a chlorotic halo. The necrotic lesions may coalesce and form large necrotic regions or
even kill the entire tissue.
Bacterial species can be further subdivided into subspecies or pathovars (pv),
which are distinguished by their host range. The two pathogens this work will focus on
are Pseudomonas syringae pv. tomato (Pst) that causes bacterial speck both in tomato
and in the model plant Arabidopsis and Xanthomonas campestris pv vesicatoria (Xcv)
that causes bacterial spot in tomato and pepper (Agrios, 1988).
Many of the plant responses to pathogens have been characterized. However, how
the plant forms and coordinates its defense response has yet to be fully elucidated
(Glazebrook, 2001). One of the major tools in such studies is mutant screening for plants
altered in their pathogen responses. The screens focus either on disease phenotype or on
PR gene induction with the plant Arabidopsis thaliana as a favored model (Glazebrook et
al., 1997). These screens have identified mutants that are compromised in their resistance
to avirulent pathogens. Some of these mutants also show enhanced susceptibility to
virulent pathogens and thus demonstrate the existence of a basal resistance, in which the
plant limits the growth of virulent pathogens (Glazebrook et al., 1996). Such mutants
often also have altered phytohormone profiles, indicating important roles for
phytohormones in coordinating the defense responses to both virulent and avirulent
pathogens (Dewdney et al., 2000; Nawrath et al., 2002).
The Role of Salicylic Acid in Arabidopsis Defense Responses
The phytohormone salicylic acid (SA) is involved in maintenance of basal
resistance, the response to avirulent pathogens and development of SAR in Arabidopsis.
5
Mutants that show enhanced susceptibility to virulent pathogens such as Pst DC3000
often accumulate less SA than their wild type parents following infection. For example
pad4, which has enhanced susceptibility to virulent Pseudomonas syringae pv maculicola
ES4326 (Psm), has reduced and delayed SA synthesis (Zhou et al., 1998).
In several plant species the removal of SA has been accomplished by introduction
of the nahG transgene encoding a Pseudomonas putida salicylate hydroxylase (EC
1.14.13.1), which converts SA into catechol (Yamamoto et al., 1965). Arabidopsis plants
carrying this transgene have enhanced susceptibility to several pathogens including Pst
(Delaney et al., 1994; Lawton et al., 1995).
An Arabidopsis SA biosynthesis mutant, sid2-2, that fails to accumulate SA in
response to pathogens has also been identified. This line contains a loss of function
mutation in the enzyme isochorismate synthase 1 (EC 5.4.4.2) that converts chorismate to
isochorismate (Figure 1-1) (Wildermuth et al., 2001). sid2-2 has both enhanced
susceptibility to Pst and fails to accumulate SA in response to infection (Nawrath and
Metraux, 1999).
NahG and sid2-2 respond differently to the non-host pathogen Pseudomonas
syringae pv. phaseolicola strain 3121, suggesting that the catechol produced by the nahG
transgene may influence the disease process (Van Wees and Glazebrook, 2003). The
conclusion that nahG has an effect beyond elimination of SA is further supported by
global expression phenotyping of Arabidopsis in response to infection by virulent Psm
(Glazebrook et al., 2003). This showed major differences between NahG and sid2-2 in
terms of the expression patterns of genes induced in the two lines by infection with Psm.
6
Figure 1-1 .The role of sid2 in SA biosynthesis and nahG in SA removal.
Signal transduction from SA can occur in an NPR1-dependent or independent
fashion (Clarke et al., 1998). NPR1 is a protein with a BTB/BOZ domain and an ankyrin
repeat domain, both of which are involved in protein-protein interactions (Cao et al.,
1997). Upon infection NPR1 is translocated to the nucleus where it interacts with bZIP
transcription factors that are involved in the SA-dependent activation of PR genes
(Despres et al., 2000). NPR1 also has a role in suppressing jasmonate signaling in the
cytoplasm (Spoel et al., 2003). However, nuclear localization of NPR1 is required for PR
7
gene expression (Kinkema et al., 2000). The loss of function mutant npr1-1 has enhanced
susceptibility to virulent Pseudomonas syringae and has reduced expression of PR genes
after infection (Cao et al., 1994).
The Role of Ethylene in Arabidopsis Defense Responses
The major role of SA in basal resistance is demonstrated by SA-deficient
Arabidopsis that are more susceptible to the virulent pathogen Pst. Acting either
agonistically or antagonistically to SA in these interactions are other phytohormones such
as ethylene and jasmonic acid (JA). For example, the Arabidopsis ethylene insensitive
mutant etr1-1 has faster disease progression than wild type plants in response to virulent
Xanthomonas campestris pv. campestris (Xcc). This suggests that ethylene negatively
regulates disease symptom development in this system. However, NahG is deficient in
ethylene production following Xcc infection, suggesting that these two phytohormones
act agonistically in this response (O'Donnell et al., 2003). The loss of ethylene in NahG is
not supported by sid2-2, which was shown to accumulate ethylene in response to
infection with Pst (Heck et al., 2003). Thus, the failure to produce ethylene in pathogen
infected NahG Arabidopsis may be a specific consequence of the nahG transgene and not
due to the failure to accumulate SA.
The Role of Jasmonates in Arabidopsis
Two Arabidopsis mutants that are SA-deficient, eds4 and pad4, have increased
sensitivity to compounds that induce the expression of JA response genes (Gupta et al.,
2000), and NahG and sid2 produce higher levels of JA in response to infection with Pst
than does Columbia (Heck et al., 2003; Spoel et al., 2003). JA is produced from alpha-
linolenic acid via the active precursor 12-oxo-phytodieonic acid (OPDA). It can also be
converted into the volatile compound methyl-jasmonate (Figure 1-2). These two
8
compounds, in addition to JA and other oxylipins, are commonly referred to as
jasmonates (Seo et al., 2001; Stintzi et al., 2001). Currently, little is known about the
roles of individual jasmonates in pathogen defense.
The evidence for a role for jasmonates in compromising the basal resistance of
Arabidopsis to Pst is further supported by the involvement of Pst-produced coronatine.
Coronatine is a phytotoxin that mimics OPDA (Weiler et al., 1994) (Figure 1-3). A Tn5
transposon insertion into Pst DC3000 produced a coronatine-deficient Pst mutant, Pst
DC3661 (Moore, 1989). This mutant strain was shown to be less virulent than Pst
DC3000 in Arabidopsis in dip infections but not in injection inoculations. However, the
disease symptoms in both forms of infection were reduced when compared to the parental
strain (Mittal and Davis, 1995).
The hypothesis that coronatine is an important virulence factor for Pst is reinforced
by studies with the Arabidopsis coronatine insensitive mutant coi1 (Feys et al., 1994).
COI1 is part of an E3 ubiquitin-ligase involved in a jasmonate response pathway (Xie et
al., 1998). The coi1 mutants are both more resistant to Pst DC3000 and have higher SA
levels (Kloek et al., 2001). These data along with similar studies in tomato (Zhao et al.,
2003) suggest that coronatine acts by stimulating the jasmonate-signaling pathway.
The Interaction of Tomato and Xcv
Not all plants use phytohormones in the same way in their defense responses. In
tomato phytohormones are involved in the response to both virulent and avirulent Xcv. In
the response to virulent Xcv, there is an induction of ethylene followed by accumulation
of SA.
9
Figure 1-2 Jasmonate biosynthesis.
10
Figure 1-3 The structure of coronatine.
SA production in this response is dependent on the previous production of ethylene
(O'Donnell et al., 2001), and both are dependent on the ability of the plant to produce
jasmonates.
Antisense plants for the jasmonate biosynthesis enzyme allene oxide synthase (as-
AOS) are resistant to virulent Xcv and show no production of either ethylene or SA
(O'Donnell et al., 2003). Transgenic tomato plants that express 1-aminocyclopropane-1-
carboxylate (ACC) deaminase (ACD) (EC 3.5.99.7) (Figure 1-4) do not produce ethylene
and are compromised in SA induction during infection. NahG plants, which do not
produce SA, have normal ethylene production. Both ACD and NahG are tolerant to
virulent Xcv and unaffected in their ability to produce jasmonates (O'Donnell et al.,
2003).
The tolerance of a plant to a pathogen can be defined as substantial growth of the
pathogen within the host tissues combined with an absence of full symptom development.
Another plant that is compromised in phytohormone signaling and shows tolerance is the
ethylene insensitive (ein2) mutant of Arabidopsis. It is tolerant to both Pst and Xcc (Bent
et al., 1992).
11
Figure 1-4 Ethylene biosynthesis.
12
The response of tomato to avirulent Xcv also involves phytohormone induction.
There is a major early induction of ethylene that is larger than that seen in the susceptible
response. There is also an early induction of SA. Increased ethylene sensitivity in tomato
caused by reduced expression of an ethylene receptor LeETR4 enhances the
hypersensitive response to avirulent Xcv (Ciardi et al., 2001). This demonstrates that
ethylene is also important in the response to avirulent pathogens.
Symptom Development and Systemic Responses in Tomato
Symptom development in tomato infected with Xcv can be categorized into two
stages. The primary response present in resistant, susceptible and tolerant interactions
consists of localized lesion formation. The secondary phenotype, which is only present in
the susceptible response, consists of the development of chlorosis and necrosis that
spreads from the sites of the primary lesions (O'Donnell et al., 2003).
Perhaps there is an advantage for the plant to produce these phytohormones and the
consequent chlorosis and necrosis development in response to virulent infections. In
addition to the necrosis of the tissue effectively removing the pathogen from the plant, it
is possible that this response produces a systemic signal that primes the plant’s defenses
in case of repeat infections. It has been demonstrated in several systems, including
tobacco and cucumber that infections with virulent pathogens that produce high levels of
necrosis can lead to the induction of SAR (Cohen and Kuc, 1981; Strobel et al., 1996).
Therefore the phytohormones induced during the interaction with virulent Xcv and
tomato may be involved in the development of SAR and this could be the reason why
they remain even though their absence would lead to tolerance. SAR is induced in tomato
13
by tobacco necrosis virus (TNV) (Jeun et al., 2000) and Phytophthora infestans (Enkerli
et al., 1993) and leads to resistance to P. infestans.
Here two different aspects of phytohormone signaling in response to infections
with virulent bacterial pathogens are studied. The first, in chapter 2, investigates the
effect of the removal of SA accumulation on the synthesis of ethylene and jasmonates
during the interaction between Pst and Arabidopsis. This chapter focuses on
phytohormone networks in the local response to infection. The second, in chapter 3, is on
the interaction between tomato and Xcv. In this chapter the focus is the systemic response
to virulent bacterial infection and the possible roles of phytohormones in this response.
Although in both cases the focus is on the role of phytohormones in response to
pathogens, it can clearly be seen that the phytohormones play different roles in the two
systems and therefore information gained from studying one plant-pathogen interaction is
not necessarily applicable to another.
14
CHAPTER 2THE EFFECT OF THE REMOVAL OF SA ON PHYTOHORMONE SIGNALING
NETWORKS IN ARABIDOPSIS INFECTED WITH VIRULENT PST
Differences in Disease Progression and Symptom Development in Salicyclic Acid-Deficient Arabidopsis Mutants infected with Pst
Phytohormones do not act in a discrete fashion. The action often attributed to one
phytohormone can be due to the combined action of several. SA plays an important role
in the basal resistance of Arabidopsis to virulent Pst. However, it is not the only
phytohormone induced in response to Pst. Ethylene and jasmonates are also induced in
this response. The aim of this chapter is to determine the effect of removing SA on the
phytohormone-signaling network in Arabidopsis in response to virulent Pst. This will
provide a clearer resolution of the complex relationships between the signaling pathways
in this system.
As a first step into understanding the effect of altered SA production or signaling,
levels of basal resistance and the disease phenotypes in four different lines were
compared. These lines are the SA biosynthesis mutant sid2-2, the SA signaling mutant
npr1-1 and the transgenic line NahG that cannot accumulate SA. The infection of
Columbia (wild type), npr1-1, sid2-2 and NahG plants with virulent Pst led to differential
bacterial growth and disease phenotypes in the four lines.
NahG supported significantly more bacterial growth than the other lines (Figure 2-
1). The mutants sid2-2 and npr1-1 had bacterial growth that was intermediate between
NahG and the wild type. The sid2-2 mutant is a better model for the loss of SA
production than NahG due to the side effects of catechol production (Heck et al., 2003).
15
Therefore, as sid2-2 supports the same levels of bacterial growth as npr1-1, this
demonstrates that the effect of SA on basal resistance is NPR1-dependent (Figure 2-1).
The development of disease symptoms showed further differences between the four
lines. Columbia exhibited patchy chlorosis at 48 h post infection (hpi). These patches
coalesced at 96 hpi. NahG showed the most severe symptom development, with
widespread chlorosis followed by complete tissue collapse at 96 hpi. The sid2-2 mutant
exhibited less severe symptoms than NahG, with widespread chlorosis and necrosis at 96
hpi although it lacked the complete tissue collapse of NahG. The npr1-1 mutant
developed chlorosis but not necrosis and had an intermediate phenotype between
Columbia and sid2-2. These data demonstrate that although sid2-2 and npr1-1 showed
the same level of basal resistance, sid2-2 exhibited necrosis and tissue collapse that did
not occur in npr1-1 under these conditions. This result indicates that the effect of SA on
repressing necrosis and tissue collapse is NPR1-independent.
Figure 2-1 Bacterial growth in Pst DC3000 infected Arabidopsis. Columbia, npr1-1,sid2-2 and NahG were dip infected with Pst DC3000. Colony forming unitsper square centimeter were determined at the time points indicated.
16
The expression of the PR genes PR1 and PDF 1.2 was monitored during disease
progression in all four lines. PR1 was induced in Columbia and slightly induced at 96 hpi
in npr1-1 but was not induced in the SA-deficient lines. PDF1.2 was induced to a similar
extent in all lines upon pathogen infection (Figure 2-2). The reduction in PR1 gene
expression in NahG and sid2-2 is consistent with that seen upon infection with avirulent
Pst (Nawrath and Metraux, 1999) and the loss of localized expression of PR genes in
npr1-1 as demonstrated by Cao et al. (1994). Consistent with my findings, PDF1.2
expression was unaltered in NahG and sid2-2, when compared to wildtype, in response to
infection with Alternaria brassicicola (Nawrath and Metraux, 1999).
Figure 2-2 PR1 and PDF1.2 gene expression in Pst infected Arabidopsis. Total RNA wasextracted from Columbia, npr1-1, sid2-2 and NahG plants dip infected withPst DC3000. Northern blot analysis was performed with 32P labeled PR1 andPDF1.2 on plants that were mock inoculated, or 48 and 96 hours postinfection.
17
SA and Jasmonate Induction in Response to Pst Infection
The study of the effect of removal of SA accumulation or perception on the
induction of other hormones was the focus of this chapter. Therefore the pattern of SA
induction in the different lines was confirmed. SA levels increased during infection in the
Columbia and npr1-1 lines, with npr1-1 accumulating significantly more SA than
Columbia. This is consistent with the results of Clarke et al. (2000), who demonstrated
that npr1-1 produces more SA than Columbia. SA remained at a low level in NahG and
sid2-2 consistent with the findings of Nawrath and Metraux (1999) (Figure 2-3).
Figure 2-3 SA production in Pst infected Arabidopsis. Columbia, npr1-1, sid2-2 andNahG dip infected with Pst DC3000. SA was measured at the time pointsindicated.
The jasmonate response of a plant can be described in terms of an oxylipin
signature consisting of different forms of JA and its precursors (Kramell et al., 2000). To
partially characterize this oxylipin signature in Arabidopsis infected with Pst, the
induction of jasmonic acid (JA) and its active precursor 12-oxo-phytodienoic acid
(OPDA) was measured. Both JA and OPDA were induced in all four lines. The highest
amounts of induction were observed in NahG and sid2-2, followed by npr1-1 with
18
Columbia producing the lowest amounts of these jasmonates (Figure 2-4). It has been
demonstrated by Heck et al. (2003) that Pst infection leads to higher JA levels in sid2-2
and NahG than in wild type Arabidopsis. Here, it can be seen that OPDA follows the
profile of JA expression and jasmonate production in npr1-1 is intermediate between
those of the SA-deficient lines and wild type.
Figure 2-4 JA and OPDA production in Pst infected Arabidopsis. Columbia, npr1-1,sid2-2 and NahG were dip infected with Pst DC3000. The amount of (A) JAand (B) OPDA was quantified at the time points indicated.
19
The Effect of Coronatine Production by Pst
Jasmonate accumulation was higher in Arabidopsis that showed enhanced
susceptibility due to SA-deficiency. Therefore, jasmonate signaling may also reduce
defense responses. Pst produces the phytotoxin coronatine that is a mimic of OPDA and
may act by stimulating jasmonate responses (Weiler et al., 1994). The total jasmonate
response consists of jasmonates and coronatine. Therefore, coronatine accumulation
during infection in the different lines was measured. NahG had a significantly higher
level of coronatine accumulation than sid2-2, npr1-1 and Columbia (Figure 2-5).
Figure 2-5 Coronatine production in Pst infected Arabidopsis. Columbia, npr1-1, sid2-2and NahG were dip infected with Pst DC3000. Coronatine was measured atthe time points indicated.
Coronatine’s action as a virulence factor may utilize the jasmonate response
pathways to repress SA. To investigate if coronatine’s action is SA-dependent, SA-
deficient lines were infected with Pst DC3661. Pst DC3661 is a Tn5 mutant that is
disrupted in its ability to produce coronatine (Mittal and Davis, 1995). Bacterial growth
was reduced by a factor of ten in all lines infected with Pst DC3661 compared to those
20
infected with Pst DC3000 but the relative differences in susceptibility between the
Arabidopsis lines remained (Figure 2-6).
Figure 2-6 Bacterial growth at 72 hpi in Pst DC3000 and Pst DC3661 infectedArabidopsis. Columbia, npr1-1, sid2-2 and NahG were dip infected with Pst.The amount of bacteria in the tissues was determined at the time pointsindicated.
Disease symptom development was also reduced in all lines infected with Pst
DC3661 when compared to those infected with Pst DC3000 (Figure 2-7). However, the
comparative severity of the disease in the different lines remained the same. These results
were confirmed with an additional coronatine-deficient Pst mutant, Pst DC3118 (Moore,
1989; Ma et al., 1991). These data demonstrate that coronatine’s action is independent of
SA, as coronatine-deficiency still reduced virulence on SA-deficient lines. These data
indicate that the JA and SA pathways act in an independent manner in the control of basal
resistance.
21
Figure 2-7 Disease symptom development in Pst infected Arabidopsis. Columbia, npr1-1, sid2-2 and NahG plants were dip infected with wild type Pst (DC3000) orcoronatine-deficient Pst (DC3661). Photographs were taken 96 hpi.
22
The Role of Ethylene in SA-Deficient Arabidopsis
Recent work has demonstrated that the catechol produced by NahG has side effects
in the NahG plant that are not due to the loss of SA (Heck et al., 2003). NahG had been
used to demonstrate an agonistic relationship between SA and ethylene in the interaction
between Arabidopsis and Xcc (O'Donnell et al., 2003). To verify this relationship in sid2-
2 and to investigate the role of NPR1 in this interaction, ethylene evolution in response to
Pst infection was measured.
Ethylene was induced to similar levels at 48 hpi in Columbia and npr1-1 indicating
that the control of ethylene synthesis by SA is NPR1-independent. A large increase in
ethylene, also at 48 hpi, was observed in sid2-2. NahG showed no induction of ethylene
during disease progression (Figure 2-8). These results indicate that catechol or its further
metabolites suppress ethylene production and that there is an antagonistic relationship
between the synthesis of SA and ethylene, rather than the agonistic relationship suggested
by the NahG phenotype. These results are also consistent with the observation that
ethylene insensitive plants synthesize more SA than wild type plants following pathogen
infection (O'Donnell et al., 2003).
To investigate if it was this suppression of ethylene signaling that caused the
differences in disease symptoms between sid2-2 and NahG, plants were treated with the
ethylene inhibitor 1-methylcyclopropene (MCP) 24 hours prior to infection and the
resultant effects on disease were assessed. MCP blocks ethylene binding to it receptors,
thus inhibiting its perception (Sisler and Serek, 1997). No differences in disease
development between those plants treated with MCP and untreated plants were observed
(data not shown). These data indicate that although ethylene production is inhibited in
23
NahG, this absence of ethylene is not responsible for the enhanced disease phenotype
observed in NahG plants relative to sid2-2.
Figure 2-8 Ethylene production in Pst infected Arabidopsis. Columbia, npr1-1, sid2-2and NahG were dip infected with Pst DC3000. Ethylene production wasmeasured at the time points indicated.
Discussion
The effect of an inability to accumulate SA on the induction of ethylene and
jasmonates during the interaction between Arabidopsis thaliana and the virulent bacterial
pathogen Pst DC3000 was investigated. Two lines that do not accumulate SA during
infection (NahG and sid2-2) were used to determine these effects. The effects of SA on
ethylene and jasmonates accumulation are believed to be NPR1-dependent (Clarke et al.,
2000). Consequently the levels of ethylene and jasmonates in npr1-1, following infection
were also measured.
In accordance with previous reports (Cao et al., 1994; Delaney et al., 1994;
Nawrath and Metraux, 1999) an enhanced susceptibility to Pst in NahG, sid2-2 and npr1-
1 was observed, with more severe symptom development in NahG and sid2-2 than in
npr1-1. This result correlates with the partial loss of SA signaling in npr1-1 compared to
24
the other two lines. NahG displayed a rapid and complete tissue collapse that did not
occur in sid2-2. NahG also supported more bacterial growth than sid2-2, although both
were more susceptible to Pst than Columbia. This result, coupled with the recent data
proposing side effects in NahG associated with catechol (Van Wees and Glazebrook,
2003), led to the comparasion of the NahG and sid2-2 lines for effects on ethylene and
jasmonate accumulation.
As has been reported previously, the SA levels in NahG and sid2-2 are roughly
equivalent following Pst infection (Nawrath and Metraux, 1999). The massive increase of
SA in npr1-1 compared to that of Columbia is probably due to a loss of feedback
inhibition on SA synthesis that relies on an NPR1-dependent SA pathway (Clarke et al.,
2000).
As well as SA, jasmonates have been reported to play a role in disease with both JA
and its precursor OPDA believed to be active signaling compounds (Stintzi et al., 2001).
It was therefore determined how the removal of SA affected the induction of these
jasmonates following infection. In Columbia, both JA and OPDA increase following
infection. In the SA-deficient lines an increase in jasmonates was observed compared to
wild type, with NahG and sid2-2 producing the most jasmonates. npr1-1 produced
intermediate jasmonate levels. This suggests that SA represses jasmonate production in a
partially NPR1 dependent manner. As NahG and sid2-2 produce similar levels of
jasmonates catechol is unlikely to affect jasmonate production. The enhanced
susceptibility of SA-deficient Arabidopsis to Pst may be due to the combined effects of
reduced SA and increased jasmonates.
25
The use of PR gene expression is often used to investigate the roles of specific
phytohormones in plant pathogen interactions. In order to determine the degree that two
of these markers represented the levels of the phytohormones produced, the expression of
PR1 and PDF1.2 was determined in the different lines during infection. The expression of
PR1 is absent in accordance with the loss of SA accumulation in both sid2-2 and NahG.
It is also much reduced in npr1-1 when compared to Columbia. These results demonstrate
that the loss of SA accumulation in these lines is sufficient to prevent the induction of SA
response pathways and that PR1 is a good marker of SA signaling.
There was also an induction of PDF1.2 to a similar extent in all lines. PDF1.2
requires the activation of both ethylene and JA response pathways to be induced in
response to Alteranria brassicicola (Penninckx et al., 1998). PDF1.2 is not visible in
sid2-2 or NahG at 96hpi due to the poor quality RNA obtained from this highly necrotic
tissue. These data indicate that although the absence of SA affects the levels of ethylene
and jasmonates this is not necessarily reflected in the expression of all downstream genes.
This indicates that marker genes may not always be the best approach to mapping
hormone networks.
The production of coronatine by Pst in the different Arabidopsis lines was
measured to further study the relationship between SA and jasmonates. Coronatine is a
non-host specific phytotoxin whose biological effects include induction of leaf chlorosis
(Mittal and Davis, 1995). It has been suggested to act as a mimic of OPDA (Weiler et al.,
1994). Coronatine production was observed in all of the lines infected with Pst, with the
most production occurring in NahG. The coronatine levels were different to those of
jasmonates. This suggests that coronatine acts via jasmonate signaling rather than by
26
stimulating jasmonate biosynthesis. The production of coronatine was the same in sid2-2
as Columbia so it is not directly related to bacteria levels. This suggests that host factors
or bacteria thresholds must be present to stimulate coronatine production.
To determine if coronatine affects SA-dependent basal resistance, the lines were
infected with the coronatine-deficient mutants Pst DC3661 and Pst DC3118. All lines
infected with coronatine-deficient Pst had reduced bacterial growth compared with those
infected with Pst DC3000 and consequently developed less severe disease symptoms.
However, the relative differences in susceptibility between the lines remained. This
indicates that role of coronatine as a virulence factor is independent of SA, as SA-
deficient lines still show an enhanced susceptibility to coronatine-deficient Pst despite its
reduced virulence. It is then both the accumulation of coronatine and the loss of SA
signaling that lead to the severe disease phenotype observed in the SA deficient lines
upon infection with Pst.
Ethylene synthesis is transient during the post-infection period, peaking around 48
hpi in Columbia in response to Pst. This induction does not occur in NahG. The faster
development of chlorosis in the ethylene insensitive mutant etr1-1 in response to Xcc
infection (O'Donnell et al., 2003) suggests that ethylene is required to slow the
development of chlorosis. The growth of Xcc in etr1-1 remains unchanged indicating that
ethylene does not play a direct role in limiting pathogen growth in this interaction. As the
Arabidopsis response to Pst and Xcc are similar, it can be concluded that ethylene does
not play a major role in basal resistance to either pathogen.
A major difference between the two SA-deficient lines with respect to this ethylene
induction was observed, with sid2-2 showing a two-fold increase in ethylene induction at
27
48 hpi relative to Columbia. These data agree with the recent study by Heck et al. (2003).
The completely opposite nature of this response in NahG when compared to sid2-2
suggests that catechol or a further metabolite negatively affects ethylene production.
However, the treatment of sid2-2 and NahG with the ethylene inhibitor MCP before
infection caused no change in their respective phenotypes. This suggests that although
ethylene may play a role in fine-tuning the disease response in Arabidopsis, it is not
responsible for the difference in susceptibility between sid2-2 and NahG. The
suppression of ethylene production by catechol in NahG therefore is independent of the
changes in susceptibility and disease phenotype.
These data indicate that NahG is not always an appropriate model for studying the
role of SA induction in plant-pathogen interactions. They also demonstrate an
antagonistic relationship between SA and ethylene in this system, as the removal of SA
increases ethylene synthesis. As no difference in ethylene induction in npr1-1 compared
with Columbia was observed, it might also be concluded that the effect of SA on ethylene
is NPR1-independent.
28
CHAPTER 3SYSTEMIC ACQUIRED TOLERANCE IN TOMATO
Introduction
Pathogens have a high negative impact on agriculture. In 1993, for example, an
estimated 12% of crops were lost to disease (Agrios, 1997). The application of chemicals
such as fungicides help to limit the damage they cause. However, utilizing plant defense
responses remains an important research area for the limiting pathogen damage. For
instance application of Benzothiadiazole stimulates plant defense responses and induces
resistance to several pathogens (Lawton et al., 1996). Infected plants can in many
instances limit the extent of pathogen growth and symptom development. Resistance
occurs via an incompatible interaction and results in rapid activation of defense responses
that limit pathogen growth (Alfano and Collmer, 1996; Hammond-Kosack and Jones,
1996). These responses include: strengthening of cell walls with hydroxy-Proline-rich
glycoproteins (Showalter et al., 1985), callose (Parker et al., 1993) and lignin
(Moerschbacher et al., 1990); rapid expression of PR proteins (Linthorst, 1991); and the
synthesis of antimicrobial compounds (Hain et al., 1993; Epple et al., 1995; Penninckx et
al., 1996).
Tolerance is the repression of symptom development without restricting pathogen
growth. The visible phenotype of the two responses is similar. Resistance is a well-
studied phenomenon yet tolerance remains an enigma. Tolerance has been identified in
several phytohormone compromised plant lines. One of these is the ethylene-insensitive
ein2 mutant of Arabidopsis, which has increased tolerance to several virulent bacterial
29
pathogens (Bent et al., 1992). Increased tolerance has also been demonstrated to virulent
Xcv in ethylene and SA-deficient tomato lines (Lund et al., 1998; O'Donnell et al., 2001).
Disease development in tomato infected with virulent Xcv can be defined in two
stages: primary and secondary disease development. Primary disease development
consists of localized lesion formation and it is unaltered in the tolerant lines. Secondary
disease development consists of chlorosis and necrosis that spreads from the primary
lesions. These secondary disease symptoms require the cooperative action of ethylene
and SA and are abolished in tolerant lines. It remains a mystery why the plant retains
these responses and thus increases the amount of tissue damage. Organized necrosis may
help the plant withdraw nutrients from the infected tissue. The phytohormones may also
be required for the induction of a systemic response that allows the plant as a whole to
respond to the increased pathogen presence.
While tolerance due to phytohormones-deficiency might be a valuable outcome for
agriculture, it is likely to have costs. Ethylene and SA are involved in many plant-
pathogen interactions. For instance, ethylene is necessary for resistance to certain fungal
pathogens and for the generation of induced systemic resistance (Knoester et al., 1998;
Knoester et al., 1999). SA is necessary for resistance to avirulent pathogens and the
generation of SAR in several species (Gaffney et al., 1993). SAR is the activation of
systemic defense responses that occurs due to the formation of necrotic lesions (Ryals et
al., 1996). The hypersensitive response during an incompatible interaction and tissue
death during a compatible interaction can both induce SAR (Hunt and Ryals, 1996). SAR
results in the development of a broad-spectrum, systemic resistance. It is not effective
against, or induced by, all pathogens. For example, the infection of Arabidopsis with
30
Botrytis cinerea fails to induce SAR and inoculations with Pseudomonas syringae does
not affect B. cinerea challenge (Govrin and Levine, 2002). In tomato SAR is induced by
pathogens such as tobacco necrosis virus and Phytophthoria infestans (Enkerli et al.,
1993; Jeun et al., 2000).
It is important to understand the roles of phytohormones in systemic responses, as
the loss of these responses could reduce any advantage gained by reduced symptom
development due to engineered ethylene or SA-deficiency, I focus here on tomato, as the
absence of ethylene and SA causes tolerance to virulent Xcv. The systemic response in
tomato to this pathogen has not been previously examined. I investigate if Xcv is capable
of inducing systemic responses in tomato and possible roles of SA and ethylene in its
generation and action. To avoid confusion I will use the term “inoculation” for the first
treatment of a tomato plant and the term “challenge” for the subsequent treatment on
distal leaves. I demonstrate that both virulent and avirulent Xcv generate a systemic
response in tomato. I show that both virulent and avirulent Xcv cause an SA and ethylene-
dependent PR gene induction and sensitize systemic defense responses. However, in
contrast to the well-established SAR, the Xcv-induced response generates tolerance to
subsequent challenge with virulent Xcv. I term this response systemic acquired tolerance
(SAT) and define it as prior pathogen exposure reducing necrosis in response to virulent
pathogen infection in distal tissues without affected pathogen growth. SAT involves a
rapid increase in both PR gene expression and ethylene production in response to
subsequent challenges with virulent Xcv.
31
Virulent and Avirulent Xcv Led to Systemic Acquired Tolerance in Tomato
To investigate systemic responses to Xcv, wild type tomato plants at the three-leaf
stage were mock inoculated, inoculated with virulent Xcv strain 93-1 or avirulent Xcv
strain 87-7 (Bonas et al., 1993) on their lowest two leaves. The inoculations were then
permitted to run their full course of around 14 days, at which point those leaves
inoculated with virulent Xcv were fully necrotic and those inoculated with avirulent Xcv
had developed lesions associated with the hypersensitive response (Figure 3-1A).
Figure 3-1 Symptom development of Xcv infected tomato. (A) Representative diseasesymptoms at 16 dpi of wild type tomato plants inoculated with avirulent andvirulent Xcv and (B) symptoms resulting from challenge with virulent Xcv.
32
To determine if this inoculation with Xcv affected responses to subsequent
pathogen exposure, a challenge was performed with virulent Xcv on uninoculated
systemic leaves. Prior inoculations with either virulent or avirulent Xcv, but not mock
inoculations, reduced the necrotic development resulting from the challenge (Figure 3-
1B). The primary symptoms such as lesion formation were unaffected and secondary
symptom development such as chlorosis and some confluent necrosis were still apparent.
The major difference in secondary symptom development during challenge was reduced
necrosis in plants with prior Xcv inoculation.
As the response consists of two independent interactions between two biological
entities a high degree of variation is to be expected. With this in mind the level of
necrosis was determined in large population groups by measuring ion leakage at 16 days
after challenge (Figure 3-2).
Figure 3-2 Cell death due to challenge of tomato with virulent Xcv. Cell death wasmeasured in the form of percent ion leakage in plants with a mock challengeor challenged with virulent Xcv . The plants were exposed to a mockinoculation or inoculation with virulent (vir) or avirulent (avr) Xcv prior tochallenge.
33
Percent ion leakage, an indicator of cell death, was two-fold higher upon
challenge in plants previously mock inoculated than those with prior Xcv inoculations. In
contrast to previously mock-inoculated plants there was no significant difference between
symptoms in plants with prior virulent or avirulent inoculations upon challenge with
virulent Xcv. The reduction of symptom development due to previous pathogen exposure
is consistent with SAR generation. Bacterial growth measurements confirmed resistance
to avirulent Xcv but not virulent Xcv, as growth of avirulent Xcv was 10-fold lower than
that of virulent Xcv (Figure 3-3A).
Figure 3-3 Bacterial growth during inoculation and challenge of tomato with Xcv. (A)The growth of virulent (vir) and avirulent (avr) Xcv was measured duringinoculations. (B) A challenge with virulent Xcv was then performed on theseplants and mock-inoculated controls and the bacterial growth was measured.
34
When bacterial populations in challenge infections were determined there was no
difference in bacterial growth due to prior inoculation with either virulent or avirulent
Xcv compared with plants with prior mock inoculations (Figure 3-3B). This result leads
to the conclusion that avirulent and virulent Xcv induced SAT rather than SAR, as they
reduced symptom development but not bacterial growth due to challenge with virulent
Xcv. As to my knowledge SAT has not been previously described I defined it as the prior
exposure to a pathogen leading to reduced necrosis development in response to
subsequent challenge with a virulent pathogen in distal tissues.
Prior Inoculation with Xcv Led to an Early Production of Ethylene upon Challengewith Virulent Xcv
Ethylene and SA are involved in the development of systemic responses in several
plants. Ethylene and SA were measured during inoculation and challenge with Xcv.
Inoculation with virulent Xcv led to ethylene production in local tissues at 5 days post
infection (dpi), while avirulent Xcv caused a greater induction of ethylene at 4 dpi (Figure
3-4A). Virulent Xcv induced SA at 10 dpi, while avirulent Xcv induced SA at 4 dpi that
peaked at 10 dpi (Figure 3-4B). The induction of ethylene and SA was later and at
reduced magnitude in response to virulent Xcv than avirulent Xcv. No systemic
production of ethylene was observed in response to primary Xcv inoculations and at 16
dpi no systemic induction of SA was observed in plants inoculated with Xcv (data not
shown).
Loss of secondary disease symptoms occurs in virulent Xcv-infected ethylene or SA
deficient tomato plants (Lund et al., 1998; O'Donnell et al., 2001). Therefore it is possible
that SAT might similarly be the result of reduced phytohormone synthesis during
challenge. To determine if SAT was due to loss of ethylene or SA, their accumulation
35
following challenge with virulent Xcv was determined. Results indicated that the
tolerance associated with SAT is not due to reduced ethylene or SA accumulation.
Instead, earlier ethylene induction upon challenge accompanies SAT (Figure 3-4).
Figure 3-4 Local ethylene and SA production during inoculation and challenge of tomatowith Xcv. Tomato plants were mock inoculated or inoculated with virulent(vir) or avirulent (avr) Xcv and (A) ethylene and (B) SA were measured.Fourteen days later a challenge with virulent Xcv was performed onuninfected leaves and (C) ethylene and (D) SA induced by the challenge wasmeasured.
36
The ethylene induction in response to a challenge with virulent Xcv, following prior
mock inoculation, reached its maximum at 10 dpi. However, plants with prior Xcv
inoculations produced additional ethylene around 5 dpi when challenged (Figure 3-4C).
Although at a reduced magnitude, this induction resembles a response to avirulent Xcv.
Challenge with virulent Xcv caused ethylene induction at 8 to 10 dpi in all plants, the
magnitude of which was dependent on the prior inoculation. Plants with prior avirulent
Xcv inoculation produced the most ethylene when challenged. This ethylene induction
was lower in plants with prior virulent Xcv inoculations and lowest in the mock-
inoculated controls. However, the significant difference remains the early ethylene
induction that is only present in plants with prior Xcv inoculations.
Plants with prior mock or virulent Xcv inoculations produced similar SA induction
profiles in response to challenge with virulent Xcv. However, a reduction in SA
production was observed in plants with a prior avirulent Xcv inoculation. These plants
also produced an early SA peak (Figure 3-4D) that resembled the response to avirulent
Xcv although reduced in magnitude. The following production of SA was delayed and
resembled that caused by virulent Xcv although at reduced magnitude.
The difference in SA production during a challenge and the increased strength and
speed of phytohormone induction during prior inoculations had no effect on the overall
SAT phenotype. Therefore the early induction of ethylene upon challenge in plants with
prior Xcv infections correlates with the tolerant phenotype, whereas SA induction does
not. Despite the lack of correlation between SA induced during challenge and SAT, SA
and ethylene induction during inoculation may be required for systemic signal formation.
37
PR Gene Expression Indicated the Necessity of Ethylene and SA in Systemic SignalGeneration
As ethylene or SA-deficient plants develop less secondary disease symptoms due
to virulent Xcv than plants displaying SAT, a direct approach to determining their role in
SAT is difficult. Therefore PR gene expression was assayed instead of ion leakage as a
marker for defense responses in phytohormone-deficient plants. To determine if ethylene
and SA are necessary for systemic signal transduction, two transgenic lines altered in
their ability to accumulate ethylene or SA were used. Loss of ethylene was achieved with
transgenic ACD plants. These plants do not accumulate the ethylene precursor ACC and
thus under-produce ethylene. The ACD line was compared to its isogenic parent UC82B.
The role of SA was determined using transgenic tomato plants expressing the bacterial
salicylate hydroxylase, nahG that cannot accumulate SA. The NahG line was compared
to its isogenic parent Money Maker (MM).
Induction of PR genes is often used as an indicator of early defense responses.
They show both local and systemic induction during SAR (Ward et al., 1991). The
expression of PR1a and PR1b was induced in the local and systemic tissues of tomato
during infection with virulent Xcv (Figure 3-5). PR1a expression was lower than PR1b.
The local expression of both genes was induced in all lines in response to virulent Xcv.
The timing and level of induction of PR1a varied between different cultivars, with an
earlier and a greater induction in MM than UC82B. The expression of PR1b was also
higher in MM than UC82B, although the timing of induction was the same. When
compared to their isogenic parents, infected ACD and NahG plants had reduced local
expression of both genes. However, this reduction did not affect pathogen growth
(O'Donnell et al., 2001).
38
Figure 3-5 Local and systemic PR gene induction in ethylene and SA-deficient tomatolines in response to inoculation with virulent Xcv. Ethylene-deficient ACD,SA-deficient NahG and their isogenic parents were inoculated with virulentXcv. PR1a and PR1b expression levels were determined by real time RT-PCRin local and systemic tissues.
39
Virulent Xcv induced systemic expression of both genes in MM and UC82B. In
MM systemic induction of PR1a and PR1b occurred at the same time, whereas in UC82B
the expression of PR1b was later than PR1a. ACD and NahG did not show significant
systemic induction of PR gene expression in response to virulent Xcv. Disease symptoms
in ACD and NahG are comparable to their isogenic parents up to 8 dpi (O'Donnell et al.,
2001). As widespread necrosis does not occur before 8 dpi the lack of systemic PR gene
expression is due to loss of ethylene and SA accumulation rather than the loss of
widespread necrosis in these lines. This lack of systemic PR gene induction indicates that
ethylene and SA-deficient lines might be compromised in their systemic signal
transduction. However, the tolerant phenotype of these lines makes direct investigation
difficult.
In UC82B systemic PR gene induction occurred within 6 dpi, whereas the major
local phytohormone induction occurred at 8 to 10 dpi in response to virulent Xcv.
Measurable phytohormone induction, therefore, was not responsible for systemic PR
gene induction. Direct damage to cells infected by the pathogen may cause local ethylene
and SA production limited to cells that are under attack. This phytohormone production
may be involved in the induction of both local and systemic defense responses.
Avirulent Xcv Induced Greater Local and Systemic PR Gene Expression thanVirulent Xcv, but they Result in Similar PR Gene Induction During Challenge
The induction of ethylene and SA is more rapid in response to avirulent than
virulent Xcv, yet the resulting systemic response to these two pathogens is the same. To
determine if the early defense responses follow this trend, induction of PR gene
expression by avirulent and virulent Xcv inoculations was assayed. Avirulent Xcv induced
higher levels and earlier local expression of PR genes than virulent Xcv (Figure 3-6). The
40
timing of systemic PR1b induction was similar in response to either pathogen, but
systemic PR1a induction was faster in response to avirulent Xcv. Faster and stronger local
PR gene response to avirulent than virulent Xcv may reflect the increased defense
responses that limit pathogen growth.
Prior avirulent and virulent Xcv inoculations produced the same induction of
ethylene and changes in symptom development during challenge. The levels of PR gene
expression were assayed to determine if increased systemic PR gene expression
translated into stronger PR gene induction upon challenge. The difference between the
two prior Xcv inoculations in PR gene expression upon challenge was negligible. Both
caused an early peak of PR gene expression at 1 dpi upon challenge that was absent in
plants with prior mock inoculation (Figure 3-7). These results are consistent with the
rapid ethylene induction following challenge. These results lead to the hypothesis that
inoculation with Xcv primed the systemic defenses and caused a faster induction of
defense responses upon challenge. This primed defense response led to the formation of
tolerance upon challenge.
Discussion
In this chapter the systemic responses of tomato to both virulent and avirulent Xcv
were studied. A primary infection with virulent Xcv led to local as well as ethylene and
SA-dependent systemic PR gene induction within 6 dpi. PR gene induction occurred
prior to measurable ethylene or SA induction, indicating that undetectable localized
ethylene and SA production occurred within days of infection with virulent Xcv and led
to the generation of a systemic signal. The systemic signal, as well as inducing PR gene
expression, altered the systemic defense response to challenge with virulent Xcv. This
41
altered defense response is tolerance and not resistance. It caused rapid PR gene
expression and ethylene induction in response to subsequent challenge, leading to
suppressed symptom development but not resistance.
Figure 3-6 The measurement of local and systemic PR gene expression in tomato duringinoculations with virulent or avirulent Xcv. Wild type (UC82B) tomato plantswere mock inoculated or inoculated with virulent (vir) or avirulent (avr) Xcvand the local and systemic expression of PR1a and PR1b was determined byreal time RT-PCR.
42
Figure 3-7 Induction of PR genes in tomato plants during challenge with virulent Xcv inthe presence or absence of SAT. Wild type (UC82B) tomato plants were mockinoculated or infected with virulent (vir) or avirulent (avr) Xcv. Fourteen dayslater a challenge was performed with virulent Xcv. The expression of PR1aand PR1b was determined with real time RT-PCR during this challenge.
The ability of a plant to send a systemic signal in response to a biological stimulus
has long been established. This communication allows separate tissues to act in concert to
the many stimuli they perceive. Systemic signals have been characterized in terms of
responses to pathogens, symbionts and wounding. SA, ethylene, jasmonates and systemin
are all involved in generating systemic signals (Pearce et al., 1991; Gaffney et al., 1993;
Pieterse et al., 1998). SA is a key player in SAR in many species (Ryals et al., 1996).
NahG plants are unable to mount SAR to bacterial, viral or fungal pathogens (Gaffney et
al., 1993; Friedrich et al., 1995; Lawton et al., 1995) and exogenous SA can induce SAR
43
(Ward et al., 1991; Vernooij et al., 1995). However, grafting experiments with NahG and
wild type tobacco indicate that although SA is required for SAR it is unlikely to be the
transmitted signal (Vernooij et al., 1994).
The role of SA in the systemic responses of tomato may differ somewhat from
that in other plant species. For example, the induction of SAR in tomato against P.
infestans demonstrated neither systemic SA accumulation upon inoculation, nor increased
SA production upon challenge, both of which are common to SAR in other plant species
(Jeun et al., 2000). While local induction of SA is observed in response to virulent and
avirulent pathogens, its accumulation is only observed after the systemic induction of PR
genes (O'Donnell et al., 2001)
In tomato, ethylene and SA are induced in response to both virulent and avirulent
Xcv, although in neither response are they involved in limiting bacterial growth (Lund et
al., 1998; Ciardi et al., 2001; O'Donnell et al., 2001; O'Donnell et al., 2003). Loss of
ethylene causes tolerance to virulent Xcv by reducing cell death and lesion size following
infection with avirulent Xcv. SA loss also leads to tolerance to virulent Xcv. However,
loss of SA increases cell death and lesion size in response to avirulent Xcv. The
development of systemic acquired tolerance to Xcv rather than resistance may be a
specific response to this pathogen and reflect the roles of ethylene and SA in this
interaction.
In agreement with the work of Ciardi et al. (2000), avirulent Xcv induces a rapid
and more intense expression of PR genes than virulent Xcv. Here I show that this
translates into an increased systemic PR gene induction. This increased PR gene
expression coupled with a faster and greater local induction of ethylene and SA may
44
affect SA production during challenge but it has no impact on SAT. Therefore, changes
in SA production during challenge are not important for the formation of SAT.
Interestingly the work of Jeun et al. (2000) demonstrates that changes in SA induction in
tomato during challenge with P. infestans are also not necessary for SAR.
The PR gene induction and ethylene profiles caused by SAT during challenge
resembled those of an incompatible interaction. However, they failed to develop with the
speed and intensity required for successful resistance to develop. Systemic induction of
defense responses and PR genes that do not lead to SAR have been observed in the
interaction of Arabidopsis and the necrotizing fungal pathogen B. cinerea (Govrin and
Levine, 2002). Virulent Pseudomonas syringae pv. tomato also fails to induce SAR in
Arabidopsis, but in this case there is no systemic induction of PR genes (Cameron et al.,
1999). An incompatible-interaction between Arabidopsis and Pseudomonas syringae pv.
syringae leads to a reduction of symptom development but no changes in bacterial
growth during a repeat challenge with the same incompatible pathogen (Summermatter et
al., 1995). These data suggest that systemic responses to pathogens exist as a continuum
between no response, tolerance and resistance.
Transgenic tobacco over-expressing PR1a show enhanced tolerance to
Peronospora tabacina (Alexander et al., 1993). While tobacco plants deficient in catalase
show that low level activation of defense responses, including PR gene induction, by
H2O2 can lead to enhanced pathogen tolerance, higher H2O2 levels cause resistance
(Chamnongpol et al., 1998). These data again suggest that a range of systemic responses
to pathogen invasion occur, with a moderate response repressing symptom development
and a strong response suppressing both symptom development and pathogen growth.
45
Here I have described the phenomenon of systemic acquired tolerance that adds to the
ranges of known systemic responses induced by pathogens and suggests that plants are
capable of more diversity in their systemic responses than previously suspected.
46
CHAPTER 4DISCUSSION
Phytohormone Networks in the Responses of Tomato and Arabidopsis to VirulentBacterial Pathogens
Plant signaling networks utilize ethylene, SA and jasmonates to coordinate defense
responses. Different plants use these phytohormones in a variety of ways to achieve the
same result. In this chapter I compare and contrast their roles of in the response of
Arabidopsis and tomato to infection with virulent bacterial pathogens. Plants
compromised in production or signaling of a phytohormone were used to determine its
effects. However, phytohormones do not act in isolation the levels of one can often affect
the levels of another. Many studies do not look at the effects of altering the synthesis or
perception of one phytohormone on others. They therefore cannot address whether the
phenotype observed is strictly due to the phytohormone lost.
Phytohormone measurements demonstrate if the altered phenotype is due to the
compromised phytohormone or if others may be involved. Table 4-1 shows the
phenotypes of Arabidopsis and tomato phytohormone mutants infected with virulent
bacterial pathogens. Table 4-2 shows the effect of these mutations or transgenes on the
production of other phytohormones in response to infection. The Arabidopsis responses
are to virulent Pst and the tomato responses are to virulent Xcv.
47
Table 4-1 Comparative phenotypes of phytohormone mutants in Arabidopsis andtomato.
Compatibleinteractions
Salicylic acid Ethylene Jasmonates
Arabidopsis and PstMutants sid2-2 etr1-1 coi 1 and fad3-2 fad7-
2 fad8 (fad3)Local phenotype enhanced
susceptibility (1)increased symptoms
(2)resistant (coi1)
no effect fad3-2 fad7-2fad8)(3)
Systemic phenotype normally none (4) ND NDTomato and Xcv
Mutants NahG ACD, Nr AOCasLocal phenotype tolerant (5) tolerant (6) resistant (7)
Systemic phenotype no SAT (8) no SAT (8) NDReferences are: 1 (Nawrath and Metraux, 1999); 2 (O'Donnell et al., 2003); 3 (Kloek etal., 2001); 5 (O'Donnell et al., 2001); 6 (Lund et al., 1998); 7 (O'Donnell et al., 2003); 8(chapter 3). ND = not determined.
Table 4-2 Comparative phytohormone profiles of Arabidopsis and tomato mutants.Arabidopsis and
PstSalicylic acid Ethylene Jasmonates
Mutants sid2-2 etr1-1 coi 1 and fad3-2fad7-2 fad8
Salicylic acid none (1) ND increased (coi1)(2)Ethylene increased (3) insensitive (4) ND
Jasmonates increased (5) ND insensitive (coi1)(6)none (fad3-2 fad7-2
fad8)(7)Tomato and Xcv
Mutants NahG ACD, Nr as-AOCSalicylic acid none (8) none (9) none (10)
Ethylene normal (11) none (ACD) (9)insensitive (Nr) (12)
none (10)
Jasmonates normal (10) normal (10) none (13)References are: 1 (Nawrath and Metraux, 1999); 2 (Kloek et al., 2001); 3 (chapter 2); 4(Bleecker et al., 1988); 5 (Heck et al., 2003); 6 (Feys et al., 1994); 7 (McConn andBrowse, 1996); 18 (Oldroyd and Staskawicz, 1998);9 (O'Donnell et al., 2001); 10 (Lundet al., 1998); 11 (O'Donnell et al., 2003); 12 (Lanahan et al., 1994); 13 (Stenzel et al.,2003). ND = not determined.
48
Arabidopsis has many phytohormone mutants including those for SA (sid2-2),
ethylene (etr1-1) and jasmonates (fad3-2 fad7-2 fad8 and coi1). The etr1-1 mutant is a
dominant-insensitive ethylene receptor mutant (Bleecker et al., 1988). The fad3-2 fad7-2
fad8 mutant is a loss of function triple mutant of the three fatty acid desaturases. Due to
its failure to synthesize linolenic acid, it has reduced jasmonate biosynthesis (McConn
and Browse, 1996). The coi1 mutant is a jasmonate-insensitive ubiquitin E3 ligase mutant
(Xie et al., 1998). Tomato also has mutants and transgenic lines compromised in
phytohormones such as SA (NahG), ethylene (ACD and Nr) and jasmonates (as-AOC).
Nr is a dominant ethylene-insensitive receptor mutant (Rick and Butler, 1956). The
transgenic plant as-AOC is an antisense line of the jasmonate biosynthesis enzyme allene
oxide cyclase (Stenzel et al., 2003).
These data allow the construction of signaling network models for these plant
pathogen interactions. However, not all phenotype and phytohormone measurements
have been addressed in each system. These models are based on only two sets of
interactions and may vary greatly in response to different pathogens or in different plant
systems.
The Compatible Tomato-Virulent Xcv Interaction
A model for the signaling network in tomato in response to virulent Xcv is shown in
Figure 4-1. In the interaction of tomato with Xcv the relationship of these phytohormones
appears to be linear, with SA production dependent on ethylene production that is in turn
dependent on jasmonate signaling (Lund et al., 1998; O'Donnell et al., 2001; O'Donnell et
al., 2003).
49
Figure 4-1 A model for the signaling network in tomato in response to virulent Xcv.
As demonstrated in chapter 3, systemic signaling in tomato is dependent upon
ethylene and SA. Their action appears to precede their measurable induction, in a manner
similar to JA. JA-deficient lines show a loss of ethylene despite the fact that measurable
JA production does not occur until after ethylene production (O'Donnell et al., 2003).
This suggests that early, local phytohormone productions can have a profound impact on
disease response.
It is clear in the case of the interaction between virulent Xcv and tomato that
jasmonates are the major players when it comes to the formation of susceptibility to Xcv.
At the local level the induction of ethylene and SA are required for the formation of
secondary disease symptoms (O'Donnell et al., 2003). The interaction between tomato
and virulent Pst also requires a functional jasmonate-signaling pathway for full Pst
virulence. This system, however, is strongly influenced by the phytotoxin coronatine
(Zhao et al., 2003).
The Compatible Arabidopsis-Virulent Pst Interaction
SA-deficient Arabidopsis plants produce increased levels of jasmonates and
ethylene in response to infection with virulent Pst. The prevalent hypothesis for
phytohormones in the response of Arabidopsis to pathogens proposes two pathogen-
response pathways in Arabidopsis (Glazebrook et al., 2003). One pathway utilizes SA
50
and acts in response to necrotic bacterial pathogens and the other utilizes ethylene and
jasmonates, acting in response to fungal and insect pathogens (Penninckx et al., 1998;
Vijayan et al., 1998).
SA, ethylene and jasmonates are all produced in the interaction between
Arabidopsis and virulent Pst. However, SA limits the production of both ethylene and
jasmonates and is the major phytohormone controlling defense responses in this
interaction. SA represses bacterial growth and thus also the development of chlorosis and
necrosis. Ethylene represses symptom development and jasmonates appear to act by
repressing defense responses.
These data suggest that co-ordinate signaling determines the overall response to the
pathogen. A combination of SA and jasmonates determine the level of bacterial growth
while ethylene influences the level of symptom development. It is likely to be the ratios
and timing of the various phytohormone inductions that control the plant responses. Pst
uses this network to its advantage by producing the jasmonate mimic coronatine.
The reduced virulence of coronatine-deficient Pst on SA-deficient and wild type
Arabidopsis demonstrated in chapter 2, suggests that coronatine’s action as a virulence
factor is SA-independent. Further experiments to confirm this include the measurement
of SA in plants infected with coronatine-deficient Pst. Similar SA levels of these plants
and those infected with wild type Pst would support SA-independent coronatine action.
The link between jasmonates and susceptibility could also be investigated using T-
DNA knock-out mutants in jasmonate biosynthesis genes. A good candidate for this is
allene oxide cyclase for which there is a single gene in Arabidopsis (Kubigsteltig et al.,
1999; Park et al., 2002). This mutant would be more appropriate than the fad3-2 fad7-2
51
fad8 as it is less likely to affect the levels of other metabolites. These experiments require
the coronatine-deficient Pst mutant, as coronatine masks jasmonate-deficiency (Kloek et
al., 2001). Changes in bacterial growth in these lines would demonstrate if jasmonates are
definitively involved in repressing defense responses in Arabidopsis.
Systemic Responses to Infection
Systemic responses to virulent and avirulent pathogens have been previously
described in both tomato and Arabidopsis, with SA playing a similar role in both plants.
In both systems pathogen infections cause a local increase in SA (Nawrath and Metraux,
1999; O'Donnell et al., 2001). SA is necessary for the induction of a systemic response,
however, it is not itself believed to be the transmitted signal (Vernooij et al., 1994;
Lawton et al., 1995). The systemic induction of SA differs between the two systems, as
Arabidopsis has strong systemic SA induction where as tomato does not (Summermatter
et al., 1995). Arabidopsis also shows a strong induction of SA upon challenge that does
not occur in tomato (Jeun et al., 2000).
Ethylene is not required for the induction of SAR in Arabidopsis (Delaney et al.,
1994; Lawton et al., 1995). However, both ethylene and SA appear to be involved the
induction of SAT in tomato (Chapter 3). Virulent pathogens can induce systemic
responses in Arabidopsis, however, SAR is not induced by virulent Pst (Cameron et al.,
1999). Both avirulent and virulent Xcv induce systemic responses in tomato.
Additional experiments are required to confirm the roles of ethylene and SA in the
generation of systemic signaling in tomato. One approach to this could be the use of
grafting to determine if a NahG stock is incapable of systemic signaling to a wild type
52
scion. The best approach to this would be to monitor PR gene expression in the scion in
response to an inoculation of the stock.
Further study is required in both systems before the complex roles of
phytohormones in these interactions can be fully understood. It is clear from this study
that information gained from studying one system will not necessarily be applicable to
another system. However, certain parallels and common responses exist. By the study of
a wide range of plant-pathogen interactions the common points and differences can be
determined. This will eventually lead to a more complete understanding of general
defense responses, perhaps allowing broad-spectrum engineering or breeding of plants
with increased resistance or reduced symptoms to a wide range of diseases.
53
CHAPTER 5MATERIALS AND METHODS
Plant Materials and Treatments
Arabidopsis thaliana Columbia, the NahG line (Delaney et al., 1994), npr1-1 (Cao
et al., 1994) and sid2-2 (courtesy of Julia Dewdney), all in the Columbia background,
were grown in soil under long night conditions (8-h day; 16-h night) for six weeks to
encourage vegetative growth. Forty-eight hours prior to infection, plants were transferred
to long day conditions (16-h day; 8-h night). Twelve hours before infection, the plants
were enclosed in a humidity dome to aid bacterial entry. Plants were inoculated with Pst
by submerging the aerial parts of the plant in 1x107 cfu ml-1 bacterial suspension,
containing 10mM MgCl2 and 0.02% (v/v) Silwet L-77 (Lehle seeds, Round Rock, TX,
U.S.A.), for 30 seconds. A vacuum was then applied to the plants for 2 min to aid
bacterial entry and the plants were returned to the humidity chamber overnight.
Lycopersicon esculentum cvs Moneymaker and UC82B are the parental lines for
NahG (Oldroyd and Staskawicz, 1998) and ACD (Klee et al., 1991) respectively. Wild
type refers to UC82B only in all experiments except PR gene analysis of ethylene and
SA-deficient lines. Plant growth and treatments were performed under ambient
temperature and lighting in a greenhouse. Plants were inoculated by submersion of the
leaves for 15 seconds in a bacterial suspension of 1x107 cfu ml-1 of Xcv strain 93-1
(virulent) or 87-7 (avirulent) containing 10mM MgCl2 and 0.02% (v/v) Silwet L-77.
Mock inoculations were performed by dipping plants in buffered Silwet. For analysis of
the systemic response to infection, inoculations were performed on three week-old plants
54
by dipping leaves 1 and 2 in infection media. Challenges were then performed on the
same plant 14 days later by dipping leaves 5 and 6 in the infection media containing
virulent Xcv. For PR gene analysis leaves 1 and 2 of six week-old plants were infected
and tissue from the local infection (leaves 1 and 2) and the systemic response (leaves 5
and 6) were removed at the indicated time points and flash frozen in liquid nitrogen.
Bacterial Culture
Pst and Xcv cultures were grown as previously described by O’Donnell et al.
(2001). Leaf colony counts were determined as previously described by Lund et al.
(1998). Briefly, five 1cm2 leaf disks were sampled from each line at each time point
indicated. The disks were ground in 10mM MgCl2, and serial dilutions were incubated at
room temperature for 2 days on solid media. The average colony-forming unit per square
centimeter (cfu cm-2) for each sample was determined by counting individual colonies.
Ion Leakage
Amount of cell death was estimated by measuring percentage of ion leakage. At 16
dpi the 5th leaf of each plant was placed in 6 ml deionized water and a vacuum of 20 psi
applied for 5 min. The samples were then shaken at room temperature for one hour. 3 ml
of the water was then removed and its conductivity was measured. The samples were
then placed in a boiling water bath for an hour and the conductance of the remaining 3 ml
of water measured. Percent ion leakage was determined by conductivity of first 3 ml
divided by conductivity of second 3 ml multiplied by 100. Measurements of tissue
challenged with virulent Xcv were made from 30 plants per treatment. Measurements on
mock challenges were made for 10 plants per treatment. Each experiment was repeated
on at least two independent occasions.
55
Ethylene Measurements
Ethylene measurements were performed on a minimum of three independent biological
replicates. Each biological sample was replicated at least three times within an
experiment. Ethylene production was determined by sampling the headspace above either
a whole rosette for Arabidopsis or a single leaf for tomato, enclosed in 5cm3 tubes for 1
hour as described by Lund et al. (1998). Ethylene concentration in a 1 ml sample was
determined by a gas chromatography (Model 5890, Hewlett-Packard, Palo Alto, CA).
SA, Jasmonate and Coronatine Measurements
SA, jasmonates and coronatine were extracted from Arabidopsis tissue and SA
from tomato tissue and derivatized using trimethylsilyl-diazomethane. The volatile
methyl esters were collected from the complex matrix using vapor phase extraction and
quantified by isobutene chemical- ionization gas-chromatography/mass spectrometry as
described in Schmelz et al. (2003). Each biological sample was replicated at least twice
with a minimum of two independent experiments.
RNA Extraction
Total RNA was extracted from 1.0g of tissue from each genotype per time point
with (phenol:chloroform:isoamyl alcohol (PCI) (25:24:1 (v/v/v))) : extraction buffer (1%
triisopropylnaphthalene-sulfonic acid (w/v); 6% p-amino salicylic acid (w/v); 0.1M Tris
pH 8; 50 mM EGTA; 0.1M NaCl; 1% SDS (w/v); 0.039% -Mercaptoethanol (v/v)) (1:1).
The extraction mixture was homogenized with a polytron and incubated at 50°C for 20
min. The phases were separated and an equal volume of PCI added to the aqueous phase.
The RNA was precipitated overnight at -80°C following the addition of 2.5 volumes of
ethanol and 1/10 volume of sodium acetate. The nucleic acids were pelleted by
centrifugation, (14,000 g for 30 min) resuspended in water and precipitated in 2M LiCl.
56
The LiCl precipitation was repeated and a subsequent sodium acetate/ethanol
precipitation performed.
RNA Gel Blot Analysis
RNA gel blot analysis was performed using 20 µg total RNA for each sample as
described by Kneissl and Deikman (1996). The RNA was transferred onto a charged
membrane (Hybond-N+; Amersham Life Science inc., Arlington Heights, IL). The PR1
(Genbank accession AY117187) and PDF1.2 (full length cDNA from gene at5g44420)
probes were obtained from The Arabidopsis information resource (Ohio State
University). DNA probes were random primer labeled with 32P with the Prime-It II
labeling kit (Stratagene, La Jolla, CA).
Real-time RT-PCR
PR1a (TC117463) and PR1b (TC115947) mRNA levels were quantified by Real-
time quantitative RT-PCR using Taqman® one-step RT-PCR reagents (Applied
Biosystems, Foster City, CA) and an Applied Biosystems GeneAmp 5700 sequence-
detection system. Each determination was performed using 250ng of Dnase-1 treated
total RNA isolated using an RNeasy® Plant mini kit (Qiagen, Valencia, CA), in a 25µl
reaction volume. RT-PCR conditions were: 48°C for 30 min, 95°C for 10 min followed
by 40 cycles of 95°C for 15 sec and 60°C for 1 min. Absolute mRNA levels were
quantified using synthesized sense strand RNAs as standards. Primers and probes were
designed using PRIMER EXPRESS software (Applied Biosystems) and were as follows:
PR1b probe 5’-/56-FAM/CAACGGATGGTGGTTCATTTCTTGCA/3BQH_1/-3’; PR1a
probe 5’-/56-FAM/TGTGGGTGTCCGAGAGGCCAGA/3BHQ_1/-3’;PR1b forward
primer 5’-GGTCGGGCACGTTGCA-3’; PR1b reverse primer 5’-GATCCAGTT-
57
GCCTACAGGACAT-A-3’; PR1a forward primer 5’-GAGGGCAGCCGTGCAA-3’;
PR1a reverse primer 5’-CACATTTTTCCACCAACACATTG-3’ (Intergrated DNA
Technologies, Coralville, IA). Each sample was a minimum of two biological replicates
and each experiment was repeated at least twice.
MCP Treatment
MCP treatment was performed 24 hours prior infection as described in Ciardi et al
(2000).
58
LIST OF REFERENCES
Agrios GN (1988) Plant pathology, Ed 3rd. Academic Press, San Diego
Agrios GN (1997) Plant pathology, Ed 4th. Academic Press, San Diego
Alexander D, Goodman RM, Gut-Rella M, Glascock C, Weymann K, Friedrich L,Maddox D, Ahl-Goy P, Luntz T, Ward E, et al. (1993) Increased tolerance totwo oomycete pathogens in transgenic tobacco expressing pathogenesis-relatedprotein 1a. Proc Natl Acad Sci U S A 90: 7327-7331
Alfano JR, Collmer A (1996) Bacterial pathogens in plants: life up against the wall.Plant Cell 8: 1683-1698
Ausubel FM, Katagiri F, Mindrinos M, Glazebrook J (1995) Use of Arabidopsisthaliana defense-related mutants to dissect the plant response to pathogens. ProcNatl Acad Sci U S A 92: 4189-4196
Bent AF, Innes RW, Ecker JR, Staskawicz BJ (1992) Disease development inethylene-insensitive Arabidopsis thaliana infected with virulent and avirulentPseudomonas and Xanthomonas pathogens. Mol Plant Microbe Interact 5: 372-378
Bleecker AB, Estelle MA, Somerville C, Kende H (1988) Insensitivity to ethyleneconferred by a dominant mutation in Arabidopsis-thaliana. Science 241: 1086-1089
Bohlmann H, Vignutelli A, Hilpert B, Miersch O, Wasternack C, Apel K (1998)Wounding and chemicals induce expression of the Arabidopsis thaliana geneThi2.1, encoding a fungal defense thionin, via the octadecanoid pathway. FEBSLett 437: 281-286
Bonas U, Conradsstrauch J, Balbo I (1993) Resistance in tomato to Xanthomonas-campestris pv vesicatoria is determined by alleles of the pepper-specific avirulencegene Avrbs3. Mol Gen Genet 238: 261-269
Cameron RK, Paiva NL, Lamb CJ, Dixon RA (1999) Accumulation of salicylic acidand PR-1 gene transcripts in relation to the systemic acquired resistance (SAR)response induced by Pseudomonas syringae pv. tomato in Arabidopsis. PhysiolMol Plant P 55: 121-130
59
Cao H, Bowling SA, Gordon AS, Dong X (1994) Characterization of an Arabidopsismutant that is nonresponsive to inducers of systemic acquired resistance. Plant Cell6: 1583-1592
Cao H, Glazebrook J, Clarke JD, Volko S, Dong X (1997) The Arabidopsis NPR1gene that controls systemic acquired resistance encodes a novel protein containingankyrin repeats. Cell 88: 57-63
Chamnongpol S, Willekens H, Moeder W, Langebartels C, Sandermann H, Jr., VanMontagu M, Inze D, Van Camp W (1998) Defense activation and enhancedpathogen tolerance induced by H2O2 in transgenic tobacco. Proc Natl Acad Sci US A 95: 5818-5823
Ciardi JA, Tieman DM, Jones JB, Klee HJ (2001) Reduced expression of the tomatoethylene receptor gene LeETR4 enhances the hypersensitive response toXanthomonas campestris pv. vesicatoria. Mol Plant Microbe Interact 14: 487-495
Ciardi JA, Tieman DM, Lund ST, Jones JB, Stall RE, Klee HJ (2000) Response toXanthomonas campestris pv. vesicatoria in tomato involves regulation of ethylenereceptor gene expression. Plant Physiol 123: 81-92
Clarke JD, Liu Y, Klessig DF, Dong X (1998) Uncoupling PR gene expression fromNPR1 and bacterial resistance: characterization of the dominant Arabidopsis cpr6-1mutant. Plant Cell 10: 557-569
Clarke JD, Volko SM, Ledford H, Ausubel FM, Dong X (2000) Roles of salicylicacid, jasmonic acid, and ethylene in cpr-induced resistance in Arabidopsis. PlantCell 12: 2175-2190
Cohen Y, Kuc J (1981) Evaluation of systemic resistance to blue mold induced intobacco-leaves by prior stem inoculation with Peronospora-hyoscyami F sptabacina. Phytopathology 71: 783-787
Delaney TP, Uknes S, Vernooij B, Friedrich L, Weymann K, Negrotto D, Gaffney T,Gutrella M, Kessmann H, Ward E, Ryals J (1994) A central role of salicylic-acid in plant-disease resistance. Science 266: 1247-1250
Despres C, DeLong C, Glaze S, Liu E, Fobert PR (2000) The ArabidopsisNPR1/NIM1 protein enhances the DNA binding activity of a subgroup of the TGAfamily of bZIP transcription factors. Plant Cell 12: 279-290
Dewdney J, Reuber TL, Wildermuth MC, Devoto A, Cui J, Stutius LM, DrummondEP, Ausubel FM (2000) Three unique mutants of Arabidopsis identify eds locirequired for limiting growth of a biotrophic fungal pathogen. Plant J 24: 205-218
Enkerli J, Gisi U, Mosinger E (1993) Systemic acquired-resistance to Phytophthora-infestans in tomato and the role of pathogenesis-related proteins. Physiol Mol PlantP 43: 161-171
60
Epple P, Apel K, Bohlmann H (1995) An Arabidopsis-thaliana thionin gene is induciblevia a signal-transduction pathway different from that for pathogenesis-relatedproteins. Plant Physiol 109: 813-820
Feys B, Benedetti CE, Penfold CN, Turner JG (1994) Arabidopsis mutants selected forresistance to the phytotoxin coronatine are male sterile, insensitive to methyljasmonate, and resistant to a bacterial pathogen. Plant Cell 6: 751-759
Friedrich L, Vernooij B, Gaffney T, Morse A, Ryals J (1995) Characterization oftobacco plants expressing a bacterial salicylate hydroxylase gene. Plant Mol Biol29: 959-968
Gaffney T, Friedrich L, Vernooij B, Negrotto D, Nye G, Uknes S, Ward E,Kessmann H, Ryals J (1993) Requirement of salicylic-acid for the induction ofsystemic acquired-resistance. Science 261: 754-756
Glazebrook J (2001) Genes controlling expression of defense responses in Arabidopsis--2001 status. Curr Opin Plant Biol 4: 301-308
Glazebrook J, Chen W, Estes B, Chang HS, Nawrath C, Metraux JP, Zhu T,Katagiri F (2003) Topology of the network integrating salicylate and jasmonatesignal transduction derived from global expression phenotyping. Plant J 34: 217-228
Glazebrook J, Rogers EE, Ausubel FM (1996) Isolation of Arabidopsis mutants withenhanced disease susceptibility by direct screening. Genetics 143: 973-982
Glazebrook J, Rogers EE, Ausubel FM (1997) Use of Arabidopsis for geneticdissection of plant defense responses. Annu Rev Genet 31: 547-569
Govrin EM, Levine A (2002) Infection of Arabidopsis with a necrotrophic pathogen,Botrytis cinerea, elicits various defense responses but does not induce systemicacquired resistance (SAR). Plant Mol Biol 48: 267-276
Gupta V, Willits MG, Glazebrook J (2000) Arabidopsis thaliana EDS4 contributes tosalicylic acid (SA)-dependent expression of defense responses: evidence forinhibition of jasmonic acid signaling by SA. Mol Plant Microbe Interact 13: 503-511
Hain R, Reif HJ, Krause E, Langebartels R, Kindl H, Vornam B, Wiese W,Schmelzer E, Schreier PH, Stocker RH, Stenzel K (1993) Disease resistanceresults from foreign phytoalexin expression in a novel plant. Nature 361: 153-156
Hammond-Kosack KE, Jones JD (1996) Resistance gene-dependent plant defenseresponses. Plant Cell 8: 1773-1791
61
Heck S, Grau T, Buchala A, Metraux JP, Nawrath C (2003) Genetic evidence thatexpression of NahG modifies defense pathways independent of salicylic acidbiosynthesis in the Arabidopsis-Pseudomonas syringae pv. tomato interaction.Plant J 36: 342-352
Hunt MD, Ryals JA (1996) Systemic acquired resistance signal transduction. Crit RevPlant Sci 15: 583-606
Jackson AO, Taylor CB (1996) Plant-microbe interactions: life and death at theinterface. Plant Cell 8: 1651-1668
Jeun YC, Siegrist J, Buchenauer H (2000) Biochemical and cytological studies onmechanisms of systemically induced resistance to Phytophthora infestans in tomatoplants. J Phytopathol 148: 129-140
Kinkema M, Fan W, Dong X (2000) Nuclear localization of NPR1 is required foractivation of PR gene expression. Plant Cell 12: 2339-2350
Klee HJ, Hayford MB, Kretzmer KA, Barry GF, Kishore GM (1991) Control ofethylene synthesis by expression of a bacterial enzyme in transgenic tomato plants.Plant Cell 3: 1187-1193
Kloek AP, Verbsky ML, Sharma SB, Schoelz JE, Vogel J, Klessig DF, Kunkel BN(2001) Resistance to Pseudomonas syringae conferred by an Arabidopsis thalianacoronatine-insensitive (coi1) mutation occurs through two distinct mechanisms.Plant J 26: 509-522
Kneissl ML, Deikman J (1996) The tomato E8 gene influences ethylene biosynthesis infruit but not in flowers. Plant Physiol 112: 537-547
Knoester M, Pieterse CM, Bol JF, Van Loon LC (1999) Systemic resistance inArabidopsis induced by rhizobacteria requires ethylene-dependent signaling at thesite of application. Mol Plant Microbe Interact 12: 720-727
Knoester M, van Loon LC, van den Heuvel J, Hennig J, Bol JF, Linthorst HJM(1998) Ethylene-insensitive tobacco lacks nonhost resistance against soil-bornefungi. Proc Natl Acad Sci U S A 95: 1933-1937
Kramell R, Miersch O, Atzorn R, Parthier B, Wasternack C (2000) Octadecanoid-derived alteration of gene expression and the "oxylipin signature" in stressed barleyleaves. Implications for different signaling pathways. Plant Physiol 123: 177-188
Kubigsteltig I, Laudert D, Weiler EW (1999) Structure and regulation of theArabidopsis thaliana allene oxide synthase gene. Planta 208: 463-471
Lanahan MB, Yen HC, Giovannoni JJ, Klee HJ (1994) The never ripe mutationblocks ethylene perception in tomato. Plant Cell 6: 521-530
62
Lawton K, Weymann K, Friedrich L, Vernooij B, Uknes S, Ryals J (1995) Systemicacquired resistance in Arabidopsis requires salicylic acid but not ethylene. MolPlant Microbe Interact 8: 863-870
Lawton KA, Friedrich L, Hunt M, Weymann K, Delaney T, Kessmann H, Staub T,Ryals J (1996) Benzothiadiazole induces disease resistance in Arabidopsis byactivation of the systemic acquired resistance signal transduction pathway. Plant J10: 71-82
Linthorst HJM (1991) Pathogenesis-related proteins of plants. Crit Rev Plant Sci 10:123-150
Lund ST, Stall RE, Klee HJ (1998) Ethylene regulates the susceptible response topathogen infection in tomato. Plant Cell 10: 371-382
Ma SW, Morris VL, Cuppels DA (1991) Characterization of a DNA region required forproduction of the phytotoxin coronatine by Pseudomonas-syringae pv tomato. MolPlant Microbe Interact 4: 69-74
McConn M, Browse J (1996) The critical requirement for linolenic acid is pollendevelopment, not photosynthesis, in an Arabidopsis mutant. Plant Cell 8: 403-416
Mittal S, Davis KR (1995) Role of the phytotoxin coronatine in the infection ofArabidopsis thaliana by Pseudomonas syringae pv. tomato. Mol Plant MicrobeInteract 8: 165-171
Moerschbacher BM, Noll U, Gorrichon L, Reisener HJ (1990) Specific-inhibition oflignification breaks hypersensitive resistance of wheat to stem rust. Plant Physiol93: 465-470
Moore RA, Starratt, A.N., Ma, S.-W. (1989) Identification of a chromosomal regionrequired for biosynthesis of the phytotoxin coronatine by Pseudomonas syringaepv. tomato. Can J Microbiol 35: 910-917
Nawrath C, Heck S, Parinthawong N, Metraux JP (2002) EDS5, an essentialcomponent of salicylic acid-dependent signaling for disease resistance inArabidopsis, is a member of the MATE transporter family. Plant Cell 14: 275-286
Nawrath C, Metraux JP (1999) Salicylic acid induction-deficient mutants ofArabidopsis express PR-2 and PR-5 and accumulate high levels of camalexin afterpathogen inoculation. Plant Cell 11: 1393-1404
Niderman T, Genetet I, Bruyere T, Gees R, Stintzi A, Legrand M, Fritig B,Mosinger E (1995) Pathogenesis-related PR-1 proteins are antifungal. Isolationand characterization of three 14-kilodalton proteins of tomato and of a basic PR-1of tobacco with inhibitory activity against Phytophthora infestans. Plant Physiol108: 17-27
63
O'Donnell PJ, Jones JB, Antoine FR, Ciardi J, Klee HJ (2001) Ethylene-dependentsalicylic acid regulates an expanded cell death response to a plant pathogen. Plant J25: 315-323
O'Donnell PJ, Schmelz E, Block A, Miersch O, Wasternack C, Jones JB, Klee HJ(2003) Multiple hormones act sequentially to mediate a susceptible tomatopathogen defense response. Plant Physiol 133: 1181-1189
O'Donnell PJ, Schmelz EA, Moussatche P, Lund ST, Jones JB, Klee HJ (2003)Susceptible to intolerance--a range of hormonal actions in a susceptibleArabidopsis pathogen response. Plant J 33: 245-257
Oldroyd GED, Staskawicz BJ (1998) Genetically engineered broad-spectrum diseaseresistance in tomato. Proc Natl Acad Sci U S A 95: 10300-10305
Park JH, Halitschke R, Kim HB, Baldwin IT, Feldmann KA, Feyereisen R (2002) Aknock-out mutation in allene oxide synthase results in male sterility and defectivewound signal transduction in Arabidopsis due to a block in jasmonic acidbiosynthesis. Plant J 31: 1-12
Parker JE, Szabo V, Staskawicz BJ, Lister C, Dean C, Daniels MJ, Jones JDG(1993) Phenotypic characterization and molecular mapping of the Arabidopsis-thaliana locus Rpp5, determining disease resistance to Peronospora-parasitica.Plant J 4: 821-831
Pearce G, Strydom D, Johnson S, Ryan CA (1991) A polypeptide from tomato leavesinduces wound-inducible proteinase-inhibitor proteins. Science 253: 895-898
Penninckx IA, Eggermont K, Terras FR, Thomma BP, De Samblanx GW, BuchalaA, Metraux JP, Manners JM, Broekaert WF (1996) Pathogen-induced systemicactivation of a plant defensin gene in Arabidopsis follows a salicylic acid-independent pathway. Plant Cell 8: 2309-2323
Penninckx IAMA, Thomma BPHJ, Buchala A, Metraux JP, Broekaert WF (1998)Concomitant activation of jasmonate and ethylene response pathways is requiredfor induction of a plant defensin gene in Arabidopsis. Plant Cell 10: 2103-2113
Pieterse CMJ, van Wees SCM, van Pelt JA, Knoester M, Laan R, Gerrits N,Weisbeek PJ, van Loon LC (1998) A novel signaling pathway controllinginduced systemic resistance in Arabidopsis. Plant Cell 10: 1571-1580
Rick CM, Butler L (1956) Cytogenetics of the tomato. Adv Genet 8: 267-382
Ryals JA, Neuenschwander UH, Willits MG, Molina A, Steiner HY, Hunt MD(1996) Systemic acquired resistance. Plant Cell 8: 1809-1819
64
Schmelz EA, Engelberth J, Alborn HT, O'Donnell P, Sammons M, Toshima H,Tumlinson JH, 3rd (2003) Simultaneous analysis of phytohormones, phytotoxins,and volatile organic compounds in plants. Proc Natl Acad Sci U S A 100: 10552-10557
Seo HS, Song JT, Cheong JJ, Lee YH, Lee YW, Hwang I, Lee JS, Choi YD (2001)Jasmonic acid carboxyl methyltransferase: A key enzyme for jasmonate-regulatedplant responses. Proc Natl Acad Sci U S A 98: 4788-4793
Showalter AM, Bell JN, Cramer CL, Bailey JA, Varner JE, Lamb CJ (1985)Accumulation of hydroxyproline-rich glycoprotein messenger-RNAs in response tofungal elicitor and infection. Proc Natl Acad Sci U S A 82: 6551-6555
Sisler EC, Serek M (1997) Inhibitors of ethylene responses in plants at the receptorlevel: Recent developments. Physiol Plantarum 100: 577-582
Spoel SH, Koornneef A, Claessens SM, Korzelius JP, Van Pelt JA, Mueller MJ,Buchala AJ, Metraux JP, Brown R, Kazan K, Van Loon LC, Dong X, PieterseCM (2003) NPR1 modulates cross-talk between salicylate- and jasmonate-dependent defense pathways through a novel function in the cytosol. Plant Cell 15:760-770
Stenzel I, Hause B, Maucher H, Pitzschke A, Miersch O, Ziegler J, Ryan CA,Wasternack C (2003) Allene oxide cyclase dependence of the wound response andvascular bundle-specific generation of jasmonates in tomato - amplification inwound signalling. Plant J 33: 577-589
Stintzi A, Weber H, Reymond P, Browse J, Farmer EE (2001) Plant defense in theabsence of jasmonic acid: The role of cyclopentenones. Proc Natl Acad Sci U S A98: 12837-12842
Strobel NE, Ji C, Gopalan S, Kuc JA, He SY (1996) Induction of systemic acquiredresistance in cucumber by Pseudomonas syringae pv syringae 61 HrpZ(Pss)protein. Plant J 9: 431-439
Summermatter K, Sticher L, Metraux JP (1995) Systemic responses in Arabidopsisthaliana infected and challenged with Pseudomonas syringae pv syringae. PlantPhysiol 108: 1379-1385
Van Loon LC, Van Strien EA (1999) The families of pathogenesis-related proteins,their activities, and comparative analysis of PR-1 type proteins. Physiol Mol PlantP 55: 85-97
Van Wees SC, Glazebrook J (2003) Loss of non-host resistance of Arabidopsis NahG toPseudomonas syringae pv. phaseolicola is due to degradation products of salicylicacid. Plant J 33: 733-742
65
Vernooij B, Friedrich L, Goy PA, Staub T, Kessmann H, Ryals J (1995) 2,6-dichloroisonicotinic acid-induced resistance to pathogens without the accumulationof salicylic-acid. Mol Plant Microbe Interact 8: 228-234
Vernooij B, Friedrich L, Morse A, Reist R, Kolditz-Jawhar R, Ward E, Uknes S,Kessmann H, Ryals J (1994) Salicylic acid is not the translocated signalresponsible for inducing systemic acquired resistance but is required in signaltransduction. Plant Cell 6: 959-965
Vijayan P, Shockey J, Levesque CA, Cook RJ, Browse J (1998) A role for jasmonatein pathogen defense of Arabidopsis. Proc Natl Acad Sci U S A 95: 7209-7214
Ward ER, Uknes SJ, Williams SC, Dincher SS, Wiederhold DL, Alexander DC,Ahl-Goy P, Metraux JP, Ryals JA (1991) Coordinate gene activity in response toagents that induce systemic acquired resistance. Plant Cell 3: 1085-1094
Weiler EW, Kutchan TM, Gorba T, Brodschelm W, Niesel U, Bublitz F (1994) ThePseudomonas phytotoxin coronatine mimics octadecanoid signalling molecules ofhigher plants. FEBS Lett 345: 9-13
Wildermuth MC, Dewdney J, Wu G, Ausubel FM (2001) Isochorismate synthase isrequired to synthesize salicylic acid for plant defence. Nature 414: 562-565
Xie DX, Feys BF, James S, Nieto-Rostro M, Turner JG (1998) COI1: An Arabidopsisgene required for jasmonate-regulated defense and fertility. Science 280: 1091-1094
Yamamoto S, Katagiri M, Maeno H, Hayaishi O (1965) Salicylate hydroxylase, amonooxygenase requiring flavin adenine dinucleotide. I. Purification and generalproperties. J Biol Chem 240: 3408-3413
Zhao Y, Thilmony R, Bender CL, Schaller A, He SY, Howe GA (2003) Virulencesystems of Pseudomonas syringae pv. tomato promote bacterial speck disease intomato by targeting the jasmonate signaling pathway. Plant J 36: 485-499
Zhou N, Tootle TL, Tsui F, Klessig DF, Glazebrook J (1998) PAD4 functionsupstream from salicylic acid to control defense responses in Arabidopsis. Plant Cell10: 1021-1030
66
BIOGRAPHICAL SKETCH
Anna Block was born on the 13th of May 1978 in Nottingham, England. She
completed her GCSE’s and A levels at John Mason School in Abingdon, Oxfordshire, in
1994 and 1996 respectively. She then went on to receive her master’s degree in
biochemistry from the University of Bath in 2000. During her master’s degree she
accomplished two 6-month internships. The first internship was in 1998 for Rhone-
Poulenc in Essex and the second in 1999 in the laboratory of Harry Klee at the University
of Florida. She returned to the University of Florida in 2000 for her doctoral studies in
the plant cellular and molecular biology program
top related