Chapter 15 The Chromosomal Basis of Inheritance PowerPoint Lectures for Biology, Seventh Edition Neil Campbell and Jane Reece Lectures by Chris Romero Copyright © 2005 Pearson…

Slide 1Chapter 15 Chromosomal Basis of Inheritance Slide 2 Mendel & Chromosomes Mendel was ahead of his time. 19 th C cytology suggested a mechanism for his earlier findings.…

Slide 1The Human Genome Project Lecture 4 Strachan and Read Chapter 8 Slide 2 The HGPs primary aims The main aims of the Human Genome Project (HGP) were to: –Construct…

Slide 1Andy Powell, Eduserv Foundation [email protected] www.eduserv.org.uk/foundation Feb 2007 The Dublin Core Abstract Model – a packaging standard? Content…

Slide 1Introduction to Maize Breeding Nathan Schnur Slide 2 Overview What is Plant Breeding? Basic Genetics Mendelian Genetics Principles of Breeding Maize Plant Breeding…

Slide 1Patterns of Inheritance Chapter 9 BIOL 1010 Slide 2 GENETICS: the scientific study of heredity Genome: complete set of an organism’s gene Gene: unit of heredity…

1.TTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATT GACTCACCCATCAACAACCGCTATGTATTTCGTACATTACT GCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGA Race, Genetic Ancestry and Prostate CCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCT…

1.Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Parents eggs Ee Ee spem Punnett square Offspring E e E e Ee Ee EE ee TT tt…

1. Chapter 15 notes The Chromosomal Basis of Inheritance 2. Concept 15.1 In 1902 Sutton noted the parallels between the behavior of chromosomes and the behavior of Mendel’s…

Title: Efflux as mechanism for drug resistance in Mycobacterium tuberculosis Authors: Pedro Eduardo Almeida da Silva1, Andrea Von Groll1,2, Anandi Martin2 and Juan Carlos…