Rapid Detection of Watermelon Viruses by Reverse ......ORIGINAL ARTICLE Rapid Detection of Watermelon Viruses by Reverse Transcription Loop-Mediated Isothermal Amplification Lei Zhao1,2,
Post on 26-Jun-2020
2 Views
Preview:
Transcript
ORIGINAL ARTICLE
Rapid Detection of Watermelon Viruses by Reverse TranscriptionLoop-Mediated Isothermal AmplificationLei Zhao1,2, Yang Liu1,2, Yunfeng Wu1,2 and Xingan Hao1,2
1 College of Plant Protection, State Key Laboratory of Crop Stress Biology for Arid Areas, Key Laboratory of Crop Pest Integrated Pest Management
on Crop in Northwestern Loess Plateau, Ministry of Agriculture, Northwest A&F University, Yangling 712100, China
2 Key Laboratory of Plant Protection Resources and Pest Management, Ministry of Education, Northwest A&F University, Yangling 712100, China
Keywords
detection, RT-LAMP, watermelon virus
Correspondence
Y.-F. Wu and X.-A. Hao, Northwest A&F
University, Yangling, China.
E-mails: wuyf@nwsuaf.edu.cn (Y-FW) and
haoxingan@nwsuaf.edu.cn (X-AH)
Received: April 12, 2015; accepted: October
3, 2015.
doi: 10.1111/jph.12461
Abstract
In this study, a stable, sensitive and specific one-step reverse transcription
loop-mediated isothermal amplification (RT-LAMP) assay was developed
to detect three watermelon viruses. The RT-LAMP primers were designed
based on the coat protein gene sequences of the watermelon mosaic virus
(WMV) and the squash mosaic virus (SqMV), as well as the cylindrical
inclusion protein gene sequence of the zucchini yellow mosaic virus (ZYMV).
Results could be obtained within an hour at temperatures of 60–61°C. Thesensitivity of the RT-LAMP assay was 10–100 times higher than that of
the conventional RT-PCR method. In addition, RT-LAMP does not require
specialized equipment and can be performed under general experimental
conditions. This report is the first to use RT-LAMP for WMV, SqMV and
ZYMV detection. The proposed RT-LAMP method has great potential for
applications in watermelon virus detection, identification and control
strategies.
Introduction
Watermelon (Citrullus lanatus) is an economically hor-
ticultural crop widely grown in China from north
(Inner Mongolia) to south (Hainan) and from west
(Tibet) to east (Zhejiang). In China, the area for the
production of watermelon is approximately 60% of
the world total (FAOSTAT, 2003; Xu et al. 2004).
However, virus diseases significantly reduce the qual-
ity and yield of watermelons (Nameth et al. 1985).
The major viruses that infect watermelon plants in
China include the watermelon mosaic virus (WMV), zuc-
chini yellow mosaic virus (ZYMV), squash mosaic virus
(SqMV), cucumber mosaic virus (CMV) and tobacco
mosaic virus (TMV) (Ma et al. 2005; Wang et al. 2010).
Among these viruses, WMV and ZYMV are members
of the genus Potyvirus in the Potyviridae plant virus
family and induce similar foliar symptoms, including
systemic chlorosis, mosaic, severe leaf deformation,
vein banding, reduced leaf laminae and plant stunting
(Shukla et al. 1994; Zitter et al. 1996; Marc et al.
1997; Adams et al. 2011). SqMV is a member of the
genus Comovirus in the family Comoviridae, which
induces curling of leaves, mottling, vein clearing, yel-
lowish spotting, domelike swellings, and light and
dark green mottling (Freitag 1956; Zitter and Banik
1984).
Watermelons infected by viral diseases mainly show
symptoms of leaf roll, mosaic and deformation; thus,
the exact virus that causes the disease is difficult to
determine (Wang et al. 2010). Loop-mediated
isothermal amplification (LAMP) was developed to
offer a feasible method for the rapid and sensitive
detection of target genes (Notomi et al. 2000; Naga-
mine et al. 2002). This method is simple, sensitive
and specific. The result can be analysed through gel
electrophoresis or directly observed by the naked eye
(Notomi et al. 2000; Nagamine et al. 2002; Zhao et al.
2012). Numerous reports have been published on the
detection of CMV and TMV by the RT-LAMP method
(Liu et al. 2010; Peng et al. 2012; Zhao et al. 2012),
but only a few focus on WMV, SqMV and ZYMV. In
this study, we developed one-step RT-LAMP assays
for the rapid detection of WMV, SqMV and ZYMV.
J Phytopathol 164 (2016) 330–336 � 2015 Blackwell Verlag GmbH330
J Phytopathol
This work is the first to report the use of RT-LAMP for
WMV, SqMV and ZYMV detection.
Materials and Methods
Materials
A total of 30 WMV-, ZYMV- and SqMV-infected
watermelon plant leaves were collected from fields at
Yangling, Rougu and Fufeng in Shaanxi Province in
2011. After detection by RT-PCR, three single virus
samples were stored at �80°C. The viral isolates were
mechanically sap-transmitted to watermelon plants in
a growth chamber in 2012. The experiment was per-
formed with leaf samples that showed obvious symp-
toms; virus-free watermelon plants were used as
healthy controls. The clinical samples were collected
from the field in different regions of Shaanxi Province
in 2012 and 2013.
RNA extraction
Total RNA was extracted from fresh young leaf tissue
with Trizol reagent by following the manufacturer’s
instructions (Invitrogen, Carlsbad, CA, USA). The
extracted RNA was resuspended in 40 ll of RNase-
free water; the RNA concentration and quality were
detected by spectrophotometric analysis (DU Series
500UV-Vis; Beckman, Brea, CA, USA) and 2% agar-
ose gel electrophoresis. The RNA samples were stored
at �80°C until further use.
Primer design
The coat protein gene sequences of WMV and SqMV
and the cylindrical inclusion protein gene sequences
of ZYMV were the relatively conservative genes of
each complete genome sequence. Therefore, the par-
tial sequence of the representative coat protein gene
of WMV (from 9150 to 9345 bp) and SqMV (from
2081 to 2308 bp), as well as the cylindrical inclusion
protein gene sequences of ZYMV (from 4818 to
5015 bp), were selected to design primers using the
PRIMER EXPLORER software version 4.0 (Eiken Chemical
Co., Ltd., Tochigi, Japan http://primerexplorer.jp/e/
v4_manual/index.html). All the primers used in this
study are listed in Table 1. The primers for RT-PCR
were designed as described by Wang et al. (2010).
Optimization of RT-LAMP amplification and RT-PCR
The RT-LAMP reaction total volume was 25 ll,which contained 1.6 lM each of the inner primers
FIP (WMV-FIP, ZYMV-FIP, SqMV-FIP) and BIP
(WMV-BIP, ZYMV-BIP, SqMV-BIP), 0.2 lM each of
the outer primers F3 and B3, 5 mM MgSO4, 1.0 mM
dNTP mix (Promega, Madison, WI, USA), 19 Ther-
moPol buffer (20 mM Tris–HCl, 10 mM KCl, 2 mM
MgSO4, 10 mM (NH4)2SO4, and 0.1% Triton X-
100), 1.0 M betaine (Sigma-Aldrich, St. Louis, MO,
USA), 4 U RNasin, 10 U reverse transcriptase (M-
MLV RT; Promega), 10 U Bst DNA polymerase
(large fragment; New England Biolabs Inc., Beverly,
MA, USA) and 1 ll target RNA.The mixture was incubated at 60–65°C (with 1°C
intervals) for 60 min with a Loopamp real-time tur-
bidimeter (LA-230; Eiken Chemical Co., Ltd.). The
RT-LAMP products were analysed through real-time
turbidity monitoring, electrophoresis in 2% agarose
gels containing ethidium bromide (EB) and direct
visual inspection of the reaction tube under white
Table 1 Primers used in this studyVirus Primer name Sequence 50–30
WMV WMV-F3 TGAACCTTCCAACAGTTG
WMV-B3 CACCAAACCATAAAACCATTC
WMV-FIP GTTGCTCGAGTGTTAAACAAATCAAGTGGGAAAATCATTCTCAGC
WMV-BIP AACACAGTTTGAATCATGGTACAGCTAATCACACCCATCTGCTC
ZYMV ZYMV-F3 TCACCACACATGGAGTTTC
ZYMV-B3 ATGCAACCTTGTTGAGCA
ZYMV-FIP ATGAGTGGTGAAGAAAGGAGTTAGCAGTGCACAGTTAAACAGATG
ZYMV-BIP CTAATCCGCCATGATGGTAGTATGTTCTGAATCCCTGAGTTTGA
SqMV SqMV-F3 TTACAGACTTGGCTCTAGTG
SqMV-B3 AAATAACAGCATCTGGCATAT
SqMV-FIP AGAAGCGTGTGCAGAACTAATCGGCATATCGATAGAAACTTGT
SqMV-BIP GGCCTGCACGTGTTCTAAAATCATTAGAATAGCATCTTTGGTG
SqMV, squash mosaic virus; WMV, watermelon mosaic virus; ZYMV, zucchini yellow mosaic virus.
J Phytopathol 164 (2016) 330–336 � 2015 Blackwell Verlag GmbH 331
L. Zhao et al. RT-LAMP assay for watermelon viruses
light after the addition of 1 ll SYBR green I� (10009;
Invitrogen).
The RT-PCR assay for detecting the three viruses
was developed as described by Wang et al. (2010).
The RT-PCR products were analysed with 2% agarose
for gel electrophoresis.
Specificity and sensitivity comparisons of RT-LAMP
and RT-PCR
The specificity of the RT-LAMP assay was evaluated
by adding different RNA samples to the RT-LAMP
reaction. For example, to test the specificity of RT-
LAMP for the WMV virus, the RNAs of ZYMV,
SqMV, CMV and TMV were adopted as templates
for amplification. The specificity for other viruses
was tested in the same manner. The amplification
products were analysed through real-time turbidity
monitoring.
The sensitivity of the RT-LAMP assay was evaluated
and compared with that of RT-PCR using the same
templates at the same concentrations. The total RNA
was serially diluted tenfold and amplified by the two
amplification reactions, which were sequentially set-
up. The amplification products were analysed through
real-time turbidity monitoring.
Evaluation of RT-LAMP with field samples
The 70 clinical samples collected from the field were
amplified and analysed through the RT-PCR and RT-
LAMP assays. The virus-free sample was used as the
healthy control. The amplification products were
analysed through real-time turbidity monitoring. The
reaction temperature was 59°C for WMV or 61°C for
ZYMV and SqMV.
Results
Detection methods of RT-LAMP
Total RNA was extracted from each sample as
described above; the extracted RNA was used as the
template for RT-PCR and RT-LAMP. RT-PCR products
were analysed through agarose gel electrophoresis.
The virus-infected samples showed specific bands,
whereas the negative controls showed none (Fig. 1a).
When the RT-LAMP products were analysed through
agarose gel electrophoresis, the virus-infected samples
showed multiple bands, whereas the negative control
showed one band (Fig. 1b). When SYBR Green I was
added into the reaction mixtures in the tubes, the
virus-infected sample produced a green colour under
daylight compared with the brown colour of the nega-
tive control (Fig. 1c).
Influence of different temperatures in RT-LAMP
The effects of different temperatures on RT-LAMP
were tested for each primer pair. The temperature
ranged from 60 to 65°C with 1°C intervals. Results
showed that when the temperature of RT-LAMP ran-
ged from 60 to 65°C, the typical ladder-like pattern of
a RT-LAMP reaction for WMV, ZYMV and SqMV
could be observed. In the WMV detection assay, 60°Cwas chosen as the optimal reaction temperature
because its shortest amplification time was 25 min
(Fig. 2a). For the other two viruses, the optimal tem-
perature for RT-LAMP was 61°C (Fig. 2b,c).
Sensitivity and specificity of RT-LAMP and RT-PCR
To evaluate the sensitivity of the RT-LAMP assay, the
RNA was serially diluted tenfold and tested. For
WMV, the RT-PCR products could not be detected
when the RNA was diluted to 2.1 9 10�5 ng/ll
(a)
(b)
(c)
Fig. 1 Determination of watermelon mosaic virus (WMV), zucchini yel-
low mosaic virus (ZYMV) and squash mosaic virus (SqMV) by RT-PCR
and reverse transcription loop-mediated isothermal amplification (RT-
LAMP) assays. Lane M1: Marker IV, +: sample infected with different
virus (WMV, ZYMV and SqMV), �: negative control (virus-free sample).
(a) RT-PCR analysis of virus by agarose gel electrophoresis. (b) RT-LAMP
analysis of virus by agarose gel electrophoresis. (c) RT-LAMP analysis of
virus by SYBR Green I staining.
J Phytopathol 164 (2016) 330–336 � 2015 Blackwell Verlag GmbH332
RT-LAMP assay for watermelon viruses L. Zhao et al.
(Fig. 3a), but RT-LAMP products could still be
detected up to 2.1 9 10�6 ng/ll (Fig. 3b). For ZYMV,
the RT-PCR products could not be detected until the
RNA was diluted to 2.7 9 10�4 ng/ll (Fig. 4a), but
RT-LAMP products could be precisely detected when
the RNA was diluted to 2.7 9 10�5 ng/ll (Fig. 4b).
For SqMV, the RT-PCR products could be detected
when the RNA was diluted to 3.3 9 10�3 ng/ll(Fig. 5a), but RT-LAMP products could be detected
when the RNA was diluted to 3.3 9 10�4 ng/ll(Fig. 5b). These results demonstrated that the sensi-
(a)
(b)
(c)
Fig. 2 Determination of the optimal temperature for the reverse tran-
scription loop-mediated isothermal amplification (RT-LAMP) assay of
watermelon mosaic virus (a), zucchini yellow mosaic virus (b) and
squash mosaic virus (c). RT-LAMP reactions at 60–65°C (tested every
one degree).
(a)
(b)
Fig. 3 Determination of the sensitivity of the reverse transcription loop-
mediated isothermal amplification (RT-LAMP) assay for watermelon
mosaic virus. Lane M1: Marker IV; Lane 1–9: tenfold dilutions of template
RNA, 2.1 9 102–2.1 9 10�6 ng/ll, respectively; Lane 10: negative con-
trol. Agarose gel electrophoresis analysis of (a) RT-PCR and (b) RT-LAMP.
(a)
(b)
Fig. 4 Determination of the sensitivity of the reverse transcription
loop-mediated isothermal amplification (RT-LAMP) assay for zucchini yel-
low mosaic virus. Lane M1: Marker I; Lane 1–8: tenfold dilutions of tem-
plate RNA, 2.7 9 101–2.7 9 10�6 ng/ll, respectively; Lane 9: negative
control. Agarose gel electrophoresis analysis of (a) RT-PCR and (b) RT-
LAMP.
J Phytopathol 164 (2016) 330–336 � 2015 Blackwell Verlag GmbH 333
L. Zhao et al. RT-LAMP assay for watermelon viruses
tivity of the RT-LAMP assay was 10–100 times higher
than that of the conventional RT-PCR for virus
detection.
To detect the specificity of RT-LAMP, the RT-LAMP
primers of WMV, ZYMV and SqMV were used to
detect WMV, ZYMV, SqMV, TMV and CMV. Results
showed that only the corresponding viruses gave posi-
tive results (Table 2), thereby indicating that the
group of sequence-specific primers were specific for
detecting a particular virus.
Testing field samples using RT-PCR and RT-LAMP
A total of 70 field samples infected by one or more
viruses were analysed through RT-PCR and
RT-LAMP. Results showed that all the positive
samples detected by RT-PCR were also positive when
detected by RT-LAMP, but some positive
samples detected by RT-LAMP were negative for RT-
PCR. This result indicated the reliability and sensitiv-
ity of RT-LAMP. A portion of the detection results is
shown in Table 3.
Discussion
From early April to late May 2007, a continuous
drought affected Shaanxi Province in China and
induced an aphid outbreak. The aphids mainly
reduced the watermelon yield by transmitting viruses.
Some of the affected fields had no harvest at all,
which seriously decreased the enthusiasm of water-
melon farmers (Wang et al. 2010). Viral diseases are
notoriously difficult to control and have been called
‘plant cancers.’ Early virus identification is important
to prevent its transmission.
In this study, an accurate and efficient water-
melon virus detection method, RT-LAMP, was
developed. This method made the detection of
watermelon viruses much easier. Less than 1 h was
needed to obtain the detection results. This method
did not involve special instruments or a complicated
process. Moreover, the sensitivity of the RT-LAMP
assay was 10–100 times higher than that of the
conventional RT-PCR. All the primers in this study
were specific for detecting a particular virus. The
optimal reaction temperatures for the three water-
melon viruses were also determined. The use of
total RNA as the template in RT-LAMP is the cur-
rent standard; viral RNA isolation has not been per-
formed to the best of our knowledge. Given the
various differences in RNA extraction methods
between viruses and total RNA, the use of total
RNA is the most effective and direct method to
evaluate RT-LAMP. The greatest disadvantage of the
watermelon virus detection method is that the RT-
LAMP reaction can be easily contaminated. How-
ever, the pre-addition of SYBR Green I was recently
developed to significantly decrease the probability of
contamination. Another disadvantage is that the
primers for RT-LAMP are occasionally difficult to
design. Although primer design software is avail-
able, most automatically generated primers cannot
(a)
(b)
Fig. 5 Determination of the sensitivity of the reverse transcription loop-
mediated isothermal amplification (RT-LAMP) assay for squash mosaic
virus. Lane M1: Marker I; Lane 1–8: tenfold dilutions of template RNA,
3.3 9 101–3.3 9 10�6 ng/ll, respectively; Lane 9: negative control.
Agarose gel electrophoresis analysis of (a) RT-PCR and (b) RT-LAMP.
Table 2 Determination of the specificity for reverse transcription loop-
mediated isothermal amplification (RT-LAMP) assay
PrimersWMVa ZYMV SqMV
Virus EP SYBR EP SYBR EP SYBR
WMVb + + � � � �ZYMV � � + + � �SqMV � � � � + +
CMV � � � � � �TMV � � � � � �
aThe primers for RT-LAMP of WMV.bRNA template of leaf infected by WMV.
EP, the RT-LAMP amplification tested by electrophoresis; SYBR, the RT-
LAMP amplification by adding SYBR Green I; +, positive result; �, nega-
tive result; CMV, cucumber mosaic virus; SqMV, squash mosaic virus;
WMV, watermelon mosaic virus; ZYMV, zucchini yellow mosaic virus;
TMV, tobacco mosaic virus.
J Phytopathol 164 (2016) 330–336 � 2015 Blackwell Verlag GmbH334
RT-LAMP assay for watermelon viruses L. Zhao et al.
be used in experiments. In this study, we chose
three primer pairs for each virus, but none of the
seemingly well-designed primer pairs for ZYMV
could work (data not shown). Therefore, we rede-
signed the primer from the cylindrical inclusion
protein gene sequences of ZYMV. In addition, for
the sequence whose primers could not be automati-
cally designed, only the manually approach was
possible.
In conclusion, although the RT-LAMP assay has
shortcomings, its advantages far outweigh its disad-
vantages. As an efficient, fast and accurate molecular
virus detection method, RT-LAMP has great potential
for a broad range of prospective applications in virus
disease control strategies for watermelon.
Acknowledgements
This study was supported by the Special Fund for
Agro-scientific Research in the Public Interest (No.
201303028), Foundation Research Project of Shaanxi
Province (No. 2015JM3091), Basal Research Fund of
NWAFU (No. 2014YB088) and the 111 Project from
the Education Ministry of China (No. B07049).
References
Adams MJ, Zerbini FM, French R, Rabenstein F, Stenger
DC, Valkonen JPT. (2011) Family Potyviridae. In: King
AMQ, Adams MJ, Carstens EB, Lefkowits EJ. (eds).
Virus Taxonomy. Ninth Report of the International
Committee on Taxonomy of Viruses. Amsteram,
The Netherlands, Elsevier-Academic Press, pp 1069–1089.
FAOSTAT, Food and Agriculture Organization of the Uni-
ted Nations (2003). Internet Resource: http://faostat.
fao.org (verified Oct 29, 2015).
Freitag JH. (1956) Beetle transmission, host range, and
properties of squash mosaic virus. Phytopathology
46:73–81.Liu YH, Wang ZD, Qian YM, Mu JM, Shen LL, Wang FL,
Yang JG. (2010) Rapid detection of tobacco mosaic virus
using the reverse transcription loop-mediated isothermal
amplification method. Arch Virol 155:1681–1685.Ma SQ, Xu Y, Gong GY, Zhang HY, Shen HL. (2005) Anal-
ysis on the inheritance of resistance to PRSV-W and
ZYMV-CH and their linkage in watermelon. J Fruit Sci
22:731–733.Marc F, James R, McFerson DM et al. (1997) Cantaloupe
line CZW-30 containing coat protein genes of cucumber
mosaic virus, zucchini yellow mosaic virus, and water-
melon mosaic virus-2 is resistant to these three viruses
in the field. Mol Breeding 3:279–290.
Table
3Detectionoffield
sampleswithreversetranscriptionloop-m
ediatedisotherm
alamplification(RT-LAMP)assay
Samples
12
34
56
78
910
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
CK
WMV
RP
+�
��
+�
�+
�+
+�
+�
��
+�
+�
��
++
��
�+
�+
�RL
+�
+�
+�
�+
�+
+�
+�
��
+�
+�
��
++
�+
�+
�+
�ZYMV
RP
+�
��
�+
�+
+�
+�
��
�+
��
++
��
++
��
++
��
�RL
+�
��
�+
�+
+�
+�
��
�+
+�
++
��
++
��
++
��
�SqMV
RP
��
+�
��
+�
��
��
++
��
++
++
+�
�+
��
�+
��
�RL
��
+�
��
+�
��
��
++
��
++
++
+�
�+
��
�+
��
�
RP,RT-PCRassay;RL,RT-LAMPassay;CK:negativeco
ntrol;+,positiveresult;�,
negativeresult;SqMV,squash
mosaicvirus;WMV,waterm
elonmosaicvirus;ZYMV,zucchiniyellowmosaicvirus.
J Phytopathol 164 (2016) 330–336 � 2015 Blackwell Verlag GmbH 335
L. Zhao et al. RT-LAMP assay for watermelon viruses
Nagamine K, Hase T, Notomi T. (2002) Accelerated reac-
tion by loop-mediated isothermal amplification using
loop primers. Mol Cell Probes 16:223–229.Nameth ST, Dodds JA, Paulus AO, Kishaba A. (1985) Zuc-
chini yellow mosaic virus associated with severe diseases
of melon and watermelon in southern California desert
valleys. Plant Dis 69:785–788.Notomi T, Okayama H, Masubuchi H, Toshihiro Y, Keiko
W, Nobuyuki A, Hase T. (2000) Loop-mediated isother-
mal amplification of DNA. Nucleic Acids Res 28:E63.
Peng J, Shi MJ, Xia ZH, Huang JS, Fan ZF. (2012) Detec-
tion of cucumber mosaic virus isolates from banana by
one-step reverse transcription loop-mediated isothermal
amplification. Arch Virol 157:2213–2217.Shukla DD, Ward CW, Brunt AA. (1994) Genome struc-
ture, variation, and function. In: Shukla DD. (ed.). The
Potyviridae. Cambridge, CAB International, pp 74–112.Wang WL, Zhang H, Yu XQ, Wu YF, Zhang WB, Zhang CP.
(2010) Establishment and application of multipIex RT-
PCR for simultaneous detection of five watermelon
viruses ZYMV, WMV, TMV, SqMV and CMV. Acta Phy-
topathol Sin 40:27–32.Xu Y, Kang D, Shi Z, Shen H, Whner T. (2004) Inheritance
of resistance to zucchini yellow mosaic virus and water-
melon mosaic virus in watermelon. J Hered 95:498–502.Zhao L, Cheng JL, Hao XA, Tian XM, Wu YF. (2012) Rapid
detection of tobacco viruses by reverse transcription
loop-mediated isothermal amplification. Arch Virol
157:2291–2298.Zitter TA, Banik MT. (1984) Dept. of Plant Pathology,
Cornell University, and R. Provvidenti, Dept. of Plant
Pathology, New York State Agricultural Experiment
Station, Geneva. Virus Diseases of Cucurbits. Fact Sheet
Page: 732.40. Internet Resource: http://vegetablemdon
line.ppath.cornell.edu/factsheets/Viruses_Cucurbits.htm
(verified Oct 29, 2015).
Zitter T, Hopkins DL, Thomas CE. (1996) Diseases caused
by viruses. In: Provident R. (ed.). Compendium of
Cucurbit Diseases. St. Paul, APS Press, pp 37–45.
J Phytopathol 164 (2016) 330–336 � 2015 Blackwell Verlag GmbH336
RT-LAMP assay for watermelon viruses L. Zhao et al.
top related