Yap Tunes Airway Epithelial Size and Architecture by Regulating the Identity, Maintenance, and Self-Renewal of Stem Cells

Please cite this article in press as: Zhao et al., Yap Tunes Airway Epithelial Size and Architecture by Regulating the Identity, Maintenance, and Self-Renewal of Stem Cells, Developmental Cell (2014), http://dx.doi.org/10.1016/j.devcel.2014.06.004

Developmental Cell

Article

Yap Tunes Airway Epithelial Size andArchitecture by Regulating the Identity,Maintenance, and Self-Renewal of Stem CellsRui Zhao,1,2,3,4 Timothy R. Fallon,1 Srinivas Vinod Saladi,5 Ana Pardo-Saganta,1,2,3,4 Jorge Villoria,1 Hongmei Mou,1,2,3,4

Vladimir Vinarsky,1,2,3,4 Meryem Gonzalez-Celeiro,1 Naveen Nunna,1 Lida P. Hariri,3,6 Fernando Camargo,4,7

Leif W. Ellisen,5 and Jayaraj Rajagopal1,2,3,4,*1Center for Regenerative Medicine, Massachusetts General Hospital, 185 Cambridge Street, Boston, MA 02114, USA2Department of Pediatrics, Massachusetts General Hospital, Boston, MA 02114, USA3Department of Internal Medicine, Pulmonary and Critical Care Unit, Massachusetts General Hospital, Boston, MA 02114, USA4Harvard Stem Cell Institute, Cambridge, MA 02138, USA5Massachusetts General Hospital Cancer Center, Boston, MA 02114, USA6Department of Pathology, Massachusetts General Hospital, Boston, MA 02114, USA7Stem Cell Program, Boston Children’s Hospital, Boston, MA 02115, USA

*Correspondence: [email protected]

http://dx.doi.org/10.1016/j.devcel.2014.06.004

SUMMARY

Our understanding of how stem cells are regulatedto maintain appropriate tissue size and architectureis incomplete. We show that Yap (Yes-associatedprotein 1) is required for the actual maintenanceof an adult mammalian stem cell. Without Yap, adultairway basal stem cells are lost through their unre-strained differentiation, resulting in the simplificationof a pseudostratified epithelium into a columnar one.Conversely, Yap overexpression increases stem cellself-renewal and blocks terminal differentiation, re-sulting in epithelial hyperplasia and stratification.Yap overexpression in differentiated secretory cellscauses them to partially reprogram and adopt astem cell-like identity. In contrast, Yap knockdownprevents the dedifferentiation of secretory cellsinto stem cells. We then show that Yap functionallyinteracts with p63, the cardinal transcription factorassociated with myriad epithelial basal stem cells.In aggregate, we show that Yap regulates all of thecardinal behaviors of airway epithelial stem cellsand determines epithelial architecture.

INTRODUCTION

How adult tissues maintain their proper size and architecture is

poorly understood. Here we explore how the regulation of adult

stem cells is linked to epithelial architecture using the airway

epithelium as a model system. Epithelial tissues are generally

classified as simple, pseudostratified, or stratified. The murine

tracheobronchial airway epithelium represents a model of pseu-

dostratified epithelium intermediate between a simple single-

layered epithelium and a multilayered stratified epithelium.

Airway basal stem cells directly and broadly abut the basement

membrane. In contrast, differentiated suprabasal secretory and

ciliated cells have smaller zones of contact with the basement

membrane and possess extensive luminal surfaces with their

nuclei displaced toward the lumen. This arrangement of cells

essentially creates a two-layered epithelium (Morrisey and

Hogan, 2010; Rock et al., 2009). Theoretically, disturbances in

the regulation of basal stem cells could, on the one hand, lead

to a hypertrophic epithelium characterized by basal stem cell

excess and stratified squamous metaplasia, as is frequently

observed in conditions such as chronic obstructive pulmonary

disease. Conversely, decreased stem cell numbers would be

predicted to result in epithelial hypoplasia, which is thought to

play a role in conditions such as bronchiolitis obliterans and

airway fibrosis (O’Koren et al., 2013; Rock et al., 2010). Thus,

tightly controlled mechanisms to regulate basal stem cell main-

tenance, proliferation, and differentiation must exist to properly

police epithelial size and architecture.

Yap (Yes-associated protein 1) is a transcriptional coactivator

in the conserved Hippo kinase cascade that has been shown to

be involved in growth control as well as the regulation of stem

and progenitors cells (Barry and Camargo, 2013; Halder and

Johnson, 2011; Pan, 2007, 2010; Ramos and Camargo, 2012;

Zhao et al., 2011). In epithelia, Yap modulation has diverse con-

sequences on stem and progenitor cell behaviors (Ramos and

Camargo, 2012; Zhao et al., 2011). In the embryonic neuroepi-

thelium, Yap loss leads to decreased progenitor cell survival

(Cao et al., 2008), whereas in the embryonic epidermis, Yap

loss leads to decreased progenitor cell proliferation (Schlegel-

milch et al., 2011). In contrast, Yap activation leads to the

same phenotype in both of these tissues, namely increased

progenitor and stem cell replication (Cao et al., 2008; Schlegel-

milch et al., 2011; Zhang et al., 2011). Unexpectedly, Yap loss

throughout the intestinal epithelium results in no obvious pheno-

type but causes hyperplasia and increased stem cell replication

after injury (Barry et al., 2013). Surprisingly, Yap overexpression

leads to a loss rather than a gain of intestinal stem cells (Barry

et al., 2013). Thus, Yap acts in a tissue-, cell-, and context-

dependent manner, even within epithelia.

Developmental Cell 30, 1–15, July 28, 2014 ª2014 Elsevier Inc. 1

mailto:[email protected]


Figure 1. Yap Is Required for the Maintenance of Adult Airway Basal Stem Cells and Yap Loss Results in the Simplification of a Pseudostra-

tified Epithelium into a Columnar Epithelium

(A) Expression of Yap mRNA in basal and secretory cells relative to that in ciliated cells.

(B) Immunostaining for Yap (red) and the basal stem cell marker cytokeratin 5 (CK5, green). Yap protein is highly enriched in the nuclei of basal stem cells (white

arrows) as compared to differentiated cells (yellow arrowheads).

(C) A schematic of the strategy and phenotypic outcome of stem cell-specific Yap deletion.

(legend continued on next page)

Developmental Cell

Yap Maintains and Regulates Stem Cell Identity

2 Developmental Cell 30, 1–15, July 28, 2014 ª2014 Elsevier Inc.


Developmental Cell



Here we use the airway epithelia to reveal that Yap, in concert

with the cardinal basal stem cell transcription factor p63, partic-

ipates in themaintenance of an adult stem cell and the regulation

of stem cell identity itself. Furthermore, we demonstrate that

stem cell behaviors including self-renewal and differentiation

can be modulated by Yap, resulting in predictable alterations

in epithelial architecture and size. These findings suggest that al-

terations in Yap activity may be involved in those diseases of the

airways associated with alterations in epithelial architecture,

such as premalignant squamous metaplasia.

RESULTS

Yap Is Required for the Maintenance of Adult AirwayBasal Stem Cells and Yap Loss Results in theSimplification of a Pseudostratified Epithelium into aColumnar EpitheliumWe defined the expression pattern of Yap in the three different

cell types of the adult airway epithelium. Basal, secretory, and

ciliated cells were sorted based upon GSIb4, SSEA1, and

CD24 surface expression, respectively (Figure S1A available on-

line). We verified the cell type-specific exclusive expression of

mRNAs in each sorted cell population (Figure S1B). Yap mRNA

was expressed at higher levels in basal stem cells than in secre-

tory and ciliated cells (Figure 1A). We used three different Yap

antibodies to establish cell type-specific Yap protein expression

patterns using tyramide signal amplification (TSA). Staining

demonstrated that Yap protein is expressed most highly in basal

stem cells (Figure 1B). The nuclear localization of Yap in basal

stem cells (n = 2,893) suggests that Yap is actively performing

its function as a transcriptional co-activator in these stem cells

(Halder and Johnson, 2011; Pan, 2010; Zhao et al., 2011).

To determine the effect of Yap removal specifically from CK5

positive (+) airway basal stem cells, we generated triple trans-

genic mice carrying the Cytokeratin5 (CK5) rtTA (Diamond

et al., 2000), tetO Cre, and floxed Yap (Schlegelmilch et al.,

2011) alleles, referred to as CK5-YapKO throughout the text (Fig-

ure 1C). We first verified that Cre recombinase was expressed

exclusively in basal stem cells using a YFP reporter (Fig-

ure S1C). Then, adult CK5-YapKO animals (age 8–12 weeks)

were treated with both inhaled doxycycline (Tata et al., 2013b)

and doxycycline in their drinking water to induce efficient Yap

deletion. Yap deletion was verified by quantitative RT-PCR anal-

ysis performed on sorted basal stem cells 1 month after doxycy-

cline administration (Figure S1D). Histology of tracheal sections

revealed that the normally pseudostratified airway epithelium

was simplified into a columnar epithelium 3months after doxycy-

cline treatment (Figure 1D). Following Yap loss, we found a sig-

nificant decrease in the total number of airway basal stem cells

as demonstrated by a loss of cells that express CK5 and p63

(Figure 1E). In control animals, 1,174 ± 16 basal stem cells

(D) Hematoxylin and eosin (H&E) staining of tracheal sections from control (left) an

Cre alleles.

(E) Immunofluorescence analysis of basal stem cell markers p63 (red) and CK

doxycycline treatment.

(F) Quantification of basal stem cells marked by p63 in control, CK5-YapKO, and

Data are presented as mean ± SEM. n = 3 for each genotype per each time point.

also Figure S1.

marked by p63 were counted in standardized tracheal sections

covering 12 cartilaginous rings. Following doxycycline treatment

in the CK5-YapKO animals, the number of p63+ basal stem cells

per section dropped to 666 ± 65 in 1 month (p = 0.0017), to 96 ±

14 (p < 0.0001) after 2 months, and to 25 ± 8 (p < 0.0001)

after 3 months (Figures 1E and 1F). These results were further

confirmed using the basal stem cell-specific markers NGFR

and T1a (Figure S1E). Additionally, there was a significant

decrease in the total number of basal stem cells in transgenic an-

imals in which only a single copy of Yapwas removed (referred to

as CK5-YapHet; Figure 1E). As compared to the controls above,

we found only 535 ± 15 basal stem cells marked by p63 per sec-

tion (p < 0.0001) in the trachea of CK5-YapHet animals 3 months

after doxycycline treatment (Figure 1F). In summary, we found

that basal stem cell-specific deletion of Yap led to a dose-depen-

dent loss of stem cells and resulted in a corresponding simplifi-

cation of airway epithelial architecture.

Basal Stem Cells Undergo Unrestrained Differentiationafter Yap LossWe hypothesized that the loss of basal stem cells following

Yap inactivation could have occurred because of their death,

decreased replication, or differentiation. We found no detectable

changes in apoptosis as assessed by activated caspase-3 and

TUNEL staining at 1, 2, and 4 weeks after doxycycline adminis-

tration (Figure S2A and data not shown). With regard to replica-

tion, at homeostasis, cycling basal cells (i.e., positive for both

Ki-67 and p63) accounts for 2.52% ± 0.97% of total basal

stem cells. The percentage of p63+Ki-67+ cells in CK5-YapKO

trachea was unchanged after Yap deletion (2.10% ± 0.81%,

2.94% ± 0.60%, 2.88% ± 1.05% at 1, 2, and 3 months

after Yap deletion, respectively). However, when we assessed

markers of differentiation, we noted the appearance of presump-

tively differentiating stem cells positive for both p63 (basal) and

Scgb3A2 (secretory; Figures 2A and S2B) and cells positive for

both CK5 (basal) and FoxJ1 (ciliated; Figures 2B and S2B) in

CK5-YapKO animals. In controls, these markers were mutually

exclusive (Figures 2A and 2B). We further demonstrated that

such transitional double-positive cells are also present during

the course of normal airway epithelial regeneration following sul-

fur dioxide-induced injury, when stem cells begin to differentiate

into suprabasal cells (Figure S2C).

To definitively confirm that stem cells were being lost through

differentiation following Yap loss, we specifically lineage-traced

the basal stem cells that had lost Yap. Triple transgenic mice

bearing CK5-CreER (Van Keymeulen et al., 2011), floxed Yap,

and Rosa26-LSL-YFP alleles were generated so that a YFP re-

porter could be used to label and trace basal stem cells in which

Yap had been deleted. Two weeks after tamoxifen induction, the

majority of YFP-labeled basal stem cells remained CK5+ basal

stem cells in control mice (98.75%, n = 240 YFP cells counted).

d CK5-YapKO (right) animals. Control animals bear only the CK5 rtTA and tetO

5 (green) in control, CK5-YapKO, and CK5-YapHet tracheal sections after

CK5-YapHet tracheal sections.

DAPI is in blue. Scale bar represents 10 mm in (B) and (E), and 5 mm in (D). See


Figure 2. Basal Stem Cells Undergo Differentiation after Yap Loss

(A) Expression of p63 (red) and secretory cell marker Scgb3A2 (green) are mutually exclusive in control epithelium. In CK5-YapKO trachea, double-positive cells

(arrows) are observed 4 weeks after continuous doxycycline administration.

(B) Expression of CK5 (red) and ciliated cell marker FoxJ1 (green) are mutually exclusive in control epithelium. Double-positive cells (arrow) are detected in

CK5-YapKO trachea.

(C) Lineage tracing of basal stem cells following Yap loss. The YFP reporter (green) is restricted to CK5-expressing (red, top) basal stem cells 2 weeks after

tamoxifen induction in control animals carrying the CK5-CreER and LSL-YFP alleles. In the experimental animals carrying the CK5-CreER, YapF/F and LSL-YFP


Developmental Cell




Developmental Cell



However, YFP+ cells that expressed the secretory cell marker

CC10 and the ciliated cell marker FoxJ1 were frequently de-

tected in the experimental animals following Yap deletion (Fig-

ure 2C). Thus, following Yap loss, basal stem cells underwent

unrestrained differentiation. As a further confirmation of these

results, we also traced the lineage of basal stem cells in CK5-

YapKO mice by identifying cells that completely lacked Yap

stainingafter TSAamplification.Whenweusedan increasedanti-

body concentration for Yap staining, every cell normally shows a

strong staining for Yap in control trachea (Figure S2D). Using this

highly sensitive immunohistochemical assay for Yap protein

expression,we foundYap-deleted cells that expressed secretory

(Scgb3A2) and ciliated cell (FoxJ1) markers in CK5-YapKO tra-

chea (Figure 2D). Such cells were never found in control airways.

The complete lack of Yap staining in these differentiated cells

indicated that they originated from basal stem cells in which

Yap had been deleted. These results further confirm that basal

stem cells that lose Yap subsequently differentiate. Consistent

with this notion, we found that there was a significant increase

in secretory and ciliated cells in CK5-YapKO animals (Figure 2E).

In controls, we counted 544 ± 10 Scgb3A2-expressing secretory

cells per standard tracheal section. This number increased signif-

icantly to 998 ± 44 (p < 0.001) in CK5-YapKO tracheal sections

2 months after doxycycline treatment (Figure 2E). Similarly, con-

trol tracheal sections contained 557 ± 22 FoxJ1+ ciliated cells per

tracheal section, whereas there was a significant increase of this

number to 925 ± 44 (p = 0.0017) in CK5-YapKOanimals 2months

after doxycycline treatment (Figure 2E). Of note, at 3 months

following doxycycline treatment, there was a significant increase

in the proportion of ciliated to secretory cells (data not shown). In

sum, because we found no significant changes in basal stem cell

proliferation or cell death after Yap deletion, our results demon-

strate that basal stem cell loss occurs predominantly through

their differentiation.

Finally, we performed ex vivo Yap knockdown experiments us-

ing a culture system that supports basal stem cell expansion and

differentiation. Sorted basal stem cells in culture were infected

with lentiviruses that expressed GFP and short hairpin RNAs

targeting Yap. Costaining for GFP and Yap demonstrated that

infected cells lost Yap protein expression, whereas control cells

showed robust Yap staining that was detectable even without

amplification in culture (Figure S2E). We first examined the effect

of Yap knockdown on cell death and cell proliferation. As we

found in vivo, there was no discernible difference in apoptosis

(as marked by the percentage of activated caspase-3+ cells

within the virally infected and therefore GFP+ cell population)

following Yap knockdown (Figure S2F). However, knockdown

of Yap did decrease cell proliferation as marked by Ki-67 in

GFP+ transfected cells (Figure S2G), although a significant frac-

alleles, YFP+ (green) and CC10-expressing (red, middle) secretory cells and the

detected. White arrows point to double-positive cells.

(D) Scgb3A2 (green, top) and FoxJ1 (green, bottom) are expressed in cells in wh

(arrows) go on to terminally differentiate.

(E) Quantification of Scgb3A2+ secretory cells and FoxJ1+ ciliated cells per trachea

CK5-YapKO animals.

(F) Quantification of the percentage of p63+ cells as a proportion of virally infected

The large majority of these GFP+ infected cells differentiate into CK8+ cells (right

Data are presented as mean ± SEM. Scale bar represents 15 mm in (A), (B), and

tion of the infected cells were still proliferating (13.81% ± 1.68%;

Figure S2G). Presumably, we detected this effect on basal cell

replication in vitro and not following Yap loss in vivo because

our culture conditions mimic injury and are associated with

dramatically increased basal cell replication when compared to

the low degree of basal cell replication during homeostasis

in vivo. We next sought to determine the effect of Yap knock-

down on differentiation. When scrambled virus was used,

73.85% ± 1.43% of infected GFP+ cells continued to express

p63, but this percentage dramatically decreased to 3.26% ±

0.70% after Yap knockdown (p < 0.0001; Figures 2F and S2H).

Although our in vitro platform does not support the terminal

differentiation of secretory or ciliated cells, infected GFP+ cells

went on to express the early differentiation marker cytokeratin

8 (CK8) (Rock et al., 2011; Figure S2H). In the scrambled control,

only 22.62% ± 0.64% of the cells differentiated and expressed

CK8 at day 9 of culture, whereas this fraction increased to

97.41% ± 2.59% following Yap knockdown (p < 0.0001; Figures

2F and S2H). This result further confirms that Yap loss promotes

stem cell differentiation.

Yap Overexpression Promotes Stem Cell Proliferationand Inhibits Terminal Differentiation Resulting inEpithelial Hyperplasia and StratificationTo assess the effect of Yap overexpression on basal stem cells,

we generated double transgenic animals carrying both the CK5

rtTA and tetO Yap (S127A; Camargo et al., 2007) alleles (referred

to as CK5-YapTg). In these animals, the expression of constitu-

tively active Yap (S127A) is induced specifically in CK5+ cells

(Figures 3A and S3). Siblings carrying the CK5rtTA driver alone

were used as controls. Although TSA amplification is required

to detect endogenous Yap, unamplified Yap staining unambigu-

ously identifies only Yap-overexpressing cells in CK5-YapTg

transgenic mice. Using unamplified Yap staining, ectopic Yap

expression was detected only in CK5+ basal stem cells 7 days

after doxycycline administration (Figure S3). Twenty-one days

after doxycycline initiation, a thickened and highly stratified

airway epithelium was evident (Figure 3B).

We then assessed the effect of Yap overexpression specif-

ically on basal stem cells. Immunohistochemical characteriza-

tion of CK5 and p63 in the stratified epithelium at day 21 revealed

that there was a significant increase in the total number of both

CK5+ and p63+ cells (Figures 3C and 3D). As compared to the

controls, which contained 1,082 ± 53 p63+ basal stem cells

per tracheal section, this number increased to 1,975 ± 223

(p = 0.0178) in the CK5-YapTg mice 21 days after continuous

doxycycline administration (Figures 3D and 3F, left graph).

We also examined the effect of Yap overexpression on basal

stem cell proliferation in CK5-YapTg animals. Following Yap

YFP+ (green) and FoxJ1-expressing (red, bottom) ciliated cells are frequently

ich Yap (red) is absent, demonstrating that basal stem cells that have lost Yap

l section reveals a significant increase in differentiated epithelial cell numbers in

GFP+ cells reveals that basal stem cells are lost following Yap knockdown (left).

).

(D, top), and 10 mm in (C) and (D, bottom). See also Figure S2.


Figure 3. Yap Overexpression Promotes Stem Cell Proliferation and Inhibits Terminal Differentiation, Resulting in Epithelial Hyperplasia and

Stratification(A) Schematic representation of the experimental design and phenotypic outcome of Yap overexpression in CK5+ basal stem cells.

(B) H&E staining of tracheal sections from CK5-YapTg animals demonstrates epithelial stratification following 21 days of Yap overexpression.

(C) CK5 (red) and Yap (green) costaining demonstrates an increase in CK5+ cells in CK5-YapTg tracheal epithelium 21 days after doxycycline induction.

(D) Immunostaining for p63 (red) and Ki-67 (green) reveals an increase in basal stem cells and their proliferation in CK5-YapTg tracheal epithelium 21 days after

doxycycline induction.

(E) Expression of Scgb3A2 (red, top) and FoxJ1 (red, middle) is not detected in Yap-overexpressing cells (green) 10 days after doxycycline treatment. Some cells

overexpressing Yap (white in bottom) also co-express CK8 (green), indicating that a preliminary differentiation program has occurred but that terminal differ-

entiation has been blocked. Red arrows point to Yap+CK5+CK8� cells. Yellow arrows point to Yap+CK5+CK8+ cells. White arrows point to Yap+CK5�CK8+ cells.


Developmental Cell




Developmental Cell



overexpression, the percentage of p63+ basal stem cells that

were positive for Ki-67 increased from 1.23% ± 0.40% in the

control to 16.47% ± 0.60% (p = 0.0001) at day 21 following

doxycycline initiation (Figures 3D and 3F, right graph). Thus,

Yap overexpression promotes stem cell self-renewal.

We then assessed the effect of Yap overexpression on differ-

entiation. Only 0.26% (n = 2,667) of Yap-overexpressing cells

were positive for the secretory cell marker Scgb3A2 at day 10 af-

ter doxycycline administration (Figure 3E, top). At day 21, only a

single Scgb3A2+ cell was found out of 1,299Yap-overexpressing

cells. With respect to ciliated cell differentiation, only 0.22%

(n = 1,349) of Yap-overexpressing cells were colabeled with

FoxJ1 at day 10 (Figure 3E, middle). Not a single FoxJ1+Yap+

cell was detected at day 21 (n = 2,097). Therefore, Yap overex-

pression in CK5-YapTg trachea blocks terminal differentiation.

We also note that Yap overexpression results in an abundance

of CK5+p63�(negative) cells not normally present in the homeo-

static airway epithelium (Figures 3C and 3D). This suggests the

presence of a population of progenitor cells that are not basal

stem cells because they are p63�, but which are blocked from

executing a terminal differentiation program. Quantification re-

vealed that 81.09% (n = 3,229) of Yap overexpressing cells

were CK5+, but only 50.13% were double positive for p63 and

CK5 and thus bona fide basal stem cells. We then assessed

whether the remaining 30.96% of p63�CK5+ Yap-overexpress-

ing cells expressed the luminal progenitor cell marker CK8. Of

the total 30.96% p63�CK5+ progenitor cells, 16.30% were

p63�CK5+CK8� and 14.66% were p63�CK5+CK8+ (Figure 3G).

The remaining CK5� Yap overexpressing cells were exclusively

CK8+ luminal progenitor cells (Figure 3E, bottom and Figure 3G)

that did not initiate a terminal differentiation program. These

results, in aggregate, suggest the presence of a group of stem

cell-derived progenitor cells in varying states of differentiation,

which were prevented from completing terminal differentiation

(Figure 3G). Of note, these progenitors (p63�CK5+CK8�,p63�CK5+CK8+, p63�CK5�CK8+ cells), are exceedingly rare in

the homeostatic tracheal epithelium, but they do occur as orderly

transient intermediates in regenerating airway epithelium (Rock

et al., 2011).

Normalizing Yap Expression Restores PseudostratifiedEpithelial Architecture and a Normally Sized Basal StemCell PoolTo determine whether the maintenance of Yap-induced stem

cell proliferation and epithelial stratification requires persistent

Yap overexpression, we first administered doxycycline to exper-

imental CK5-YapTg animals for 20 days and then withdrew

doxycycline for 20 days. At the end of the chase period, we

observed that the airway epithelium wasmorphologically normal

(Figures 4A and 4B). There was no significant difference between

control and CK5-YapTg animals in the total number of CK5+

basal stem cells per section (Figures 4C and S4A). Additionally,

(F) Graphs showing the total number of p63+ cells (left) and the percentage of pro

numbers and their proliferation rates increase after Yap overexpression.

(G) A column chart showing the relative abundance of p63+CK5+CK8� basal stem

cells (green), p63�CK5�CK8+Scgb3A2�FoxJ1� progenitor cells (yellow), Scgb

expressing epithelial cells 21 days after doxycycline treatment.

Data are presented as mean ± SEM. Scale bar represents 10 mm in (B), (D), and

the proportion of CK5+ cells per total cells present in the epithe-

lium and the percentages of proliferating basal cells marked by

both CK5 and Ki-67 were not statistically different from those

in control animals (Figures 4C, S4B, and S4C). Thus, persistent

Yap overexpression is required tomaintain excess stem cell pro-

liferation and epithelial stratification.

We next examined the effect of Yap normalization on terminal

differentiation using lineage analysis. Triple transgenic mice pos-

sessing CK5 rtTA, tetO Yap (S127A), and tetO histone 2B GFP

(H2BGFP) alleles (referred to as CK5-YapTg-GFP) were gener-

ated. In these animals, the expression of the active Yap allele

and the H2BGFP reporter is induced in concert, under the con-

trol of the CK5rtTA driver. Because the H2BGFP protein has a

very long half-life, GFP labeling persists in the descendants of

basal stem cells. This persistence of the GFP label allows

the use of GFP expression as a lineage-tracing tool to identify

cells that had once overexpressed Yap (Figure 4D). Following

20 days of doxycycline administration, 98.56% (n = 761) of

GFP+ cells overexpressed Yap protein (Figure 4E, left). Although

the GFP lineage label persisted 2 weeks after doxycycline with-

drawal, ectopic Yap expression was lost within 1 week (Fig-

ure 4E, right), confirming that persistent H2BGFP can be used

as an effective lineage tracing tool for marking cells that previ-

ously overexpressed Yap. Two weeks after doxycycline with-

drawal, GFP+ lineage-traced stem cell progeny included cells

positive for mature secretory (Scgb3A2) and ciliated (FoxJ1)

cell markers (Figure 4F). Thus, stem and progenitor cells that pre-

viously expressed ectopic Yap underwent terminal differentia-

tion after Yap withdrawal. We further confirmed this result with

stains for CC10 (secretory cells) and acetylated tubulin (A-tub,

ciliated cells) to ensure that differentiated cells expressed a full

panel of markers associated with terminal differentiation (Fig-

ure S4D). Additionally, immunostaining revealed normally posi-

tioned and shapedCK5+ basal stem cells, CC10+ secretory cells,

and A-tub+ ciliated cells in an architecturally normal pseudostra-

tified epithelium 20 days after doxycycline withdrawal (Fig-

ure S4E). Therefore, when Yap expression was normalized, a

normally sized epithelium was restored with a normally sized

basal stem cell pool and the epithelium was characterized by a

proper pseudostratified architecture.

The Overexpression of Yap in Secretory Cells CausesThem to Adopt a Basal-like ProgramThus far, we have demonstrated that Yap is required for the

maintenance of adult basal stem cells and that Yap overexpres-

sion promotes stem cell proliferation at the expense of terminal

differentiation. These findings suggest the possibility that Yap

overexpression in a differentiated cell could promote a stem

cell-like program. To test this hypothesis, we overexpressed

Yap in secretory cells. We generated triple transgenic mice

carrying the CC10-CreER (Rawlins et al., 2009), Rosa26-LSL-

rtTA-IRES-GFP, and tetO Yap (S127A) alleles (referred to as

liferating basal stem cells (p63+ Ki-67+, right) demonstrate that basal stem cell

cells (red), p63�CK5+CK8� progenitor cells (blue), p63�CK5+CK8+ progenitor3A2+ secretory cells (purple), and FoxJ1+ ciliated cells (cyan) in Yap-over-

(E), and 20 mm in (C). See also Figure S3.


Figure 4. Normalizing Yap Expression Restores Pseudostratified Epithelial Architecture and a Normally Sized Basal Stem Cell Pool

(A) A schematic of the experimental strategy and phenotypic result of an experiment designed to test whether normalizing Yap signaling in a stratified epithelium

restores normal basal stem cell numbers and pseudostratified epithelial architecture.

(B) H&E staining reveals the restoration of a normal pseudostratified epithelium after the discontinuation of doxycycline-induced Yap overexpression.

(C) Immunostaining for CK5+ basal stem cells (red) and Ki-67 (green) reveals a normalization of stem cell numbers and proliferation rates following doxycycline

withdrawal. The arrow points to a basal stem cell that is double positive for CK5 and Ki-67.

(D) Experimental strategy for using long-lived H2BGFP expression as a lineage tracing tool for tracing the behavior of stem and progenitor cells that have

previously overexpressed Yap.

(E) Expression of GFP (green) is detected in the majority of the cells that overexpress Yap (red, left) following doxycycline treatment. Ectopic Yap expression is no

longer detected following 1 week of doxycycline withdrawal, whereas strong GFP lineage label endures (green, right).

(F) Scgb3A2 (red, left) and FoxJ1 (red, right) occur in H2BGFP+ (green) cells 2 weeks after doxycycline removal (arrows point to double-positive cells).

Scale bar represents 20 mm in (B), (C), (E), and (F). See also Figure S4.

Developmental Cell




Figure 5. The Overexpression of Yap in

Secretory Cells Causes Them to Adopt a

Basal-like Program

(A) Schematic of the strategy to inducibly over-

express Yap in GFP lineage tagged secretory

cells. Following Yap induction, some GFP tagged

secretory cells adopt a basal stem cell-like identity.

(B) Costaining of the secretory cell lineage tag GFP

with the basal stem cell marker T1a (red) shows

that GFP is associated with normal columnar cells

and not basal stem cells in control animals (left). In

experimental animals, GFP+ T1a+ basal-like cells

derived from Yap-overexpressing secretory cells

are observed (right, arrows).

(C) A pyramidal basal-like cell expressing p63 (red)

and ectopic Yap (green) reveals that the stem-

like cell was derived from a Yap-overexpressing

secretory cell (arrow).

(D) Expression of Scgb3A2 (red) is lost in pyrami-

dal Yap-overexpressing (green) secretory-derived

cells (arrow).

(E) Yap knockdown using GFP-expressing lenti-

virus prevents the dedifferentiation of secretory

cells into basal stem cells as demonstrated by the

absence of p63 (red, top) and CK5 (red, bottom)

staining in GFP+ infected cells as opposed to

controls. Arrowheads point to GFP+ cells infected

with control viruses that do dedifferentiate into

p63+ and CK5+ basal stem cells.

(F) Quantification of p63+ and CK5+ basal stem

cells as a fraction of all GFP+ infected cells in

scrambled control and Yap knockdown secretory

cell cultures reveals that inhibition of Yap prevents

secretory cell dedifferentiation into stem cells.

Data are presented as mean ± SEM. Scale bar

represents 20 mm in (B), (C), and (D) and 100 mm in

(E). See also Figure S5.

Developmental Cell



CC10-Yap mice). In these mice, CreER protein is expressed

exclusively in secretory cells. Upon tamoxifen administration, a

multicistronic transcript containing rtTA and GFP is permanently

induced in these cells and doxycycline administration then

induces Yap overexpression specifically in these GFP lineage-

tagged secretory cells (Figure 5A).

Tamoxifen was administered to adult CC10-Yap transgenic

mice (8–10 weeks old) and then followed by doxycycline induc-

tion. Fluorescence-activated cell sorting analysis demonstrated

that GFP+ cells accounted for 3.94% of the total epithelial cells

(Figure S5A). In control animals possessing the CC10-CreER

and Rosa26-LSL-rtTA-IRES-GFP alleles, GFP expression was

appropriately restricted to columnar secretory cells (Figure 5B,

left) and entirely absent in basal stem cells. In experimental ani-

mals, some GFP+ cells exhibited the characteristic pyramidal

morphology of basal stem cells and expressed the basal stem

cell-specific marker T1a (Figure 5B, right). These pyramidal cells

established a broad base in direct contact with the basement

membrane and stained for ectopic Yap, as assessed by Yap

staining without amplification (Figure S5B). Furthermore, the

pyramidal GFP+ Yap-overexpressing cells also expressed the

basal stem cell-specificmarker p63 (Figure 5C). Of all GFP+ cells,

we note that only 79.30% continued to express Scgb3A2

(Figure 5D) and 8.06% became p63+ basal-like cells (n = 589).

Thus, in addition to adopting a basal-like program, secretory

cells that had once overexpressed Yap also suppressed ele-

ments of their secretory cell program.

To test whether the secretory cell-derived partially reprog-

rammed basal-like cells persisted following the normalization

of Yap expression, we administered doxycycline to CC10-Yap

mice for 2 weeks and then withdrew doxycycline for 3 weeks.

After this period, there were no GFP+ basal-like cells (n = 561).

Thus, persistent overexpression of Yap was required to maintain

the partially reprogrammed basal-like state that is transiently

induced by Yap overexpression in secretory cells.

The Inhibition of Yap Blocks the Dedifferentiation ofSecretory Cells into Basal Stem CellsWe recently demonstrated that secretory cells cultured ex vivo

dedifferentiate into p63+ CK5+ basal stem cells (Tata et al.,

2013a). To further examine the role of Yap in regulating stem

cell identity, we performed Yap lentiviral knockdown experi-

ments in secretory cell cultures to assess whether Yap loss

alters the propensity of a secretory cell to dedifferentiate. In

contrast to controls, secretory cells infected with a Yap knock-

down lentivirus failed to dedifferentiate into stem cells and did

not activate p63 expression 9 days after plating (Figures 5E

and 5F). Among the GFP+ cells infected with scrambled virus,

p63+ basal stem cells were easily detected and accounted

for 24.61% ± 0.96% of all GFP+ cells. Among the GFP+ cells


Figure 6. Yap and p63 Interact in Basal

Stem Cells and Regulate Common Target

Genes

(A) Quantitative-PCR analysis demonstrates that

DNp63a is the major p63 transcript expressed in

sorted basal stem cells.

(B) Immunoprecipitation demonstrates that Yap

interacts with p63 in human basal stem cells.

(C) Quantitative-PCR analysis of p63 target

genes demonstrates that these targets are more

enriched in basal stem cells.

(D) ChIP-PCR analysis demonstrates that Yap

binds to the promoters of p63 target genes.

(E) Decrease in mRNA expression of p63 target

genes following Yap knockdown.

(F) Gene expression analysis shows an increase in

mRNA expression of p63 target genes following

Yap overexpression, but this effect is abolished

when p63 is knocked down.

Data are presented as mean ± SEM. See also

Figure S6.

Developmental Cell



infected with Yap virus, p63+ cells decreased to only 1.18% ±

0.51% of the total population (p < 0.0001; Figure 5F). We

confirmed the finding with another basal stem cell marker

CK5 (Figures 5E and 5F). In cells infected with the scrambled

control virus, 41.33% ± 6.2% of GFP-expressing cells were

CK5+ 9 days after culture. This number dramatically decreased

to 1.23% ± 0.79% (p < 0.0001) when Yap was knocked down

(Figures 5E and 5F). These results suggest that Yap is required

for the dedifferentiation of secretory cells and their adoption of a

stem cell program.

Yap and p63 Interact in Basal Stem Cells and RegulateCommon Target GenesBecause the transcription factor p63 is the most well-estab-

lished regulator of basal stem cells (Koster et al., 2004; Romano

et al., 2012; Su et al., 2013), we sought to determine whether

there was a direct mechanistic interaction between p63 and

Yap. Although p63 has previously been shown to interact with

Yap in cell lines (Chatterjee et al., 2010; Strano et al., 2001;

Yuan et al., 2010), the functional relevance of such an interaction

has not been established in vivo.


p63 has two isoforms, TA and delta

N (DN), each of which has three splice

variants: a, b, and g (Yang et al., 1998).

Quantitative PCR revealed that TAp63

splice variants were expressed at very

low levels in basal stem cells, and that

DNp63a was by far the most abundant

transcript in basal cells in vivo and in

cultured basal cells (Figures 6A and

S6A). Staining with two DNp63-specific

antibodies showed that the expression

of DNp63 was exclusively restricted

to the basal stem cell population (Fig-

ure S6B). We then verified the previously

reported interaction of Yap and DNp63a

in HEK cells using Myc-tagged Yap and

Flag-tagged DNp63a (Figure S6C). To extend these findings to

our model system, we performed reciprocal immunoprecipita-

tions using primary human basal stem cells and found that Yap

and p63 physically interact with one another specifically in

airway epithelial basal stem cells (Figure 6B). Of note, the size

of the precipitated p63 in the Yap pull-down demonstrates that

the Yap partner is DNp63.

We then examined whether Yap modulation had an effect on

the transcription of p63 target genes in mouse basal stem cells.

In other contexts, p63 has been shown to regulate the transcrip-

tion of CK5, EGFR, FGFR2, Integrin alpha 6 (Igta6), Integrin b4

(Igtb4), and p63 itself (Carroll et al., 2006; McDade et al., 2012;

Romano et al., 2009). All of these p63 target genes were more

enriched in basal stem cells relative to secretory and ciliated

cells (Figure 6C). We verified that p63 binds upstream of the

transcriptional start sites of these genes with chromatin immu-

noprecipitation (ChIP)-PCR (Figure S6D). Additionally, DNp63

knockdown in mouse basal stem cell cultures led to a decrease

in the expression of these target genes after 6 days (Figures

S6E–S6H). Using ChIP-PCR analysis, we found that Yap also

binds upstream of the transcriptional start sites of the

Developmental Cell



aforementioned p63 target genes (Figure 6D). Furthermore, Yap

knockdown resulted in a decrease in the expression of p63

target genes (Figure 6E). Conversely, the transcription of all

p63 target genes was significantly increased 12 hr after doxycy-

cline was administered to induce the expression of Yap in sorted

basal stem cells fromCK5-YapTg trachea, as compared to those

from CK5rtTA controls (Figure 6F). To directly test whether the

transcriptional effect caused by Yap overexpression was medi-

ated by p63, we knocked down p63 while overexpressing Yap.

We harvested and analyzed these cells after 6 days of culture,

because at this time point the majority of infected cells remained

p63+CK5+ basal stem cells, although p63 expression was

decreased given the knockdown (Figure S6E). We found that in-

creases in the transcription of p63 target genes in Yap-overex-

pressing basal cells were significantly suppressed when p63

was inhibited (Figure 6F). In aggregate, these data demonstrate

that Yap and p63 interact in basal stem cells to regulate common

target genes.

p63 and Yap Genetically InteractFinally, we sought to establish whether genetic and phenotypic

data could confirm an in vivo relevance for our biochemical

data demonstrating an interaction of Yap and p63. Specifically,

we asked whether p63 loss would phenocopy Yap loss. Trans-

genic animals carrying the CK5 rtTA, tetO Cre, and floxed p63

alleles (Mills et al., 2002) (referred to as CK5-p63KO) were gener-

ated, and we hypothesized that stem cell loss would occur

following p63 deletion in analogy to the phenotype associated

with Yap deletion (Figure 7A). Using animals bearing only the

CK5 rtTA and tetO Cre alleles as controls, our histological anal-

ysis revealed that p63 deletion resulted in a simplification of

the normal pseudostratified epithelium into a simple columnar

epithelium 3 weeks after doxycycline treatment (Figure 7B).

This was accompanied by a significant decrease in the total

number of p63+ cells (Figure 7C), demonstrating efficient dele-

tion of p63. A loss of CK5+ and T1a+ cells (Figures 7C and

S7A) confirmed the loss of basal stem cells in CK5-p63KO ani-

mals. Controls had 1,184 ± 15 CK5-expressing cells per stan-

dard tracheal section. After doxycycline treatment, this number

decreased to 563 ± 67 (p < 0.001) in 2 weeks and to 126 ± 15

(p < 0.0001) in 3 weeks (Figure 7E). Although we functionally

demonstrated that DNp63 was the predominant isoform of p63

in basal stem cells, to further verify this point, we analyzed the

effect of TAp63 loss on the tracheal epithelium of TAp63 null

animals (Su et al., 2009). No changes in the histology of the

tracheal epithelium and the expression of basal stem cell

markers including DNp63 and CK5 were found in the mutant

TAp63 trachea (Figures S7B and S7C). Furthermore, quantifica-

tion of CK5+ and DNp63+ cells in the mutant and control trachea

revealed no significant differences in the number of basal stem

cells per standard section (Figure S7D), indicating that TAp63

is dispensable for the maintenance of basal stem cells in the tra-

chea during homeostasis. These data together demonstrate that

p63, specifically DNp63, is required for the maintenance of an

adult airway basal stem cell.

We next sought to determine whether basal stem cells under-

went differentiation following p63 loss by assessing whether

transitional cells expressing both basal and differentiated cell

markers were induced. Indeed, a significant increase in cells

double positive for CK5 and CC10 or CK5 and FoxJ1 occurred

(Figure 7D), suggesting that basal stem cells were differentiating

into both secretory and ciliated cells in the absence of p63. Simi-

larly, p63 knockdown in basal stem cell cultures at day 10

decreased the number of cells that were positive for the basal

stem cell marker CK5 (Figure S7E, top) and increased the num-

ber of cells expressing the early differentiation marker CK8 (Fig-

ure S7E, bottom). Taken together, these results demonstrate

that p63, like Yap, is required for the maintenance of adult basal

stem cells.

Finally, we sought to determine whether Yap and p63 geneti-

cally interact. To do this, we examined whether the removal

of one copy of p63 could suppress the phenotype generated

by Yap overexpression. Transgenic animals bearing CK5rtTA,

tetO Yap (S127A), tetO Cre, and a single floxed p63 allele were

generated. Siblings carrying CK5rtTA and tetO Yap (S127A) as

well as animals with CK5rtTA, tetO Cre and floxed p63 were

used as controls. All animals were given doxycycline continu-

ously for 10 days. There was no obvious effect on basal stem

cell maintenance or airway epithelial architecture when one

copy of p63 was deleted at homeostasis (Figure S7F, top). As

we observed previously, epithelial stratification was induced

when Yap was activated in CK5-YapTg animals (Figure S7F,

middle). Epithelial stratification was suppressed when one

copy of p63 was removed (Figure S7F, bottom). Similarly, the

increases in basal stem cell numbers and their proliferation

rates following Yap activation were significantly lessened when

one copy of p63 was removed (Figures 7F and 7G). Ten days

after doxycycline treatment, 1,331 ± 54 basal stem cells marked

by p63 per tracheal section were detected following Yap overex-

pression. This number significantly decreased to 1,143 ± 41

(p = 0.049) when one copy of p63 was removed (Figure 7F).

With regard to basal stem cell proliferation, 8.16% ± 1.00% of

p63+ cells were also Ki-67+ when Yap was overexpressed.

This number significantly decreased to 4.32% ± 0.71% (p =

0.036) when one copy of p63 was removed (Figure 7G). These

data suggest that the effects of Yap overexpression are medi-

ated by p63 and that the two factors genetically interact in the

airway epithelium.

DISCUSSION

Wedemonstrate that the regulation of basal stem cell behavior is

intimately associated with epithelial size and architecture in the

adult airway epithelium. On one hand, basal stem cell loss results

in the simplification of a pseudostratified airway epithelium into a

columnar one. Conversely, Yap overexpression increases stem

cell proliferation, resulting in epithelial hyperplasia and stratifica-

tion. Although one might assume that epithelial size and stratifi-

cation are largely governed by the increased replicative activity

of a stem cell, we note that suprabasal progenitor cells (not nor-

mally present in the homeostatic airway epithelium) also divide,

just as they do in embryonic epidermis (Lechler and Fuchs,

2005). Indeed, after airway injury, stratification is similarly

accompanied by replication in both a stem cell and a newly re-

vealed progenitor cell compartment. The nature of the cell divi-

sions (i.e., symmetric versus asymmetric) occurring in these

two compartments is not understood and is possibly distinct.

Interestingly, in other instances of epithelial stratification such


Figure 7. p63 and Yap Genetically Interact

(A) A schematic of the strategy for basal stem cell-specific p63 deletion. It is hypothesized that p63 deletion results in a loss of basal stem cells (red), mirroring Yap

deletion.

(B) H&E staining of tracheal sections from control (left) and experimental CK5-p63KO (right) animals reveals a simplification of a normally pseudostratified

epithelium into a columnar epithelium following p63 deletion. Control animals bear only the CK5 rtTA and tetO Cre alleles.

(C) Immunostaining for p63 (red) and CK5 (green) reveals a significant decrease in total basal stem cell numbers in CK5-p63KO tracheal sections as compared to

that in control mice possessing only the CK5 rtTA and tetO Cre alleles.


Developmental Cell




Developmental Cell



as in the human larynx or esophagus, parabasal cells are the

dominant replicating cell population, and the putative basally

located stem cells are more quiescent (data not shown). Thus,

stem and progenitor cell behaviors may be differentially regu-

lated to produce alternative paths to epithelial stratification. Of

note, premalignant airway squamous metaplasia is also associ-

ated with both stem and progenitor cell replication and excess

(Rock et al., 2010) and our Yap overexpression system may

serve to model some aspects of this pathology.

The size of a steady-state stem cell pool is dictated by

balanced rates of stem cell self-renewal, stem cell survival,

and stem cell differentiation. Previous reports have largely

focused on the role of Yap in promoting stem cell and progen-

itor cell replication and survival (Barry et al., 2013; Cai et al.,

2010; Cao et al., 2008; Schlegelmilch et al., 2011). In contrast,

our loss-of-function study points to a requirement for Yap in re-

straining stem cell differentiation as a mechanism to ensure the

maintenance of stem cells during normal epithelial homeosta-

sis. Indeed, we also demonstrated a dose-dependent effect

of Yap on the maintenance of basal stem cells, suggesting

that the tight control of Yap levels is critical to maintain a nor-

mally sized basal stem cell pool. The notion of a set point for

the airway stem cell pool contingent on particular levels of

Yap expression is further evidenced by the return of a normal

stem cell pool size when Yap expression is normalized after

its overexpression.

Given that Yap overexpression promotes basal stem cell pro-

liferation, it will be of interest to determine whether Yap levels

are transiently increased following airway epithelial injury repair

because the early stratification that accompanies regeneration

is also associated with an increased rate of basal cell prolifera-

tion. This notion would be consistent with our finding that Yap

knockdown inhibits stem cell proliferation in vitro, as dissociation

and culture of basal cells induces a proliferative response similar

to that encountered after airway injury. Analogously, the differen-

tiation associated with late epithelial repair might be associated

with a tuning down of Yap levels.

Furthermore, we revealed a role for Yap in regulating stem cell

identity per se. Previously, we demonstrated that secretory cells

can stably dedifferentiate into stem cells (Tata et al., 2013a).

We now show that Yap loss prevents this dedifferentiation.

Conversely, Yap overexpression in secretory cells promotes a

stem cell-like identity and concomitantly suppresses the secre-

tory cell program. Interestingly, persistent Yap overexpression

is required to maintain the stem cell-like identity despite the

induction of the basal stem cell transcription factor p63. Thus,

the induction of p63 in secretory cells is insufficient to stably

reprogram differentiated cells into stem cells within the time

we assessed. We note that following Yap overexpression in

secretory cells, there aremore cells that suppress their secretory

(D) Detection of transitional cells double positive for CK5 (red) and CC10 (green; le

after doxycycline administration. Arrows point to the double-positive cells.

(E) Quantification of CK5+ basal stem cells per standard tracheal section followin

(F) Quantification of p63+ cell numbers reveals that a loss of one copy of p63 sig

overexpression.

(G) Quantification of p63+ Ki-67+ cells reveals that the loss of one copy of p63 sign

overexpression.

Data are presented as mean ± SEM. Scale bar represents 5 mm in (B), and 10 mm

cell identity than cells that adopt a basal cell-like program,

implying the existence of transitional progenitor cells. Similarly,

Yap overexpression from basal stem cells produces more basal

cells, but Yap overexpression is also associated with an excess

of intermediate progenitor cells, again suggesting that Yap alone

cannot enforce a basal stem cell identity in which differentiation

is fully blocked. It will be of considerable interest to determine

why Yap overexpression partially reprograms secretory cells,

while stem cell ablation induces a permanent conversion to a

stem cell state. Although in aggregate very high levels of Yap

expression seem to drive cells toward a stem cell-like identity,

the low levels of Yap detected in secretory cells, as well as cili-

ated cells, of the homeostatic epithelium may be of some func-

tional relevance that we have not yet assessed.

The interaction of the Yap transcriptional coactivator with

TEAD partners has been well established to have an in vivo phys-

iologic relevance (Yu and Guan, 2013). Other partner transcrip-

tion factors have been shown to interact with Yap in cultured

cells, including Smad 1 (Alarcon et al., 2009), Smad 7 (Ferrigno

et al., 2002), RUNX 1/2 (Yagi et al., 1999), ErbB4 (Komuro

et al., 2003), p73, and p63 (Strano et al., 2001). In this study,

we have now demonstrated that a WW domain (Yap)-PPxY

(p63) interaction is physiologically relevant in an in vivo setting

(Chen and Sudol, 1995; Sudol and Harvey, 2010). Previously, it

had been shown that p63 null mutants die at birth without embry-

onic basal stem cell progenitors in their airway epithelium (Dan-

iely et al., 2004), either because basal stem cells were never

specified or because they could not be maintained after specifi-

cation. We now show that p63, like Yap, is required for the actual

maintenance of adult airway basal stem cells. In addition, both

Yap loss and p63 loss are ultimately associated with an excess

of ciliated cell numbers relative to secretory cell numbers.

Furthermore, p63 overexpression had been shown to promote

epithelial stratification in the murine lung (Koster et al., 2004;

Romano et al., 2009). In aggregate, this suggests a functionally

relevant role for an interaction of Yap with a new transcription

factor partner. This interaction may be relevant in the myriad

epithelia that contain p63+ basal cells. Indeed, prior work in the

epidermis reveals a role for both p63 and Yap in epidermal basal

stem cell proliferation and epithelial stratification (Koster et al.,

2004; Romano et al., 2012; Schlegelmilch et al., 2011; Zhang

et al., 2011). Finally, because Yap and p63 both have roles as tu-

mor suppressors and oncogenes (Overholtzer et al., 2006; Pan,

2010; Su et al., 2013), our results have potential implications for

understanding tumorigenesis.

EXPERIMENTAL PROCEDURES

Detailed protocols are described in the Supplemental Experimental

Procedures.

ft) as well as CK5 (red) and FoxJ1 (green; right) in CK5-p63KO trachea 2 weeks

g p63 loss.

nificantly suppresses the increase in basal stem cells numbers caused by Yap

ificantly suppresses the increased basal stem cell proliferation caused by Yap

in (C) and (D). See also Figure S7.


Developmental Cell



Animal Models

TheCK5 rtTA (Diamond et al., 2000),CK5-CreER (Van Keymeulen et al., 2011),

CC10-CreER (Rawlins et al., 2009), tetO Yap (S127A; Camargo et al., 2007),

floxed Yap (Schlegelmilch et al., 2011), floxed p63 (Mills et al., 2002), and

TAp63 knockout (Su et al., 2009) mice have been previously described. Trans-

genic mice bearing tetO Cre (006234), tetO H2BGFP (005104), Rosa26-LSL-

YFP (006148), and Rosa26-LSL-rtTA-IRES-GFP (005670) were purchased

from Jackson laboratory. Doxycycline was administered via drinking water

(1 g/l) and inhalation (Tata et al., 2013b). Tamoxifen (2 mg/20 g body weight)

or corn oil was injected intraperitoneally for 3 consecutive days in transgenic

animals carrying CK5-CreER, floxed Yap, and Rosa-LSL-YFP and their

respective control animals, and for 5 consecutive days in CC10-Yap animals

and their respective controls. Mice were killed using CO2. All animal work

was approved by the committee on Research Animal Care of the Massachu-

setts General Hospital according to federal and institutional policies and

regulations.

Cell Dissociation and Sorting of Different Fractions of Epithelial

Cells

Mouse tracheas were dissected, minced manually, and then incubated in

Papain dissociation solution. Cells were sorted using a fluorescence-activated

cell sorting Aria flow cytometer (BD) or a Vantage Cell Sorter (BD). Epithelial

cells were gated as EpCAM+ cells. Basal stem cells were sorted as EpCAM+

GSIb4+ cells (confirmed by staining for p63 after cytospin). Secretory cells

were sorted as EpCAM+ SSEA1+ cells (verified by staining with CC10 after

cytospin). Ciliated cells were sorted as EpCAM+ CD24+ cells (verification

with both Foxj1 and A-tub staining after cytospin).

Yap TSA Amplification

Immunohistochemical staining for Yap protein was performed using a

TSA Biotin Tyramide Amplification system (SAT700001EA, Perkin Elmer).

The following Yap antibodies were used: mouse anti-Yap (101199, Santa

Cruz); mouse anti-Yap (H00010413-M01, Abnova), and rabbit anti-Yap (kindly

provided by Joseph Avruch). When used at a 1:500 dilution, immunohisto-

chemical staining in the case of each antibody revealed a strong nuclear signal

in basal stem cells as compared to weaker staining in differentiated cells. To

confirm that cells were Yap-negative following Yap deletion, we deployed anti-

body staining at a 1:100 dilution so that we could detect even very low levels of

Yap protein expression.

Cell Counting

Cells were manually counted based upon immunofluorescent staining for

markers of specific cell types in at least three different tracheas with three to

five representative regions per tracheal section. For the quantification of total

basal stem cells, p63+ cells were counted along the full length of the tracheal

epithelium extending from cartilage ring 1 to 12 in three to five tracheas with

two to three 6-mm thick sections counted per trachea.

Coimmunoprecipitation and ChIP

Detailed protocols for coimmunoprecipitation and ChIP are provided in the

Supplemental Experimental Procedures.

Statistical Analysis

Data were analyzed and compared between groups using two tailed, unpaired

Student’s t tests (Prism, Graphpad). A p < 0.05 was considered statistically

significant and is presented as * p < 0.05, **p < 0.01, or ***p < 0.001.

SUPPLEMENTAL INFORMATION

Supplemental Information includes Supplemental Experimental Procedures

and seven figures and can be found with this article online at http://dx.doi.

org/10.1016/j.devcel.2014.06.004.

ACKNOWLEDGMENTS

We thank Adam Glick and Alea Mills for providing the CK5rtTA and p63 floxed

mice, Elsa Flores for the TAp63 knockout mice, Brigid Hogan for the CK5-

CreER and CC10-CreER mice, Barry Stripp for providing the goat anti-CC10


antibody, Shioko Kimura for the rabbit Scgb3A2 antibody, Satrajit Sinha for

the rabbit DNp63 antibody, and Joseph Avruch for the rabbit Yap antibody.

We acknowledge XuWu and Jenna Galloway for their comments on themanu-

script. We thank Nicole Forster, Karin Schlegelmilch, Laura Prickett-Rice, Kat

Folz-Donahue, and David Dombkowski for technical assistance. J.R. is a New

York Stem Cell Foundation-Robertson Investigator. This study was supported

by an NIH-NHLBI Early Career Research New Faculty (P30) award

(5P30HL101287-02), a grant from the NHLBI Progenitor Cell Biology Con-

sortium (PCBC, 5U01HL099997-04; to J.R.), an R01 (1R01HL116756-01a)

from NIH/NHLBI (to J.R.), an NIDCR R01 DE015945 (to L.W.E. and S.V.S.),

and a Harvard Stem Cell Institute Junior Investigator Grant (to J.R.).

Received: January 12, 2014

Revised: April 7, 2014

Accepted: June 6, 2014

Published: July 17, 2014

REFERENCES

Alarcon, C., Zaromytidou, A.I., Xi, Q., Gao, S., Yu, J., Fujisawa, S., Barlas, A.,

Miller, A.N., Manova-Todorova, K., Macias, M.J., et al. (2009). Nuclear CDKs

drive Smad transcriptional activation and turnover in BMP and TGF-beta

pathways. Cell 139, 757–769.

Barry, E.R., and Camargo, F.D. (2013). The Hippo superhighway: signaling

crossroads converging on the Hippo/Yap pathway in stem cells and develop-

ment. Curr. Opin. Cell Biol. 25, 247–253.

Barry, E.R., Morikawa, T., Butler, B.L., Shrestha, K., de la Rosa, R., Yan, K.S.,

Fuchs, C.S., Magness, S.T., Smits, R., Ogino, S., et al. (2013). Restriction of

intestinal stem cell expansion and the regenerative response by YAP. Nature

493, 106–110.

Cai, J., Zhang, N., Zheng, Y., deWilde, R.F., Maitra, A., and Pan, D. (2010). The

Hippo signaling pathway restricts the oncogenic potential of an intestinal

regeneration program. Genes Dev. 24, 2383–2388.

Camargo, F.D., Gokhale, S., Johnnidis, J.B., Fu, D., Bell, G.W., Jaenisch, R.,

and Brummelkamp, T.R. (2007). YAP1 increases organ size and expands

undifferentiated progenitor cells. Curr. Biol. 17, 2054–2060.

Cao, X., Pfaff, S.L., and Gage, F.H. (2008). YAP regulates neural progenitor

cell number via the TEA domain transcription factor. Genes Dev. 22, 3320–

3334.

Carroll, D.K., Carroll, J.S., Leong, C.O., Cheng, F., Brown, M., Mills, A.A.,

Brugge, J.S., and Ellisen, L.W. (2006). p63 regulates an adhesion programme

and cell survival in epithelial cells. Nat. Cell Biol. 8, 551–561.

Chatterjee, A., Sen, T., Chang, X., and Sidransky, D. (2010). Yes-associated

protein 1 regulates the stability of DeltaNp63alpha. Cell Cycle 9, 162–167.

Chen, H.I., and Sudol, M. (1995). The WW domain of Yes-associated protein

binds a proline-rich ligand that differs from the consensus established for

Src homology 3-binding modules. Proc. Natl. Acad. Sci. USA 92, 7819–7823.

Daniely, Y., Liao, G., Dixon, D., Linnoila, R.I., Lori, A., Randell, S.H., Oren, M.,

and Jetten, A.M. (2004). Critical role of p63 in the development of a normal

esophageal and tracheobronchial epithelium. Am. J. Physiol. Cell Physiol.

287, C171–C181.

Diamond, I., Owolabi, T., Marco, M., Lam, C., and Glick, A. (2000). Conditional

gene expression in the epidermis of transgenic mice using the tetracycline-

regulated transactivators tTA and rTA linked to the keratin 5 promoter.

J. Invest. Dermatol. 115, 788–794.

Ferrigno,O., Lallemand, F., Verrecchia, F., L’Hoste, S., Camonis, J., Atfi, A., and

Mauviel, A. (2002). Yes-associated protein (YAP65) interacts with Smad7 and

potentiates its inhibitory activity against TGF-beta/Smad signaling. Oncogene

21, 4879–4884.

Halder, G., and Johnson, R.L. (2011). Hippo signaling: growth control and

beyond. Development 138, 9–22.

Komuro, A., Nagai, M., Navin, N.E., and Sudol, M. (2003). WW domain-con-

taining protein YAP associates with ErbB-4 and acts as a co-transcriptional

activator for the carboxyl-terminal fragment of ErbB-4 that translocates to

the nucleus. J. Biol. Chem. 278, 33334–33341.



Developmental Cell



Koster, M.I., Kim, S., Mills, A.A., DeMayo, F.J., and Roop, D.R. (2004). p63 is

the molecular switch for initiation of an epithelial stratification program. Genes

Dev. 18, 126–131.

Lechler, T., and Fuchs, E. (2005). Asymmetric cell divisions promote stratifica-

tion and differentiation of mammalian skin. Nature 437, 275–280.

McDade, S.S., Henry, A.E., Pivato, G.P., Kozarewa, I., Mitsopoulos, C.,

Fenwick, K., Assiotis, I., Hakas, J., Zvelebil, M., Orr, N., et al. (2012).

Genome-wide analysis of p63 binding sites identifies AP-2 factors as co-reg-

ulators of epidermal differentiation. Nucleic Acids Res. 40, 7190–7206.

Mills, A.A., Qi, Y., and Bradley, A. (2002). Conditional inactivation of p63 by

Cre-mediated excision. Genesis 32, 138–141.

Morrisey, E.E., and Hogan, B.L. (2010). Preparing for the first breath: genetic

and cellular mechanisms in lung development. Dev. Cell 18, 8–23.

O’Koren, E.G., Hogan, B.L., and Gunn, M.D. (2013). Loss of basal cells pre-

cedes bronchiolitis obliterans-like pathological changes in a murine model of

chlorine gas inhalation. Am. J. Respir. Cell Mol. Biol. 49, 788–797.

Overholtzer, M., Zhang, J., Smolen, G.A., Muir, B., Li, W., Sgroi, D.C., Deng,

C.X., Brugge, J.S., and Haber, D.A. (2006). Transforming properties of YAP,

a candidate oncogene on the chromosome 11q22 amplicon. Proc. Natl.

Acad. Sci. USA 103, 12405–12410.

Pan, D. (2007). Hippo signaling in organ size control. Genes Dev. 21, 886–897.

Pan, D. (2010). The hippo signaling pathway in development and cancer. Dev.

Cell 19, 491–505.

Ramos, A., and Camargo, F.D. (2012). The Hippo signaling pathway and stem

cell biology. Trends Cell Biol. 22, 339–346.

Rawlins, E.L., Okubo, T., Xue, Y., Brass, D.M., Auten, R.L., Hasegawa, H.,

Wang, F., and Hogan, B.L. (2009). The role of Scgb1a1+ Clara cells in the

long-term maintenance and repair of lung airway, but not alveolar, epithelium.

Cell Stem Cell 4, 525–534.

Rock, J.R., Onaitis, M.W., Rawlins, E.L., Lu, Y., Clark, C.P., Xue, Y., Randell,

S.H., and Hogan, B.L. (2009). Basal cells as stem cells of the mouse trachea

and human airway epithelium. Proc. Natl. Acad. Sci. USA 106, 12771–12775.

Rock, J.R., Randell, S.H., and Hogan, B.L. (2010). Airway basal stem cells:

a perspective on their roles in epithelial homeostasis and remodeling. Dis.

Model. Mech. 3, 545–556.

Rock, J.R., Gao, X., Xue, Y., Randell, S.H., Kong, Y.Y., and Hogan, B.L. (2011).

Notch-dependent differentiation of adult airway basal stem cells. Cell Stem

Cell 8, 639–648.

Romano, R.A., Ortt, K., Birkaya, B., Smalley, K., and Sinha, S. (2009). An active

role of the DeltaN isoform of p63 in regulating basal keratin genes K5 and K14

and directing epidermal cell fate. PLoS ONE 4, e5623.

Romano, R.A., Smalley, K., Magraw, C., Serna, V.A., Kurita, T., Raghavan, S.,

and Sinha, S. (2012). DNp63 knockout mice reveal its indispensable role as a

master regulator of epithelial development and differentiation. Development

139, 772–782.

Schlegelmilch, K., Mohseni, M., Kirak, O., Pruszak, J., Rodriguez, J.R., Zhou,

D., Kreger, B.T., Vasioukhin, V., Avruch, J., Brummelkamp, T.R., and

Camargo, F.D. (2011). Yap1 acts downstream of a-catenin to control

epidermal proliferation. Cell 144, 782–795.

Strano, S., Munarriz, E., Rossi, M., Castagnoli, L., Shaul, Y., Sacchi, A., Oren,

M., Sudol, M., Cesareni, G., and Blandino, G. (2001). Physical interaction with

Yes-associated protein enhances p73 transcriptional activity. J. Biol. Chem.

276, 15164–15173.

Su, X., Paris, M., Gi, Y.J., Tsai, K.Y., Cho, M.S., Lin, Y.L., Biernaskie, J.A.,

Sinha, S., Prives, C., Pevny, L.H., et al. (2009). TAp63 prevents premature

aging by promoting adult stem cell maintenance. Cell Stem Cell 5, 64–75.

Su, X., Chakravarti, D., and Flores, E.R. (2013). p63 steps into the limelight:

crucial roles in the suppression of tumorigenesis and metastasis. Nat. Rev.

Cancer 13, 136–143.

Sudol, M., and Harvey, K.F. (2010). Modularity in the Hippo signaling pathway.

Trends Biochem. Sci. 35, 627–633.

Tata, P.R., Mou, H., Pardo-Saganta, A., Zhao, R., Prabhu, M., Law, B.M.,

Vinarsky, V., Cho, J.L., Breton, S., Sahay, A., et al. (2013a). Dedifferentiation

of committed epithelial cells into stem cells in vivo. Nature 503, 218–223.

Tata, P.R., Pardo-Saganta, A., Prabhu, M., Vinarsky, V., Law, B.M., Fontaine,

B.A., Tager, A.M., and Rajagopal, J. (2013b). Airway-specific inducible trans-

gene expression using aerosolized doxycycline. Am. J. Respir. Cell Mol. Biol.

49, 1048–1056.

Van Keymeulen, A., Rocha, A.S., Ousset, M., Beck, B., Bouvencourt, G., Rock,

J., Sharma, N., Dekoninck, S., and Blanpain, C. (2011). Distinct stem cells

contribute to mammary gland development and maintenance. Nature 479,

189–193.

Yagi, R., Chen, L.F., Shigesada, K., Murakami, Y., and Ito, Y. (1999). A WW

domain-containing yes-associated protein (YAP) is a novel transcriptional

co-activator. EMBO J. 18, 2551–2562.

Yang, A., Kaghad, M., Wang, Y., Gillett, E., Fleming, M.D., Dotsch, V.,

Andrews, N.C., Caput, D., and McKeon, F. (1998). p63, a p53 homolog at

3q27-29, encodes multiple products with transactivating, death-inducing,

and dominant-negative activities. Mol. Cell 2, 305–316.

Yu, F.X., and Guan, K.L. (2013). The Hippo pathway: regulators and regula-

tions. Genes Dev. 27, 355–371.

Yuan, M., Luong, P., Hudson, C., Gudmundsdottir, K., and Basu, S. (2010).

c-Abl phosphorylation of DNp63a is critical for cell viability. Cell Death Dis.

1, e16.

Zhang, H., Pasolli, H.A., and Fuchs, E. (2011). Yes-associated protein (YAP)

transcriptional coactivator functions in balancing growth and differentiation

in skin. Proc. Natl. Acad. Sci. USA 108, 2270–2275.

Zhao, B., Tumaneng, K., and Guan, K.L. (2011). The Hippo pathway in organ

size control, tissue regeneration and stem cell self-renewal. Nat. Cell Biol.

13, 877–883.


Developmental Cell, Volume 30

Supplemental Information

Yap Tunes Airway Epithelial Size and Architecture

by Regulating the Identity, Maintenance,

and Self-Renewal of Stem Cells

Rui Zhao, Timothy R. Fallon, Srinivas Vinod Saladi, Ana Pardo-Saganta, Jorge Villoria,

Hongmei Mou, Vladimir Vinarsky, Meryem Gonzalez-Celeiro, Naveen Nunna, Lida P.

Hariri, Fernando Camargo, Leif W. Ellisen, and Jayaraj Rajagopal

SUPPLEMENTAL INFORMATION

SUPPLEMENTAL FIGURE LEGENDS

Figure S1. Pure Sorts of Airway Epithelial Cell Populations and Stem Cell Loss Following Basal

Stem Cell-Specific Yap Deletion. Related to Figure 1.

(A) Sorting of basal, secretory, and ciliated cells based upon surface expression of GSIβ4,

SSEA1 and CD24 respectively. EpCAM is a marker of all airway epithelial cells. (B)

Quantitative PCR of p63, Scgb1a1 and FoxJ1 transcripts verifies that sorted basal, secretory, and

ciliated cells are pure. Data are represented as mean +/- SEM. (C) Immunostaining for the basal

stem cell-specific marker CK5 (red) and a YFP reporter (green) shows that YFP expression is

induced solely in basal stem cells following doxycycline induction in mice carrying CK5rtTA,

tetO Cre and LSL-YFP alleles. (D) Quantitative PCR using two pairs of primers (Yap-1 and Yap-

2) in control and post-recombination CK5-YapKO sorted basal stem cells one month after

doxycycline treatment. Control mice possess only the CK5 rtTA and tetO Cre alleles. Data are

represented as mean +/- SEM. (E) Immunostaining for T1α (green) and NGFR (red) reveals a

loss of basal stem cells in CK5-YapKO trachea following three months of doxycycline

administration. Scale bars represent 15 μm in C and E.

Figure S2. Basal Stem Cells Undergo Differentiation Upon Yap Loss. Related to Figure 2.

(A) There is no increase in TUNEL (green) or activated Caspase 3 (green) staining in CK5-

YapKO tracheal epithelium 4 weeks after doxycycline administration. (B) Hypothetical schema

showing that, following Yap loss, basal stem cells undergo differentiation transiting through

intermediate cells positive for both basal and differentiated cell markers. (C) Transient

transitional cells double-positive for p63 (red) and Scgb3A2 (green) as well as for CK5 (red) and

FoxJ1 (green) are frequently detected in the tracheal epithelium 3.5 days after sulfur dioxide

(SO2) injury. White arrows point to double-positive cells. (D) Immunostaining for Yap (red)

following tyramide signal amplification (TSA). Yap staining reveals clear signals in both basal

stem cells marked by p63 (green) and suprabasal differentiated cells. Here the Yap antibody

dilution has intentionally been increased to 1:100 to detect even minimal or residual Yap

expression. (E) Immunostaining of GFP (green) and Yap (red) in basal stem cell cultures after

Yap lentiviral transfection demonstrates efficient Yap knockdown (GFP+ cells that are infected

with Yap knockdown virus do not express Yap). (F) Quantification of the percentage of Caspase

3+ cells within the GFP+ virally infected cell population reveals no difference in the degree of

apoptosis following Yap knockdown. (G) Quantification of the percentage of GFP+ virally

infected cells that are also positive for Ki-67 reveals that Yap knockdown decreases cell

proliferation. Data are represented as mean +/- SEM. ns represents not significant. (H)

Immunostaining of GFP (green), basal stem cell marker p63 (red) and differentiation marker

CK8 (red) in basal stem cell cultures after Yap lentiviral knockdown demonstrates that stem cells

differentiate following Yap loss. Scale bar represents 20 μm in A, E and H, and 10 μm in C and

D.

Figure S3. Yap Overexpression in Basal Stem Cells. Related to Figure 3.

Unamplified Yap immunostaining (green) identifies Yap-overexpressing basal cells marked by

CK5 (red) 7 days after doxycycline administration to CK5-YapTg mice. Scale bar represents 30

μm.

Figure S4. Normalizing Yap Expression Restores Basal Stem Cell Proliferation and

Differentiation. Related to Figure 4.

(A) Quantification reveals no significant changes in total p63+ basal stem cell numbers between

control and CK5-YapTg animals 20 days after doxycycline withdrawal (CK5-YapTg Dox Off).

Control animals bearing only the CK5 rtTA driver underwent the same treatment as experimental

animals, namely 20 days of doxycycline followed by a 20-day washout period. (B) The

proportion of basal stem cells (marked by CK5) as a fraction of the total epithelial cells in the

CK5-YapTg animals three weeks after doxycycline withdrawal is not statistically different than

that in control animals. (C) The percentage of proliferating CK5+ basal stem cells in CK5-

YapTg animals after doxycycline withdrawal is not statistically different from that in control

animals. Data are represented as mean +/- SEM in A, B and C. ns indicates a lack of

significance. (D) Co-immunostaining of H2BGFP (green) with the secretory cell marker CC10

(red) and the ciliated cell maker acetylated tubulin (A-tub, white) shows that H2BGFP lineage

labeled stem and progenitor cells that previously overexpressed Yap terminally differentiate after

Yap expression is normalized. Red arrows point to the cells double-positive for H2BGFP and

CC10. White arrows point to the cells double-positive for H2BGFP and A-tub. (E) CK5+ basal

stem cells (red), CC10+ secretory cells (green) and A-tub+ ciliated cells (white) occur in a

normal distribution in a pseudostratified epithelium following Yap normalization. Scale bar = 20

μm in D and E.

Figure S5. Yap Overexpression in Secretory Cells Causes Them to Adopt a Basal-like Identity.

Related to Figure 5.

(A) FACS analysis of control CC10-Yap animals treated with corn oil and PBS (left panel) and

experimental CC10-Yap animals treated with tamoxifen followed by doxycycline (right panel).

No GFP+ cells are detected in the corn oil and PBS treated CC10-Yap animals (left panel),

whereas 3.94% of total epithelial cells are GFP+ in experimental animals. X axis represents GFP

expression and Y axis represents PE, which is used to gate out cells exhibiting autofluoresence.

(B) Staining for ectopic Yap using unamplified Yap staining (red) in CC10-YapTg animals

demonstrates that some Yap-overexpressing secretory cells altered their morphology to resemble

pyramidal basal stem cells (arrows). Scale bar = 10 μm in B.

Figure S6. Yap and p63 Interact and Share Common Target Genes. Related to Figure 6.

(A) Quantitative-PCR analysis shows that ΔNp63α is the major p63 transcript in cultured basal

stem cells. (B) Expression of ΔNp63 protein (red) occurs exclusively in T1α+ (green) basal stem

cells. (C) Yap interacts with ΔNp63α in HEK cells. (D) p63 binds to the promoters of its target

genes in basal stem cells. (E) Immunohistochemical analysis reveals that p63 expression (red) is

decreased at day 6 and is totally abolished at day 10 after p63 knockdown in basal cell cultures.

Immunostaining reveals no significant difference in CK5 (green) between control and p63

knockdown at day 6. However, CK5 protein expression is no longer detectable 10 days after p63

knockdown. (F) Decrease in the mRNA expression of p63 target genes following p63

knockdown in basal stem cells cultured for 6 days. (G) No significant decrease in the mRNA

expression of p63 target genes is detected following TAp63 knockdown. (H) Decreases in mRNA

expression of p63 target genes are observed following ΔNp63 knockdown. Data are represented

as mean +/- SEM. ns represents not significant. Scale bar represents 10 μm in B and E.

Figure S7. p63 and Yap Genetically Interact. Related to Figure 7.

(A) There is a loss of basal stem cells marked by T1α (red) in CK5-p63KO tracheal epithelium

after 3 weeks of doxycycline administration. Transgenic animals bearing only CK5 rtTA and tetO

Cre alleles are used as controls. (B) Quantitative-PCR analysis confirms the lack of TAp63 in

TAp63 knockout mice. No discernible change in the expression of ΔNp63 was observed with

TAp63 deletion. (C) Immunostaining for ΔNp63 and CK5 reveals that basal stem cell

maintenance is not affected by the absence of TAp63. (D) Quantification of cells positive for

ΔNp63 and CK5 reveals that the total number of basal stem cells remains unchanged in the

absence of TAp63, suggesting that TAp63 is dispensable for homeostatic basal stem cell

maintenance in the airway. (E) Immunostaining for p63 (red) confirms that p63 is efficiently

knocked down by lentiviral short hairpin RNAs 10 days after viral infection. A representative

picture showing the lack of CK5+ (green) cells (upper right panel) confirms the loss of basal

stem cells after p63 knockdown. The increase in CK8-expressing cells (red) at day 10 is evidence

for basal stem cell differentiation into suprabasal progenitors following p63 knockdown (bottom

panel). (F) H & E staining of tracheal sections reveals that the epithelial stratification caused by

Yap overexpression is suppressed by removing one copy of p63. Data are presented as mean+/-

SEM in B and D. DAPI is in blue. Scale bar represents 20 μm in A and E, and 10 μm in C and F.

EXTENDED EXPERIMENTAL PROCEDURES

Mouse Tracheal Epithelial Cell Dissociation and Sorting of Different Fractions of

Epithelial Cells

Minced mouse tracheal fragments were incubated in a dissociation solution containing Papain

(20U/mL), EDTA (1.1 mM), 2-Mercaptoethanol (0.067 mM), Cysteine-HCl (5.5 mM) and

DNAse I (100 U/mL) for 1 hour and 30 minutes. The reaction was stopped with Ovomucoid

protease inhibitor (Worthington biochemical Corporation, Cat LK003182) on a rocker at 4ºC for

20 minutes. Cells were centrifuged and resuspended in FACS buffer (2.0% FBS in PBS). Cells

were then stained with EpCAM-PECy7 (1:100; 25-5791-80, eBiosciences), GSIβ4-FITC (1:100;

L2895, Sigma), SSEA1-Alexa Fluor® 647 (1:50; 125608, BioLegend), and CD24-PE (1:75;

553262, BD Pharmingen) for 30 minutes on ice. Cell-specific surface markers for individual cell

populations were identified by screening 40 cell surface markers. Cell specificity was confirmed

by immunostaining of sorted cell populations after cytospin. After selecting the most specific and

reliable markers, basal cells were sorted as EpCAM+ GSIβ4+ cells. Ciliated cells were sorted as

EpCAM+ CD24+ cells. Secretory cells were sorted as EpCAM+ SSEA1+ cells. The purity of the

sorted basal (96.71%), secretory (95.74%), and ciliated cell (96.87%) populations was

established using p63, CC10 (Scgb1A1)/Scgb3A2, and FoxJ1 immunostaining respectively.

Immunofluorescence and Microscopy

Tracheas were dissected and fixed in 4% PFA for 2 hours at 4°C followed by three washes in

PBS. For frozen section preparations, tracheal samples were then placed in 30% sucrose

overnight at 4˚C and embedded in OCT. For paraffin sections, fixed tracheal samples were

dehydrated and embedded in paraffin. Frozen sections or deparaffinized sections (6 μm) were

permeabilized with 0.1% Triton X-100 in PBS, blocked in 1% BSA for 30 minutes at room

temperature, incubated with primary antibodies for 2 hours at room temperature or 4ºC

overnight. The sections were then incubated with secondary antibodies diluted in blocking buffer

for 45 min at room temperature and counterstained with 4', 6-diamidino-2-phenylindole (DAPI,

1μg/mL). Cells stained as whole mounts on a tissue culture dish were fixed with 4% PFA,

washed with PBS, and stained as described above.

The primary antibodies used were: anti-Acetylated tubulin (1:500; T6793, Sigma); rabbit

anti-CK5 (1:1000; ab53121, Abcam); mouse anti-CK5 (1:250; M7237, DAKO); anti-CK8 (1:50;

TROMA 1, Developmental Studies Hybridoma Bank); anti-Caspase3 (1:100; 9661, Cell

Signaling); anti-ΔNp63 (1:50; 619001, BioLegend); rabbit anti-ΔNp63 (1:100, kindly provided

by Satrajit Sinha); anti-FoxJ1 (1:100; 14-9965, eBioscience); chicken anti-GFP (1:500; GFP-

1020, Aves Labs); rabbit anti-GFP (1:100; A11122, Invitrogen); mouse anti-Ki-67 (1:500;

550609, BD Pharmingen); rabbit anti-Ki-67 (1:200; ab15580, Abcam); anti-NGFR (1:100;

ab8875, Abcam); goat anti-CC10 (also named Scgb1A1) (1:5000; kindly provided by Barry

Stripp); rabbit anti-Scgb3A2 (1:3000; kindly provided by Shioko Kimura); anti-SSEA1 (1:100;

125602, BioLegend); anti-T1α (1:50; 8.1.1, Developmental Studies Hybridoma Bank); mouse

anti-p63 (1:100; sc-56188, Santa Cruz); rabbit anti-p63 (1:100; SC8343, Santa Cruz), mouse

anti-Yap (1:100; 101199, Santa Cruz); mouse anti-Yap (1:100; H00010413-M01, Abnova), and

rabbit anti-Yap (1:100; kindly provided by Joseph Avruch). All secondary antibodies were Alexa

Fluor® conjugates (488, 594 and 647) and were used at 1:500 dilutions (Life Technologies).

DeadEnd™ Fluorometric TUNEL System (Promega, G3250) was used to detect apoptosis.

Images were obtained using an Olympus IX81 Inverted microscope (Olympus, Center

Valley, PA). Confocal images were obtained using a Nikon A1R-A1 Confocal Microscope

System (Nikon Instruments Inc., NY).

Yap TSA Amplification

Immunohistochemical staining for Yap protein was performed using a TSA Biotin Tyramide

Amplification system (SAT700001EA, Perkin Elmer). Samples were PFA fixed and prepared as

above. Antigen retrieval was performed in citrate buffer (10mM Citric Acid, 0.1% Tween 20, pH

6.0) using a high pressure controlled retrieval machine. Samples were then treated for 15 minutes

with peroxidase blocking solution (S2003, Dako), and then incubated with primary Yap

antibodies diluted in a blocking buffer containing PBS with 0.1% Triton X-100 (PBST) and 1%

BSA at 4ºC overnight. Following primary antibody staining, samples were washed thoroughly

with PBST and then incubated with anti-primary HRP conjugated secondary antibodies diluted at

1:100 in blocking buffer for 3 hours at room temperature. Following secondary antibody

staining, samples were washed with PBST. Active biotinylated tyramide solution (biotinylated

tyramide reagent dissolved in DMSO) was added. The tyramide deposition reaction was halted

using three PBS washes. Samples were then treated with a 1:250 dilution of streptavidin

conjugated to Alexa Fluor® 594 (Invitrogen) in PBST for 30 minutes at room temperature.

Immunoflourescent stains of additional proteins could then be achieved by sequential application

of the standard immunofluorescence protocol. The following Yap antibodies were used for TSA

amplification: mouse anti-Yap (101199, Santa Cruz); mouse anti-Yap (H00010413-M01,

Abnova), and rabbit anti-Yap (kindly provided by Joseph Avruch).

Mouse Tracheal Epithelial Cell Culture

Sorted basal and secretory cells were plated on transwells with polyester membranes (3470,

Corning) in MTEC medium (You et al., 2002). Rho kinase inhibitor was added for the initial two

days following plating.

Plasmid and Lentiviral Infection

The pLKO.1 backbone vector, with either a GFP reporter or a Puromycin selection cassette, was

used for lentivirally mediated gene knockdown. The sequences of the short hairpins for the

scrambled control and Yap were described previously (Zhang et al., 2011). For p63 knockdown,

the following short hairpins were used: shp63-1 tgatcgatgccgtgcgcttta and shp63-2

gaatgaacagacgtccaattt. For TAp63 knockdown, the following short hairpins were used: shTAp63-

1 tatccgcatgcaagactcaga and shTAp63-2 tgtatccgcatgcaagactca. For ΔNp63 knockdown, the

following short hairpins were used: shΔNp63-1 aacaatgcccagactcaattt and shΔNp63-2

aatgcccagactcaatttagt. Cells infected with shRNA virus were selected with 1 µg/mL puromycin

(Sigma) for 5 days before they were subjected to further analysis.

Quantitative PCR analysis

Total RNA was isolated using Trizol (Invitrogen) and cDNA was produced using the Superscript

III kit (Invitrogen). Quantitative Real Time PCR (qPCR) was done following the instructions in

the Brilliant II SYBR® Green QPCR Master Mix kit (600828, Agilent Technologies), and the

samples were analyzed on a StepOnePlus™ Real-Time PCR System (Applied Biosystems).

Sequence information for qPCR primers is provided below:

Gene name Primer sequence

β-actin Forward: TGGAATCCTGTGGCATCCATGAAAC

Reverse: TAAAACGCAGCTCAGTAACAGTCCG

Scgb1A1 Forward: GATCGCCATCACAATCACTG

Reverse: CTCTTGTGGGAGGGTATCCA

ΔNp63 Forward: GGAAAACAATGCCCAGACTC

Reverse: GATGGAGAGAGGGCATCAAA

EGFR Forward: GAACATCACC TGTACAGGCA

Reverse: GGCATCTGCATACTTCCAGA

FGFR Forward: CCTCGATGTCGTTGAACGGTC

Reverse: CAGCATCCATCTCCGTCACA

FoxJ1 Forward: GAGCTGGAACCACTCAAAGG

Reverse: GGTAGCAGGGCAGTTGATGT

GAPDH Forward: AACTTTGGCATTGTGGAAGG

Reverse: ACACATTGGGGGTAGGAACA

Itgα6 Forward: GCTGTTCTTG CCGGGATTCT

Reverse: AGTATGGATCTCAGCCTTGT

Itgβ4 Forward: ACGATTGCCC CTTTAAAGTC

Reverse: GCAACAGGAGGAAGATGAGC

p63α Forward: GCTGCTCATCATGCCTGGA

Reverse: CAGACTTGCCAAATCATCCA

p63β Forward: GCATGGGAGCCAACATTCCTA

Reverse: TGCCAAATCCTGACAATGCTG

p63γ Forward: CTGCTGTACCTACCAGTGAGA

Reverse: TGAAGCAGGCTGAAAGGAGA

TAp63 Forward: TTACAGATCTGCCATGTCGC

Reverse: CCCAGATATGCTGGAAGACC

Yap-1 Forward: TACATAAACCATAAGAACAAGACCACA

Reverse: GCTTCACTGGAGCACTCTGA

Yap-2 Forward: CATCT TCTGGTCAAA GATACTTC

Reverse: CAGAATTCATCAGCGTCTG

Sulfur Dioxide Injury

The standardization of the sulfur dioxide injury model has been previously described (Kim et al.,

2012; Rock et al., 2011). The exposure time was modified to 3 hours and 40 minutes of 500ppm

SO2 in the strains we used so that the suprabasal epithelium was completely eliminated without

damaging the basal cell layer.

Transfection

For transient transfections, 293T cells were transfected with pLPC-ΔNp63α-Flag and pQCXIH-

Yap-Myc (Zhao et al., 2007) (#33091, Addgene) using Fugene 6 (E2691, Promega) according to

manufacturer’s instructions. Forty-eight hours post transfection, cells were harvested and nuclear

extracts were prepared for co-immunoprecipitations.

Human Basal Cell Culture

This study was approved by the Partners Human Research Committee (IRB Protocol No.

2010P001354/MGH). Primary human airway epithelial cells were isolated from the discarded

trachea and bronchi of donor lungs using the papain dissociation method described above and

cultured in LHC-9 medium (12680-013, Life Technologies). These cultured cells were stained at

each passage. All of the cells expressed the pan epithelial marker EpCAM. Over 96% of the cells

were positive for the basal stem cell markers p63 and CK5.

Co-Immunoprecipitation

Nuclear extracts were prepared by suspending human basal cells in buffer A (10mmol/L Tris-

HCl pH 7.5, 1.5 mmol/L MgCl2, 10 mmol/L KCl) for 20 minutes, followed by douncing.

Pelleted nuclei were first suspended in 1 volume of 20 mM KCl nuclear buffer (20 mM Tris-HCl

pH 7.5, 1.5 mM MgCl2, 0.2 mM EDTA, 25% glycerol). One volume of 1.2 mol/L KCl nuclear

buffer was then added dropwise followed by incubation for 30 minutes at 4°C with rotation.

Nuclear extracts were pre-cleared with equilibrated protein G beads. Cleared nuclear lysates

were incubated with antibody and protein G beads for 4 hours at 4°C, and were then washed with

wash buffer (50 mM Tris-HCl pH 7.5, 5 mM MgCl2, 0.2 mM EDTA, 0.1% NP-40, 10%

glycerol) containing different concentrations of KCl (100 mM, 250 mM, 250 mM, and 100 mM).

The following antibodies were used: anti-c-Myc (9E10, DSHB), anti-Flag (M2 clone, Sigma),

mouse anti-YAP (H00010413-M01, Abnova), rabbit anti-Yap (NB110-58358, Novus), mouse

anti-p63 (4A4, Santa Cruz Biotechnology), rabbit anti-p63 (H129, Santa Cruz Biotechnology),

rabbit anti-TAp63 (618902, Biolegend) and beta-tubulin (D-10, Santa Cruz).

Chromatin Immunoprecipitation

Human basal cells were subjected to additional cross-linking with 2 mM EGS (Ethylene Gycol-

bis (Succinimidylsuccinate)) in PBS for 30 minutes at room temperature followed by washing in

PBS and cross-linking with 1% (v/v) formaldehyde at room temperature for 15 minutes. Cross-

linking was stopped by adding 125 mM glycine. Cells were then lysed in RIPA buffer (10 mM

Tris-HCl pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% (w/v) sodium deoxycholate, 0.1% (w/v)

SDS, 1% (v/v) NP40, proteinase inhibitor cocktail and phosphatase inhibitor cocktail) for 2hr at

40C. Nuclear lysates were sonicated for 5 min 8-10 times in a bioruptor (Diagenode). Sonicated

chromatin was precleared with Protein G sepharose beads (GE healthcare) pre-blocked with BSA

and sonicated salmon sperm DNA (15632-011, Invitrogen). Samples were incubated with 2 μg

antibody overnight at 40C and with beads for an additional 2 hrs. Rabbit anti-Yap (NB110-

58358, Novus) and rabbit anti-p63 (H129, Santa Cruz Biotechnology) were used. Beads were

washed in wash buffer 1 (150 mM NaCl, 20 mM Tris pH 8.1, 2 mM EDTA, 0.1% (w/v) SDS,

1% (v/v) Triton-X-100), wash buffer 2 (500 mM NaCl, 20 mM Tris pH 8.1, 2 mM EDTA,

0.02% (w/v) SDS, 1% (v/v) Triton-X-100), wash buffer 3 (250 mM LiCl ,10 mM Tris pH 8.1, 1

mM EDTA, 1%(w/v) sodium deoxycholate, 1% (v/v) NP40), and 10 mM Tris pH 7.9, 1 mM

EDTA. After the wash, beads were incubated for 3 hours at 550C, then overnight at 650C in 10

mM Tris pH 7.9, 1 mM EDTA, 0.5% (w/v) SDS, 10μg RNase A, and 10 μg Proteinase K. DNA

was purified via QIAquick PCR purification kit (28106, Qiagen) as per manufacturer’s

instructions. PCR was performed using IQ SYBR Green Supermix reagent (Bio-Rad) in a

MX300P machine (Stratagene). Percentage of input from the IPs was calculated by using 10% as

a standard. ChIP primers for FGFR2, EGFR were previously described (McDade et al., 2012).

ChIP-PCR primers are listed below:

ACTB Forward: CCAGGAATTCCGACTTTCAA

Reverse: CAGGACTGGTGAAGTGCTCA

CK5 Forward: AGCCTTGGCCCCCATCCCTTAGATT

Reverse: GGTGTGCCATGAGCAAAACACCTTTCA

ΔNp63 Forward: GCTTGACTACCGTGGAGAGC

Reverse: TTTTCCCAAACTCCAACCTG

EGFR Forward: GGTTAGGGCAGCTCCTCTTT

Reverse: TGGAATTAAGCCTCTCTGCAA

FGFR2 Forward: AAATGAGCGCGCAAGTTAGA

Reverse: CGAACTGGACCGACTTTTTC

Itgα6 Forward: TTATAGGTCCACAAGCGGTGAATGC

Reverse: TCCCCATGACTAAAGCAAGTCCACACC

Itgβ4 Forward: GAGCCGCAGCCCTTTCCG

Reverse: ACGAGGCGGGCAGCGCTTTAT

SUPPLEMENTAL REFERENCES

Kim, J.K., Vinarsky, V., Wain, J., Zhao, R., Jung, K., Choi, J., Lam, A., Pardo-Saganta, A.,

Breton, S., Rajagopal, J., et al. (2012). In vivo imaging of tracheal epithelial cells in mice during

airway regeneration. Am J Respir Cell Mol Biol 47, 864-868.

You, Y., Richer, E.J., Huang, T., and Brody, S.L. (2002). Growth and differentiation of mouse

tracheal epithelial cells: selection of a proliferative population. Am J Physiol Lung Cell Mol

Physiol 283, L1315-1321.

Yap Tunes Airway Epithelial Size and Architecture by Regulating the Identity, Maintenance, and Self-Renewal of Stem Cells

Documents