BI420 – Course information
Web site: http://bioinformatics.bc.edu/~marth/BI420
Instructor: Gabor Marth
Teaching assistant: Aaron Quinlan
BI420 – Material
Lectures (PowerPoints posted on web site)
Text
BI420 – Discovery questions
http://www.aw-bc.com/geneticsplace/
BI420 – Discovery questions
Page 36, Discovery question #1.
BI420 – Discovery questions
GGGCTCAGCTGTATCAGCCACGTGCCTACAACAATCTGCCCCT
BI420 – Discovery questions
BI420 – Discovery questions
Genome organization
and Bioinformatics
Gabor T. Marth
Department of Biology, Boston Collegemarth@bc.edu
BI420 – Introduction to Bioinformatics
DNA – the carrier of the genetic code
DNA organization – chromosomes
DNA organization – mitochondria
Translation of genetic information
mRNA splicing – alternative splicing
Mechanisms of molecular evolution
Evolution of chromosome organization
Evolution of gene structure
Evolution of DNA sequence
Genetic variations
1. The informatics of DNA sequencing
DNA sequencing informatics
2. Gene prediction, genome annotation
3. Polymorphism discovery and analysis
• look at multiple sequences from the same genome region
• use base quality values to decide if mismatches are true polymorphisms or sequencing errors
4. Gene/DNA expression analysis
6. Storage/retrieval of Biological data
7. Sequence alignment/similarity search
9. Evolutionary Genomics
10. Medical Genomics
11. Practical Bioinformatics
using LINUX
programming in PERL
12. Practical Bioinformatics
HITid cloneID hspID start end1 1 1 1 179572 2 1 96912 114891
CLONEid name received masked1 NH0260K08 12-25-99 12-26-992 NH0407F02 12-28-99 01-03-00
ALLELEid hitID nucleotide1 1 C2 2 T
using and building databases