Genetic between ABA Insensitive Mutant, ABA Mutant, · Abstract Genetic Interactions between the ABA Insensitive Mutant, abil-1, and the ABA Supersensitive Mutant, era14, in Arabidopsis
Post on 03-Apr-2018
231 Views
Preview:
Transcript
Genetic Interactions between the
ABA Insensitive Mutant, abil-i, and the ABA Supersensitive Mutant, ers14,
in Ambidopsis thaliana.
Nocha Van Thielen
A thesis submitted in wnformity with the requirements for the degree of Master of Science
Graduate Deparûnent of Botany in the
University of Toronto
O Copyright by Nocha Van Thielen, 1999
National Library Bibliothèque nationale du Canada
Acquisitions and Acquisitions et Bibliographie Services services bibliographiques
395 Wellington Street 395, rue Welliigtori OUawaON KlAON4 Oaawa ON K I A ûN4 canada Canada
The author has granted a non- exclusive licence allowing the National Library of Canada to reproduce, loan, distribute or sell copies of this thesis in microform, paper or electronic formats.
The author retains ownership of the copyright in this thesis. Neither the thesis nor substantial extracts fiom it may be printed or otherwise reproduced without the author's permission.
L'auteur a accordé une licence non exclusive permettant à la BibIiothèque nationale du Canada de reproduire, prêter, distniuer ou vendre des copies de cette thèse sous la forme de microfiche/nlm, de reproduction sur papier ou sur format électronique.
L'auteur conserve la propriété du droit d'auteur qui protège cette thèse. Ni la thèse ni des extraits substantiels de celle-ci ne doivent être imprimés ou autrement reproduits sans son autorisation.
Abstract
Genetic Interactions between the
ABA Insensitive Mutant, abil-1, and the ABA Supersensitive Mutant, era14,
in Arabidopsis thaliana.
bÿ
Nocha Eleonor Van Thielen
Degree of Master's of Science
Graduate Department of Botany, University of Toronto
Abstract
The mutant, abil-1 (ABA insensitive), is insensitive to exogenous and endogenous ABA
(abscisic acid) and thus is defective for a number of physiological responses. The
mutant, era14 (enhanced response to ABA), was isolated in a suppressor screen of
abil-1. The era7-4 mutant is able ta suppress many of the defective ABA responses of
abil-1 examined to varying degrees, from not at al1 to cornplete suppression, depending
on the character. Further study of the abil-1 and the era l4 mutants revealed
developmental defects previously unreported. When the two mutations are combined,
there are more severe developmental effects specifically in the stomate and florai organ
number. This implies AB11 and ERAl may have broader roles in Arabidopsis developrnent
than previously known.
List of Abbreviations
List of Abbreviations
ABA AB17
cm CM CTAB DNA EDTA ERAI FI F2 mase FW Kb Ler LSM M a min(s) rd m MOPS MS Ncol PAGE PCR PPK: ra bAea/de hydrin
w RNA RT SDS S C SSLP TAE TB€ 7E UV vol (s) w/v "C E Pg CM Im
abscisic acid ABA insensitive locus base pairs confidence intewal centimeters centi Morgans cetyl methyi ammonium bromide deoxyribonucleic acid ethlenediaminetetra-acetic acid enhanced response to ABA locus first generation offspring second generation offspring famesyltransferase fresh weight kilobase pairs Landsberg erecta ecotype least squares mean Meyerowitz Columbia ecotype minute@) milliliters millimeters 3-[N-morpholino]propanesuI phonic acid Murashige and Skoog enzyme isolated from Nocardia corollina polyacrylamide gel electrophoresis polymerase chain reaction protein phosphatase 2C responsive to ABA/ late embryogenesis abundantldehydration induced restriction fragment length polymorphism ribonucleic acid room temperature sodium dodecyl sulfate sodium chloridelsodium citrate solution short sequence length polymorphisrn tris-acetate1EDTA electrophoresis buffer tris/borate/EDTA electrop horesis buffer Tris HCVEDTA ultraviolet volume(s) weight pet volume degrees centigrade micro Einsteins micrograms mimmolar micrometers
Table of Contents
Table of Contents
Abstract ii Ab breviations iii List of Figures vi List of Tables vii
4 1.2.0 ABA Responsive Mutants -,a,-,-,-,,,,-,,,,,,---------,-------
1.2.1 ABA Insensitive Mutants 5 1.2.3 Enhanced Response to ABA Mutants 10
2.2 Genetic Methods ---II 2.2.1 Polymerase Chain Reaction (PCR) Conditions of AB11 Locus 17 2.2.2 Mapping Studies 19
2.3 Developmentai Analyses Methods ,----------------------------,---- 2 1 2.3.1 Inflorescence Height, Silique Length and Floral Organ Number 21 2.3.2 Stomatal Measurements 21 2.3.3 Scanning Electron Micrographs 21 2.3.4 Statistical Analyses of Data 22
2.4 Physiological Methods ----,----,,,-,,-,,,-----d----------------- 2 2 2.4.1 Seed Sensivity to Exogenous and Endogenous ABA 22 2.4.2 New Root Growth on ABA Assay 23 2-4.3 Water Loss Assay 23 2.4.4 Stomatal Aperture Assay 23 2.4.5 RABI8 mRNA Induction 24
2.5 Molecular Biological Methods ,-,,,,,-,,,,,,--,,-,------------------ 2 4 2.5.1 Plant DNA Isolation 24 2.5.2 DNA Gel Blot Analysis 25 2.5.3 Plant RNA Isolation 25 2.5.4 RNA Gel Blot Analysis 26 2.5.5 Probe Generation 27 2.5.6 Famesylation Assay 27
3.1.2 Complementation of the era1-2 Mutation with the abil-1 Suppressor Mutation 35 3.1 -3 era 1 4 as a Suppressor of abZ-1 40
3.2 Developmental Characterization of era 1-4, a b i l - 1 and abil-1 eral-4 4 3 3.2.1 Inflorescence Height 43 3.2.2 Silique and Floral Oevelopment 43 3.2.3 Stomate Parameters 52
3.3 Physiological Characterization of eral-4, abi l -1 and abi l - lera 1-4 --,-,-J 2 3.3.1 Seed Responsiveness to Exogenous and Endogenous ABA 54 3.3.2 Root Growth Sensitivity to ABA 56 3.3.3 Whole Plant and Stomatal Response to ABA 60 3.3.4 RAB18 Induction 63
6 6 4.2 The abil-1 Mutant as a Response and Developmental Mutant -------
6 9 4.3 Mutations in ERA1 in the Landsberg erecta Ecotype
7 3 4.4 The eral-4 Mutant as a Suppressor of the a b i l - l Mutant
6.1 Statistical Analysis of Developmental Traits and Physiological Responses 8 4
6.2. Suppressor Screen of Fast Neutron abil-1 Mutagenized Seed 8 5
List of Figures Figure Page
1. Establishing the genotype of SC1 9-6 X Ler F3 family individuals at the AB11
2. DNA gel blot hybridized with the ERAI genomic probe. 38
3. ln vifni famesylation activity of Ler and era 14. 39
4. RNA gel blot hybridized with the ERAI cDNA probe. 41
5. Gross morphology of ler, abii-7, abii-7 era7-4, and era7-4, 44
6. Inflorescence height and silique length of Ler, abil-1, eral4, and abil-1 era1-4. 45
7- Examination of pistil and stamen rnorphology of Ler, eral4, abil-1, and abil-1 eral4. 46
8. Examination of an aberrant pistil and anther in abil-1 en14 by SEM. 48
9. Examination of pollen grains of Ler, eral-4, abil-1, and abil-1 eral-4. 49
10. Number of floral organs of Ler, abil-1, era14, and abil-l eral-4. 50
1 1. Examination of carpe1 transverse sections of Ler, eral-4, abil-?, and abil-1 era14. 51
12. Stomate parameters of Ler, abil-1, eral4, and abil-1 era 1 4 . 53
13. Germination rates on exogenous ABA of Ler, abil-1, eral-4, and abil-1 era74. 55
14. Dormancy of Ler, abil-1, era14, and abil-1 eral-4- 58
1 5. New root growth on exogenous ABA of Ler, abil-1, era 1-4, and abil-1 era1-4. 59
1 6. Rate of water loss in Ler, abi l -1, eral4, and abil-1 eral4. 61
17. Stomatal aperture response of Ler, abil-1, eral4, and abil-1 eral-4. 62
18. RNA gel blot hybridized with #e RAB18 probe. 64
19. Function of AB11 and ERAI in ABA signaling. 74
List of Tables
Table page
1, Mutants used in this study. 18
2. SSLP loci examined by PCR used to map the suppressor mutation. 20
3. RFLP loci on chromosome 5 examined by PCR and enzyme digestion used to map the suppressor mutation. 20
4. Regimes of PCR of SSLP and RFLP markers. 20
5. Genotype and phenotype of SC19-6 X Ler F2 classes- 30
6. Plant gross morphology and establishment of the genotype at the AB11 locus of approximately 20 representatives of 4 F3 families. 32
7. Mapping results. 36
8. Germination rates of F2 progeny of era14 X abi2-7. 42
9. Matemal influence in the seed mat on germination on exogenous ABA 57
10. Summary of responses by abil-1, eraf-4 and the interaction between the two loci. 67
vii
List of Appendices
List of Appendices
Appendix page
1 . Statistical analysis of developmental traits and physiological responses. 84
2. Suppressor screen of fast neutron abif-7 mutagenized seed. 85
3. Suppressor screen of abil-1 era 7-4. 88
1 .O Introduction
The nature of the plant life cycle dicbtes that plant devetopment is intrinsically tied to
environmental cues, Because of their sessile habit, changes in light, temperature and moisture,
for example, rnust be perceived and responded to appropriately. This constant feedback of
environmental signal to devefopmental responses is perhaps the main reason that plants maintain
a plastic nature throughout their development, Although many genes have been identified that
appear to encode important regulators of plant developrnent, Iiffle is known about how these
gene acüvities respond to changes in environmental cues- Hormones present excellent
candidates to function as modulators of the environmental signals as they respond quickly and
can initiate many signal cascades within a short period of time- Hormone levels increase and
decrease in response to environmental changes and therefore can act to modulate plant growth
and development (Zeevaart & Creelman 1988). Tissue sensitivity to hormones also fluctuates
throughout the life cycle; thus the sensitivity to environmental cues must be regulated (Zeevaart
& Creelman 1988).
The plant hormone abscisic acid (ABA) has been shown to act as a modulator of
environmental signals in the seed and in vegetative tissues throughout the life cycle of the plant
(Zeevaart 8 Creelman 1988, Black 1991, Rock & Quatrano 1995). During early stages of seed
development, the embryonic body fom is established and seed storage reserves (protein, starch
and oils) are deposited. Although the seed is not sufficienfly mature to geminate at these
stages, if the embryo is excised from the seed coat, it will germinate (Zeevaart 8 Creelman 1988,
Bfack 1991, Rock 8 Quatrano 1995). This suggests that endogenous factors present in the seed
suppress germination of the embryo- If excised embryos are placed on media supplemented with
ABA, the embryos will be inhibited from germinating (Zeevaart 8 Creelman 1988, Black 1991,
Rock 8 Quatrano 1995). It follows that an endogenous factor prevenüng germination is ABA.
ABA has also been shown to stimulate seed storage reserve deposition (Zeevaart 8 Creelman
1988, Black 1991, Rock 8 Quatrano 1995). These proteins include napin and cruciferin and
supply the geminating embryo with the energy required for germination.
- - --
As maturation proceeds, the seed acquires desiccation tolerance and begins the process
of desiccation- A group of genes terrned rabnealdehydrin (responsive to ABN late
embryogenesis abundanVdehydration induced) are expressed in late embryogenesis and
coincide with water loss of the embryo (Rock & Quatrano 1995). The LEA and RAB gene
products have hydrophilic domains and are hypothesized to function in desiccation tolerance
(Espelund et al. 1992). These gene products are also drought and cold stress induœd in both the
seed and the vegetative tissue (Welin et al, 1994). ABA functions as the regulatory signal for
drought and cold stress; thus it can induce many, but not ail of the rab/lea/dehydnn genes. Sorne
rab/iea,dehydrin genes induced by ABA include: RAB18, AtEml, AtEm6, At2S3, and CRC (Ung
& Palva 1992, Parcy et al, 1994, Parcy & Giraudat ! 997). Both the inhibition of germination and
the acquisition of desiccation tolerance are preceded by an increase in endogenous ABA levels
in the seed, providing circumstantial evidence for a causal relationship (Black 1991, Rock &
Quatrano 1995).
ABA also has an extensive role in modulating environmental cues in the vegetative tissue,
For adult plants, drought and cold stress are threatening to survival. These stresses induce
rab/iea/'dehydrin genes (Le., cor47, lti30, lfi45, and RAB 18) in the vegetative tissue; these may
function in desiccation tolerance (Lang 8 Palva 1992, Welin et al. 1994). It is hypothesized that
cold and drought stresses induce these genes directly or by using ABA as a signal. There are
also other ABA regulated genes in the vegetative tissue. Alcohol dehydrogenase (Adh) is a gene
induced by ABA, drought and low oxygen (de Bruxelles et al. 1996). It catalyzes the reduction of
acetaldehyde to ethanol, a process important when hypoxic conditions occur in the root (de
Bruxelles et al. 1996). The ATHB7 gene is a putative transcription factor whose expression is
induced by water deficit and exogenous ABA application (Saderman et al. 1996). This gene may
also play an important role in the drought stress response. ABA also mediates other stress
responses, such as stomatal closure (Zeevaart 8 Creelman 1988). Stomatal closure is important
as a drought response that limits the amount of water evaporation thmugh the stomatal pore.
Although low physiological levels of ABA stimulate root growth, higher physiological levels
Introduction 3
negatively regulate cell division in the plant, thereby inhibiting root growth (Zeevaart & Creelman
1 988).
The mechanism by which ABA is able to impinge on these processes is largefy unknown.
Traditionaliy, ABA has been hypothesized to function in signal transduction cascade, similar to
the pheromone response in yeast or the mitogenic response in mamrnais (Himmelbach et al.
1998). Understanding the ABA pathway and the components within it would increase our
understanding on the role of ABA and assist in its manipulation for agricultural purposes.
Therefore, genetic screens have been designed to detect molecules in this signal cascade via
mutagenesis and selecting for mutants with defects in ABA synthesis or sensitivity and
response (Koomneef et al. 1982, 1984, Nambara et al. 1992, F inkelstein 1994b, Cutler et al.
1 996).
1.1 .O ABA biosynthetic mutants Mutants defective within the ABA biosynthetic pathway were identified by two screens
(Koornneef et al. 1982, Léon-Kloosterziel et al. 1996). These screens produced alleles in three
loci, designated ABA 1, 2 and 3, al1 of which showed reduced levels of endogenous ABA. The
enzymatic defect for these mutants have been shown. The gene corresponding to the ABAl has
been cloned from tobacco (Nicotiana plumbaginifolia) and is found to be involved in the first
committed step of ABA production, the epoxidation of zeaxanthin to antheraxanthin and
violaxthin (Marin et al. 1996). The ABA2 and ABA3 gene products of Arabidopsis have also been
characterized biochemically and are responsible for the two last steps in ABA production
(Schwartz et al. 1997). A mutation in ABA2 blocks the conversion of xanthoxin to ABA-aldehyde,
whereas a mutation in ABA3 blocks the conversion of ABA-aldehyde to ABA, suggesting ABAZ
and ABA3 encode the proteins responsible for the enzymatic activity (Schwartz et al. 1997).
The reduction in enzymatic activity in these mutants results in endogenous ABA levels
approximately 4-30% of wildtype levels (Koomneef et al. 1982, Léon-Kloosterziel et al. 1996).
The reduction in ABA levels results in reduced seed domancy and increased wilting and
transpiration rates in the vegetative tissue (Koomneef et al. 1982, Karssen et al. 1983, Léon-
Introduction 4
Kloosterziel et al. 1996). A number of genes induced by ABA are also not expressed in
auxotrophic backgrounds (Le., ATH87 and RABfB), indicating ABA is required as the signal for
the induction of these genes (LQng 8 Palva 1992, Soderman et al. 1996, Parcy 8 Giraudat 1997).
Lea gene products, specifically those whose expression is ABA induced, act as markers of
seed development and are also decreased in aba mutants (Le., A t h 1 and AtEm6) (Parcy et al.
1994, Parcy & Giraudat 1997). Experimental use of ABA auxotrophic mutants allows for
dissection of specific gene induction pathways. For example, expression of the Adh gene is
induced by dehydration, addition of exogenous ABA and iow oxygen (de Bruxelles et al. 1996)-
In the abal mutant, low oxygen and low temperature induces Adh, whereas dehydration
treatment does not, indicating that induction of Adh by drought is ABA dependent and that low
oxygen and low temperature induction is ABA independent (de Bruxelles et al. 1996). In addition,
expression of the LEA gene, lti30, is induced by drought and low temperatures. Although the
gene is not induced by direct application of ABA, drought no longer induces this gene in the abal
mutant, indicating that ASA is required for induction (Welin et al. 1994). As expected, these ABA
dependent phenotypes can be rescued with application of exogenous ABA, indicating that the
lesion is not in the sensing or responding pathways, but in ABA biosynthesis. The mutant
phenotypes of biosynthetic mutants give some insights into the role that ABA plays in wildtype
plants and suggest that ABA acts to increase dormancy in the seed, to decrease wilting in the
vegetative tissue, and to induce specific stress response and developmental genes.
1.2.0 ABA Responsive Mutants The isolation of ABA response mutants has provided systerns for studying A6A signaling
(Koomneef et al. 1984, Cutler et al. 1996). Biosynthetic mutants can be dmerentiated from
response mutants because the phenotypes of biosynthetic mutants are rescued by the
application of exogenous ABA, whereas the phenotypes of response mutants are not.
Response mutants have been identified by screening mutagenized population of seeds on
exogenous ABA for hypenensitivity or insensitivity when cornpared to wildtype sensitivity. Two
Introduction 5
classes of response mutants have been isolated to date: 1) ASA insensitive mutants (ab& and
2) mutants with enhanced response to ABA (era),
1.2.1 ABA Insensitive Mutants The first class of insensitive mutants includes the AB11 and the AB12 genes (for ABA
insensitive). Mutations in these genes result in plants that wilt under mild water stress conditions
and seeds that are nondormant and can geminate on exogenous ABA concentrations which
inhibit wildtype seeds from germinating (Koomneef et al. 1984)- The abil-1 and abi2-1 mutants
have levels of ABA in the seeds similar to wildtype, indicating mat the lesion daes not result in
increased turnover or inactivation of the hormone (Koomneef et al. 1984). In accordance with
their name, application of ABA also does not induce other responses which occur in the
wildtype. For exarnple, stomates are induced to close and root growth is inhibited when wildtype
seedlings are placed on exogenous ABA. Osmotic stress and exogenous ABA also induces the
accumulation of proline, which functions as an osmolyte (Finkelstein & Sommerville 1990). These
responses are defective in abil-1 and abi2-1 mutants (Koornneef et al. 1984, Leung et al. 1994,
Pei et al. 1997). Induction of genes in aba mutants is also defective in abil-1 and abi2-1 mutants
(i.e., Adh and RAB18) (Lang 8 Palva 1992, Welin et al. 1994, de Bruxelles et al. 1996). That rnany
ABA responses are affected in abil-1 and abi2-1 mutant plants suggests these gene products
function in the eariy steps of ABA signaling. Furthemore, the similarity of biosynthetic and
response mutants (i.e., lack of donnancy, stornatal closure and ABA responsive genes),
suggests that response mutants do have reduced signal flux through the ABA response
pathway.
Physiological, genetic and molecular studies have been used to assign a role to the AB11
and AB12 gene products. It is difficult to assign a role for AB11 as the abil-1 allele is dominant
and the catalytic activity of the enzyme has decreased (Bertauche et al. 1996, Armstrong et al.
1995, Sheen et al. 1998). To further understand the action of AB11 , the gene was cloned and
shown to encode a protein phosphatase 2C (PP2C) (Leung et al. 1994, Meyer et al. 1994). The
- - - . . - - - - -
PP2C represents a class of highly conserved proteins found in both plants and animals and is
often associated with negative regulation of protein kinase cascades that are activated as a
result of stress (Rodiguez 1 998). The AB1 1 protein requires MgZ' for activation (Bertauche et al.
1996, Sheen 1998). AB11 also contains an ca2+ binding domain, known as an EF hand; however,
ca2+ regulation of AB11 has not been demonstrated (Bertauche et al. 1996, Sheen 1998). m e
mutation in abii-1 is a Gly180 to Asp transition due to a one base pair change (Leung et al. 1994,
Meyer et al. 1994). This mutation likely disrupts the confirmation of neighbouring ~ g ~ '
coordinating residues, which can expiain the reduced catalytic activity of abil-1 (Sheen 1998).
To assign a wildtype role, Sheen (1998) designed a deletion AB11 mutant in maize protoplasts.
Activation or repression of certain ABA responsive gene were examined, These mutants lose
the a bility to negatively regulate ABA signal transduction for both gene activation and repression
One expianation for the abil-l mutant phenotype invokes a scenario where abif-? sequesters
and poisons the target protein, thus preventing it from transducing the ABA signal (Sheen 1998);
although to date, no known interactors with AB11 have been cloned. These data suggest that
AB11 may function as a negative regulator of ABA signaling in the seed and vegetative tissue-
Electrophysiological studies of AB11 have shown this gene product to operate in the
guard cell (Armstrong et al. 1995, Pei et al. 1997). In wildtype, drought conditions stimulate a nse
in ABA levels (Zeevaart & Creelman 1988). ABA causes depolarization of guard cell membranes,
which causes solute effiux (primarily K+) and outward rectifying anions (Cf) from the guard cells
(Pei et al. 1997, MacRobbie 1998)- Furthemore, ABA has been shown to negatively regulate the
K' inward channel and stimulate the K' outward channel. ABA can also stimulates a rise in ca2'
concentration and alkalization of the guard cell, both of which stimulate guard cell closure
processes. The loss of solutes causes water to exit, resulting in a decrease in turgor in the
guard cells, and subsequent decrease in the stomataI pore width (MacRobbie 1998).
The effect of the abil-l mutation appears to be a decrease in the anion channel activity
and outward K' channel, resulting in ABA insensitivity and increased stomatal aperture
(Armstrong et al. 1995, Pei et al. 1997). To investigate possible pathways in which AB11
operates in the guard dl, biochemicai and genetic studies were employed. Stomabl aperture
can be increased in wildtype or abi1-l by inhibiting slow anion channels with a phosphatase
inhibitor which is an ABA independent action (Pei et al. 1997)- Since PP2C's are phosphatase
inhibitor resistant, this suggesl that an additional protein phosphatase (PP), sensitive to the
inhibitor, is located at the same level or upstream of AB11 and is involved in an ABA-independent
pathway of stomate closure. Biochemical suppression of abi1-1 results from treatrnent with a
kinase inhibitor (Armstrong et al. f995, Pei et al. 1997). When ABA is present, the use of a kinase
inhibitor can rewver anion activity. This suggests there is also a ABA dependent kinase that
operates to negatively regulate the ABA signal by inhibiting anion channel activity. AB11
negatively regulates this kinase, suggesting a positive role for AB1 1 in stomatal closure (Pei et al-
1998). The use of a kinase inhibitor can also restore ABA control of K* channel activities,
suggesting phosphorylation/dephosphorylation is involved in contrd in the guard cells
(Armstrong et al. 1995). Although these protein inhibitor studies contribute new data to AB11
function in the guard cell, these data must be interpreted with caution. The specificity of the
inhibitor may not be faittiful, or may have unanticipated secondary effects. The inhibitor results
rnay reveal the actual pathway in the guard cell through which the AB11 gene product acts, but
more studies are required to verify this data,
Recently, the second ABA insensitive mutant in this class of responsive mutants, AB12,
was cloned and it also appears to enwâe a PP2C (Leung et al. 1997). Aside from their molecular
similanty (81 % nucleotide identity of the genes), there are a number of physiological similarities
between AB11 and AB12. For example, the abi2-1 mutant has seeds and guard cells which are
defective in ABA response (Koomneef et al. 1984, Pei et al. 1997). The mode of inheritance also
is dominant (Leung et al. 1997). Since there are no recessive, loss-of-function mutations for
either ABIl or AB12 yet isolated, it may suggest the two gene products act in a redundant manner
(Leung et al. 1997). However, it is becoming increasingly apparent that AB11 and AB12 operate in
different subsets of the A6A response pathway- For example, in the guard cell, a kinase inhibitor
which can rescue anion channel activity in abil-1, does not restore channel activity in abi2-1
(Pei et al. 1997). Also a number of ABA responsive genes (ATHB7, AtDi21, Adh and RAB18) are
differenüally regulated by AB11 and AB12 (Gosti et al. 1995, de Bruxelles et al. 1996, Sodeman et
Introduction 8
al. 1996). ATHB7, AtDi21, and RAB1 8 induction in the abi2-1 mutant is not as defective as the
abil-1 and more impaired than the abii-1 mutant in Adh expression (Gosti et al. 1995, de
Bruxelles et al. 1996, Soderman et al. 1996). The use of a gibberellic acid (GA) inhibitor suggests
that the mechanism through which abi2-1 seed is able to germinate is different from abil-7
(Nambara et al. 1991). Together, these data suggest that although AB11 and AB12 are stmcturally
redundant, they appear to have only partially overiapping functions.
ABA also has other important functions that may not have become apparent without the
use of genetic manipulation. Mutations in the ABl3, AB14 and AB15 genes were isolated by
screening mutagenized population of seeds on exogenous ABA for insensitivity when compared
to wildtype sensitivity (Koomneef et al. 1984, Nambara et al. 1992, 1994, Ooms et al. 1993,
Finkelstein 1994b). The phenotypes of these mutations are sirnilar to those seen in abil-1 and
abi2-1 in that they confer resistance to exogenous ABA to the seed; however these mutants
are also defective in the developmental program of the embryo (Finkelstein 1994b). A613 has
been cloned and the sequence shows homology to VPl, a seed specific transcription factor
found in maize (Giraudat et al. 1992). A mutation in VP1 also confers ABA insensitivity to the
seed (McCarty et al. 1991). These data suggest these transcriptional factors may be a
conserved hormone response regulators.
An allelic series has been isolated for the AB13 locus (Koornneef et al. 1984, Nambara et
al. 1992, 1994, Oorns et al. 1993). Phenotypes of these mutants include desiccation intolerance,
lack of dorrnancy, absence of chlorophyll degradation, reduction in seed storage proteins (i.e.,
12s cruciferin and 2s napin) and lipids, and LEA gene products (Le., MIO, M77, AtEm1, PAP38);
and in the severe alleles, germination is viviparous (Koomneef et al- 1984, Finkelstein 8
Somerville 1990, Nambara et al. 1992, 1994, Finkelstein 1993, Ooms et al. 1993, Parcy et al.
1994). The abi3 mutants do not have altered stomatal amtrol and respond to ABA in the
vegetative tissue similarly to wildtype (Koomneef et al. 1984, Finkelstein 8 Sommerville 1990).
The mutant phenotypes are confined to the embryonic tissue and AB13 is not found to be
expressed in the adult vegetative tissue, suggesting a tissue specific role for AB13 (Giraudat et
al. 1992, Parcy et al. 1994). The abi3-1 mutant also has wildtype levels of ABA in the seed,
indicating the lesion is not in ABA turnover or inactivation of the hormone (Kwmneef et al. 1984).
These data suggest that ABA is required for the normal maturation of the embryo; however. if
these seeds are potted before they desiccate, they will develop into normal plantlets. It has also
been reported that mature abi3 embryos have premature initiation of leaf primordia and
differentiation of xylern tissue, therefore the mutants resernble a developing seedling rather than
an embryo (Nambara et al, 1995). Gene expression in the embryo also show that these mutants
bypass the wildtype developmental processes for which expression of LEA gene products are
markers (Finkelstein 1993, Parcy et al- 1994). It follows that because these seeds are insensitive
to ABA, ABA has a central role in embryo maturation. However, sinœ severe ABA auxotrophs
do not have developmentally altered embryos, a broader role for AB13 may exist Alternative
hypotheses for AB13 function are: 1) AB13 is responsible for the establishment of a
developmental pathway in the seed, through which ABA may act; or 2) AB13 acts in both ABA
signaling and embryo maturation (Bonetta & McCourt 1998). However, studies do support a minor
role for ABA in embryo development. When crossed to the ABA auxotroph abal, a weak allele
of abi3 has severe phenotypes (Koomneef et al. 1989). If ABA is applied to the double mutant,
desiccation tolerance is increased (Kwrnneef et al. 1989). In addition, a srnall subset of the
genes which have altered expression patterns in abi3 mutants are also reduced in abal mutants
(Le., AtEm1 and AtEm6) (Parcy et al. 1994). When vegetative tissue with ectopic expression of
AB13 is exposed to ABA, seed specific genes are induced (Le., AfEml, Af2S3, and CRC) (Parcy
et al. 1994, Parcy & Giraudat 1997), and ABA sensitivity is partially recovered in the abil-1
mutant (Parcy & Giraudat 1997). Which ever is the actual process, the data suggest that ABA
does indeed act through a path in the seed delineated by ABl3.
Mutations in A514 and AB15 cause a reduction in sensitivity to exogenous ABA and in
accumulation of a LEA gene product (AfEMG) in the seed (Finkelstein 1994b). These mutants do
not have altered stomatal wntrol. Although effects of mutations in AB14 and AB15 appear to be
confined to the seed (thus making them similar to AB13), there are also differences. For example,
neither mutation causes a reduction in dorrnancy of the mutant seeds (Finkelstein 1994b).
Furthemore, expression of AB14 has been detected in the shoots and roots, making regulation of
Introduction 10
AB14 spatially d0Vferent from AB13 (Finkelstein et al. 1998). AB14 has been cloned and is a putative
AP2 transcription factor (Finkelstein et al. 1998). This protein contains a putative WAAEIRD box
motif which is hypothesized to participate in hormonal andlor stress related signaling (Finkelstein
et al. 1998). These mutants represent the newest additions to the ABA insensitive mutants, but
information is lirnited to date, However, further analysis of these mutants may provide fumer
insight into ASA function not found by the other ABA insensitive mutants descrïbed.
1.2.3 Enhanced Response to ABA Mutants At the opposite end of the spectnim of ABA sensitivity are era mutants, enhanced
response to ABA- These were isolated by screening rnutagenized seeds on levels of ABA that
do not inhibit wildtype seeds frorn germinating and selecting seeds that are not able to germinate
(Cutler et al. 1996). Mutations in three loci were isolated in the original screen, however, only
one, era7, has been characterized to date. in addition to seeds that are hypenesponsive to
exogenous and endogenous ABA, the guard cells are also more responsive to exogenous and
endogenous ABA when compared to wildtype (Culter et al. 1996, Pei et al. 1998)- €RA 1 encodes
the l3 subunit of the enzyme, protein famesyltransferase (FTase) (Cutler et al. 1996). FTases are
within the same group of enzymes as geranylgeranyltransferases (GGTase), called protein
prenyltransferases (Schafer 8 Rine 1992). FTase has been shown to consist of two subunits (a
and 13) which dimerize. 60th subunits are required for activity (Qian et al. 1996). In addition to the
l3 subunit in Arabidopsis, the genes for the a and B subunits from pea (Yang et al. 1993, Qian et
al. 1996) and tomato (Schmitt et al. 1996) have been cloned. Prenyftransferases prenylate, or
covalently attach a lipophilic isoprenyl moiety (wmpounds with a repeating five carbon
structure), to a protein substrate. FTase attaches famesyl groups (15 carbon groups). The point
of attachment is at the C terminus of the protein with a C M motif where A is any aliphatic
amino acid and X is any arnino acid except leucine and phenylalanine. The attachrnent is a
thioester linkage to the cysteine residue. This process increases the lipophilicity of the target
protein, and the famesyl group can insert into the plasma membrane (Schafer 8 Rine 1992).
From other mode1 organisms, Rases are known to localize to the membrane and activate target
proteins, such as the Ras superfamily of small GTP-binding proteins, the 6 subunit of the
heterotrimeric GTP-binding proteins, fungal mating factors, and nuclear lamins (Schafer & Rine
t992). These targets, in tum, participate in a variety of signal transduction pathways, modulating
a number of cellular events, including cell division, yeast mating, and stress responses (Schafer
& Rine 1992). In plants, ANJ1, a homolog of the bacterial chaperone DnaJ, known to function in
stress responses, is the only characterized target of FTase (Zhu et al. 1993).
FTases have been Iinked with the cell cycle in marnmals and Randall et al- (1993) showed
that there are many proteins in cultured tobacco cells which are isoprenylated. Thus, it followed
that FTase may function in cell cycle wntrol in plants. Therefore, the influence of Rase on the
cell cycle has been investigated in tobacco suspension cells and in tobacco (Nicotiana tabacum
cv. Xanthi) transforrned with a promoterGUS fusion with the B subunit of pea FTase (Pisum
sativum cv Alaska) (Qian et al. 1996, Zhou et al. 1997). Use of a Rase specific inhibitor
suggests that n a s e acts to positively regulate cell division in tobacxo suspension cell cultures
and increased FTase expression is associated with increased mitotic activity (Qian et al. 1996).
In addition, FTase activity has been shown in all tissues of tomato (Lycopersicon esculentum cv
VFNT cherry), but higher levels of activity were observed in tissues characterized by rapid cell
division, such as the apical bud and stems from young plants and in developing fruit (Schmitt et
al. 1996). Control of the cell cycle appearç to be regulated by differential expression of FTase
(Zhou et al 1997). However, there is no clear correlation between meristematic activity and
nàse activity, suggesting a more complex function for n a s e in plants. Activity of Rase was
not high in rapidly dividing tomato cell culture (Schmitt et al. 1996), furthemore, FTase activity
was present in stem tissue in which cell division has ceased (Schmitt et al. 1996). In addition,
expression of pea FTase in transgenic tobacco was also seen in vascular tissue (Zhou et al.
1 997).
Regulation of FTase expression is much less characterized. Studies suggest that FTase
is mainly, but not exclusively, expressed in rapidly dividing tissue such as mature and
geminating embryos, meristematic tissues, and junctions between organs (Zhou et al. 1997).
Introduction 12
Light has been shown to regulate expression of mase in pea, but FTase expression in tobacco
transforrned with a promoterGUS fusion with the B subunit of pea FTase was reversibly Iight
regulated (Yang et al. 1993, Zhou et al, 1997) and not light regulated in tomato (Schmitt et al.
1996). The hormone, auxin, has also been shown to positively regulate n a s e expression,
whereas ABA had no effect (Zhou et al. 1997). To fully understand the role of FTase in plants,
the role and the regulation of Rase must be further studied.
The eral-2 mutant has enhanced response to ABA in the seed and the guard cell (Cuiter
et ai. 1996, Pei et al. 1998)- The eral-2 mutation is a deletion mutation and is a recessive, Ioss-of-
function mutation (Culter et al. 1996). lnterpretation of the eral-2 mutant phenotype suggests that
the ERAl gene product operates both within the seed and the vegetative tissue. The mutant
phenotype also suggests in wildtype it acts as a negative regulator of the ABA signal (Cutler et
al. 1996). Given that the function of ERAl is to farnesylate target proteins, it is more likely that
ERA1 farnesylates a target protein which negativety regulates the ABA signai (Cutler et al.
1996).
Studies involving ABA response mutants have been useful in providing information to
establish the role of ABA in plants, and the data so far suggest that ABA has a broad range of
functions, Further study using genetic mutants will expand the knowledge of ABA function.
1.3. Digenic Studies The use of digenic studies has been valuable in determining the order of genes within
pathways and relating gene product functions with other gene products (Finkelstein 8
Sommerville 1990). For example, ABA levels can be altered genetically in a response mutant
background, thereby elucidating the influence of ABA within a pathway. Also, examining the
severity of a phenotype within a double mutant background provides insight as to how those
gene products are ordered with respect to each other. For example, if a double mutant is
constructed between two nuIl mutations found in genes of products within the same pathway,
the resulting phenotype of the double will be similar to either of the single mutants. In contrast, if
the two nuIl mutations are in paralfel pathways, the phenotype will be more severe. In the event
ln troduction 13
the mutations are leaky, two mutations within the same pathway will be result in a phenotype
which is additive, rather than synergistic as when two mutations are in parallel pathways
(Finkelstein 8 Somme~lle 1990).
With this in mind, a cross was designed between an ABA auxotroph and wildtype. The
result was a matemal plant that produced ABA while housing an embryo within a silique that did
not produce any ABA (Karçsen et al. 1983). These mutant studies showed that of the two
increases in endogenous ABA characteristic of a developing embryo, the first ABA peak is the
result of materna1 production and the second is derived €tom the embryo- These data also
suggest that domancy is established almost exclusively by the endogenous ABA of embryonic
origin, regardless of the genotype of the matemal tissue (Karssen et al. 1983, Koomneef et al.
1989). Other crosses between an ABA auxotroph and a weak abi3 mutant revealed that the
matemal tissue does, however, influence embryo maturation and desiccation tolerance as
normal maturation and desiccation tolerance were established if either the matemal tissue or the
embryo could produce ABA (Koomneef et al. 1989). Matemal tissue has also been shown to
influence the sensitivity of seeds to exogenous ABA as seeds with mutated AB11 gene products
in the seed mat are less sensitive to exogenous ABA than seeds with wild type AB11 gene
products (fin keistein 1994a).
When abil-1 or abi2-1 is crossed to abi3-1, the result is increased insensitivity to
exogenous ABA when compared to the single mutants. These data suggest that these gene
products operate in parallel and overlapping ABA signaling pathways (Finkelstein & Sommerville
1990). This is in cornparison to double mutants between abil-1 and abi2-1 where the resulting
seeds have only slightly increased resistance to exogenous ASA compared to the single
mutants, suggesting that the gene products operate in the same pathway. But as described
above, AB11 and AB12 gene products appear to only operate in a subset of the same responses,
further supporting the notion that ABA operates via a branching web-like path as compared to a
linear path. Double mutant analysis between abi4-1 and abil-1, abi2-1 and abi3-1 suggest that
AB14 operates in a parallel pathway to ABII, but in a similar pathway to AB12 and AB13, as the
sensitivity to exogenous ABA was increased in the abil abi4 double mutant, but oniy slightly
Introduction 14
increased in the abi2-1 abi4-1 or abi3-1 abi4-1 double mutants (Finkelstein 1994b). Double
mutant analysis between abi5-7 and abil-1, abi2-1 and abi3-1 suggest that AB15 operates in a
parallel pathway to AB11 and AB12 and in a simiiar pathway to AB13 (Finkelstein 1994b).
Epistatic studies also assist in ordering gene products within a pathway (McCourt 1999).
To date, there is only one well characterized mutant that can be used in a epistatic study with
ABA insensitive mutants; eral mutants. Epistasis is the condition when one mutation replaces
the phenotype of another mutation with its own (McCourt 1999). For the results to be meaningful
in an epistatic study, there are two criterion that must be met: 1) both mutations must be nuIl
mutations; and 2) the two mutations must have clearly distinct phenotypes (McCourt 1999). The
era mutants have phenotypes which are clearly distinguishable from abi mutant phenotypes.
Furthemore, erai-2 is a nuIl mutation, thereby fuffilling al1 the criterion for an appropriate
candidate for an epistatic study.
The eral-2 mutant was crossed to both abil-1 and abi2-1 (Pei et al. 1998), and these
studies showed that eral-2 is epistatic to both abil-1 and abi2-1, Le., phenotypes of the double
mutant more resemble those of era 1-2 than abil-1 or abi2-1 (Cooney 1996. Pei et al. 1998). A
mutation in eral-2 is able to suppress the lack of ABA sensitivity in the seed and in the guard cell
(Pei et al. 1998). With respect to the guard ceIl, anion channel activity is recovered, indicating
successful transmission of the ABA signal. To place these two genes in a pathway, these data
suggest that downstream of AB11 and AB12, €RA 1 localizes a negative regulator of anion
channels in guard cells to the plasma membrane for proper function (Pei et al. 1998).
The data from the dQenic studies described above must be interpreted very carefully.
Although eral-2 is a nuIl mutation. the remaining mutants have leaky mutations, which leads to
ambiguous results. Also, the signaling state of the AB11 and AB12 gene products are in question,
due to the dominant negative nature of the mutant alleles. This further complicates interpretation
of these results. Placing these gene products within pathways can be tentative at best.
however, until more nuIl mutants are isolated; the mutants described above provide Me only
framework on which to operate.
Introduction 15
The data collected thus far suggest that a Iinear path may not be an appropriate model to
represent ABA functioning, There is much "crosstalkn and overlap between "apparent"
pathways delineated by loci presently characterized, perhaps better presented by a web-
However, there are interactions within the ABA web still to be characterized.
1.4 Interactions Between Hormones There are presentiy seven plant hormones identified, each having specific roles
rnodulating plant growth and the extemal environment (Kende 8 Zeevaart 1997). Often, clear
distinctions are not present and there is overlap in function between hormones. For example,
auxin, cytokinin and GA have al1 been shown to promote cell division. Auxin and GA have also
been shown to prornote cell elongation. In addition to complementary roles, hormones have also
been shown to act as antagonists to each other. For example, ABA has been shown to act as
an antagonist to auxin responses and inhibits shoot and root growth (Himmelbach et al. 1998).
Also shown, GA promotes germination in the seed and ABA has also been shown to act as an
antagonist, inducing dormancy (Black 1991). These data also suggest that screening for mutants
within one hormone pathway may recover mutants in other pathways. For example, Koomneef
et al. (1 982) screened for revertants of nongenninating GA auxotrophic mutants and isolated an
ABA auxotrophic mutant (abal). Other ABA auxotroph mutants were isolated by screening for
seeds with the ability to geminate on paclobutrazol, a GA inhibitor (Léon-Kloosterziel et al.
1996). In addition, a GA insensitive mutant was isolated by searching for a suppressor of abil-l
(Steber et al- 1998). Results also indicate that a mutation in AB13 alleviates the need for GA to
geminate in a GA auxotroph (Narnbara et al. 1992); also ABA insensitive and biosynthetic
mutants are insensitive to GA biosynthetic inhibitors (Nambara et al. 1991, 1992). These data
suggest that ABA and GA are antagonists and are perhaps operating via a push-pull mechanisrn
(Koornneef et al. 1982, Steber et al. 1998). When, for example, the level of ABA is decreased
genetically, then the amount of GA required to induce germination also decreases (Steber et al,
1998). Taken together, these data suggest that there are interactions between hormones. In
addition to a branching pathway for ABA signal transduction, a web-like pathway may also be a
ln troduction 16
more appropriate model to describe plant development and response, where hormones and
development no longer act through individual pathways, but through overlapping and interfocking
ones.
1.5 Thesis Work Screening for mutants supersensitive to ABA presents an interesting challenge to
recover since these mutants would be hyperdomant, To recover them, it may be necessary to
genetically alter the endogenous ABA level or the sensitivity to it. This suggests that a
suppressor screen of ABA auxotrophs or insensitives may be fruitful in finding novel ABA
supersensitive mutants (Cooney 1996). It has been demonstrated that eral-2 is suppressor of
abil-1 with respect to ABA sensitivity at the level of seed germination and in guard cell function
(Cooney 1996, Pei et al. 1998). This suggests that novel alleles of eral or other supersensitive
mutants could be isolated as suppressors of abil-1. One mutant, SC19-6, along with others,
was obtained in such a screen (Steber et al. 1998). SC19-6 is a semi dwarf with club-shaped
siliques and an exaggerated flat floral bud. This mutant was isolated from the abil-1 background
and was found not to complement eral-2 suggesting it is an new allele of eral; era14. The
development, genetics, physiology, expression levels of ERAI, and activity of the era14 protein
are examined in eral-4 and abil-l/abil-1 era 14/eral4-
The suppression of ABA responses in abil-1 by era14 appears to fall into four
categories: 1) era14 is epistatic to abil-1 (i.e., phenotype of abil-Ilabil-? era14/era14 is like
eral-4), 2) partial suppression (i.e., phenotype of double mutant is an intermediate of e ra l4 and
abil-1), 3) era14 does not suppress (Le., phenotype of double mutant is like abil-1) and 4)
phenotype of double mutant is more severe than either abil-1 or era1-4. Ail genetic,
developmental, and physiological data presented in this thesis are examined in this context.
Materials and Methods
2.0 Materials and Methods
2.1 Growth Conditions Arabidopsis Vlaliana wild type strains used in this study were: Landsberg erecta (Ler)
and Meyerowitz Columbia (MCol). All seeds were surface stenlized in solution containing 10%
bleach and 0.001 % sodium dodecyl sulfate (SDS) (wlv) for 5 mins at room temperature (RT). The
seeds were suhsequently rinsed four times with sterile deionzed water and plated on petri
plates containing 0.8% agar supplernented with Murashige and Skoog (MS) basal culture salts
(Sigma Chemicals) buffered at pH 5.7 with 5mM morpholinoeoianesuWonic acid (MES) (Sigma
Chernicals). Unless stated otherwise, al1 seeds were chdled four days at 4°C to synchmnize
germination. Plants were grown in pots or on plates at W C under continuous light conditions.
Plants were grown in a standard autoclaved soi1 medium (Premier Pro-mix) containing sphagnum
peat moss (75%-85%), perlite, vermiculite, dolomitic and calcitic Iimestone.
Abscisic aüd (ABA) was dissolved in methanol to a final concentration of 1 OmM. The
agar media was sterilized and aflowed to cool to approximately 55°C before the hormone was
added.
2.2 Genetic Methods A Iist of mutant strains used in this analysis is provided in Table 1.
2.2.1 Polymerase Chain Reaction (PCR) conditions of AB11 locus Synthetic oligonucleotide prirners for PCR were designed within the coding region of the
ABII locus (Leung et al, 1994, Meyer et al. 1994)- The primers used were: AB1 1 GEN 1
S'GGAGCTATCTTATAGATCACAACC3' and A81 1 GEN2
SGCGTGTGAGATGGCAAGGAAGCGG3' and generated a fragment 830 bp long containing an
intemal Ncol site in wildtype- The conditions for PCR were: 1 :30 min at 94°C followed by thirty
cycles of O:3O min at 94'C, 1 :O0 min at 56°C and 1 :O0 min at 72°C. This restriction enzyme site
17
Materials and Methods 18
Table 1. Mutants used in this study,
S k i n Ecotype Phenotype & Mutagen Reference heritabiÏ&
abil-7 Ler 1, EMS (point Koomneef et daminant mutation) al., 1984
a bi2- 1 Ler 1, EMS (point Koornneef et dominant muta&) al., 1984
era 1-2 MCd 2, fast neutron Cutter et al., recessive (null) 1996
1 = ABA insensitive, seeds are nondormant and can germinate on high levels of exogenous ABA, vegetative tissue is witty due to stomatai closure defect 2 = ABA sensitive, seeds are dormant and can not geminate on low levels of M A , vegetative tissue is nonwilty due to enhancement of ABA signal and flowers have protruding carpels and enlarged inflorescence.
Materials and Methods 19
does not exist in abil-1 owing to the point mutation found within the gene. Digestion of the
wildtype PCR product with Ncol (New England Biolabs) produced two bands: 257 bp and 573
bp, that were size fractionated by electrophoresis using a 1.5% agarose gel (Sambrook et al.
1989). The DNA was visualized by staining with ethidium bromide and visualizîng under UV Iight
(BioKan True View Transillurninator).
2.2.2 Mapping Studies Mapping the mutation to a specific chromosome was perforrned using ecotypespecific
short sequence length polymorphisms (SSLP) and restriction fragment length polymorphisms
(RFLP) (Koniecmy & Ausubel 1993, Fabri & SchafTner 1994). The mutant was crossed to MCol,
and plants homozygous for the mutation were selected from the resulting F2 progeny by
choosing non-geminators when grown on 0.8pM ABA and moving them to MS media for rescue.
The DNA was isolated according to Rogers and Bendich (1 994) with modifications.
Approxirnately 2cm2 leaves were homogenized in CTAB buffer (2% cetyl methyl ammonium
bromide [CTABj, 1.4M NaCI. 8mM EDTA and 20mM TRIS-HCI [pH 8.O]), 200~1 per leaf and 1 pl B 2-
mercaptoethanol. The mixture was heated at 65'C for 30 mins. Chloroform (250pl) was added
and the mixture was vortexed for 3 mins and centrifuged in a microfuge at 13000 rpm for 5 mins.
The aqueous layer was removed and placed in a microhige tube and isopropanol(150pI) was
added. The DNA was allowed to precipitate for 15 mins at RT and was recovered by
centrifugation at 13000 rpm for 1 O mins. The resulting pellet was washed with 70% ethanol and
dried in a Savant SC 110 Speed Vac. The DNA was resuspended in 50pl TE (10mM Tris HCI pH
8.0, 1 mM EDTA pH 8.0).
Synthethic oligonucleotide primers (Research Genetics Map Pairs) were used to amplify
SSLP's and RFLP's and appear in Tables 2 and 3. PCR regimes for SSLP and RFLP PCR primer
sets appear in Table 4. RFLP products were digested with restriction enzymes according to
manufacture's specifications (Pharrnacia). RFLP fragments and SSLP PCR products were
separated by electrophoresis using 4% agarose gels in 1X TAE buffer and stained with ethidium
bromide. The PCR fragments were visualized on a Bio/Can True View 300 transilluminator.
Materials and Meaiods 20
Table 2. SSLP ioci examined by PCR used to map the SC194 mutation.
The SC19-6 mutant was crossed to MCol and homozygous plants for the SC19-6 were selected by choosing nongeminators on MS media supplemented with 0.8pM ABA and subsequently moving them to MS media for rescue. DNA was isolated from 1 O plants and the genotype of the specified loci determined by PCR according to the conditions described. PCR products were size fractionated by electrophoresis on a 4% agarose gel and stained with ethidium bromide and visualized with UV light.
Chromosome SSLP marker MCol size (bp) Ler size (bp) 1 nga 280 1 O5 85
3 nga 6 143 123 3 AîhGAPablf f 142 150 4 nga8 1 54 1 98 4 nga 1 1 07 150 140 5 nga 225 119 1 89 5 nga 76 231 250
Table 3. RFLP loci on chromosome 5 examined by PCR and enzyme digestion used to rnap the SC79-6 mutation.
The SC19-6 mutant was crossed to MCol and plants hornozygous for SCIS-6 were selected by choosing nongeminators on 0BpM ABA and subsequently moving them to MS media for rescue. DNA was isolated from 10 plants and the genotype of the specified loci determined by PCR according to the conditions descnbed. PCR products were digested by the specified enzymes according to manufacture's instructions (NEB, Pharmacia) and size fractionated by electrophoresis on a 2% agarose gef. The gel was stained with ethidium bromide and the DNA visualized with UV light-
Table 4. Regimes of PCR for SSLP and RFLP markers.
Each set of cycles were preceded by an initial denaturation of 1 :30 at 94°C.
Denature Reanneal Extension Marker "C nn "C h "C n h cycles SSLPes 94 0:30 55 0:25 72 0:30 40
DFR 94 0:30 55 0:25 72 1:lO 40 lfyiii 94 0:30 55 O:= 72 0:40 30
RBCSB 94 0:30 58 0:30 72 0:30 40
Materials and Methods 21
2.3 Developmental Analyses Methods
2.3.1 Inflorescence Height, Silique Length and Floral Organ Nurnber Inflorescence height was measured with a ruler frorn soit level just below the rosette
leaves to the top of the tallest inflorescence. Mature plants grown under continuous tight
conditions were measured (n=10-14). Silique length was measured using a dissecting
microscope and induded the abscission zone to the tip of the stigmatic tissue- Five mature
siliques from five plants for each genotype grown under continuous light conditions were
chosen for the analysis (n=25). Floral organ number was counted using the dissecting
microscope.
2.3.2 Stomatal Measurements Mature rosette leaves were cleared according to Berleth and Jurgens (1993). Tissue
was fixed in solution a containing ethanokacetic acîd (6:l) at RT ovemight, washed four times in
100% ethanol, and placed in dearing solution (8g chforohydrate in 2ml water and 1 ml glyceral)
ovemight. The abaxial side of the Ieaves were examined with Nornarski optics on Reichert
Polyvar microscope. To obtain stomate density, stomates were counted and divided by the area.
Measurements of stomate length included the guard cells. Stomatal aperture invoived measunng
the widest point of the stomatal pore delineated by the guard cells. Twenty stomates from four
leaves from each genotype were examined (n=78-80).
2.3.3 Scanning Electron Micrographs Floral tissue was fixed in FAA (35% fomaldehyde: glacial acetic acid: 70% ethanol
[1 : 1 :18]). The fixed tissue was dehydrated through a graded ethanol series, then critical point
dried with CO2 (Autosamdri 814 critical point drier). The dehydrated samples were mounted on
metal stubs, sputter coated with gold (Polaron SP3 sputter mater) and observed with a Hitachi
S-2500 SEM at 10 and 15 kV. Examination and charactenzation of the morphological changes
Materials and Methods 22
found in the mutant and double mutant were perfomied- This induded an examination of the pistil,
anthers, pollen grains and a transverse cross section of the carpel.
2.3.4 Statistical Analyses of Data Chi-squared (x2) tests were perfomed aaxrding to (McClave 8 Dietrich 1991).
Data was analyzed using a model II nested ANOVA, where genotype (n=4-5) and
treatrnent were treated as f ~ e d effects and plants within genotype were treated as random
effects. Least Squared Mean (LSM's) accounted for the variation among plants and replicates
within a genotype; thus these means were used for graphing unless otherwise stated- Error
bacs represent 95% confidence intervals (C.1,). Normal distribution was unattainable for any trait
except inflorescence height, but results for the ANOVAs were robust (Le., similar trends
following In, logit and other transformations). Analysis was perfomed on the statisticaf prograrn
JMP 3.1. (SAS lnstitute 1 994). Descriptions of the models appear in Appendix 1.
2.4 Physiological Methods
2.4.1 Seed Sensivity to Exogenous and Endogenous ABA Seed sensitivity to exogenous ABA was assayed by plating surface sterilized seeds of
equivalent age on petri plates with MS media supplemented with 0,0.3, 0.6, 12, or 3pM ABA.
Plated seeds were chilled for 4 days to syrichronize germination, Germination rates were scored
5 days after transfer to 22-C. Expanded cotyledons was the criterion for germination.
Sensivity to endogenous ABA was assayed by measuring dormancy. Seeds of
equivalent age were plated on petn plates with MS media. Without chilling, the germination rates
were scored each day for 5 days. Radicle emergence from the seed mat was the criterion for
germination.
Materials and Methods 23
2.4.2 New Root Growth on ABA Assay New root growth on ABA was perforrned as descnbed by Leung et al. (1997) with slight
modifications. Seeds were surfaced sterilized and plated on 0.8% phytagel (Sigma Chemicals)
plates. Plates were placed vertically to prevent the roots from penetrating the agar. When Me
roots were approximately 2cm long (after one week), the seedlings were moved to MS media
agar petri plates supplemented with 0, 10.50. or 100pM ABA. The length of Me roots was
marked and three days later, the new root growth was measured. Data from three independent
expen'ments are shown (n=22-50)- Each data point represents the LSM of al1 three experiments-
2.4.3 Water Loss Assay Water loss assay was performed as described by Koornneef et al. (1984). Plants of
approximately the same size, just prior to senescence, were sprayed wÏth 1 pM ABA and placed
in the dark for one hour to induce stomatal closure. The plants were patted dry and excised just
below the rosette leaves and placed in preweighed buckets. The plants and buckets were
weighed every 20 mins over a three hour period. Subsequently, to establish the dry weight and
the total amount of water in the plants, they were placed at 37°C for approximately three days.
Percent water loss over time was calculated. Five plants per genotype per bucket were used.
The data points represent the average of three replicates (n=15). The experiment was
perfomed once.
2.4.4 Stomatal Aperture Assay Stomatal aperture in response to ABA exposure was tested as descnbed by Pei et al.
(1 997) with slight modifications. Rosette leaves were floated (adaxial side up) with petioles
submerged for two hours on a stomate opening solution (20mM KCI. ImM CaCI, and 5mM MES
KOH [pH 6.1 51) under 300pE illumination. Leaves were subsequently floated on the stomatal
opening solution supplemented with O or 30pM ABA for 24 hours under 300pE illumination.
Leaves were patted dry and clear nail polish was applied to the adaxial side and peeled off
when dry. These nail polish impressions were examined on a Reichert Polyvar microscope at
Materials and Methods 24
40X magnification and the stomatal aperture measured (n=204). Two leaves for each genotype
were examined for each condition. The experiment was repeated twice with similar results-
2.4.5 RAB18 mRNA Induction Seeds were surfaced sterilized and plated on 0-8% phytagel (Sigma Chemicals) plates.
Plates were placed verb'cally to prevent the rwts from penetrating the agar- When the seedlings
were approximately two weeks old, they were moved to petn plates with MS media
supplemented with 0, 10 or 50pM ABA, 48 hours later, RNA was isolated and analyzed for
RAB78 expression as descnbed in sections 2-5.3 and 2.5.4.
2.5 Molecular Biological Methods
2.5.1 Plant DNA Isolation Plant DNA was isolated according to Rogers and Bendich (1994). Several grams of plant
tissue were hawested and ground to a fine powder with Iiquid nitrogen in a mortal and pestle-
The powder was placed in a Corex tube and 1 mUgFW 2X CTAB buffer (2% CTAB, 100mM Tris-
HCI [pH 8.01, 20mM EDTA [pH 8.01, 1.6 M NaCl and 1 % polyvinylpyrrolidone [PVP]) was added to
remove polysaccharides and chlorophyll. Proteins were extracted with 1 rnlIgRN
chloroforrn:isoamyialcohol(24:1) and mixed thoroughly. The mixture was centrifuged at 10000
rpm for 10 mins in a Sorval SS-34 rotor at RT. The supematant was transferred to a clean
centrifuge tube. 0.1 vols of 10% CTAB buffer (10% CTAB and 0-7M NaCI) heated to 65°C. was
added to the supematant Proteins were further extracted with 1 rnllgFW
chloroform:isoamylalcohol(24:1) followed by centrifugation as described above. The
supematant was transferred to centrifuge tube and 1 vol of CTAB precipitation buffer (1 %
CTAB, 50mM Tris-HCI pH 8.0, lOmM EDTA [pH 8.03) was added- The solution was mixed gently
and DNA was allowed to precipibte at 4°C ovemight The DNA was collected by centrifugation
at 10000 rpm for 10 mins in a Sorval SS-34 rotor. The pellet was dried and resuspended in
Materials and Methods 25
200pVgMI high salt TE buffer (10 mM Tris-HCI @H 8.0],1 mM EDTA and 1 M NaCI). RNAase
(1 00pg/ml) was added to eliminate RNA contamination. The mixture was incubated at 37°C for 1-
2 hours and the RNAase was extracted with 0-5 vols chloroform:isoamylalcohol(24:1) followed
by centrifugation. The supematant was transferred to new tube and 2 vols of cold 100%
ethanol was added and the DNA was allowed ta precipitate for 15 mins at -20°C. The DNA was
collected by centrifugation at 10000 rpm for I O mins in a Sorval SS-34 rotor- The pellet was
washed with 70% ethanol and dn'ed using a speed vac (Savant SC 110). The pellet was
rehydrated in 0.1X TE buffer 40 pVgFW (1mM Tris-HCI [pH 8-01, OAmM EDTA).
2.5.2 DNA Gel Blot Analysis Arabidopsis genomic DNA was digested using restricüon enzymes according to the
manufacturer's instructions (Phannacia, New England Biolabs, Stfatagene) and separated by
electrophoresis using 0.8% agarose gels in 0.5X TBE buffer (Tris boric acid EDTA) (Sambrook et
al. 1989). Gels were soaked in 0.25N HCI to fragment the DNA. The DNA was transferred ont0
Hybond-N+ nylon membrane (Amersham) by capillary transfer ovemight in 10X standard saline
citrate (SSC) (Sambrook et al. 1989) and the DNA was immobilized by irradiating the membrane
(12000kJ of UV Iight in a Stratagene Stratalinker). The membrane was prehybridized and
hybridized in a buffer (6X SSC, 5X Denhardt's 0.5% reagent and 100pglml sheared calf thymus
DNA) at 65°C. The biots were washed for 15 mins in 2X SSC and 0.1% SDS (wlv) at RT,
followed by a 30 mins wash at 37°C in O.iX SSC and 0.5% SDS (w/v), and a wash in 0-1X SSC
and 0.5% SDS (wlv) at 50°C for 15 mins and completed with a rinse at RT with O.1X SSC. The
DNA blot was exposed to Hyperfilm MP autoradiograph (Amersham) ovemight at -70°C to
visualize [*PI hybridizati on.
2.5.3 Plant RNA Isolation Al! glassware was baked ovemight at 350°F (Sambrook et al. 1989). All solutions were
prepared with 1 % diethyîpyrocarbonate (DEPC) and autodaved. Plant RNA was isolated
Materials and Meaiods 26
according to Verwoerd et al. (1 989) with slight modifications. Tissue (200mg) was frozen with
Iiquid nitrogen and ground to a fine powder with a morbr and pestle. The powder was placed in
a microfuge tube and the RNA was extracted with 500pl of hot extraction buffer (phenol : 0.1 M
LiCI, 100mM Tris-HCI IpH 8.0],10mM EDTA, 1 % SDS (wk) [M l ) preheated to 90°C. The mixture
was heated further for 1 min at 90°C and then vortexed for 5 mins. Proteins were extracted by
adding 250pI of chloroform: isoamyî alcohol(24:l) and the mixture was vortexed for 5 mins and
centrifuged for 15 mins at 13000 rprn in an Eppendorf centrifuge 5414 at 4°C. The aqueous Iayer
was removed and the protein extraction was repeated twice more, One vol of 4mM LiCl was
added and the RNA was allowed to precipitate ovemight at 4°C. To c=oHect the RNA, the mixture
was centrifuged for 15 mins at 4°C at 13000 rprn in an Eppendorf centrifuge 5414. The pellet
was resuspended in 250~~1 sterile, deionized water. To precipitate the RNA, 0.1 vols of 3M
sodium acetate (pH 5.2) and 2 vols 100% ethanol were added. An aliquot was taken and
centrifuged for 20 mins at 4°C at 13000 rprn in an Eppendorf centrifuge 5414. The pellet was
washed with 70% ethanol to remove salts from the pellet and dned using a speed vac (Savant
SC1 1 O). The pellet was resuspended in 25pl DEPC H20 and analyzed for integrity via
electrophoresis.
2.5.4 RNA Gel Blot Analysis Plant RNA (5pg) was denatured by heating to 65°C for 15 mins in denaturing buffer (10~1
formamide, 1 pl 10X MOPS butfer, and 3.5~1 formafdehyde). RNA was separated by
electrophoresis using 1.1% agarose gel containing formaldehyde (6.6%) in 1X MOPS buffer [pH
7-01 (0.2M MOPS, SOmM sodium acetate (pH 7.01, 10mM EDTA). The RNA was stained with
ethidium bromide and visualized with a UV transilluminator (Bio/Can True View 300). The gel was
equilibrated with 1OX SSC for 30 rnins, luith a solution change after 15 mins. The RNA was
transferred ont0 Hybond-N+ nylon membrane (Arnersham) by capillary transfer in 20X SSC
(Sambrook et al. 1989) and immobilized using UV light (12000k.J of UV Iight in a Stratagene
Stratalinker). The membranes were prehybridizeâ and hybridized in a buffer (1 M NaCI, 10%
Dextran Sulfate. 1 % SDS (wlv) and denatured fragmented salrnon spem DNA [100~iglml]) at
Materials and Methods 27
65°C. The blots were washed twice at RT for 15 mins in 2X SSC and 0.5% SOS (w/v) followed
by two washes at 60°C for 15 mins 0.2X SSC and 0.5% SDS (wfv). Blots were exposed to
Hyperfilm MP autoradiograph (Arnersham) ovemight at -70°C to visualize [=PI hybridkation. Sizes
for transcripts were compared to five ribosomal bands previously sized (Chang & Meyerowitz
1 986).
2.5.5 Probe Generation Radioactive probes were synthesized by random prirning as suggested by Sambrook et
al. (1989). The RAB18 (Ung & Palva 1992) probe was a 1300bp fragment that was generated
using PCR from Ler wildtype genornic DNA. The PCR regime used was: 1 :O0 min denature at
94°C. forty cycles of 0:30 min at W C , 0:25 min at 55'C and 1:10 min at 72°C. The final extension
was 3:00 at 72°C.
The ERA1 cDNA and genomic probes were a 1300bp and a 5kb fragment respectively
that were generated using PCR. The cDNA probe was generated from the pZLS1 plasmid
containhg the ERA 1 cDNA (Cutler et al. 1996). The prirners used were T7 and M l 3 forward
Universal pnmers. The conditions for PCR were: 1 :30 min at 94°C by followed by forty cycles of
0:30 min at 94°C. 0:30 min at 55°C and 1 :O0 min at 72°C. The genomic probe was generated from
the pBK-CMV plasmid (Cutler et al. 1996). The prirners used were T3 and 77 Universal pnmers.
The conditions for PCR were: 1 :O0 min at 94°C by followed by twenty-five cycles of 0:30 min at
94°C. 0:30 min at 51 OC and 500 mins at 72°C.
2.5.6 Farnesylation Assay The famesylation assay was performed according to Cutler et al. (1996) with slight
modification. Floral bud tissue from plants grown under continuous iight conditions was
harvested. Protein was extracted in 1 ml of extraction buffer (50mM Hepes [pH 7.51, ImM MgCl,,
1 rnM EGTA, 5mM dithiotfireitol (OTT), leupeptin (Zpgfrnl), aprotinin (2Cig/ml) and 1mM
phenylmethylsulfonyl fluoride). Extracts were clarified by centrifugation at 1OOOOg for 10 mins
Materials and hlethods 28
and then at 100000g for 30 mins. Soluble protein extract (100pg) was incubated at 30°C for 40
mins in 25pI of reacüon buffer (SOmM Hepes [pH 5.71,SmM MgCI2, 5mM DlT, 5ug nudeosorne
assem bl y pmtein (NAP). and OSpM tmarnesyl diphosphate (FPP) [17.O Cümrnol: AmershamD.
Reactions were teminated with EDTA (50mM) and the mixture was analyzed by SDS PAGE,
NAP was used as the target for prenylation for the endogenous farnesytransferase (nase).
Gels were stained with Coornassie Brillant Blue R (Sigma) and incubated for 3040 mins in
Amplify (Amersharn) before drying using a BioRad 6583 gel drier. The dehydrated gel was
exposed to Hyperfilm MP autoradiograph (Arnersham) for one week at -70°C to visualize the
incorporation of PHIFPP. This experiment was perfomed once.
Results 29
3.0 Results
3.1 Genetic Analysis
3.1.1 Isolation of Suppressor Mutation from abil- 1 The strain, SC1 9-6, was isolated by screening mutagenized abil-1 seeds for
suppression of ABA insensitivity in the seed (Steber et al. 1998). When grown, the double
mutant is a semi-dwarf with short, club-shaped siliques and flat floral buds. To isolate the
suppressor mutation from the abii-1 background, SC1 9-6 was crossed to Ler- An resulting F i
plant was allowed to self pollinate and the F2 seeds were collected. Since the vegetative and
ABA sensitivity phenotypes of the suppressor mutation were unknown, the strategy to isolate
the plant containing the suppressor mutation was to eliminate those classes for which the
phenotype was known and readily identifiable (Le., ab i l - l and wildtype respectively). The first
round of seledion included plating F2 seeds on MS media supplemented with 3pM ABA to allow
the abil-l/abil-1 homozygotes and abil/+ heterozygotes to genninate. In this selection, 27%
(54: 143) of seeds geminated on 3pM ABA, representing subset#l (Table 5). This percentage
suggested 5 out of 16 possible classes germinated (XL 0.61, p>O.OS), perhaps including the
abil/abil sc79-6/+ class, but excluding the double heterozygote (Table 5). These data
suggested that plant homozygous for the suppressor mutation is not insensitive to ABA and must
be homozygous to suppress homozygous abil-1. It also appeared that a heterozygous
suppressor mutation can suppress heterozygous abil-1, or at least alter the sensitivity of the
seed to ABA. The possibility of a matemal effect also remained, Le., the seed mat may influence
the sensitivity to exogenous ABA, altering the germination ratios from the expected ratios
(Finkelstein 1994a). However, since the concentration of A6A also prevents wildtype seeds
from germinating, these data did not ailow determination of the mode of inheritance of
suppressor mutation. The remaining classes (1 111 6) are represented by subset#;! (Table 5). This
Table 5. Genotype and phenotype of SC19-6 X Ler F2 classes.
The SC19-6 mutant was crossed to Ler. The resulting FI plant was allowed to self pollinate. The F2 seeds were plated on 3pM ABA and classes in subset#l gemrinated and thus couid be eliminated from the analysis. Seeds from subseW were rnoved to MS media for rescue. Within subset##2, F2 plants were selected based on phenotype. Those looking like wild type (wt) were excluded and those resernbling the suppressor mutant ('sc19-6") were placed in subset#2B- Selection within subseWB included examining the gemination rate on MS media and establishing the genotype of representatives of F3 families at the AB11 locus, seeking the plant which resembled the suppressor mutant and was wildtype at the AB11 locus. -
Subset Genotype Proportion out of Germination Vegetative
16 classes phenotype on phenotype
3pM ABA
SC 1 9 - 6 / ~ ~ 19-6
abi1-V abil-1 1 - "scl 9-6"
SC 1 9 - 6 / ~ ~ 19-6 * +/+ 1 - SC^ 9-6"
SC 79-6 /~~19-6
"desired ciass; + = germination, - = nongermination
For simplicity, the strain name is used as the gene name of the suppressor mutation and %cl 9-6" is used to describe the phenotype of the homozygous suppressor mutation isolated from abil- Ilabil-1.
Resul ts 31
includes the desired class, +/+ scl9-Wsc19-6. The seeds from subseW were moved from 3pM
ABA to MS media to geminate.
Selection from within subset#2 involved eliminating those plants which did not display the
"sc19-6" vegetative phenotypes when grown in pots. The F2 seedlings (107) were potted and
the vegetative phenotypes were scored. Of these, 28% (30:77) were scored as having a "sc19-
6"-like phenotype, with a semidwarf stature, an exaggerated flat floral bud, and club-shaped
siliques. With the data collected thus far, it was not possible to predict which classes from within
subseH2 were selected, as the mode of inheritance had not yet been determined. SubseWB
(Table 5) represents 4 classes of 11 likely having "sc19-6" vegetative phenotypes (30:77,
x2=1 -27. p>0.05).
Selection from within subseWB included an examination of the germination phenotypes
of the F3 families. The thirty plants selected from subset#2 were allowed to self pollinate and the
F3 seeds were collected- Due to the nature of this screen, the possibility existed that this mutant
was not recoverable in an ABII+/ABIl+ background (Steber et al. q998). To test this possibility,
F3 families were plated on MS media and the germination rates were scored. In the F3 family
analysis, four families (3, 16,23,28) showed germination rates that suggested only one mutation
was segregating as nongerminating seeds. If the segregating mutation responsible for the
nongerminating seeds was the suppressor mutation of abil-1, this mlght suggest that the
suppressor mutation was not recoverable in a witdtype background. I t was also possible that
background mutations were preventing the seeds from germinating. Four F3 families were
further analyzed to distinguish between these two possibilities.
Approximately 20 representatives from each F3 family were potted and the vegetative
phenotype scored. In addition, the genotype of representatives from each of the F3 families at
the AB1 locus was determined using PCR and Ncol restriction analysis, as described in section
2.2.1. Representatives from each of the families were genotyped in this manner (Table 6, Fig. 1).
These data allowed detemination whether the suppressor mutation was recoverable in an
ABIl+/ABIl+ background and whether the 'sc19-6" phenotype was dependent on the presence
of the mutation in ABIl. lndividuals within one F3 family (#28), were found to display the 'sc19-6"
Table 6. Plant gross morphology and establishment of the genotype at the AB11 locus of approximately 20 representatives of 4 F3 families.
F3 families from the cross SC19-6 X Ler were selected from other F2 plants baseci on vegetative phenotypes. Plants were either scored as wildtype (wt) or with semi-dwarfed stature and club- shaped siliques ('sc19-6"). The genotype for each plant at the AB11 locus was established as described (2.2.1). The plant sought was that one possessing 'sc19-6" phenotypes and wildtype at the AB11 locus.
F3 family plants in family: phenotype genotype at AB17 locus
For simplicity, the strain name is used as ?he gene name of the suppressor mutation and "sc19-6" is used to describe the phenotype of the homozygous suppressor mutation isolated from abil- ?/abil -1.
Results 33
Fig 1. Establishing the genotype of SC1 9-6 X Ler F3 family individuals at the A811 locus.
The PCR product is 830 bp long. The point mutation in abil-1 within the PCR product eliminates an Ncol site. Ncol digestion in wildtype produces two products, 257 and 573 bp. Arrows indicate 300 and 600 bp in the 100 bp ladder.
Lane 1.100 base pair ladder Lane 2. Ler Lane 3. abil-1 Lane 4. wild type cDNA Lane 5. F3 family #16.1 Lane 6. F3 family #23.1 Lane 7. F3 family #3.1 Lane 8. F3 family #28.1 Lane 9. F3 family #28.8 Lane 10. F3 family #28.2
Results 34
phenotype and were genotyped to have the wildtype allele at the AB11 locus. These data
suggest that suppressor mutation does have a vegetative phenotype independent of abil-l and
that the homozygous plant is recoverable in the wildtype background. However, since wild type
plants were also segregating, indicating the parent plant was a heterozygote at the suppressor
mutation locus, it was necessary to select the progeny homozygous for the suppressor
mutation.
F4 seed was collected from individual plants in F3 family (#28). Preliminary data
suggested suppressor mutant seeds were more sensitive to exogenous ABA than wildtype
seeds. Therefore, progeny from individual lines with 0% germination on 0.3pM ABA would
represent a Iine homozygous for suppressor mutation. Two families (28.8 and 28.9), showed 0%
germination on 0.3pM M A . These seeds were moved to MS media for rescue and assumed to
be mutant lines homozygous for the suppressor mutation. The mutant plant was not a semi-
dwarf; however it was supersensitive to ABA at the level of the seed and had club-shaped
siliques, resembling SC1 9-6. The combination of ABA supersensitivity with the vegetative
phenotypes does not resemble the phenotype of any mutant previously described-
3.1.2 Confirmation of the abil-1 Suppressor Mutation Since the suppressor mutant was isolated from an EMS mutagenized population, the
possibility existed that the vegetative phenotype is due to background mutations and is unlinked
to the germination defect that was used to select the mutant. Therefore, it was necessary to
show that the mutation in the suppressor mutation was the same mutation in the double mutant,
SC1 9-6, and to show tight linkage between the distinctive suppressor mutation vegetative
phenotype and the ABA supersensitivity germination defect.
To ensure the recovered single mutant contained the mutation responsible for the
phenotype observed in the original double mutant, the homozygous suppressor muation was
crossed to abil-Vabil-1. An F1 plant was allowed to self pollinate and the resulting F2 progeny
were plated on a MS media supplemented with 0.6 or 3 pM ABA. The expected ratio of 9:7
germination: nongermination on a MS media supplemented with 3pM ABA was observed (59:40,
Results 35
x2 = 0.53). On 0.6pM ABA, the expected ratio 133 germination: nongermination was also
observed (70:10, X' = 2.20). These data suggest the suppressor mutation isolated was the
mutation observed in SC1 9-6.
To establish tight lin kage between the vegetative phenotype and the ABA su persensitivity
germination defect, the suppressor mutant was crossed to Ler. An F1 plant was allowed to self
pollinate and the resulting F2 progeny were plated on a MS petri plate supplemented with 0.6pM
ABA. The germination rate of the F2 progeny (135:59, 3:l x2=3.03) suggests suppressor
muation is a recessive mutation in one gene- A portion of the non-germinating seeds (24) were
moved to MS for rescue. Both classes of seeds (genninating and non-germinating on a MS petri
plate supplemented with 0.6pM ABA) were potted and the vegetative phenotypes were scored.
AU42 plants scored as having wildtype sensitivity to ABA at the level of the seed also had
wildtype vegetative tissue. Al124 plants scored as ABA supersensitive had 'sc19-6"
phenotypes, including shorter, club-shaped siliques and exaggerated flat-topped flowers. The
data suggested suppressor mutation is a homozygous mutant line and the obsewed vegetative
and germination phenotypes are caused by a single recessive mutation.
3.1.2 Complementation of the eral-2 Mutation with the abil-1 Suppressor Mutation
The suppressor mutation causes the seeds to be supersensitive to the application of
exogenous ABA. Three other mutants (era) have previously been described as ABA
supersensitive at the level of seed germination (Cutler et al. 1996). To detemine if the
suppressor mutation was located at the same locus as any of these genes, it was mapped as
described in section 2.2.2 using 10 SSLP and RFLP markers. Two markers on the bottom of
chromosome five (nga 76 and DFR) were found to CO-segregate with the ABA sensitivity
phenotype of suppressor mutation (Table 7). suggesting suppressor mutation is found on the
bottom of chromosome five. ERAI has been cloned and located on BAC MNS9, containing a
IOkB fragment of the bottom of chromosome five, the same position as suppressor mutation.
Consequently, suppressor mutant was crossed to eral-2. The reciprocal cross was also done.
Table 7. Mapping results.
The eral-4 mutant was crossed to wildtype MCol. Plants hornozygous for eral-4 were selected by choosing nongerminators on MS media supplemented with 0.8pM ABA. DNA was isolated from each plant and PCR analysis performed. Markers linked to eml-4 segregated with eral-4; thus markers with high numbers of Ler alleles will indicate the chromosome on which m l - 4 is found.
Plant Totals Marùer 1 2 3 4 5 6 7 8 9 10
y g a 280 H L H C H H C H H H . nga 168 C C L L C - C L C C
nga 6 H L C H H H C L H C . nga 8 H C H H L H L C L C AthGAB H - - - H H H L L C
L C H 1 2 7 3 6 O 1 3 5 3 3 4 2 1 4
Results 37
The F i plants were extremely faciated and resembled the eral-2 phenotype. The F i plants were
allowed to self pollinate and the resulting F2 progeny were plated on a MS petri plate
supplemented with 0.8pM ABA- None of the F2 seeds (0:100 for each cross) gerrninated. These
data suggest that the suppressor mutation does not camplement the en1 mutation and thus is an
alleIe of ERAI. The suppressor mutant was thus renamed era1-4-
To confinn that e n 1 4 was not a contamination of eral-2 in the seed stock of the original
screen, a DNA blot analysis of genomic DNA from Ler, era14, MCol, and eral-2 probing with
ERAI was performed (Fig- 2)- The erai-2 mutation is a deletion allele and does not produce a
signal on a autoradiogram when probed with ERAI (Cutler et al, 1996). The era1-4 mutation was
produced by EMS mutagenesis, which commonly causes point mutations (Feldmann et al. 1994)
suggesting the ERAI gene should be intact in the era1-4 mutant- Genomic DNA was isolated
from Ler, eral-4, MCol, and eral-2. The DNA was digested with Eco RI and DNA gel blot
analysis was performed. The blots were hybridized with the ERAI probe. Ler, MCol, and eral-4
had expected 4.3 and 1.5kb hybridization bands whereas eral-2 had no corresponding
detectable signal. This suggest the ERAI gene is intact in both Ler and eral-4.
ERA 7 encodes the l3 su bunit of famesyltransferase (FTase) and prenylates famesyl
groups on to target proteins. The farnesylation activity of eral-2 is completely eliminated as
measured by the assay (Cutler et al. 1996). Although era14 is likely a point mutation and the
gene is still intact, en14 displays many phenotypes similar to eral-2, suggesting that
farnesylation activity may also be eliminated in era14. A famesylation assay (Fig. 3) shows Ler
possesses a band at approximately 86kD corresponding to the predicted size of the NAP-GST
fusion protein, which acts as the substrate for prenylation by FTase. No such band was seen in
the corresponding era 1-4 lane, suggesting e n 7 4 has reduced, if any, famesylation activity.
Together, the complementation. mapping. DNA gel blot analysis and the famesylation assay
indicate that era14 is a novel allele of ERAI.
fo ensure that the loss of famesylation activity was due to a mutation within the gene as
opposed to a mutation within a regulatory region preventing transcription or translation of the
Fig. 2 DNA gel blot hybridized w i h he ERAI gaiornic probe.
Genornic DNA from Ler (lane l), etal4 (lane 2), MCoi (lane 3). and era7-2 (lane 4) were digesed wi(h Eco RI a d size fradionated using agarose gel eiedropharesis.The predded 4.3 and 1.5 kb fragments (indicaded by the arrw s) were producad in Ler, MCd and ma f -4. The m l 2 mutaon is a deie(ion and does not have ne predcted bmds
era14 Ler
Fig. 3. In vitro farnesyiation activity of Ler and
Soluable protein was extracted and incubated
era 1-4.
with NAP-GST and (3HlFPP. NAP-GST fusion protein acted as the subsîrate and [3H]FPP was covalently attached if endogenous famesyiation advity existed. Protein was equally loaded and size Cadionated by SDS PAGE. Show in the autoradiagram is a band at approxïmately 86 kD (indicatd by the arrow) corresponding to the predicted size of NAP-GST fusion protein indicating famesyiation activity in Ler. No such band was seeo in the eral4 sample, indicab'ng no detectabie endogenous fanesylation activity.
Results 40
gene, a RNA gel blot was hybridized with the ERAI probe (Fig. 4). Ler and abil-1 show barely
detectable levels of E R ! 1. In contrast, era1-4 and abil-1 era1-4 show increased levels of ERA1
transcripts. The eral-2 mutant shows no signal (data not shown). These data suggest that the
ERAl gene is intact and the era l4 mutation does not prevent transcription of the gene and in
fact, the era 14 mutation enhances transcription.
3.1.3 eral-4 as a Suppressor of abi2-f In addition to isolating abil-1, Koomneef et al. (1 984) also isolated tbe mutant, abi2-7.
The AB12 gene has since been found to be a homologue of AB11 (Leung et al. 1997). The mutant,
abi2-1, resembles abii-1 in many respects, The seed, the root and the guard celfs have al1 been
shown to be insensitive to ABA (Koomneef et al. 19û4, Leung et al. 1 997, Pei et al. 1 997). ln
fact, abi2-1 has a similar mutation resulting in the same RFLP as abil-1 allowing it to be
assayed by PCR and enzyme digestion with Ncol (Leung et al. 1997). Not surprisingly, eral-2 is
able to rewver the ABA sensitivity of the seeds in abi2-1 as well as in abil-1 (Pei et al. 1998).
Thus, to detemine if eral-4 was also able to suppress abi2-1 with respect to ABA sensitivity in
the seed, e r a l 4 was crossed to abi2-1. The FI plants (era14/+ abi2-7/+) were allowed to self
pollinate and resulting F2 seeds were plated on both 0.8 or 3pM ABA and the germination rates
scored (Table 8). Neither the expected ratio of 9:7 germination:nongennination on 3pM (321:172,
x2=1 6.6). no? Me expected ratio of 13:3 germination:nongerrnination on 0.8pM ABA (347:114,
x2=1 0.55) was observed. However, era14 and abi2-1 are found within 1 ScM of each other on
chromosome 5. Therefore, the eral-4 and abi2-1 mutations will only be located within the same
plant at a very low frequency due to rare recombination events. In order to determine whether or
not eral-4 is able to suppress abi2-1, it was necessary to find a plant that did not geminate on
0.8pM ABA that had the abi2-7 mutation as well. This would suggest that indeed, era1-4 was
able to suppress abi2-1. Thus, F2 seeds not germinating on 0.8pM ABA were rnoved to MS to
rewver, These plants are assumed to be homozygous for the era l4 mutation. From each of 31
plants, DNA was isolated and genotyped at the AB12 locus. In this way, 10 lines (X89.4, X89.6.
X89.10, X89.12. X89.13. X89.14, X89.l 5, X89.26. X89.27, X89.30) al1 heterozygous at the AB12
Fig . 4. RNA gel blot hybridized with the €RA 1 cDNA probe.
Seedlings were grown vertically on petri plates containing MS media for approximately two weeks. RNA was extracted and separated by electrophoresis using a 1.1 % agarose fomialdehyde gel. A signal (approximately 1 -26kb) was detected. corresponding to the sire of the ERA1 cDNA. The same blot was probed with rRNA to show equd loading.
Lane 1. Ler Lane 2. abi7-7 Lane 3. era14 Lane 4. abi7-l eral4
Results 42 - -
Table 8. Germination rates of F2 progeny of eral4 X abi2-1.
The era 1 4 mutant was crossed to abi2-1 and the resulüng FI plant was allowed to self pollinate. The F2 seeds were plated on MS media supplemented with 0, 0.8 or 3vM ABA and the germination rates scored. Seeds not germinating were transferred to MS to germinate.
Results 43
locus were recovered. Because of the dominant nature of the abi2-1 mutation, these data
tentatively suggest that era1-4 is able to suppress M A insensitivity of abi2-1 seeds, To confirrn,
it is necessary to isolate to double mutant and observe the germination phenotype on 0.6pM
ABA.
3.2 Developmental Characterization of era 1-4, abil- 1 and abil-1 eral-4
Cutler (1 996) describes a developmental defect in the siliques of eral-2. A number of
other developmental defects in eral-2 have also been reported, including increased floral organ
number, a faciated inflorescence, and an enlarged meristem (0. Bonetta, personal
communication). A number of characters, including inflorescence height, floral and stomate
parameters in era14, mutant and wildtype plants were characterized morphologicaliy.
3.2.1 Inflorescence Heig ht The gross morphology of Ler, abil-1, abil-1 eral-4 and era1-4 is shown (Fig. 5). Ler is
a tall, erect plant with long, slender siliques. The most noticeable defect in both eral-4 and abil-
7 is the reduced inflorescence height. Both era l4 and abil-1 are significantly shorter than Ler
(Fig. 6). This effect is enhanced in the double mutant, abil-l eral-4, and plants of this genotype
are significanüy shorter than either of the single mutants (Figs. 5,6). These data suggest that a
mutation in either era l4 or abil-1 causes a reduction in inflorescence height. There is a greater
decrease in height when the two mutations are combined.
3.2.2 Silique and Floral Development The silique length in eral-4 and abil-1 era14 were not significantly different from each
other; however, they were significantly shorter than either abil-1 and Ler (Fig. 6). The mutant
abil-1 also has significantly shorter siliques when compared to Ler. Analysis of the pistil using
SEM (Fig. 7) shows era1-4 (B) and abil-1 eral-4 (O) tend to have shorter, wider pistils when
' Results 44
Ler abi7-1 abif -1 eral-4 eraf 4
Fig. 5. Gross morphology of Ler, abil-1, abil-l era 1 4 , and era 1-4.
Plants are approximateiy four weeks old and grown at 22°C under continuous light conditions.
Results 45
Inflorescence Height
B Silique L e m
l Ler abil-1 en14 abil-l eral-4
Fig. 6. Inflorescence height and silique length of Ler, abil-1, era 1-4, and abil- 7 era 14.
Plants approximately four weeks old grown under continuous light conditions were rneasured for inflorescence height (A) (n=10- 1 4). Five siliques from five plants for each genotype were measured for silique length (B) (n=25). Data points represent LSM. a, b and c are significantly different. Error bars represent 95% C.I.
Fig. 7. Examination of pistil and stamen morphology of Ler (A),em14 (6). abi1-1 (C). and abil-1 era1-4 (D) by SEM.
The e n 1 4 and abil-1 en14 mutants have shorter, club shaped pistils and three locules. The abil-1, erai-4 and sbi7-1 era1-4 mutants have altered stamen morphology when compared to Ler. Sepals and petals were removed for clanty. Stamens were alsa removed in A, 8 and 0. Scale bars = 0.6mm.
Results 47
compared to Ler (A) or abil-1(C). Analysis of additional samples of abil-1 era14 revealed more
severe defects in carpe1 morphology (Fig. 8). These deformities were seen in approximately 50%
of al1 carpels examined. In addition to carpe1 deformities, anther deformities were also seen in
era14, abil-1 and abil-leral-4 (Figs. 7,8). The pollen of era1-4, abi1-l and abil-1 era1-4 is
also affected (Fig. 9). T hese data suggest that a mutation in either ERAI or AB11 causes defects
in morphology of the reproductive tissues. Silique length is negatively affected in both abil-1 and
era1-4; however, eral-4 is shorter than abil-1 - Because the silique length of abil-1 eral-4
more cfoseiy resembles that of eral-4, this suggests era1-4 is able to campfetely suppress the
phenotype of abil-1 with respect to silique length (Fig. 6). Anther and pollen morphology is also
aberrant in abil-1, era7-4 and abil-l e ra l4 (Figs. 7,8,9). The most aberrant morphological
effects are in the gynecium of the double mutant where the effects of the era14 and the abil-1
mutations are synergistic, as they are more severe in the double mutant than in either of the
single mutants (Figs. 6,7,8).
Fioral organ number is a highly regulated event, with the typical flower having 2 locules. 6
anthers, 4 petals and 4 sepals (Coen 8 Meyerowitz 1991). The mutant era14 was shown to
affect length and shape of two floral organs; the carpe1 and the anther. To investigate whether
or not other parameters of floral development were also affected in e ra l4 and abi l - l eral4,
floral parts were counted (Fig- 1 O). Carpel number (A) was increased in era14 and the effect
was exaggerated in abil-1 era14 with a higher proportion of samples having increased locule
number. This is also seen in transverse sections of the carpels (Fig. 11B,D) and in the SEM
analysis of the pistil (Fig. 7B.D). The mutation in era7-4 did not affect organ numbers in the other
three whorls, however the same was not true for abil-1 era1-4. Anther number (B), petal
number (C) and sepal number (O) were ail increased in the double mutant. The largest change in
organ number from Ler was in anther number where two samples had 11 anthers, cornpared to
six wmmonly found in samples of the other three genotypes. All Me data wmbined suggest a
mutation in ERA 1 affects development of reproductive tissue. specifically gynoecium and
androecium tissue. Any developmental effect in floral organ number seen in abi1-7 is not
suppressed by eral-4, but is arnplified when era1-4 is combined with abil-1.
Results 48
Fig. 8. Examination of an aberrant pistil (A) and anther (B) in abil-1 eral-4 by SEM.
The double mutant abil-l eral-4 has deformities in as many as 50% of ail pistils and stamens examined. Plants were grown under continuous Iight conditions.
Fig. 9. Examination of pollen grains of Ler (A). e m l 4 (B), abil-1 (C). and abil-1 em14 (D) by SEM.
The era1-4 and abil-1 eral4 mutants have deformed pollen grains (amws) when compared to Ler. Scale bars = 30um.
I A Carpel Number
I Petal Number
Lerecta atil-1 ml4 abil-1 ml4
Fig. 10. Number of floral organs of Ler, abil-1, era14, and abil-1 eral-4 genotypes.
Carpel number (A), stamen number (B), petal number (C), and sepal number (D) were counted in ter, abil-1, era 1 4 , abil-1 era 1 4 . The organs of 5 flowers from 5 plants per genotype were counted (n=25). Legend indicates number of floral organs counted. (+) category may include a partial organ. Plants were grown under continuous light conditions.
Fig . 1 1. Examination of pistil transverse -ans of Ler (A), e r a l 4 (B), abil-1 (C), and abil-1 e m l 4 (D) by SEM.
Ler and abil-1 have two locules wmpared to em14 and abil-1 era7-4 which have three. Scale bar = 0.5mm.
Results 52
3.2.3 Stomate Parameters To investigate whether or not e n 1 4 also affected stomatal development, leaves frbm
Ler, abil-7, eral-4, and abil-1 era1-4 were cleared and examined. Three parameters of
stomate development were investigated (Fig. 12): density (A), length (6) and aperture (C).
Stomate density was not affected in either era14 or abi l-1 era1-4 when compared to Ler (A).
Stomatal density was increased in abil-1. Stomate length was not affected in abil-1 nor em14
when compared to Ler (6). However, when the two lesions were combined, stomatal length
was significantly increased in abil-1 era 14. Stornatal aperture (C) is a third parameter studied
with respect to the stomates. There were significant differences between the four genotypes:
abil-1 and abil-1 e r a l 4 were not significantly different from each other, having a pore width
of approximately 5pm, but were significantly different from era1-4 (3.5pm) and Ler (2pm). The
mutant era7-4 also had a "resting" stornatal pore significantly wider than Ler.
The analysis of stomates from al1 four genotypes suggest that abil-1 has increased
stornatal density and the double mutant has a stomate density resembling eral-4, suggesting
eral-4 is able to suppress the effect of increased stomatal density of abil-7. Conversely, abil-
1 has an increased resting stomatal pore and eral-4 is not able to suppress the increase in
resting stomatal pore aperture as the double mutant resembles abil-1. With respect to stomatal
length, e r a l 4 and abil-1 appear to have a synergistic effect, where the stomate length of the
double mutant is significantly longer than either of the single mutants. This shows defects exist
beyond aberrations seen in the siliques and in the inflorescence height and suggests a possible
cornplex interaction between ERA1 and AB11 in stomate and floral organ development,
3.3 Physiological Characterization of era 1-4, abil -1 and abil- leral-4
The mutant, abil-1, was isolated in a screen selecting for seeds that were able to
germinate on amounts of exogenous ABA that prohibited wildtype seeds from germinating
(Koomneef et al, 1984). A number of studies have shown that, in addition to defective ABA
response in the seed, abil-1 was also defective for other ABA responses when compared to
Results 53
- - --
A Stomate Density
Le? abil-1 era14 abil-1 era14
B Stomate Length
Ler abil-1 eral-4 abil-1 erald
Stomate Aperture
Fig. 12. Stomate parameters of Ler, abil-1, era 1 4 , and abil-1 eral-4
8 -
Mature, fully expanded leaves from plants grown under continuous light conditions were cleared and stomate parameters were measured. Stomates were counted and measured on four leaves for stomate density (A), stomate length (6) and stomate aperture (C). Stomate length includes the guard cells and aperture. Stomate aperture was measured at the widest opening between the two guard cells. A l data points represent LSM of 78-80 stomates measured. Error bars represent 95% C.I. a, b and c are significantly different from each other.
6 - - A
L 4 - - Y
a a
C
2 - -
O b
Ler abil-l -14 abil-1 eral-4
wildtype- These responses included: ability for root growth on inhibitory levels of ABA, defective
guard cell closure resulting in a drought susceptible plant, lack of domancy, and defective
RAB18 induction (an ABA inducible gene) in the vegetative tissue (Koomneef et al. 1984, Leung
et al. 1997, Pei et al. 1997)-
It has also been shown that eral-2, a supersensitive mutant, can suppress abil-l in at
least two of these responses, seed ABA sensitivity and guard cell ABA sensitivity (Cooney
1996, Pei et al. 1998), suggesting €RA 1 is epistatic to ABIl. An investigation of whether or not
era7 can suppress any other of the ABA responses defective in abil-7 will provide information
on the pathways in which both AB11 and ERAl gene products operate. Therefore, the intensity
of ABA responses of era14 and its ability to suppress the responses of abil-1 were examined
for germination of seeds on exogenous ABA, sensitivity of root growth on ABA, water loss, the
response of the guard cells to ABA and domancy.
3.3.1 Seed Responsiveness to Exogenous and Endogenous ABA The germination rates of Ler, abil-1, era1-4 and abil-1 era14 on exogenous ABA are
shown (Fig. 13). 100% of abil-1 seeds were able to geminate on MS media supplemented with
3pM ABA, confirming it is ABA insensitive. Ler is more sensitive than abil-1 and had only
approximately 30% germination on 1.2pM AB& The era14 mutant has similar sensitivity to ABA
as eral-2, with approximately 10% germination on 0.3pM ABA. The double mutant abil-1 e n 1 4
was less sensitive than era1-4, but more sensitive than Ler with approximately 30% germination
on 0.3pM ABA- These data suggest that era1-4 is able to partially suppress abil-1 with respect
to ABA sensitivity in the seed.
Throughout the investigation it became apparent that the sensitivity of era 1-4 seeds to
exogenous ABA varied depending whether era1-4 was matemally or paternally derived.
Crosses were designed to investigate the possibility that the genotype of the seed coat (derived
from matemal tissue) was influencing the sensitivity of the seed to exogenous ABA. Reciprocal
crosses were perfomed between e n 1 4 and Lerand era1-4 and abil-1 and the resulting F l
Results 55
Germination Rates on Exogenous ABA
Fig. 13. Germination rates on exogenous ABA of Ler, abil- 1, era 7 4 , and abil-1 era1-4 .
Approximately 100 seeds per genotype were surface sterilized and plated on petri plates with MS media supplernented with 0,0.3, 0.6, 1.2 or 3pM ABA. Seeds were chilled for four days and the germination scored after 5 days of moving to 22OC. The experiment was repeated three times with similar results. Data shown are from one such experiment.
Results 56
seeds were plated on MS media supplemented with 0.6 or 3vM ABA (Table 9). The data suggest
that when the genotype of the maternally derived seed coat is eral-4/era14, the sensitivity of
the seed to exogenous ABA is enhanced. This enhanced sensitivity to exogenous ABA also
occurs when the dominant, insensitive mutation, abil-7, is present in the embryo. This suggests
that the matemal tissue plays an important rote in germination suppression. Finkelstein (1994a)
afso concluded sensitivity of seeds to exogenous ABA is partially controlfed by the matemal
tissue when she examined reciprocal crosses between abil-1 and Ler- When abi l - l was
maternalIy derived, the sensitivity of the seeds to ABA was decreased, compared to when abil-
1 was patemally derived.
ABA is known to positively regulate dorrnancy (Karssen et al. 1983)- ABA insensitive
genotypes have been shown to be nondormant while ABA supersensitive genotypes have been
shown to be hyperdonnant (Kwmneef et al. 1984, Cutler et al. 1996). The mutants, era7-4 and
abil- l era 14, were assayed for dormancy with respect to Ler and abil-1 (Fig. 14). Both Ler
and abi7-1 were non-dormant having approximately 85% germination by Day 2 post imbibition.
The eral-4 mutant was more dormant with only 60% germination by Day 5 p s t imbibition. The
era1-4 mutant is able to partially suppress abil-1 with respect to germination as abil-1 era74
shows 80% germination by Day 5, an intermediate response between era1-4 and abil-1.
3.3.2 Root Growth Sensitivity to ABA The inhibition of root growth on exogenous ABA is also a measure of ABA sensitivity and
abil- l has been shown to be insensitive in this response (Koomneef et al. 1984, Leung et al.
1994, 1997). The inhibition of root growth of Ler, abil-7, era 14 and abi l - l era 1 4 was
assayed on varying concentrations of ABA (Fig. 15). All genotypes except era14 had
approximately the same amount of new root growth on MS media (1 6mm); the era14 mutant had
slightly less root growth with approxirnately 12mm. The mutant abil-1 was not inhibited in mot
growth with approximately equivalent amount of mot growth on 10pM ABA as on MS media. Ler
and eral-2 are sensitive to exogenous ABA and had Omm of new root growth on 1OpM ABA.
The era74 mutant is slightly less sensitive and had approximately 3mm of new root gmwth on
Results
Table 9. Matemal influence in the seed mat on germination on exogenous ABA
Reciprocal crosses were performed between Ler and eraI-4 (A) and abil-1 and era l4 (B). Fi seeds were plated on MS media supplemented with O and 0.6 or O and 3vM ABA and the germination rates scored.
A Cross Cross number 8 Total Germination on 0.6uM ABA
LeP X eral-4 X51 r (8:3) (21 :7)
X61 (6:l)' e r a 1 4 X Ler X 50a ($:IO) (2:26)
X50b (0:s) X 501 (1 :6) X50m (0:5)
B Cross Cross number & Total Germination on 3uM ABA
abil-1' X era 1 4 X53a (17:O) (43:O)
' matemal plant
Resuits 58
+ Ler ' +abil -1 +eral4 &abil -1 eral4
Fig. 14. Dormancy of Ler, abil-7, eral4, and abil-l eral-4.
Approximately 100 seeds per genotype, four months of age, were surface sterilized and plated on MS media. Wihout chilling, the germination rates were scored everyday for five days. Experirnent was done twice with similar results. Data shown are from one experiment.
Results 59
Fig. 15. New root growth on exogenous ABA of Ler, abil-1, era 1 4 , and abil-l era 1-4.
Seedlings were grown vertically for approximately one week on MS media. Seedlings were then transfened to MS media supplemented with 0, 10,50 or 100pM ABA and the roots measured after three days growth. The data shown represent the cornbined LSM of three independent expenments (n=22-50). Emor ban represent 95% C.I.
lOpM ABA. The abil-1 era1-4 double mutant displays an intermediate phenotype hetween eral-
4 and abi1-1 with 9mm of new root growth on 1OpM ABA. These data suggest eral-4 can
partiaily suppress abil-1 with respect to new root growth on exogenous ABA.
3.3.3 Whole Plant and Stomatal Response to ABA The rate of water loss in excised plants can be a measure of water relations within a
plant. ABA has been shown to be the signal that promotes guard cell closure (Pei et al. 1997)
which suggests that genotypes insensitive to ABA will have defective stomatal closure, and
supersensitive genotypes will be able to close their stomates more effectively. When the plants
are excised, the abil-7 mutant has been shown to be intolerant to mild drought stress and has
higher transpiration rates when compared to wildtype (Koomneef et al. 1984). When plants are
deprived of water while in their pots, eral-2 has been shown to be drought tolerant (Pei et al,
1998). The effect that the era1-4 and abil-1 era14 mutations had on this response was
assayed with respect to Ler and abil-1 by excising the plants and measuring the weight over
time (Fig. 16)- The abil-1 mutant had high transpiration rates. In comparison, e n 1 4 was able to
parüally suppress abil-1, and the double mutant transpired at an intemediate rate cornpared to
abil-l and e r a l 4 - The surprising result was that era1-4 transpired faster when compared to
Ler. This does not support previously published data (Pei et al. 1998).
To further test ABA responses with respect to stomatal response of the eral-4 and
abil-1 e ra l4 , excised leaves were ffoated on ABA solutions as described (section 2.4.4). The
results of this assay suggest that abil-l is insensitive to ABA and does not change stomatal
aperture with addition of ABA (Fig- 17). In contrast, Ler, era14, and abil-7 era14 al1 respond to
ABA by closing their stomates. After the addition of ABA, there was no significant difference
between Ler. era1-4, and abi-1-1 eral-4 with respect to the stomatal pore width. These data
suggest that era14 is able to respond to ABA in the guard cell, however, it does not appear to
be supersensitive to ABA. The era14 is also able to completely suppress abil-1 as the
response of abil-1 era1-4 was not significantly different from era 1-4,
Results 61
Water Loss Assay
Fig. 1 6. Rate of water loss examined in Ler, abil- 1, era 14 and abil-1 era14.
Plants were sprayed with 1 pM ABA and placed in the dark for one hour. Plants were then excised below the the rosette leaves, placed in preweighted buckets, and weighed over time. The amount of the total water in the system is plotted with respect to time. Data points represent the average of three replicates (n=15).
Results 62
Stomate Aparture Response on ABA
Ler abil-1 era14 abil-1 era1-r)
Fig. 17. Stomatal aperture response of Ler, abil-1, era 1-4, and abil - 7 era 1-4 to exogenous ABA.
Leaves were floated on a solution for two hours to open the stomates, then placed on O or 30pM ABA for 24 hours. Naïl polish impressions of the resulting stomatal apertures were measured on the adaxial stomates. Data points represent LSM (nz20-43). Error ban represent 95% C.I. The experiment was performed twice with similar results. a,b, and c are significantly different from each other.
3.3.4 RAB18 Induction RAB78 is an ABA response gene and is upregulated in wildtype when exogenous ABA
is applied (Lang 8 Palva 1992). The mutant abil-1 had been shown not to respond to ABA and
does not upregulate RAB78 (Leung et al. t 997)- Levels of RAB1 8 mRNA were analyzed in Ler,
abil-7, era14 and abi7-l era14 by RNA gel blot analysis using the RAB18 probe (Fig. 18).
RAB18 mRNA was upregulated in Ler while abil-1 showed very liffle response when compared
to Ler. RAB18 appeared to be down regulated in eral4 when compared to Ler, but had higher
levels of mRNA when compared to abil-1, A similar pattern of expression to era14 was found
in the eral-2 samples. The double mutant, abil-1 era14, has a similar expression pattern of
RAB18 as abil-1. These data suggest that era1-4 is not supersensitive to ABA with respect to
RAB18 induction and it is not able to suppress abil-1 in this response.
Fig. 18. RNA gel blot hybridioed with the RAB18 probe.
Seedlings were gown vertically on petri plaies eontaing MS media for hivo weeks ta prevent he rod from penelratiq Ihe agar. The seedlings were tansferad to petri plaies oaitaining MS meda supplemented wih 0, I O and 54iM ABA for 48 houm. The firs t laie mntains RNA extracted from Ler seeds (S) which represents a posiive oontol for RABI8 expression. A sigial approximatei y 1.5kb, coorespondirg bo the size of the RAB18 cONA was deteded The same blot was probed wiîh rRNA to show equal lloabng.
Discussion 65
4.0 Discussion
4.1 Suppressor Analysis
Suppressor analysis can be a valuable genetic tool in detemining new genes in a signal
transduction pathway. The suppression of a mutation can also impar? information on the
suppressor mutation, the mutation it is suppressing, and the relationship the two mutations have
with each other. In a general case, a mutation A is suppressed by another mutation 6 via two
possible rnechanisms. The first is for mutation B to bypass mutation A via a parallei pathway,
thereby increasing the signal flux through the alternative pathway (Guarente 1993, McCourt
1999). The second possibility is that A and B are successive in a pathway and a mutation in B
causes B to no longer require activation by A (Guarente 1993. McCourt 1999). Resolution of
these possibilities will provide a great deal of information on the signal transduction pathway(s).
However, suppressor mutations can be subtie and may have no distinguishable phenotype on
their own, making them difficult to study. However, this also suggests that suppressor analysis
provides a method for obtaining mutants that would be difficult to detect by screening for a
particular phenotype.
The eral-4 mutant was isolated as a suppressor of abil-1 at the level of ABA sensitivity
of the seed so that the double mutant doas not geminate on 3pM ABA (Steber et al. 1996). The
eral-4 mutation was isolated from the abil-1 background. but how this was achieved is
uncertain. The eral-4 mutant isolation depended on selection from within subset##2 (Table 5).
The criterion was based on phenotype, selecting only those plants which had club-shaped
siliques and short inlorescences. Subsequentiy. the F3 family 28.8 was selected and plated on
0.3pM ABA. Seeds insensitive and sensitive to the exogenous ABA segregated, indicating the
parent plant was a heterozygote at the ERAl locus (Table 6, Fig. 1). The following crosses
showed that era74 is a recessive mutation and that the heterozygote has no phenotype. That a
heterozygote e r a l 4 mutant was selected based on phenotype that is recessive can not be
Discussion 66
easily explained. These plants were grown in small pots with much air circulation, producing a
dry environment. Perhaps these conditions were harsh, even for wildtype plants, resulting in a
shorter wildtype plant with shorter siliques, causing it to be selected- It is also possible that
background mutations subsequently crossed out canferred lack of fitness, resulting in a shorter
plant with shorter siliques- Whatever the explanation, the era74 mutation was selected and
shown to be a recessive mutation in a single gene, resulting in a plant with club-shaped siliques.
If we apply the conditions of a suppressor mutation described above, there are two
expfanations for how eraf-4 is able to suppress abil-1. The first is that the €RA1 is in a parallel
ABA signal transduction pathway to AB11 in the seed. The abil-1 mutation is hypothesized to
prevent transduction of the ABA signal and the era1-4 mutation increases the flux through a
parallel pathway, resulting in a seed that is now more sensitive to exogenous ABA. The second
possibility is that the ERAI gene product operates imrnediately downstream of the AB11 gene
product and is activated by ABl1. The eral-4 mutation relieves the need for activation, thus
bypassing abil-1. Examination of a nurnber of responses in the abil-1 era7-4 double mutant
may provide more evidence that will distinguish between these two possibilities.
4.2 The abil - l Mutant as a Response and Devalopmental Mutant The abil-1 mutant responses to ABA reported in this thesis are similar to previously
reported data (Koomneef et al. 1984, Leung et al. 1997, Pei et al. 1997). The abi7-1 mutant is
shown to have defective responses to ABA in the seeds, roots, guard cells, water relations
within the plant and RAB18 induction when cornpared to wildtype (Table 10). In agreement with
Leung et al. (1994). abi1-l also has increased resting stomatal aperture (Fig. 12C). This could be
interpreted as a developmental defect; however, when placed on solution to stimulate stomatal
opening (Fig. 17), there is no significant difference between Ler and abil-1. This suggests the
wide resting stomatal opening is a rneasure of sensitivity to endogenous ABA and the maximum
aperture in abil-1 is not significantly different than Ler. These data are consistent with the
notion that the abil-1 mutation causes insensitivity to endogenous and exogenous ABA in the
seed and in the vegetative tissue.
Discussion 67
Table 10. Surnrnary of responses of abil-1, era14 and the interaction between the two loci.
Response Genotype Degree of
suppression of - - abi-1-1 by era1-4
abil-1 era14 abil-1 era 7 4 stomate density + +/- +/- total
silique length - -- -- total seed sensitivity - ++ + partial
to ABA root growth --- - -- partial sensitivity to
guard cell - +/- +/- partial sensitivity to
ABA dorrnancy - ++ + partial water loss +++ + ++ partial
resting stomatal 4+ + ++ none aperture RAB18 -- - -- none
floral +/- +/- - wmpoundeà' development
stomate length +/- +/- + wmpounded' inflorescence - - -- compounded*
heiq ht +/- = wildtype levels, +, ++, +++ = ievels increased from wildtype - > - I - = levels decreased from wildtype 'phenotype is more severe than either single mutant
Discussion 68
In contrast with the conforrning ABA response data, data presented in this study also suggest
that the abil-l mutation influences developmental responses not previously reported (Table 10).
One developmental defect includes increased guard ceIl density on the abaxial side of the leaf
(Fig. 12A). This is contrary to previously published data where abil-1 stomate density was
shown not to be significantly different from Ler on the abaxial side of the leaf (Finkelstein
1994a). The difference between these two studies is not known, but may reflect different
growing conditions, such as decreased humidity.
Secondly, abil-l plants show decreased inflorescence height and silique length (Fig- 6)-
This defect is not reported in any other ABA response mutant, however, the abal, aba2, and
aba3 auxotrophic mutants are also reported to be shorter in stature than wildtype (Koornneef et
al. 1982, Léon-Kloostecziel et al. 1996). The authors attribute this decrease in height to be a
decrease in overall vigor of the plant due to increased transpiration- The shorter stature of ABA
auxotroph and insensitive mutants is inconsistent with the notion that ABA functions as a
negative regulator of cell division (Himmelbach et al, 1998). ABA has been shown to negatively
regulate cdc2a expression, which has been linked to cell division (Hemerly et al- 1993). These
data suggest that ABA auxotroph and insensitive mutants should be morphologically altered and
have increased cell number, unless the low level of ABAfsensitivity present in the mutants is
sufficient for cell cycle control, or the control of cell cycle by ABA is only a stress response.
There is evidence to suggest that ABA can 'crosstalk" with other hormones, thus the
developmental effect seen here may be a byproduct of crosstalk between other hormone
pathways. ABA is known to act as an antagonist to GA in germination and auxin in growth
responses (Himmelbach et al. 1998). Both auxin and GA are known to promote ce11 elongation
and expansion (Kende & Zeevaart 1997). Thus, a shorter inflorescence and shorter siliques
may reflect compounding effects of these hormones. However, until an AB11 loss-of-function
allele exists, it is difficult to predict in which pathways the gene product acts.
As previously described, the AB/? gene product functions in many overlapping pathways
with other signaling molecules in ABA signaling. The data presented here also suggest that
stomate, silique and inflorescence height development are also processes which are influenced
by this gene. It is not known whether ABA is the primary signaling message for these responses
or whether this represents ABA independent branch(es) within which AB11 functions. However,
these data suggest that AB11 may have a broader role in Arabidopsis development than
previously known.
4.3 Mutations in €RA1 in the Landsberg erecta Ecotype From the data presented in this thesis, era l4 is more sensitive to ABA than Landsberg
erecta (ier) for two of the responses tested (Table 10). The era l4 mutant seeds are more
sensitive to endogenous and exogenous levels of ABA when compared to Ler. The seeds are
more sensitive when plated on MS media supplemented with ABA: 10% germination on 0.3pM
ABA by eral-4 compared to 100% germination by Ler on the same ABA concentration (F ig. 13).
The era1-4 seeds are also more dormant when compared to Ler: 10% germination by Day 1,
post imbibition compared to 85% germination by Ler on the same day (Fig. 14).
In contrast, eral-4 has wifdtype sensitivity or less than wildtype sensitivity to ABA for
other responses tested. In the conditions used, eral-4 has wildtype sensitivity to ABA in the
guard cells (Fig. 17). i.e., the eral-4 response is not significantly different than Ler. However,
this assay involves minute differences in stomatal pore width between different genotypes, and
the equipment used may not be sensitive enough to differenüate between supenensitivity and
wildtype sensitivity to ABA. New root growth in era1-4 is also fess sensitive to ABA than Ler;
era7-4 had approximately 3mrn of new root growth on 1 OpM ABA compared to approximately
Omm of new root growth on the same concentration by Ler (Fig. 15). RAB18 induction is also
less sensitive to ABA in the era l4 mutant than Ler (Fig. 18). Finally, stomatal response in era1-4
is less sensitive than Ler. The resting stomatal aperture is significantly wider Vian Ler (Fig. 12C).
suggesting eral-4 is less sensitive to endogenous ABA than Ler. When plants are excised and
the rate of water loss is measured, eral-4 transpires faster than Ler (Fig. 16).
Although the stomatal data are inconsistent with the some of the other data presented in
this thesis. they are intemafly consistent. If one assumes the water loss assay is a measure of
the resting stomatal aperture, than eral-4 will transpire more quickly than wildtype, as the
Discussion 70
aperture of the stomates is wider. However, the plants used in the water loss assay were
sprayed with ABA pnor to desiccation, suggesting that the response should be more similar to
the guard cell response to ABA (Fig. 17) and that the era14 plants would transpire at the same
rate as Ler. Perhaps the ectopic application of ABA in the manner used here was insufficient
for a response as it could not penetrate the cuticle. The ABA was dissolved in water and
sprayed on the plants. Other modes of application include dissolving the hormone in methanol or
ethanol and applied directly to the leaf may be more effective (Sponsel et al. 1997). This
suggests, therefore, that perfoming this assay without ABA application woutd result in similar
trends as the data described here.
When al1 of the ABA responses of era14 are taken together, they are inconsistent with
each other. All of the responses have been shown to be ABA induced (Lang & Palva 1992,
Leung et al. 1997, and Pei et al. 1997). However, era1-4 is more sensitive to ABA than Ler for
two responses and for the remainder of the responses tested, era1-4 is as sensitive to ABA as
Ler or less. Therefore it would appear that ERA1 may have opposite signaling functions in the
different responses tested (Le., functioning as a negative regulator of the ABA signal in the seed
and as a positive regulator of RAB 18 expression); or the e n 1 4 mutation causes different
signaling states. In order to differentiate between these two hypotheses, it is necessary to
examine the phenotypes of the nuIl mutation, era 1-2 and compare them to era14.
The era1-2 mutation causes increased sensitivity to ABA in the seeds and in the guard
cells when compared to wildtype (MCol) (Cutler et al. 1996, Pei et al. 1998). The eral-4 mutation
also causes increased sensitivity to endogenous and exogenous ABA when compared to
wildtype (Ler). However, the eral-4 mutation appears to confer different sensitivity to ABA than
eral-2. The sensitivity of era1-4 mutant seeds to ABA is slightly less than eral-2 mutant seeds;
10% germination on 0.3pM ABA by eral-4 compared to 0% by eral-2 seeds on the same ABA
concentration (Fig. 13). These data suggest that era1-4 and the era1-2 mutation cause similar
phenotypic responses to exogenous and endogenous ABA in the seed.
The eral-2 mutant was shown to have hyperresponsive guard cells to ABA when
compared to MCol (Pei et al. 1998). These authors also report that erai-2 has a resting stomatal
Discussion 71
aperture pore width that is smaller than MCol and it represents a measure of the sensitivity to
endogenous ABA levels. In addition, the eral-2 mutant has also been shown to transpire more
slowly than wildtype, owing to the increased responsiveness to ABA in the guard cell (Pei et al.
1998). In contrast, the guard cells of era1-4 have a resting stomatal pore that is larger than in
Ler. In the assays employed here, the eral-4 mutant transpired faster than wildtype and had a
resting stomatal pore that was larger than Ler- Although neither e r a l 4 and eral-2 nor the
wildtype ecotypes were compared directly in the stomatal responses, the era14 mutant is less
sensitive than ter in the guard cell. suggesting that it is also less sensitive than eral-2. The data
presented here also suggests that the e r a l 4 mutation causes a different phenotype than the
eral-2 mutation causes.
The era1-4 mutant has a similar expression pattern of RAB18 induction when compared
to eral-2 (Fig. 18). In both genotypes, the plants are not supersensitive to ABA with respect to
RAB18 induction, but in fact, appear to down regulate RAB18. New root growth by era1-4 is
also less sensitive to ABA than eral-2; eral-4 had approxirnately 3mm of new root growth on
1OpM ABA compared to approximately Omm of new root growth on the same concentration of
ABA by eral-2 (Fig. 15). Consequently, the new root growth by eral-2 is not significantly
different than Ler on exogenous ABA. These data suggest that neither e r a l 4 nor eral-2 are
supersensitive to ABA in al1 responses tested (Le., new root growth and RAB18 induction)-
These data summarize two important conclusions. The first is that e n 1 4 is less sensitive
to ABA than eral-2 for many of the responses tested. The second conclusion is that ERA1 does
not appear to have a consistent role in ABA signaling. Each of these conclusions are
considered.
The data presented in this thesis suggest that e r a l 4 may be a weaker allele compared to
eral-2 (i.e., seed sensitivity to endogenous and exogenous ABA and new root growth). It is
plausible that eral-4 is a weaker allele than eral-2, given that erai-4 was EMS induced which
commonly causes point mutations (Feldmann et al. 1994). This notion is also supported by the
fact that the ERAI gene is detectable by DNA blot analysis (Fig. 2) and also its mRNA by RNA gel
blot analysis is also detectable (Fig. 4). In contrast, Me eral-2 mutation was created by fast
Discussion 72
neutron mutagenesis and is a complete deletion of the gene, thus is not detectable by DNA or
RNA gel blot analysis (Fig. 2, data not shown). Although era7-4 is perhaps a weaker allele
compared to erai-2, famesylation activity is still not detectable in this mutant by this assay (Fig.
3). The famesylation assay used NAP protein, which rnay not be a good target. It is also possible
that the assay used was not sensitive enough to detect the slight amount of farnesylation that
rnay have occuned in the weaker allele. In addition, the regulation of famesylation is largely
unknown; thus erai-4 rnay contain dornains that are still functional. For instance, n a s e in pea
and yeast (Saccharomyces cerevisiae) have been shown to bind their protein substrates
(Trueblood et al. 1997, Qian et al. 1996)- Perhaps in the eral-4 mutant, where there is
conceivably only a base pair change, Rase is still able to forrn the heterodimer and bind the
substrate- This rnay allow for another type of modification such as methylation, which can permit
a low level of target protein activity (Clarke 1992). This would not be possible in the eral-2
mutant because n a s e must form the heterodimer in order to be fundional (Qian et al. 1996). The
possibility also exists that the reduction in ABA sensitivity is due to the ecotype in which the
eral-4 allele is found (Table 1). The seeds of Ler appears to be slightly less sensitive to
exogenous ABA than MCol seeds. For example, when plated on 1.2pM ABA, MCol has 0%
germination (data not shown) compared to 30% germination by Ler at the sarne ABA
concentration. Furthemore, to induce RAB18 expression, Ler requires 48 hour exposure to
ABA, as compared to MCol which only requires 6 hours (M. Ghassemian, personal
communication). The Ler ecotype contains a mutation in the ERECTA gene which has been
cloned and shown to encode a serinelthreonine receptor kinase (Torii et al. 1996). It is,
therefore, not surprising that differences in phenotypes rnay be seen in a different ecotypes
given the large number of potential interactors for ERAl which rnay differ between ecotypes.
This implies that ERA1 is interacting at some level with one of the mutations in the Ler
background.
To examine the potential that ERAl does not appear to have a consistent role in ABA
signaling, it is necessary to examine the role of nase. The famesylation targets in plants are
alrnost entirely unknown; however, genome sequencing and biochemical studies of Arabidopsis
Discussion 73
suggests there are multiple target proteins (Randall et al. 1993). The extent to which
famesylation is involved in plant homeostasis is also targely unknown, although given the diverse
role of famesylation in other organisms (i-e., cell division, yeast mating, and stress responses),
it is likely that famesylation may impact many processes. It is also probable that FTase does not
function rnerely as a negative regulator of ABA signal transduction, but functions in a broad
range of responses and that regulation of the ABA signal is a byproduct. This hypothesis will
also help explain why there is not an consistent response to ABA when ERAI is mutated.
4.4 The eral-4 Mutant as a Suppressor of the abil-1 Mutant As surnmarized above, eral-4 is able to suppress abil-1 in ABA responses to varying
degrees ranging from incomplete to total suppression, depending on the ABA responses
rneasured (Table 10). Because a mutation in €RA1 is not able to suppress al1 the responses of
abil-1, these data suggest that the ERAl gene product operates in a subset of the responses in
which the AB11 gene product operates. If we apply the conditions of a suppressor mutation
described in section 4.1, these data also lead us to conclude that ERA1 may operate
downstream of AB11 for some responses and in a parallel pathway to ABf 1 for other responses
(Fig. 19). However, neither eral-4 nor abil-7 are nuIl alleles; therefore this is not a tme epistatic
study and these interpretations will need to be qualified when an abi l null mutation is isolated.
The phenotypes that eral-4 is able to partially or totally suppress (Le., seed sensitivity,
domiancy, root sensitivity, guard cell sensitivity and water loss) suggest that the ERAI and AB11
gene products, or the targets on which they operate, do indeed function within the same
pathway (Table 10). Some flux in the pathway due to leaky mutations is possible for both abil-1
and era 1-4. The abM-1 has an upper limit to M A sensitivity, suggesting that above a certain
threshold level, ABA is sensed in the mutant (Finkelstein 9994a). The era14 mutation is in the 8
subunit of the enzyme famesyltranseferase. This enzyme is important for adding a famesyl
group to target proteins and localiùng them to a membrane for proper and efficient function. It is
possible the target proteins are still able to function at some low level without being localized to
Discussion 74
A wildty pe mutant
response response (dmancy, nongermination, guard cell dosure', mot growth)
wildtype mutant
ABA ABA
response response (floral, inflorescence
and silique development) C
wildtype mutant
ABA ABA
response response (RAB1 8 induction,
resting stornatal aperture*)
Fig. 19. Function of AB1 1 and ERAl in ABA signating. (A) shows how AB11 and ERA1 may be operating in the same pathway. Both AB14 and ERAl are hypothesed to function as negative regulators of the ABA function, except in the guard cell (') where AB11 is hypothesized to function as a positive regulator. (B) shows AB11 and ERAI operating in parallel pathways. (C) shows where ERAl may not be functioning at all. or is not operating as a negative regulator of the ABA signal. Thickness of line is representative of the intensity of the ABA response.
Discussion 75
the membrane (Clarke 1992)- A possible scenario is each mutation is sufficiently leaky that there
is partial activity of the target proteins, each operating in the opposite manner on the ABA signal.
The net effect is a push-pull mechanism, where neither abil-1 nor era1-4 are significantly more
influential than the other, resulting in partial suppression in the double mutant (Fig. 19A)-
lnterpretation of the phenotypes in the double mutant that are more severe than either
single mutant (Le., floral organ number, inflorescence height and stomate length) suggests that
ERAl and ABIA are operating in paratlel pathways (Table 10). In the case where both genes are
mutated, both pathways are fauity and the net resuit is compounded combination of each single
mutant phenotype (Fig. 196). For the phenotypes where eral4 does not suppress abil-1 (Le.,
RAB78 induction), ERAl does not operate in those pathways, or at least does not function as a
negative regulator of the ABA signai (Fig- 19C).
These data also provide infornation on the role of AB1 I and ERAI. Because the mutant
abil-1 affects stomate, inflorescence and floral development, it suggests that AB11 has a role in
the regulation of these processes. All of those processes are strictly regulated, and it is possible
that the influence of AB11 has not been detected previously because of other compensating
pathways. However, the effects are apparent when abi1-l is in the correct genetic
background, including era1-4. This allows us to draw another conclusion; since ERAl is able to
suppress some responses (Le., stomate density), is synergistic with other phenotypes (i-e.,
stomate length, inflorescence and floral development), and is required for the influence of AB11
to be discemible, it implies that ERAl also functions to regulate these pathways. In addition, there
is data that suggests that ERA1 also has a role in regulating other developmental pathways,
specifically with respect to the floral meristem and the floral organs (D. Bonetta, personal
communication), supporting this notion.
Complementary to these conclusions is the possibility that ABA functions in floral organ,
stomate and inflorescence development AB11 and ERA1 are hypothesized to fundion in ABA
signaling pathways and until now have not been reported to regulate development. The data
presented here suggest that ABA may have a novel function in the control of floral organ,
stomate and inflorescence development via ERA1 and A M .
Discussion 76
Evidence suggests that ERA1 and AB11 may be functioning in the parallel pathways for
some responses and the same pathway for other responses. Therefore, it is important to
consider the pathways that are already known to exist. AB11 has been shown to funcüon in the
seed (Koomneef et al. 1984). T hrough the use of digenic studies, AB13, AB14 and ABE have
been shown to function in parallel pathways to AB11 and play an active role in controlling
developmental processes, thereby potentiating the tissue for the ABA signal in the seed.
Although some data suggest these gene products may have a minor role in the vegetative tissue
(Finkelstein et al, 1998, Parcy & Giraudat 1997), they have not been associated with controlling
developrnental processes in the vegetative tissue. ERA1 appears to operate in the same
pathway as ABIA in the "typical" ABA responses, including seed sensitivity to ABA and
dormancy and in parallel pathways to AB1 1 for controlling developmental pathways. This may
suggest that perhaps ERA1 is functioning in the same pathway as AB13, AB14 and AB15 for
developmental processes. A further extension of this hypothesis is that there may now be a link
for AB13, AB14 and AB15 to function in vegetative tissue. Interestingly, AB13 has been found as a
suppressor of ERAl vegetative phenotypes, supporting this hypothesis (Sarkar 1999).
Expression of AB14 has been show in the vegetative tissue; however, the abi4-1 mutant does
not display any vegetative phenotypes implying only a minor role, if any, in ABA signal
transduction in the vegetative tissue (Finkelstein et al. 1998)- Demonstration of an interaction
between ERA1 and AB13, A614 and AB15 in the vegetative tissue woufd expand the nurnber of
genes that are known to function in ABA signaling in the vegetative tissue. Perhaps the effects
have not been previously noted because the mutations in AB13, AB14 and AB15 have not been in
the correct genetic background.
AB12 is the only other ABA signaling molecule that has been identified to date (Koomneef
et al. 1984). This gene product was originally thought to act in a redundant manner to AB11 as it
also is a PP2C (leung et al. 1997); however, it has sinœ been shown function in some sirnilar
but also in a number of dflerent subsets of ABA function wmpared to AB11 in the vegetative
tissue (Soderman et al. 1996, Gosti et al. 1995, Nambara et al. I W l , Pei et al. 1997). In those
subsets of ABA response in AB12 which are different from ABI1, it would be interesting to
Discussion 77
investigate which ones also overlap with ERAI, given that ERA1 also functions in the vegetative
tissue.
4.5 Increased Expression of ERA in eral-4 The mutant era7-4 had higher ERAI mRNA levels when compared to wildtype. This
phenornenon may be explained by a number of possibilities. One is that the lack of famesylation
activity causes a positive feedback response with respect to €RA 7 mRNA expression- The
wildtype condition, therefore, suggests that FTase acts as an autoregulator, responding to the
amount of farnesylation in the signal transduction pathway. As ERA1 is a negative regulator of
the ABA signal, the net result is a negative feedback bop with respect to ABA signal
transduction. Such a feedback mechanism is found in GA biosynthesis. The hormone GA
negatively regulates GAI, a putative transcription factor (Peng et al. 1997). lncreased expression
of GAI regulates GA biosynthesis genes, thereby downregulating endogenous GA (Peng et al.
1 997).
A second possiblity to explain the increased expression of ERA7 in e n 1 4 is increased
stability of the mRNA due to the putative point mutation. AXR3 is a gene whose product interacts
with auxin response factors and together, ttiey induce auxin related processes. A point mutation
in AXR3 (designated axr3-1). causes increased auxin responses. lntragenic mutations suppress
these phenotypes, indicating the axr3-1 mutation is a gain-of-function mutation, as opposed to a
dominant negative function. This may suggest that the increased activity is due to a increase in
stability of the protein or the mRNA (Rouse et al. 1998). Because era14 is a loss-of-function
mutation, this interpretation would likely apply to increased stability of the mRNA.
4.6 Future Work The work in this thesis would be cornplemented with a protein analysis in era14. The
detemination of whether or not the ERA1 protein is actually present will clarify many questions,
such as the severity of allele of eral4. The hypothesis that eral-4 is a weaker alfele hinges on
Discussion 78
the ERAl protein being translated. However, the point mutation in era7-4 rnay also be a
frarneshift or a premature stop codon, both with the potential to cause very severe alterations in
the protein. If the protein is present in the plant, then sequencing of the era1-4 gene and
determining the lesion rnay prove to be valuable. The point mutation rnay alter an important domain
for farnesylation. All of these studies will enhance the understanding of famesylation in plants,
The increased expression of ERAI transcript rnay also represent a system for studying
FTase reguiation, The determination of why the transcript levels are increased would be an
important first step. There are a nurnber of methods to test whether the increased levels are due
to increased mRNA stability or autoregulation (sedon 4-5)- First, inhibiting a putative ERA1
regulated event in wildtype seedlings, such as cell division, should have a similar effect as the
eral-4 mutation and result in increased transcription of the ERAl gene if the increased
expression is due to a feedback mechanism, Second, an investigation of the levels of ERAI
mRNA in a TDNA insertion eral mutant (era7-1) will also indicate whether or not the increased
levels are allele specific (Cutler et al. ?996). Finally, crossing eral-4 with a transgenic plant for
ERA l promotecGUS fusion construct will indicate whether or not the increased expression is
due to a feedback rnechanism. Also, the regulation via environmental conditions rnay be more
easily studied in a genetic background where levels of expression are increased. Manipulation of
salt, temperature or other conditions with eral-4 rnay reveal a mechanism of control. The era1-4
mutation rnay represent an important mutant for studying R a s e reguiation and action in
Ara bidopsis.
Literature Cited 79
5.0 Literature Cited
Armstrong, F., Leung, J., Grabov, A, Breariey, J., Giraudat, J., and Blatt, M.R. 1995. Sensitivity to abscisic acid of guard-ceIl K' channels is suppressed by abi7-1, a mutant Arabidopsis gene endcoding a putative protein phosphatàse. Proc. ~ a t l . Acad. Sci. USA 92: 9520- 9524.
Berieth, T. and Jurgen, G. 1993- The role of MONOPTEROUS gene in organizing the basal body of the Arabidopsis embryo- Devel- 118: 575-587.
Bertauche, N., Leung, and Giraudat, J. 1 996. Protein phosphatase activity of abscisic acid insensitive 1 (ABl1) protein from Arabidopsis fialiana. Eur. J- Biochem. 241 : 193-200.
Black, M. 1991. Involvement of ABA in the physiology of developing and mature seeds. In Membranes, metabdism. and diy organism*kd. AC ~eopold. Cornstock Publishing Association, I thaca, NY. pp358-363.
Bonetta, D., and McCourt, P. 1998. Genetic analysis of ABA signal transduction pathways. TlPS 3: 23 1-235.
Chang, C., and Meyerowitz, E.M. 1986. Molecular cloning and DNA sequence of the Arabidopsis thaliana alwhol dehydrogenase gene. Proc. Nati. Acad Sci. USA. 83: 1408-1 41 2.
Clarke, S. 1992. Protein isoprenylation and methylation at carboxyl-terminal cysteine residues. Annu. Rev. Biochern. 61 : 355-386.
Coen, ES., and Meyerowitz, E.M. 1991. The war of the whor1s:genetic interactions controlling flower development- Nature 353: 31 -37,
Cooney, S.E. 1996. Genetic interactions of ABA and GA responses in Arabidopsis thaliana. M.Sc. Thesis, University of Toronto, Toronto.
Cutler, S.R. 1996. Isolation and characterizartion of an Arabidopsis mutant supersensitive to abscisic acid. MSc. Thesis, University of Toronto, Toronto.
Cutier, S.R., Ghassemian, M., Bonetta, D., Cwney, S., and McCourt. P. 1996. A protein famesyl transferase involved in abscisic acid signal transduction in Arabiodpsris. Science 273: 4 239-1 241.
de Bruxelles, G.L., Peacock, W.J., Dennis, E.S., and Dolferus, R. 1996. Abscisic acid induces the alcohol dehydrogenase gene in Arabidopsis. Plant Physiol. 11 1 : 381-391.
Espelund, M., Saeboe-Lassen, S., Hughes, D.W., Galau, G.A., Larsen, F., and Jakobsen, K.S. 1992. Late embryogenesis-abundant genes encoding proteins with different numben of hydrophilic repeats are regulated differentially by abscisic acid and osmotic stress. Plant Journal 2: 241-252.
Fabri, C.O., and Schaffner, A. R. 1994. An Arabidopsis thaliana RFLP mapping set to localize mutations to chmmosomal regions. Plant J. 5: 149-156.
Feldmann, KA., Malmberg, R.L., and Dean, C. 1994. Mutagenesis in Arabidopsis- In Arabidopsis. eds. E.M. Meyemwitz and C.R. SomeMlle, Cdd Spring Harbor Laboratory Press. ~ ~ 1 3 7 - 1 72.
Literature Cited 80
Finkelstein, R.R. 1993. Abscisic acid-insenstive mutations provide evidence for stage specific signal pathways regulating expression of an Arabidopsis late embryogenesis-abundant (lea) gene. Mol. Gen. Genet 238: 401-408.
Finkelstein, R.R, 1994a. Matemal effects govem variable dominance of two abscisic acid response mutations in Arabidopsis thaliana. Plant Physiol. 105: 1203:lSO8.
Finkelstein, R.R. 1994b. Mutations at two new Arabidopsis ABA response loci are similar to the abi3 mutations- Plant Joumal 5:765-771.
Finkelstein, R.R. and Sommerville, CR- 1990. Three classes of abscisic acid @BA)-insensitive mutations of Arabidopsis define genes that control overlapping subsets of ABA responses- Plant Physiol, 94: 1 172-1 179-
Finkelstein, R.R., Wang, M.L., Lynch, T.J., Rao, S,, and Goodman, H.M. 1998. The Arabidopsis abscisic acid response locus AB14 enwdes an APETALAZ domain protein. Plant Cell10: 1 043-1 054,
Giraudat, J., Hauge, B.M., Valon, C., Smalle, J., Parcy. f., and Goodman, H.M. 1992- Isolation of the Arabidopsis AB13 gene by positional cloning. Plant Cell4: 1251 -1 261.
Gosti, F., Bertauche, N., Vartanian, N., and Giraudat, J. 1995. Abscisic acid-dependent and - independent regulation of gene expression by progressive drought in Arabidopsis thaliana. Mol. Gen. Genet, 246: 10-1 8.
Guarente, L. 1993. Synthetic enhancernent in gene interaction: a genetic tool wme of age. TIG 10:362:6.
Hemierly, AS., Ferreira, P., de Airnieda Engler, J., Van Montsgu, M., Engler, G,, and Inzé, D. 1993. cdc2a expression in Arabidopsis is linked with cornpetence for cell divison. Plant Cell5: 171 1-1 723-
Himmelbach, A., Iten, M., and Grill, E. 1998. Signalling of abscisic acid to regulate plant growth. Phil. Trans. R. Soc. Lond. B 353: 1439-1444.
Karssen, C. M., Brinkhorst-van der Swan, D.L.C., Breekland, A.E., and Koomneef, M. 1983. Induction of dorrnancy during seed development by endogenous abscisic acid: studies on abscisic acid deficient genotypes of Arabidopsis thaliana (L.) Heynh. Planta 157: 1 58: 1 65.
Kende, H. and Zeevaart, J.A. 1997. The five "classical" plant hormones. Plant Cell9: 1 197-1 21 0.
Konieczny, A. and Ausubel, F. 1993. A procedure for mapping Arabidopsis mutations using co- dominant ecotypespecific ?CR-based markers. Plant J- 4:403-410.
Koomneef, M., HanhaR, C.J., Hilhorst, H.W.M., and Karssen, C.M. 1989. ln vko inhibition of seed development and reserve protein accumulation in recombinants of abscisic acid biosynthesis and responsiveness mutants in Arabidopsis thaliana. Plant Physiol. 90: 463- 469.
Koornneef, M., Joma, M.L., Brinkhorst-van der Swan, D.L.C. and and Karssen, C.M. 1982. The isolation of abscisic acid (ABA) deficient mutants by selection of induced revertants in non-germinating gibberellin sensitive lines of Arabidopsis thaliana (L.) Heynh. Theor. Appl. Genet- 61: 385-393.
Literature Cited 81
Koomneef, M., Reuling, G., and Karssen, CM, 1984. The isolation and characterization of abscisic acid-insensitive mutants of Arabidopsis fhaliana. Physiol. Plant 61 :377-383.
Lang, V. and Palva, ET. 1992. The expression of a rab-related gene. rab 18, is induced by abscisic acid during the cold acclimation process of Arabidopsis thaliana (L.) Heynh. Plant Mol. Biol. 20:951-962.
Léon-Kloosterziel, K-, Alvarez Gil, M., Ruijs, G.J., Jacobsen, SE, Olszewski, N.E-, Schwartz, S.H ., Zeevaart, J.A.D., and Koomneef, M. 1996. Isolation and characterization of abscisic acid-deficient Arabidopsis mutants at two new loci. Plant J. 10: 655-661.
Leung, J., Bouvier-Durand, M., Morris, P,, Guerrier, O., Chefdor, F., and Giraudat, J. 1994. Arabidopsis thaliana ABA response gene AB11 : features of a calcium-modulated protein phosphatase- Science 264: 1448-4 452.
Leung, J., Merlot, S. and Giraudat, J. 1997- The Arabidopsis ABSCISIC ACID - INSENSITIVE2 (AB121 and ABIl genes encode homologous protein phosphatases 2C involved in abscisic acid signal transduction. Plant Cell9: 759-771.
MacRobbie, E.A.C. 1998- Signal transduction and ion channels in guard cells. Phil. Trans. R. Soc. Lond. B 353: 1475-1488.
Mann, E. Nussaume, C-, Quesada, A., Gonneau, M., Sotta, B., Hugueney, P., Frey, A., and Marion-Poll, k 1 996. Molecular identification of zexanthin epoxidase of Nicoüana plumbaginifolia, a gene involved in abscisic acid bios ynthesis and corrseponding to the A BA 1 locus of Arabidopsis thaliana. EMBO J. 1 5: 233 1 -2342.
McCarty, D.R., Hattori, T., Carson, C.B., Vasil, V., Lazar, M., and Vasil, I.K. 1991. The vivipamus- 1 developmental gene of maize encodes a novel transcriptional activator. Cell66: 895- 905.
McClave, J.T. and Dietrich II, F.H. 1991. Inferences based on a single sample: tests of hypotheses. In Statistics. Oellen Publishing Company, San Francisico. pp 325-377.
McCourt, P. 1999. Genetic analysis of hormone signalling- Annu. Rev. Plant. Physiol. Plant Mol. Biol. 50: 219-243.
Meyer, K., Leube, M., and Grill, E. 1994, A protein phosphatase 2C involved in ABA signal transduction in Arabidopsis thaliana. Science 264: 1452-1 455.
Nambara, E., Akazawa, T.. and McCourt, P. 1991. Effects of the gibberellin biosynthetic inhibitor uniconizol on mutants of Arabidopsis, Plant Physiol. 97: 736-738.
Nambara, E., Keith, K., McCourt, P., and Naito, S. 1994. Isolation of an intemal deletion mutant of the Arabidopsis thaliana AB13 gene. Plant Cell Physiol. 35: 509-513.
Nambara, E., Keith, K., McCourt, P., and Naito, S. 1995. A regulatory role for the AB13 gene in establishment of ernbyro maturation in Arabidopsis thaliana. Devel. 121: 629-636-
Nambara, E., Naito, S., McCourt, P. 1992. A mutant of Arabidopsis which is defective in seed development and storage protein accumulation is a new abi3 allele. Plant J. 2: 435-441.
Ooms, J.J.J., Léon-Mwsterziel, K., Bartels, D., Kwmneef, M., and Karssen, C.M. 1993. Acquistion of desiccation tolerance and longevity in Arabidopsis thaliana. A comparative study using abscisic acid-insensitive abi3 mutants. Plant Physiol. 102:1185-1191.
Parcy, F. and Giraudat, J. 1997. Interactions between AB17 and the ectopically expressed AB13 genes in controlling abscisic acid responses in Arabidopsis vegetative tissues. Plant J. 11 : 693-702,
Parcy, F., Valon, C., Raynal, M., Gaubier-Comella, P.. Delseny, M., and Giraudat, J. 1994- Regulation of gene expression programs during seed development: roles of the AB13 locus and of endogenous abscisic acid. Plant Cell6: 1567-1 582.
Pei, Z., Ghassernian, M., Kwak, C., McCourt, P., and Schroeder, J. 1998. Rote of famesyltranferase in ABA regulation of guard cell anion channels and plant water loss. Science 282:287-290.
Pei, Z., Kuchitsu, K., Ward, J., Schwarz, M., and Schroeder, J. 1997. Differential abscisic acid regulation of guard cell slow anion channels in Arabidopsis wild-type and abil and abi2 mutants, Plant Cell9:409-423-
Peng, J., Carol, P., Richards, D.E., King, )CE., Cowling, R.J., Murphy, G.P., and Harberd, N.P. 1997- The Arabidopsk GAI gene defines a signaling pathway that negatively regulates gibberellin responses. Genes and Devol. 4 1 :3194-3205.
Qian, D. Zhou, D., Ju, R., Cramer, C.L. and Yang, Z- 1996. Protein famesyltransferase in plants: molecular charcterkation in cell cycle control. Plant Cell8: 2381 :2394.
Randall, S.K., Marshall, M.S., and Cruwell, D.N. 1993. Protein isoprenylation in suspension- cultured tobacco cells. Plant Cell5: 433-442.
Rock, C.D., and Quatrano, R.S. 1995. The role of hormones during s e 4 development In Plant hormones: Physiology, biochemistry and rnolecular biology- Kluwer Academic, Dordtecht. pp 671-697.
Rodn'guez, P.L. 1998. Protein phosphatase 2C (PP2C) function in higher plants, Plant Mol. Biol. 38: 991 9:927.
Rogers, S.0. and Bendich, A.J. 1994. Extraction of total cellular DNA from plants, algae and fungi. In Plant Molecular B i o l m Manual. &S. S.B. Gelvin and R.A. Schilperoot Kluwer Academic Publistiers, Dordrecht.
Rouse, D., Mackey, P., Stimberg, P., Estefle, M., and Leyser, 0. 1998. Changes in auxin response from mutations in an AUX/IAA gene. Science 279: 137 1-1 373.
Sambrook, J., Fritsch, E.F., and Maniatis, T. 1989. Molecular Cloning: A laboratory manual- Cold Spring Harbor, New York. Cold Spring Harbor Laboratory Press.
Sarkar, S. f 999. Epistatic, suppressor and morphological analysis of insensitive revertants in era 7 , an ABA supersensitive mutant of Arabidopsis. M .Sc. Thesis, University of Toronto, Toronto.
Sheen, J. 1998. Mutational analysis of pmtein phosphatase 2C involved in abscisic acid signal tranduction in higher plants. Proc. Natl. Acad Sci. USA. 95: 975-980.
Literature Cited 83
Schafer, W.R. and Rine, J. 1992, Protein prenylation: genes, enzymes, targets and functions. Annu. Rev. Genet 30: 209:37.
Schmitt, D., Callan, K-, and Gwissem, W. 1996. Molecular and biochemical characterization of tomato famesyl-protein transferase. Plant Physiol. 112: 767-777.
Schwartz, S.H., Léon-K l~s te~e l , K., Kwmneef, M., and Zeevaart, J.A.D. 1997. Biochemical charaderkation of the aba2 and aba3 mutants in Arabidopsis Ulaliana. Plant Physiol. 114: 161-166.
Sederman, E., Mattççon, J., and Engstfim, P. 1996- The Arabiodpsis homeobox gene A m 7 is induced by water deficit and by abscisic acid. Plant J. 10: 375-381.
Sponsel, V.M., Schmidt, F.W., Porter, S.G., Nakayama, M., Kohlstruk,S., and Estelle, M. 1997. Characterization of new gibberellin-responsve semidwarf mutant of Arabidopsis- Plant Physiol. 115: 1 OO9:lO2O-
Steber, CM., Cooney, S.E., and McCourt, P. 1998. Isolation of the GA-Response Mutant slfl as a suppressor of ABl1-1 in Arabidopsis thaliana. Genetics 149: 509-521.
Torii, KU., Mitsukawa, N., Oosumi, T., Matsuura, Y., Yokayama, R., Whitter, R.F., and Komeda. Y. 1996. The Arabiodpsis ERECTA gene encodes a putative protein kinase with extracellular leucine-rich re peats. Plant Cell 8: 735-746.
Trueblood, C.E., Boyartchuk, V.L., and Rine, J. 1997. Substrate specificity deterrninants in the famesylatransferase 8-subunit, Proc. Natl. Acad. Sci. USA. 94: 10774-1 0779.
Van Slogteren, C.M.S., Hoge, J.H.C., Hooykaas, P.J.J., and Schilperoort, R A 1983. Clonal analysis of heterogenous crown gall tumor tissues induced by wild-types and shooter mutant strains of Agrobactekm tumefaciens-expression of T-DNA genes. Plant Mol. Biol. 2: 321-333,
Welin, B. V., Olson, A,, Nylander, M., and Palva, E. T. 1994. Characterization and differential expression of dhn/lea/rab-like genes during cold acclimation and drought stress in Arabidopsis thaliana. Plant Mol. Biol. 26: 131 -144.
Yang. Z., Cramer, C.L., and Watson, J. C. 1993. Protein famesyltransferase in plants. Molecular doning and expression of a homolog of the B subunit from the garden pea. Plant Physiol. 101 : 667-674.
Zeevaart, LA., and Creelman, RA. 1988. Metabolism and physiology of abscisic acid. Ann. Rev. Plant Physiol. 39: 439-73,
Zhou, D., Qian. D., Cramer, C.. and Yang, Z. 1997. Developmental and environmental regulaüon of tissue and cell specific expression for a pea protein famesyltransferase gene in transgenic plants. Plant J. 12: 921-930.
Zhu, J., Bressan, R A , and Hasegawa, P.M. 1993. lsoprenylation of the plant molewlar chaperone ANJ1 facilitates membrane association at higher temperature. Proc. Natl. Acad. Sci. USA 90: 8557-8561.
6.0 Apendices
6.1 Statistical Analysis of Devalopmental Traits and Physiological Responses
Table 1. ANOVA of developmental traits of Ler, abil-1, era14, and abil-1 era1-4 was perforrned. Variation in [silique length, inflorescence height, stomate length, stomate density and stomate aperture] was assessed among genotypes (GEN), accounting for differences among plants within a genotype (PLANTGEN]) and replicates within a plant (REP[PLANT, GEN]). F vatues are shown; significance levels are show ('P c 0.05, "P <0.005, and ""P<0.0005). The dash (-) indicates the measurement was not applicable for the character. Oegrees of freedom are shown in brackets.
Source silique inflor- stomate stomate stomate length heicjht length density aperature
52.57'" (3) 22.54- 8.86" 3-51' 12.40"
Table II. ANOVA of physiological responses of Ler, abil-1, era14, and abil -1 eral-4. Variation in [stomatal aperture with ABA and root length with ABA] was assessed among genotypes (GEN), between ABA treatment (TREAT), among plants within a genotype and ABA treatment (PLANqGEN, TREATJ), betirveen genotype and treatment (GENmEAT), and replicates between experirnents (ASSAY[PLANT,GEN]), F values are shown; significance levels are shown (*P < 0.05, "P ~0.005, and -P<0.0005). The dash (-) indicates the measurement was not applicable for the character. Degrees of freedom are shown in brackets.
Trait -
Source stomate aperture with ABA root length with ABA
GEN 4.19 (3) 2 3 6 . 1 7 (5) TRfAT 25.43" (1) 1 660.58'" (3)
GENTREAT 5.71 * (3) 56.85- (14) P W G E N , TREAq 6.63'" (7) -
ASSAYrGEN, TREATl - 14.82'" (27)
6.2. Suppressor Screen of Fast Neutron abil-l Mutagenized Seed
Fast neutron mutagenized abil-1 seed were obtained from Lehley seeds. They were
potted 40 per pot and hawested as 43 pools, Because the plants became infested with fungi,
500 seeds from each pool were sterilized in solution wntaining 10% bleach and 0.001 % SOS for
five minutes at RT and plated on MS media supplemented with 5vM ABA and 2pgIml benornyl
dissolved in OMS0 to a final concentration of 1000Opg/ml. Plates were chilled for four days and
plaœd at 22°C. After five days, the nongeminators were moved to MS media for rescue, The
phenotypes of the M l putative ERAI alleles and germination rates of M2 seed are described
(Table 1).
Table 1. Putative eral Vegetative Germination of M2 seeds
allelle phenotypes - -
MS media 0.8~M ABA 3~ M ABA FN 14-1 siliques club 100% 97% 0%
s-haped (97:3) (O: 100) FN78-1 protniding 100% 1% 0%
carpels, (1 :99) (O: 1 00) faciated,
"era 1 -2-likew FN20-1 semidwarf, 100% 74% 72%
clu b-shaped (59:21) (1 14:45) siliques
FN204 club-shaped 100% 95% 87% siliques (95:5) (1 44:22)
FN22-1 'eral-2 - likew - - - FN24-1 - 100% 95% 71 %
- -- -
Nongerminating seeds of 20-1 and 24-1 were moved to MS media for rescue. The plantlets of
14-1, 18-1, 20-7, 24-7 and 30-7 were potted and crossed to eral-4 and abil-l eral-4 for
complernentation analysis. The results appear in Table II. The possible scenarios for the crosses
are shown below:
Cross: abil-1 FNX X era1-4 - abil-1 FNX eral-4
Apendices 86
If FN mutation = eral-x:
FI abil-1 era14 These seeds will not germinate on 0.8pM ABA. + eral-x
F2 1: abil-1 era14 2: abil-l eral-4 1: + era l4 None of these classes will abil-1 eral-x + eral-x + era7-x geminate on 0.6pM ABA,
If FN mutation f eral-x:
FI abil -1 era 1 4 FNX + + +
F2 Many classes will segregate including abi1-7 and wildtype which will geminate O.8pM ABA. Therefore, if the FN mutation is an aHele of ERAl, it will be be apparent on 0.8pM AB A.
Cross: abil-1 FNX X abil-1 eral-4 abil-1 F M abil-1 era 1 4
If FN mutation = eral-x
FI abil -1 era 1 4 These seeds will not germinate on 2pM ABA. abil-1 eral-x
F2 abil-1 eral-4 These seeds will germinate on 2pM ABA. abil-? era 1-x
If FN mutation # eral-x
F1 abil-1 era14 FNX abil-1 + +
F2 Many classes will segregate including abil-1 which will geminate 2pM ABA. Therefore, if the FN mutation is an allele of ERAI, it will be be apparent on 2pM ABA.
Table II. Cornplementation data of putative ERA alleles from an FNabil-1 suppressor screen. The * represents the matemal plant
Cross F1 seeds on F I seeds on F2 seeds on 0.8pM ABA 0.6pM ABA 0.6vM ABA
FN18-1' X era14 1% (2:150) FN18-1' X abil-1 e ra l 4 0% (0:3) era14* X FN22-1 0% (0:5) era14* X FN24-1 16% (1:6) 0% (0:3) 100% (1OO:lOO) FN244'X abil-1 eral-4 100% (8:8) FN30-1'X abil-1 eral-4 100% (1 0:1 O)
The data above suggest that FN18-1 mutant is a putative ERAI allele. 60th the data of
germination rates of the F I seeds from the cross between FN18-1 and abil-1 era1-4 plated on
0.6pM ABA (0%) and the germination rates of the F2 seeds from the cross between FNl8-1 and
Apendices 87
eral-4 plated on 2pM ABA (1 %) suggest that FN18-1 is a putative ER41 allele- No further
analyses have been done on this mutant
The data above shown no other putative allele from this screen. Although the F1 data of
the cross between FN24-1 and em14 suggest that FN24-1 is also an ERA1 allele, the matemal
effect of era l4 in the seed mat on exogenous ABA is the cause of the lack of germination by
these F1 seeds. The F2 data for the the cross between FN24-1 and eral-4 show that FN24-1 is
not an ERA 1 allele. The cross between era 1 4 and FN22-1 requires further analysis before a
conclusion can be drawn.
6.3 Suppressor Screen of abil-1 eral-4
To invesitgate whether or not abil-leral-4 could detect ABA via a pathway that muid
be dissected genetically, 15000 abil-leral-4 seeds were mutagenized. Seeds were suspended
in 100mls of 0.4% EMS and incubated at 4°C for 24 hours. The rnutagen was decanted off and
neutralized by 10% sodium thiosulfate. The seeds were washed ten times for 30 mins each in
distilled water. Approximately 500 seeds were planted per pot (30 pots) and allowed to self
pollinate, Each pot was harvested as a p l and plated on MS media supplemented with 3vM
ABA and geminators were selected from a population of nongerminators. 153 putative
suppressors were potted and harvested as families. M3 families were retested for germination
on 3pM ABA. Those showing insensitivity to 3pM ABA were tested for greater ABA insensitivity
by plating on MS media supplemented with 5 or 1OpM ABA- The results appear in Table 1.
Table 1. Germination rates of putative abil-leral-4 suppressor mutants M3 families on 5 and
30-1 ' al1 other M3 families did not genninate on 5pM ABA
These data suggest that putative mutant 30-1 may represent a abi l - lera i4 suppressor mutant.
No other analyses have been perforrned on this mutant.
top related