Slide 1 Slide 2 What is genetic engineering? A direct, deliberate modification of an organisms genome Slide 3 So what does it look like? A farmer mates his two largest pigs…

Slide 1CHANGING THE LIVING WORLD Slide 2 How we change the living world… Selective breeding: crossing organisms with desired traits to produce the next generation. Slide…

Slide 1Applied Genetics Ch. 24 How the Principles of Genetics are used. Slide 2 How have humans applied Genetics?  People have bread plants and animals for specific desirable…

Slide 1 Slide 2 Technique involving the insertion of a fragment of foreign DNA into a vector capable of replicating autonomously in a host cell (usually Escherichia coli…

Slide 1The structure of DNA http://ghr.nlm.nih.gov/handbook/illustrations/dnastructure.jpg Slide 2 ATGCCGATCGTACGACACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGATCCATTTTA…

1.Genetic Ancestry, Linguistic Ancestry and Mathematical AncestryM N VahiaTata Institute of Fundamental Research Ancestry 1 Ancestry 2 Archeao GeneticsMethodology • There…

1.Genetic Engineering2. What is Genetic Engineering? Genetic Engineering –technology of altering the genes of an organism to produce a desired change. 3. Types of Genetic…

1.CHAPTER 16 Prokaryotes and Viruses2. PROKARYOTIC LIFE BEGAN ON A YOUNG EARTH Stromatolites are composed of thin layers of sediment pressed tightly together resembling layers…

1. Every living thing has DNA. That means that you have something in common with a zebra, a tree, a mushroom and a beetle!!!! DNA stands for: D: Deoxyribose N: Nucleic A:…

1. Molecular Approaches to Nutrition Molecular Biology 2Principles and Methods Dr. Janice Drew 2. Principles and Methods Purification and handling of DNA/RNA Gel Electrophoresis…