Contents Chapter 1: Carbohydrate Chemistry............................................................. 3 Chapter 2: Carbohydrate Metabolism ........................................................…

1. What is the amino acid sequence encoded by the DNA sequence? The DNA sequence given is: GCATGCTGCGAAACTTTGGCTGA The 3-letter codons are: ATG CTG CGA AAC TTT GGC TGA The…

After the discussion, the class will be able to: Explain the Hexose Monophosphate Shunt Discuss the importance of G6PD as to the reaction it catalyzes, and its role in the…

PENTOSE PHOSPHATE PATHWAY Pentose Phosphate Pathway Otto Warburg Frank Dickens Dr. Bernard L. Horecker OVERVIEW Functions 1. To generate reducing equivalents, in the form…

1. By,Shabnam RelhanM.Pharm(Biotech.)AIP 2. OVERVIEW Pharmacogenomics Single nucleotide polymorphism Importance of pharmacogenomics Examples of altered drug reponse…

1. Pentose Phosphate Pathway of Glucose Oxidation 2. Glucose 6-phosphate does have other catabolic fates, however, which lead to specialized products needed by the cell.…

1. ANEMIA ByDr Bashir Ahmed Dar Chinki pora sopore kashmir Associate professor of Medicine 2. Classification of Anemia I.Etiologic Classification 1.Impaired RBC production…

Integration of Metabolism Integration of Metabolism Gandham.Rajeev Email:[email protected] Glycolysis: The degradation of glucose to pyruvate or lactate generates…

1. �APLAtY MEDICAL USMLE™. Step 1 Biochemistry and Medical Genetics Lecture Notes BK4029J *USMLE™ is a joint program of the Federation of State Medical Boards of the…

1. Pentose Phosphate Pathway Dr. Deepak K Gupta www.facebook.com/notesdental 2. Introduction • Alternative route for the metabolism of glucose • Also known as Hexose…