BI420 – Course information

BI420 – Course information

Web site: http://bioinformatics.bc.edu/~marth/BI420

Instructor: Gabor Marth

Teaching assistant: Aaron Quinlan

BI420 – Material

Lectures (PowerPoints posted on web site)

Text

BI420 – Discovery questions

http://www.aw-bc.com/geneticsplace/

BI420 – Discovery questions

Page 36, Discovery question #1.

BI420 – Discovery questions

GGGCTCAGCTGTATCAGCCACGTGCCTACAACAATCTGCCCCT

BI420 – Discovery questions

BI420 – Discovery questions

Genome organization

and Bioinformatics

Gabor T. Marth

Department of Biology, Boston [email protected]

BI420 – Introduction to Bioinformatics

The animal cell

DNA – the carrier of the genetic code

DNA organization – chromosomes

DNA organization – mitochondria

Translation of genetic information

Gene organization

mRNA splicing – alternative splicing

Gene expression

Protein structure

RNA structure

DNA evolution

Mechanisms of molecular evolution

Evolution of chromosome organization

Evolution of gene structure

Evolution of DNA sequence

Genetic variations

1. The informatics of DNA sequencing

DNA sequencing informatics

2. Gene prediction, genome annotation

3. Polymorphism discovery and analysis

• look at multiple sequences from the same genome region

• use base quality values to decide if mismatches are true polymorphisms or sequencing errors

4. Gene/DNA expression analysis

5. Proteomics

6. Storage/retrieval of Biological data

7. Sequence alignment/similarity search

8. Phylogenetics

9. Evolutionary Genomics

10. Medical Genomics

11. Practical Bioinformatics

using LINUX

programming in PERL

12. Practical Bioinformatics

HITid cloneID hspID start end1 1 1 1 179572 2 1 96912 114891

CLONEid name received masked1 NH0260K08 12-25-99 12-26-992 NH0407F02 12-28-99 01-03-00

ALLELEid hitID nucleotide1 1 C2 2 T

using and building databases