Identifizierung neuer nicht-kodierender RNAs in Xanthomonas campestris pv. vesicatoria und funktionelle Charakterisierung der regulatorischen RNA sX13 Dissertation zur Erlangung des Doktorgrades der Naturwissenschaften (Dr. rer. nat.) der Naturwissenschaftlichen Fakultät I – Biowissenschaften – der Martin-Luther-Universität Halle-Wittenberg, vorgelegt von Herrn Cornelius Schmidtke geb. am 15.05.1982 in Jena Gutachter: Prof. Dr. U. Bonas Prof. Dr. G. Sawers Prof. Dr. W. Hess Verteidigung: 29.04.2014
161
Embed
Xanthomonas campestris pv. vesicatoria und funktionelle ...€¦ · II Zusammenfassung Das Gram-negative pflanzenpathogene γ-Proteobakterium Xanthomonas campestris pv. vesicatoria
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Identifizierung neuer nicht-kodierender RNAs inXanthomonas campestris pv. vesicatoria und funktionelle
Charakterisierung der regulatorischen RNA sX13
Dissertation
zur Erlangung des Doktorgrades der Naturwissenschaften (Dr. rer. nat.)
der
Naturwissenschaftlichen Fakultät I – Biowissenschaften –
der Martin-Luther-UniversitätHalle-Wittenberg,
vorgelegt
von Herrn Cornelius Schmidtke
geb. am 15.05.1982 in Jena
Gutachter:Prof. Dr. U. BonasProf. Dr. G. SawersProf. Dr. W. Hess
Verteidigung: 29.04.2014
I
Teile dieser Arbeit wurden in Fachzeitschriften publiziert:
Schmidtke, C., Findeiß, S., Sharma, C.M., Kuhfuss, J., Hoffmann, S., Vogel, J., Stadler, P.F. and
Bonas, U. (2012) Genome-wide transcriptome analysis of the plant pathogen Xanthomonas identifies
sRNAs with putative virulence functions. Nucleic Acids Res., 40, 2020-2031.
Findeiß, S., Schmidtke, C., Stadler, P.F. and Bonas, U. (2010) A novel family of plasmid-
Schmidtke, C., Abendroth, U., Brock, J., Serrania, J., Becker, A. and Bonas, U. (2013) Small
RNA sX13: a multifaceted regulator of virulence in the plant pathogen Xanthomonas. PLoS Pathog.,
9, e1003626.
II
Zusammenfassung
Das Gram-negative pflanzenpathogene γ-Proteobakterium Xanthomonas campestris pv. vesicatoria ist
der Erreger der bakteriellen Fleckenkrankheit auf Paprika und Tomate. Die Kenntnis bakterieller
Faktoren, die zur Infektion von Wirtspflanzen beitragen, war zu Beginn dieser Arbeit auf Proteine
begrenzt, wohingegen die Rolle nicht-kodierender RNAs in der Virulenz von Xanthomonas Spezies
unbekannt war. Mittels eines cDNA-Sequenzieransatzes, welcher die Unterscheidung von
Primärtranskripten und prozessierten RNAs ermöglicht, wurden 1.421 potentielle
Transskriptionsstartpositionen sowie abundante nicht-kodierende RNAs in X. campestris pv.
vesicatoria Stamm 85-10 identifiziert. Insgesamt wurden 24 potentiell regulatorische RNAs
experimentell bestätigt, von denen drei (PtaRNA1, sX12 und sX13) näher untersucht wurden.
Bioinformatische Analysen deuten darauf hin, dass der ptaRNA1 (‚plasmid-transferred antisense RNA
1‘) Lokus durch horizontalen Gentransfer verbreitet wird und lassen vermuten, dass die PtaRNA1
antisense RNA die Synthese eines potentiell toxischen Proteins unterdrückt. Acht der in dieser Arbeit
identifizierten nicht-kodierenden RNAs, einschließlich sX12, sind mit dem Typ III Sekretionssystem,
einem essentiellen Pathogenitätsfaktor von X. campestris pv. vesicatoria, ko-reguliert. Durch
genetische Analysen konnte nachgewiesen werden, dass sX12 die Virulenz von X. campestris pv.
vesicatoria fördert. In dieser Arbeit wurde zudem die konstitutiv exprimierte und abundante sX13
RNA als neuartiger Virulenzfaktor von X. campestris pv. vesicatoria identifiziert. sX13 fördert die
Expression von Komponenten und Substraten des Typ III Sekretionssystems und trägt zum
bakteriellen Wachstum in Kultur bei. ‚Microarray‘ Analysen ergaben ein großes sX13 Regulon und
lassen vermuten, dass sX13 zur Adaption von X. campestris pv. vesicatoria an sich verändernde
Umweltbedingungen beiträgt. sX13 hemmt die Expression des RNA-Bindeproteins Hfq, welches in
zahlreichen Bakterien für die Aktivität regulatorischer RNAs essentiell ist und zur Virulenz
pathogener Bakterien beiträgt. Die Ergebnisse deuten darauf hin, dass sX13 Hfq-unabhängig agiert
und dass hfq für die Virulenz von X. campestris pv. vesicatoria entbehrlich ist. Strukturanalysen von
sX13 sowie Deletions- und Komplementationsexperimente ergaben, dass sX13 drei ‚Stem-Loop‘
Strukturen mit ‚C‘-reichen Loops aufweist, welche in unterschiedlichem Maße zur Virulenz von X.
campestris pv. vesicatoria beitragen. Mittels eines GFP-Reportersystems wurde nachgewiesen, dass
‚C‘-reiche sX13 Loops und ‚G‘-reiche Motive in potentiellen Ziel-mRNAs für die sX13-abhängige
Repression der Proteinsynthese essentiell sind.
III
Summary
The Gram-negative plant-pathogenic γ-proteobacterium Xanthomonas campestris pv. vesicatoria is
the causal agent of bacterial spot disease on pepper and tomato. At the beginning of this study, the
knowledge of bacterial factors, which contribute to the infection of host plants, was limited to proteins,
whereas the role of noncoding RNAs in the virulence of Xanthomonas species was unknown. Using a
cDNA-sequencing approach, which allows distinguishing unprocessed and processed RNAs, 1,421
putative transcription start sites and abundant noncoding RNAs were identified in X. campestris pv.
vesicatoria strain 85-10. In total, 24 putative regulatory RNAs were experimentally verified, three of
which (PtaRNA1, sX12 and sX13) were analyzed in more detail. Bioinformatic analyses suggest that
the ptaRNA1 (‘plasmid-transferred antisense RNA 1’) locus is transferred via horizontal gene transfer
and further indicate that the PtaRNA1 antisense RNA represses the synthesis of a presumably toxic
protein. Eight of the identified noncoding RNAs, including sX12, are co-regulated with the type III
secretion system, which constitutes an essential pathogenicity factor of X. campestris pv. vesicatoria.
Genetic analyses showed that sX12 contributes to virulence of X. campestris pv. vesicatoria.
Furthermore, this work revealed that the constitutively expressed and abundant sX13 RNA represents
a novel virulence factor of X. campestris pv. vesicatoria. sX13 promotes the expression of components
and substrates of the type III secretion system and contributes to bacterial growth in culture.
Microarray analyses revealed a large sX13 regulon and suggest that sX13 contributes to environmental
adaptation of X. campestris pv. vesicatoria. sX13 inhibits the expression of the RNA-binding protein
Hfq, which is essential for the activity of regulatory RNAs in many bacteria and contributes to
virulence of pathogenic bacteria. The data suggest that sX13 acts Hfq-independently. Furthermore, hfq
is presumably not involved in virulence of X. campestris pv. vesicatoria. Structure analyses of sX13
and deletion and complementation experiments revealed that sX13 consists of three stem-loops with
‘C’-rich loops, which differentially contribute to virulence of X. campestris pv. vesicatoria. Using a
GFP-reporter system, both the ‘C’-rich sX13 loops and ‘G’-rich motifs in presumed target mRNAs
were shown to be essential for the sX13-dependent repression of protein synthesis.
IV
Danksagung
Mein besonderer Dank gebührt allen, die an mich geglaubt haben, allen voran Frau Prof. Dr. Ulla
Bonas für die Bereitstellung dieses hochinteressanten und anspruchsvollen Forschungsthemas, die
fruchtbaren Diskussionen und ihr stetiges Vertrauen in meine Fähigkeiten.
Zudem danke ich allen Kooperationspartnern, insbesondere Sven Findeiß, Juliane Brock und Ulrike
Abendroth, die maßgeblich zum Erfolg dieser Arbeit beigetragen haben.
Für die schöne Zeit, den regen Gedankenaustausch und die freundliche Arbeitsatmosphäre bedanke ich
mich bei den Mitgliedern des Labors 215, Evelyn Löschner, Ulrike Abendroth, Juliane Brock,
Christine Wagner und Johannes Stuttmann, sowie bei allen Mitgliedern der Arbeitsgruppe Bonas.
Carola Kretschmer, Hannelore Espenhahn und Marina Schulze danke ich für die hervorragende
technische Assistenz und Bianca Rosinsky für ihren grünen Daumen.
Ein herzlicher Dank gilt Heike Berndt, Daniela Büttner, Steve Schulz, Sebastian Schulze, Tom
Schreiber und Oliver Müller für die pausenfüllenden Diskussionen und Hilfe in allen Lebenslagen.
Simone Hahn und Robert Szczesny danke ich für wahre Freundschaft.
Mein aufrichtiger Dank gilt meiner Familie für ihre bedingungslose Unterstützung und meiner Frau
Katja, ohne deren Liebe, Geduld und Zuspruch diese Arbeit vermutlich nicht möglich gewesen wäre.
Danke!
V
Inhaltsverzeichnis
Zusammenfassung ................................................................................................................................ II
Summary .............................................................................................................................................. III
Danksagung .......................................................................................................................................... IV
Inhaltsverzeichnis ................................................................................................................................. V
Abbildungsverzeichnis ...................................................................................................................... VII
Abkürzungsverzeichnis .................................................................................................................... VIII
Adenosylhomocystein (SAH) oder Adenosylcobalamin (Ado-Cbl)(5,79). Andere Riboswitches binden
Aminosäuren wie Glycin oder Lysin bzw. Nucleobasen wie Adenin oder Guanin (5,79). Zudem
wurden Riboswitches identifiziert, die den sekundären Botenstoff zyklisches di-
Guanosinmonophosphat (zyklisches di-GMP) bzw. Mg2+ binden (79).
Die Bindung eines Liganden an die evolutionär konservierte Aptamerregion (35-200 Nt) eines
Riboswitches induziert eine strukturelle Veränderung in der sogenannten Expressionsplattform. Dies
beeinflusst entweder die weitere Transkription der mRNA durch Ausbildung oder Auflösung einer
transkriptionellen Terminatorstruktur im 5‘-UTR oder die Zugänglichkeit der Ribosomenbindestelle
(RBS) für die Ausbildung des Translations-Initiationskomplexes (Abb. 1A)(193). In Bakterien beginnt
die Translation mit der Bindung eines Komplexes aus 30S Ribosomenuntereinheiten, der Initiator
transfer RNA (N-formyl-methionyl tRNA, fMET-tRNAfMet) und Initiationsfaktoren an die Shine-
Dalgarno (SD) Sequenz der mRNA (70,111). Die SD-Sequenz (Konsensus in E. coli ‚GGAGG‘) ist
Teil der RBS und lokalisiert wenige Nukleotide stromaufwärts des Translationsstartcodons
(TLS)(200). Durch komplementäre Basenpaarung mit dem 3‘-Ende der 16S rRNA, der sogenannten
Anti-SD Sequenz (‚CCUCC‘), rekrutiert die SD-Sequenz 30S Ribosomenuntereinheiten an die mRNA
(86,90,175,208). Nach Ausbildung des Initiationskomplexes binden 50S Ribosomenuntereinheiten,
wodurch translationsaktive 70S Ribosomenkomplexe ausgebildet werden.
RNA-Thermometer sind regulatorische Elemente, die in 5‘-UTRs von temperaturresponsiven Genen
lokalisiert sind und temperaturabhängig ihre Faltung verändern (107). Niedrige Temperaturen
bedingen meist eine Konformation, welche die Bindung von 30S-Ribosomenuntereinheiten an die
4 Einleitung
RBS der mRNA verhindert. Dagegen vermitteln höhere Temperaturen das Aufschmelzen
inhibitorischer Sekundärstrukturen (107). Sogenannte ‚ROSE‘-Elemente kontrollieren die Synthese
von Hitzeschockproteinen (149), während ‚FourU‘-Elemente u.a. die Expression von Virulenzgenen
regulieren (238). Die temperaturabhängige Expression von Virulenzgenen, z.B. prfA in L.
monocytogenes und lcrF in Yersinia pseudotuberculosis, ermöglicht pathogenen Bakterien die
Erkennung und Infektion warmblütiger Wirtsorganismen (12,93).
Abbildung 1. Modelle der Funktionsweise von Riboswitches und proteinbindenden RNAs. (A) Riboswitches sind in 5‘-UTRs von mRNAs (blau) lokalisiert und umfassen eine Liganden-bindende Aptamerregion sowie eine Expressionsplattform. (Linke Seite) Die Bindung des Liganden fördert oder hemmt die Ausbildung einer transkriptionellen Terminatorstruktur (UUU) im 5‘-UTR. (Rechte Seite) Die Ligandenbindung fördert die Ausbildung oder Auflösung einer Sekundärstruktur, welche die Ribosomenbindestelle (RBS) blockiert und die Translation des offenen Leserasters (ORF) hemmt. (B) Modulation der Proteinaktivität durch ncRNAs. (Linke Seite) Die Aktivität des CsrA Proteins, welches die Translation von Ziel-mRNAs beeinflusst, wird durch Bindung der ncRNA CsrB bzw. CsrC gehemmt. (Rechte Seite) Die δ70-assoziierte RNA Polymerase ermöglicht die Transkription durch Bindung an Promotorregionen. Die DNA-Assoziation der RNA Polymerase wird durch Bindung der 6S RNA gehemmt und führt zur verminderten Aktivität von δ70-Promotoren. (Abb. modifiziert nach Waters und Storz, 2009 (245)).
1.3.2. RNA-vermittelte Modulation der Proteinaktivität
Regulatorische RNAs können essentielle Funktionen von Ribonukleoproteinkomplexen vermitteln
(z.B. rRNA und ‚transfer-messenger RNA‘, tmRNA) oder die Aktivität gebundener Proteine
modulieren (z.B. 6S RNA und CsrB/ CsrC)(Abb. 1B). Das namensgebende Charakteristikum der
tmRNA ist eine tRNA- sowie eine mRNA-ähnliche Region, welche ein kurzes offenes Leseraster
(‚open reading frame‘, ORF) enthält (142). Bei Unterbrechung des Translationsprozesses bindet
tmRNA an Ribosomen und terminiert die Translation. Hierbei vermittelt das tmRNA-kodierte
Polypeptid den Abbau der unvollständig translatierten Polypeptidkette, während das Stoppcodon des
tmRNA-ORFs die Ablösung des Ribosoms von der mRNA ermöglicht (142).
Die hochkonservierte 6S RNA (180-200 Nt) weist eine Struktur auf, die der Konformation der DNA
während der Transkription ähnelt (Abb. 1B)(222). In E. coli akkumuliert die 6S RNA in der
stationären Wachstumsphase und bindet die mit dem Sigmafaktor δ70 assoziierte RNA-Polymerase
Einleitung 5
(244). Infolgedessen werden Gene mit δ70 Promotoren vermindert transkribiert (221). 6S RNA kann
auch als Matrize der RNA-Polymerase dienen und generiert 14-20-Nt ‚product RNAs‘ (pRNAs). Die
pRNA Transkription wird vermutlich durch einen Anstieg der Nukleosidtriphosphat-Konzentration
induziert und vermittelt die Ablösung der 6S RNA von der RNA-Polymerase (242).
Die zentrale Rolle von ncRNAs in der Regulation physiologischer Prozesse wird insbesondere anhand
des Csr- (‚carbon storage regulator‘) bzw. des verwandten Rsm (‚repressor of secondary metabolites‘)-
Systems deutlich (Abb. 1B). Das RNA-Bindeprotein CsrA reguliert in E. coli die Synthese und
Verwertung von Kohlenstoffquellen sowie die Motilität (177,248). CsrA inhibiert die Translation der
meisten Ziel-mRNAs oder beeinflusst deren Stabilität durch Bindung an multiple ‚GGA‘-
Sequenzmotive in den 5‘-UTRs (3,217). Die CsrA Aktivität wird durch die ncRNAs CsrB und CsrC
moduliert, welche multiple ‚GGA‘-Motive enthalten und mit mRNAs um die Bindung an CsrA
konkurrieren (Abb. 1 B)(3,120,250). Orthologe des E. coli Csr-Systems wurden beispielsweise in
Pseudomonas-, Legionella- und pflanzenpathogenen Erwinia- und Xanthomonas spp. identifiziert und
sind u.a. an der Regulation der Zelldichte-abhängigen Genexpression, der Motilität und der
Virulenzgenexpression beteiligt (34,110,264).
1.3.3. Cis-kodierte antisense RNAs
Cis-kodierte antisense RNAs (asRNAs) werden vom DNA-Gegenstrang proteinkodierender Gene
transkribiert und weisen daher perfekte Komplementarität, meist über mehr als 75 Nt, zur
korrespondierenden mRNA auf (Abb. 2A)(20). RNA-Seq Analysen ergaben, dass Bakterien eine
unerwartet hohe Zahl von asRNAs exprimieren (64), z.B. wurden in H. pylori asRNAs für 46% der
annotierten ORFs identifiziert (196). Die Transkriptlängen von asRNAs variieren und reichen von
etwa 100 Nt, wie SymR und GadY in E. coli (99,154), bis mehrere Kilobasen (Kb), z.B. asRNAs im
Cyanobakterium Prochlorococcus sp. Stamm MED4 (207). asRNA Gene können mit dem 5‘- oder 3‘-
UTR oder dem ORF der cis-lokalisierten Gene überlappen, wobei die Interaktion von asRNA und
mRNA in einer veränderten Translation der mRNA bzw. einer veränderten Stabilität der Transkripte
resultiert (Abb. 2A)(20,64). Die E. coli asRNAs SymR und GadY gehören zu den am besten
untersuchten asRNAs. SymR überlappt in antisense Orientierung mit der RBS und dem TLS der symE
mRNA und unterdrückt deren Translation (99). GadY vermittelt die Prozessierung der bicistronischen
gadXW mRNA zwischen gadX und gadW, wobei die prozessierten Transkripte eine höhere Stabilität
als die unprozessierte mRNA aufweisen (154,220). Die asRNA-induzierte mRNA Prozessierung wird
meist durch die Ribonuklease (RNase) E oder RNase III vermittelt (64). RNase III spaltet präferentiell
perfekt gepaarte RNA-RNA Komplexe, wohingegen RNase E bevorzugt imperfekt gepaarte
Komplexe degradiert. Neben der Modulation der Translation und mRNA Stabilität können asRNAs
auch die Transkription beeinflussen (Abb. 2A). Beispielsweise vermittelt im Fischpathogen Vibrio
anguillarum die asRNA RNAß die vorzeitige Termination der Transkription des fatDCBA-angRT
6 Einleitung
Operons stromabwärts von fatA (209). Die regulatorische Funktion einiger anderer asRNAs beruht
vermutlich allein auf deren Transkription, da divergent transkribierte Promotoren einander
beeinflussen können (transkriptionelle Interferenz)(64). Die Transkription eines DNA-Strangs durch
die RNA Polymerase verhindert hierbei die Initiation bzw. Elongation der Transkription auf dem
DNA-Gegenstrang (156).
Abbildung 2. Regulatorische Mechanismen basenpaarender RNAs. (A) cis-kodierte asRNAs. (Linke Seite) Die Interaktion einer asRNA mit der Ribosomenbindestelle (RBS) der Ziel-mRNA hemmt die Initiation der Translation und induziert meist den RNA-Abbau. (Mitte) asRNAs können die RNase-vermittelte Prozessierung polycistronischer mRNAs induzieren, wobei die prozessierten Transkripte eine veränderte Stabilität aufweisen. (Rechte Seite) Während der Transkription der polycistronischen mRNA kann die Bindung einer asRNA die vorzeitige Termination der Transkription vermitteln und die Expression stromabwärts lokalisierter Cistrons unterdrücken. (B) trans-kodierte sRNAs. sRNAs interagieren meist über kurze und imperfekt-komplementäre Sequenzen mit den 5‘-UTRs von Ziel-mRNAs und hemmen deren Translation (linke Seite), induzieren den RNase-vermittelten Abbau der mRNA (Mitte) oder fördern die Translation durch Auflösung inhibitorischer Sekundärstrukturen (rechte Seite). (Abb. modifiziert nach Waters und Storz, 2009 (245)).
Einleitung 7
1.3.4. Trans-kodierte RNAs
Die Mehrheit der charakterisierten ncRNAs wurde in den Enterobakterien E. coli und Salmonella
untersucht und geht Basenpaarungen mit mRNAs ein, welche im Genom abseits der ncRNA kodiert
sind (in trans). Diese Transkripte werden als trans-kodierte RNAs oder ‚small RNAs‘ (sRNAs)
bezeichnet, sind überwiegend nicht-kodierend und stark strukturiert und weisen Längen von meist 50-
300 Nt auf (210). Im Gegensatz zu cis-kodierten asRNAs interagieren sRNAs üblicherweise über
kurze und imperfekt komplementäre Sequenzen (~10-25 Nt) mit den 5‘-UTRs von multiplen mRNAs
(67,245). Dies erschwert die bioinformatische Vorhersage von Ziel-mRNAs (117). Da die meisten
sRNAs die Translation und/ oder die Stabilität von mRNAs modulieren, können potentielle Ziel-
mRNAs durch Proteom- und Transkriptomanalysen von sRNA-Deletionsmutanten oder
Überexpressionsstämmen identifiziert werden (198,236). Der Einfluss von sRNAs auf Ziel-mRNAs
wird häufig mittels translationaler mRNA-Reporterfusionen analysiert, z.B. Fusionen mit gfp (‚green
fluorescent protein‘)(224).
1.3.4.1. Mechanismen sRNA-vermittelter Regulation
Die meisten sRNAs wirken negativ auf Ziel-mRNAs und inhibieren die Initiation der Translation
durch Basenpaarung mit oder nahe der RBS der mRNA (Abb. 2B)(67). Zudem sind Beispiele bekannt,
in denen sRNAs die Translation von Ziel-mRNAs unterdrücken, indem sie an Sequenzen binden, die
bis zu 70 Nt stromaufwärts und 15 Nt stromabwärts des TLS lokalisiert sind (19,84). Parallel zur
Hemmung der Translation induzieren sRNA-mRNA Interaktionen häufig den RNase E-vermittelten
Abbau der beteiligten Transkripte (Abb. 2B)(31). Für die E. coli sRNAs RyhB und SgrS wurde
nachgewiesen, dass die Hemmung der Ziel-mRNA Translation unabhängig von der RNase E-
vermittelten Degradation erfolgt (145). Einige sRNAs fördern ausschließlich den Abbau von Ziel-
mRNAs, z.B. bindet die Salmonella sRNA MicC in der kodierenden Region der ompD mRNA und
beschleunigt deren Abbau durch RNase E (163). Neben RNase E wurde eine Rolle von RNase III in
der Degradation von sRNA-mRNA Komplexen beschrieben (31,87,230).
sRNAs können auch als Aktivatoren der Genexpression wirken und die Translation von Ziel-mRNAs
fördern (60). Hierbei induziert die Bindung einer sRNA an den 5‘-UTR der mRNA die Auflösung
einer inhibitorischen Sekundärstruktur, welche die RBS einschließt und die Initiation der Translation
verhindert (Abb. 2B). Beispielsweise sind drei E. coli sRNAs bekannt (ArcZ, DsrA und RprA),
welche die Synthese des Sigmafaktors RpoS aktivieren (125,126,203).
8 Einleitung
1.3.4.2. Das RNA-Chaperon Hfq
Hfq (‚host factor for the replication of the RNA phage Qß‘) wurde als E. coli Wirtsfaktor für die
Replikation des Bakteriophagen Qß identifiziert (59). Das RNA-Bindeprotein Hfq ist in etwa 50%
aller Bakterien konserviert und vermittelt, insbesondere in Enterobakterien, die Interaktion von sRNAs
und Ziel-mRNAs (44,235). Für Salmonella wurde beschrieben, dass Hfq mit rund 100 sRNAs und
etwa 20% der transkribierten mRNAs assoziiert ist (160,202). Hfq bildet eine homohexamere
Ringstruktur aus und bindet an ‚AU‘-reiche einzelsträngige Sequenzen in sRNAs und mRNAs (235).
Es wird vermutet, dass Hfq die lokale Konzentration von sRNAs und Ziel-mRNAs erhöht und dadurch
die Basenpaarung von kurzen und imperfekt-komplementären Sequenzen begünstigt (44). Dafür
spricht, dass sRNA-mRNA Interaktionen über längere und perfekt komplementäre Regionen, wie im
Fall cis-kodierter asRNAs, in der Regel Hfq-unabhängig sind. Hfq ist mit RNase E und weiteren
Proteinen des sogenannten RNA-Degradosoms assoziiert und vermittelt dadurch den Abbau von
sRNA-mRNA Komplexen (32,88,144). Interessanterweise nimmt die Stabilität von E. coli sRNAs in
Abwesenheit von Hfq ab, was vermuten lässt, dass Hfq-gebundene sRNAs vor Degradation geschützt
sind (235).
Die Inaktivierung des hfq Gens ist in verschiedenen Bakterien mit pleiotropen Phänotypen, wie
reduziertem Wachstum, veränderter Motilität sowie veränderter Toleranz gegenüber
Stressbedingungen verbunden (35). Zudem beeinträchtigt die Inaktivierung von hfq die Virulenz
zahlreicher humanpathogener Bakterien (35,160). Dagegen ist Hfq für die Virulenz von beispielsweise
L. pneumophila und S. aureus entbehrlich, wenngleich sRNAs in diesen Bakterien die
Virulenzgenexpression modulieren (13,133).
1.4. Gram-negative pflanzenpathogene Bakterien
Der Befall von Nutzpflanzen mit Schädlingen und Parasiten verursacht weltweit erhebliche
Ertragsverluste und stellt ein ernstzunehmendes Problem für die Nahrungsmittelproduktion dar. Gram-
negative pflanzenpathogene Bakterien sind vor allem in feucht-warmen aber auch in gemäßigten
Klimaregionen von Bedeutung (130). Von besonderem ökonomischen und wissenschaftlichen
Interesse sind Ralstonia solanacearum, der Erreger der bakteriellen Welke in mehr als 200
Pflanzenarten (63), Erwinia amylovora, der Erreger des Feuerbrands (228), das Tumor-induzierende
Bakterium Agrobacterium tumefaciens (167) sowie Pathovare (pv.) von Pseudomonas syringae,
welche Blattflecken, Brände oder Geschwüre auslösen (130). Ernteverluste durch Vertreter der
Gattung Xanthomonas sind insbesondere schwerwiegend, da Wirtspflanzen wie Reis und Maniok die
Nahrungsgrundlage von Millionen von Menschen darstellen (130). Im Folgenden werden
Pathogenitätsmechanismen von pflanzenpathogenen Bakterien der Gattung Xanthomonas näher
betrachtet.
Einleitung 9
1.4.1. Die Gattung Xanthomonas
Gram-negative γ-Proteobakterien der Gattung Xanthomonas sind stäbchenförmige, obligat aerobe
Bakterien mit einem polaren Flagellum und einer optimalen Wachstumstemperatur von 25-30°C
(212). Das namensgebende Charakteristikum (griech. xanthos, gelb; monas, einzeln) ist die gelbe
Färbung der Bakterien, welche durch das membrangebundene Pigment Xanthomonadin bedingt wird
und Toleranz gegenüber UV-Strahlung vermittelt (171). Ein weiteres Charakteristikum ist das
extrazelluläre Polysaccharid Xanthan, welches adhäsive Eigenschaften besitzt und u.a. als
Verdickungsmittel in der Kosmetik- und Lebensmittelindustrie Verwendung findet (8).
Pflanzenpathogene Xanthomonas spp. sind hemibiotrophe Pathogene, die lebendes Gewebe
kolonisieren und mehr als 120 monokotyledone und 260 dikotyledone Pflanzen infizieren (115).
Anhand ihres Wirtsspektrums werden Xanthomonas Arten in Pathovare unterteilt. Aufgrund von
Ernteverlusten von bis zu 100% gehören die Erreger der Weißblättrigkeit und bakteriellen
Streifenkrankheit von Reis, X. oryzae pv. oryzae (Xoo) bzw. X. oryzae pv. oryzicola (Xoc), sowie der
Erreger des Bakterienbrandes von Maniok, X. axonopodis pv. manihotis (Xam), zu den wirtschaftlich
bedeutsamsten Pflanzenschädlingen (130). Nicht minder relevant sind X. albilineans (Xal), der Erreger
der Blattstreifigkeit von Zuckerrohr, X. axonopodis pv. citri (Xac), der Verursacher des Zitruskrebs‘ in
verschiedenen Zitruspflanzen und X. campestris pv. campestris (Xcc), der Erreger der Adernschwärze
von Brassicaceen (130). Zu den etablierten Modellsystemen zur Untersuchung der Interaktion
pflanzenpathogener Bakterien mit Wirtspflanzen gehört neben Xac, Xcc und Xoo das in dieser Arbeit
untersuchte Pathogen X. campestris pv. vesicatoria (Xcv). Xcv wird auch als X. axonopodis pv.
vesicatoria und X. euvesicatoria bezeichnet (94,229) und verursacht die bakteriellen Fleckenkrankheit
(‚bacterial spot disease‘) auf Paprika (Capsicum spp.) und Tomate (Solanum spp.)(46,83).
Xanthomonas Bakterien werden durch Regen und Wind im Pflanzenbestand verbreitet und gelangen
über natürliche Öffnungen, wie Stomata und Hydathoden, oder Verwundungen in den pflanzlichen
Interzellularraum (212). Dort vermehren sich die Bakterien entweder lokal begrenzt, z.B. Xcv, Xac und
Xoc, oder verbreiten sich systemisch im Xylem, wie im Falle von Xcc und Xoo (24). Virulenzfaktoren
tragen zur Effizienz und Schwere der Infektion bei, d.h. sind nicht essentiell, wohingegen
Pathogenitätsfaktoren für die Vermehrung in planta unentbehrlich sind. Ein gut untersuchter
Virulenzfaktor von Xanthomonas spp. ist Xanthan, welches Bakterienzellen vor Umwelteinflüssen
schützt, die Ausbildung von Biofilmen auf der Blattoberfläche und in der Pflanze fördert und zudem
zur Ausprägung von Krankheitssymptomen beiträgt (24). Eine Rolle in der Anheftung an
Blattoberflächen wurde u.a. für das Adhäsin XadA1 von Xoo sowie für Typ IV Pili (Tfp) von X.
campestris pv. hyacinthi beschrieben (172,225). Tfp bestehen aus einem membranverankerten Multi-
Proteinkomplex und einem retraktilen Pilus, welcher eine kriechende bzw. gleitende Fortbewegung
der Bakterienzelle vermittelt (‚twitching/ gliding motility‘)(91). Studien an Xoc und Xoo lassen
vermuten, dass Tfp zur lokalen bzw. systemischen Ausbreitung der Bakterien im Wirtsgewebe
10 Einleitung
beitragen (42,240). Virulenzfunktionen wurden außerdem für extrazelluläre Enzyme aus Xcv, Xcc und
Xoo beschrieben, z.B. Zellulasen, Endoglucanasen und Xylanasen (24,213). Es wird vermutet, dass
solche und andere bakterielle Enzyme am Abbau der pflanzlichen Zellwand beteiligt sind (24).
Untersuchungen an Xcc ergaben, dass die Synthese von Virulenzfaktoren, wie Xanthan und
extrazellulären Enzymen, mit zunehmender Populationsdichte ansteigt, wohingegen eine geringe
Zelldichte die Ausbildung von Biofilmen begünstigt (47,214). Die Regulation der bakteriellen
Genexpression in Abhängigkeit von der Populationsdichte wird als ‚quorum sensing‘ (QS) bezeichnet
und beruht in Xcc auf einer diffussionsfähigen α,ß-ungesättigten Fettsäure (‚diffusible signal factor’;
DSF)(241). Das rpf (‚regulation of pathogenicity factors‘)-Genclusters kommt in allen Xanthomonas
spp. vor und kontrolliert in Xcc die Synthese (RpfF, RpfB) und Perzeption (RpfC, RpfG) von DSF
(48). Die extrazelluläre Akkumulation von DSF induziert vermutlich die RpfG-vermittelte Hydrolyse
des intrazellulären Botenmoleküls zyklisches di-GMP und fördert dadurch die Synthese extrazellulärer
Enzyme (48,78).
Die Pathogenität von Xanthomonas spp. sowie der meisten Gram-negativen pflanzen- und
tierpathogenen Bakterien beruht auf dem Typ III Sekretionssystem (T3S System), welches
Effektorproteine über beide bakterielle Membranen und die pflanzliche Zellwand bzw. Zellmembran
in die Wirtszelle transloziert (24,75). Eine Ausnahme innerhalb der Gattung Xanthomonas ist Xal, für
dessen Pathogenität das sekretierte Toxin Albicidin essentiell ist (11,165). Das T3S System
pflanzenpathogener Xanthomonas spp. wurde erstmals in Xcv identifiziert und wird im folgenden
Kapitel näher betrachtet (16).
1.4.2. Xanthomonas campestris pv. vesicatoria
Xcv wird vor allem durch Spritzwasser verbreitet, dringt über Stomata und Wunden in den
pflanzlichen Interzellularraum ein und vermehrt sich in anfälligen (suszeptiblen) Pflanzen lokal
begrenzt zu hohen Zelldichten (168,206). Die durch Xcv verursachte bakterielle Fleckenkrankheit tritt
insbesondere in subtropischen und tropischen Regionen auf und ist durch wässrige Läsionen an
Blättern und Früchten gekennzeichnet, welche später nekrotisch werden und hohe Ernteverluste
verursachen (Abb. 3A und 3B)(95).
Als einer der ersten Vertreter der Gattung wurde im Jahr 2005 die Genomsequenz des Xcv Stamms 85-
10 veröffentlicht (215). Das Genom besteht aus einem zirkulären Chromosom (~5,18 Mbp) und vier
Plasmiden (pXCV2, pXCV19, pXCV38 und pXCV183; 2-183 Kbp) und weist einen für die Gattung
charakteristischen G+C Gehalt von 64,75% für das Chromosom und 56 bis 73% für die Plasmide auf.
Insgesamt wurden 4.726 ORFs annotiert, welche 87,13% des Genoms ausmachen (215). Biologische
Funktionen wurden etwa 65% der ORFs zugewiesen. Die übrigen ORFs kodieren hypothetische
Proteine mit unbekannten Funktionen. Das Xcv Genom weist zwei rRNA Operons auf, welche jeweils
die 16S, 23S und 5S rRNA enthalten, sowie 56 Gene für tRNAs, von denen 54 im Chromosom
Einleitung 11
lokalisiert sind (215). Außer rRNAs und tRNAs waren zu Beginn dieser Arbeit keine ncRNAs in Xcv
und anderen Xanthomonas spp. bekannt.
Das Xcv Genom weist große Ähnlichkeit zu den Genomen von Xac, Xcc und Xoo auf, wobei 66,8%
der vorhergesagten Proteine dieser Stämme konserviert sind (40,112,170,215). Die Genome von
Xanthomonas spp. unterscheiden sich vor allem hinsichtlich des Plasmidgehalts sowie in DNA
Regionen, welche einen niedrigen G+C Gehalt aufweisen und meist von IS Elementen flankiert sind
(215). Solche Sequenzregionen wurden vermutlich durch horizontalen Gentransfer erworben und
kodieren häufig Typ III Effektorproteine (215). Zu den hochkonservierten Bereichen von
Xanthomonas Genomen gehören u.a. das rpf-Gencluster, welches vermutlich an der Synthese und
Produktion von DSF beteiligt ist, das gum-Gencluster, welches die Xanthanproduktion vermittelt,
sowie das hrp (‚hypersensitive response and pathogenicity‘)-Gencluster (215).
Das 23-Kbp hrp-Gencluster in Xcv kodiert das T3S System und ist essentiell für die bakterielle
Vermehrung und die Ausbildung von Krankheitssymptomen in suszeptiblen Pflanzen sowie für die
Induktion der hypersensitiven Reaktion (HR) in resistenten Pflanzen (16). Die HR ist eine schnelle
und lokal begrenzte Zelltodreaktion, welche die weitere Vermehrung des Pathogens verhindert
(68,96). Das Xcv hrp-Gencluster umfasst 25 Gene, die in acht Transkriptionseinheiten organisiert sind
(16,23,27,246). Die Expression des T3S Systems wird in der Pflanze oder im synthetischen XVM2
Medium durch die Schlüsselregulatoren HrpG und HrpX transkriptionell induziert (Abb.
3C)(189,252,253,255). HrpG gehört zur OmpR-Familie der ‚response regulators‘ und wird vermutlich
unter hrp-Gen-induzierenden Bedingungen posttranslationell aktiviert (254,255). Die verantwortlichen
pflanzlichen Signale und Xcv Signalproteine sind bislang unbekannt (254). Das aktive HrpG Protein
induziert die Transkription von hrpX, welches einen Transkriptionsaktivator der AraC-Familie kodiert
(252,254,255). Das HrpG-/ HrpX-Regulon, im Folgenden als hrp-Regulon bezeichnet, umfasst u.a.
das hrp-Gencluster, Effektorgene und vorhergesagte Virulenzgene (Abb. 3C)(150,191,215,216,252).
Die Transkription der meisten dieser Gene wird durch Bindung von HrpX an ein konserviertes
Grundlage für die funktionelle Charakterisierung des T3S Systems war die Identifizierung einer
konstitutiv aktiven HrpG Punktmutante (HrpG*), welche die konstitutive Expression des hrp-
Regulons unter nicht-induzierenden Bedingungen vermittelt, z.B. in NYG (‚nutrient-yeast-glycerol‘)
Komplexmedium (254). Allerdings erfordert die in vitro Sekretion von Effektorproteinen spezifische
Bedingungen (Minimalmedium A, pH 5.2)(180).
Der Basalapparat des T3S Systems durchspannt beide bakterielle Membranen und wird vermutlich
von Hrc (‚hrp-conserved‘)-Proteinen gebildet, welche in pflanzen- und tierpathogenen Bakterien
konserviert sind (22). Der extrazelluläre Hrp-Pilus dient als Transportkanal für bakterielle Proteine,
durchdringt die pflanzliche Zellwand und ist mit bakteriellen Translokonproteinen verbunden, die eine
Pore in der pflanzlichen Membran bilden (Abb. 3C)(25,26). Das Pilusprotein HrpE und das potentielle
Translokonprotein HrpF gehören zu den nicht-konservierten Hrp-Proteinen und werden über das T3S
12 Einleitung
System sekretiert (23,26,247). Darüber hinaus tragen sogenannte Hpa (‚hrp-associated‘)-Proteine zur
Typ III Sekretion bei (25). hpa-Gene fördern die Virulenz von Xcv, wohingegen hrc- und hrp-Gene
für die Pathogenität essentiell sind.
Die Hauptsubstrate des T3S Systems sind Effektorproteine, welche in Xanthomonas spp. als Xop
(‚Xanthomonas outer protein‘)- bzw. Avirulenz (Avr)-Proteine bezeichnet werden (24). In
suszeptiblen Pflanzen hemmen Effektoren die pflanzliche Basalabwehr und ermöglichen dadurch das
bakterielle Wachstum sowie die Ausbildung von Krankheitssymptomen (Abb. 3C)(24). Die
pflanzliche Basalabwehr wird durch die Erkennung konservierter Pathogen-assoziierte Moleküle, wie
Flagellin oder Elongationsfaktor Tu, induziert und umfasst lokale Zellwandverdickungen sowie die
Produktion reaktiver Sauerstoffspezies und antimikrobieller Substanzen (109,152). Bislang wurden 26
Effektoren in Xcv Stamm 85-10 identifiziert (190). Beispielsweise spaltet XopD SUMO (‚small
ubiquitin-relatet modifier‘)-Modifikationen von pflanzlichen Zielproteinen ab und trägt dadurch zur
Modulation der pflanzlichen Genexpression und zum bakteriellen Wachstum in Tomate bei
(29,85,103). XopS und XopB unterdrücken die Expression pflanzlicher Abwehrgene und hemmen den
Vesikeltransport (191). Zudem wurde nachgewiesen, dass XopS und XopB die Vermehrung von Xcv
in suszeptiblen Paprikapflanzen des Kultivars ECW (‚Early Californian Wonder‘) fördern (191).
Resistente Pflanzen sind in der Lage, Avr-Proteine durch spezifische Resistenzgene bzw.
Resistenzproteine zu erkennen (24). Beispielsweise induziert die Erkennung der Xcv 85-10 Effektoren
AvrBs1 und AvrBs2 in resistenten Paprikapflanzen des Kultivars ECW-10R bzw. ECW-20R eine HR
(Abb. 3C), welche die Vermehrung von Xcv verhindert (135,178,206).
Neben dem T3S System kodiert das Genom von Xcv 85-10 Komponenten für alle weiteren Arten von
Sekretionssystemen, die bisher in Gram-negativen Bakterien identifiziert wurden. Diese umfassen das
Sec- und TAT-System sowie Sekretionssysteme des Typs I bis VI (24,215). Mit Ausnahme des Typ
III und Typ II Sekretionssystems ist die Rolle dieser Sekretionssysteme in der Virulenz von Xcv
unbekannt. Xcv kodiert zwei Typ II Sekretionssysteme, welche als Xps und Xcs Systeme bezeichnet
werden (215). Kürzlich wurde gezeigt, dass das Xps-, jedoch nicht das Xcs-System, durch Sekretion
der Xylanase XynC zur Virulenz und dem in planta Wachstum von Xcv beiträgt (213). Des Weiteren
wurde für Xcv 85-10 nachgewiesen, dass die Aconitase AcnB zur Virulenz, dem in planta Wachstum
und der Verwertung von Citrat als Kohlenstoffquelle beiträgt und Toleranz gegenüber reaktiven
Sauerstoffspezies vermittelt (104).
Einleitung 13
Abbildung 3. Die Interaktion von Xcv mit Wirtspflanzen. Xcv verursacht die bakterielle Fleckenkrankheit auf Früchten und Blättern von (A) Tomate und (B) Paprika. (C) Modell der Xcv-Pflanze Interaktion. Im Apoplasten perzipiert Xcv unbekannte pflanzliche Signale, welche die Aktivierung von HrpG und die Transkription von hrpX induzieren. HrpG und HrpX kontrollieren die Expression eines genomweiten Regulons, welches Gene für Komponenten und Substrate des T3S Systems sowie weitere mögliche Virulenzgene umfasst. Das T3S System vermittelt die Sekretion von Translokonproteinen bzw. die Translokation von Effektoren in die Pflanzenzelle. In suszeptiblen Pflanzen ermöglichen Effektoren die bakterielle Vermehrung. Die resultierenden Krankheitssymptome (wässrige Läsionen) sind als Laborphänotyp auf einem Paprikablatt gezeigt (oben, Kultivar ECW). Die Erkennung von Effektorproteinen durch pflanzliche Resistenzgene bzw. Resistenzproteine induziert die hypersensitive Reaktion, welche als Laborphänotyp auf einem Paprikablatt dargestellt ist (unten, Kultivar ECW-10R). (IM, ÄM: innere und äußere bakterielle Membran; PM: Plasmamembran der Pflanzenzelle. Bildquellen: (A) und (B), Clemson University, USDA Cooperative Extension Slide Series, www.forestryimages.org).
1.5. Zielstellung
Zu Beginn dieser Arbeit waren sRNAs in Xanthomonas spp. unbekannt. Ziel dieser Arbeit war die
Identifizierung von sRNAs im Xcv Stamm 85-10 sowie die funktionelle Charakterisierung
ausgewählter Kandidaten in Hinblick auf mögliche Virulenzfunktionen. Vor Beginn dieser Arbeit
wurden sRNA Kandidaten durch bioinformatische Analyse der Xcv Genomsequenz (215)
vorhergesagt, jedoch nicht experimentell validiert (S. Findeiß, F. Thieme, P.F. Stadler und U. Bonas,
unveröffentlicht). Die Ergebnisse dieser Analysen sind nicht in die vorliegende Arbeit eingegangen.
Zur Identifizierung von sRNA Kandidaten sollte eine 454-Pyrosequenzierung des Xcv Transkriptoms
durchgeführt (Kooperation mit C.M. Sharma und J. Vogel) und durch manuelle und bioinformatische
Sichtung der Sequenzierdaten analysiert werden (Koop. mit S. Findeiß und P.F. Stadler). sRNA
Kandidaten sollten mittels Northern Blot Analysen bestätigt und auf eine HrpG- bzw. HrpX-abhängige
Expression getestet werden. Mögliche Virulenzfunktionen von ausgewählten Xcv sRNAs sollten durch
genetische Analysen wie Deletionsmutagenese sowie durch Wachstums- und Infektionsstudien
untersucht werden. Im Falle einer veränderten Virulenz von sRNA Deletionsmutanten sollten die
zugrunde liegenden Mechanismen näher charakterisiert werden.
Ergebnisse 15
2. Ergebnisse
2.1. Analyse des Xcv Transkriptoms
2.1.1. Publikation 1
Genome-wide transcriptome analysis of the plantpathogen Xanthomonas identifies sRNAs withputative virulence functionsCornelius Schmidtke1,*, Sven Findeiß2,3, Cynthia M. Sharma4, Juliane Kuhfuß1,
Steve Hoffmann3,5, Jorg Vogel4, Peter F. Stadler2,3,5,6,7,8,9 and Ulla Bonas1,*
1Department of Genetics, Martin-Luther-Universitat Halle-Wittenberg, Institute for Biology, D-06099 Halle,Germany, 2Institute for Theoretical Chemistry, University of Vienna, A-1090 Vienna, Austria, 3Department ofComputer Science and Interdisciplinary Centre for Bioinformatics, University of Leipzig, D-04107 Leipzig,4Institute for Molecular Infection Biology, University of Wurzburg, D-97080 Wurzburg, 5LIFE – Leipzig ResearchCenter for Civilization Diseases, University of Leipzig, D-04107 Leipzig, 6Fraunhofer Institute for Cell Therapyand Immunology, RNomics Group, 7Max Planck Institute for the Mathematics in Science, D-04103 Leipzig,Germany, 8Center for non-coding RNA in Technology and Health, University of Copenhagen, DK-1870Frederiksberg, Denmark and 9The Santa Fe Institute, Santa Fe, 87501 New Mexico, USA
Received March 31, 2011; Revised and Accepted October 5, 2011
ABSTRACT
The Gram-negative plant-pathogenic bacteriumXanthomonas campestris pv. vesicatoria (Xcv) isan important model to elucidate the mechanismsinvolved in the interaction with the host. To gaininsight into the transcriptome of the Xcv strain85–10, we took a differential RNA sequencing(dRNA-seq) approach. Using a novel method toautomatically generate comprehensive transcriptionstart site (TSS) maps we report 1421 putative TSSsin the Xcv genome. Genes in Xcv exhibit a poorlyconserved �10 promoter element and no consensusShine-Dalgarno sequence. Moreover, 14% of allmRNAs are leaderless and 13% of them have un-usually long 50-UTRs. Northern blot analysesconfirmed 16 intergenic small RNAs and seven cis-encoded antisense RNAs in Xcv. Expression of eightintergenic transcripts was controlled by HrpG andHrpX, key regulators of the Xcv type III secretionsystem. More detailed characterization identifiedsX12 as a small RNA that controls virulence of Xcvby affecting the interaction of the pathogen andits host plants. The transcriptional landscape ofXcv is unexpectedly complex, featuring
abundant antisense transcripts, alternative TSSsand clade-specific small RNAs.
INTRODUCTION
At a staggering pace new high-throughput sequencingtechnologies have helped to unveil the transcription-al complexity of many organisms in all kingdoms oflife (1–3). The recently developed differential RNAsequencing approach (dRNA-seq) has yet added a newperspective. dRNA-seq, based on a selective enrichmentof native 50-ends, has been shown to accurately andcost-effectively identify transcription start sites(TSSs) and RNA processing sites for whole genomes(4). In addition to the obvious advantages for theanalysis of 50-UTR or promoter elements, dRNA-seqallows distinguishing independently transcribed shortnon-coding and coding RNAs from post-transcriptionalprocesses such as maturation (4). However, a fully-automated method to annotate and statistically evaluateTSSs in large dRNA-seq data sets has been missing so far.Here, we sketch a procedure to automatically identifyTSSs.
Transcriptome analyses in plant pathogenic bacteriaso far mainly focused on coding regions and theregulon controlling type III secretion [e.g. (5,6)]. A
*To whom correspondence should be addressed. Tel: +345 5526291; Fax: +345 5527277; Email: [email protected] may also be addressed to Cornelius Schmidtke. Tel: +345 5526345; Fax: +345 5527277; Email: [email protected]
The authors wish it to be known that, in their opinion, the first two authors should be regarded as joint First Authors.
2020–2031 Nucleic Acids Research, 2012, Vol. 40, No. 5 Published online 12 November 2011doi:10.1093/nar/gkr904
� The Author(s) 2011. Published by Oxford University Press.This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
16 Ergebnisse
recent deep sequencing analysis of Pseudomonas syringaeidentified many small RNA (sRNA) candidates, mostof which, however, await validation by independentmethods (7).
The Gram-negative plant pathogenic g-proteobacterium Xanthomonas campestris pv. vesicatoria(Xcv) is the causal agent of bacterial spot disease onpepper and tomato and is of great economic importancein regions with a warm and humid climate (8). Xcv servesas a model system to elucidate the molecular communica-tion between plant pathogens and their hosts and to char-acterize bacterial virulence strategies. Genome analysispredicted 4726 open reading frames (ORFs) in the Xcvstrain 85–10 (9), yet the overall gene structure andnon-coding RNA output of this model pathogen are stillpoorly understood.
Essential for pathogenicity of Xcv on susceptible hostplants is the type III secretion (T3S) system, encoded bythe hrp [hypersensitive response (HR) and pathogenicity]gene cluster (10). In Xcv, as in most Gram-negative bac-terial pathogens, the T3S nanomachine translocates a suiteof effector proteins into the plant cell where they manipu-late host cellular processes to the benefit of the pathogen,e.g. by suppression of basal plant defense responses(9,11–13). hrp mutants do not grow in plant tissue, andthey no longer cause disease in susceptible plants and theHR in resistant plants (10). The HR is a local, rapidprogrammed cell death at the site of infection, whichcoincides with arrest of bacterial multiplication in theplant (14,15).
The T3S system is transcriptionally induced in certainminimal media and in the plant (16,17). Key regulatoryproteins are the OmpR-type response regulator HrpG,which is activated by unknown plant signals andcontrols the expression of a genome-wide regulonincluding hrp, type III effector and putative virulencegenes (16–19). HrpG-mediated activation of gene expres-sion depends in most cases on the AraC-type transcrip-tional activator HrpX (18), which binds to a conservedmotif (plant-inducible promoter; PIP box) in the pro-moters of target genes (20). The identification of a pointmutation in HrpG (termed HrpG*), which renders theprotein constitutively active, was key for the analysis ofT3S and the identification of putative virulence factorsthat are cotranscribed with the T3S system (19,21). Anopen question was whether virulence gene expression inXcv is post-transcriptionally regulated, for instanceby sRNAs. Here, we provide for the first time an in-sight into the transcriptional landscape of a plant patho-genic bacterium and the involvement of sRNAs in itsvirulence.
MATERIALS AND METHODS
RNA isolation for 454 pyrosequencing, RACE analysisand northern blot
RNA was isolated from NYG-grown Xcv strains 85–10and 85* (exponential growth phase) by phenol extractionand treated with DNase I (Roche). For RACE andnorthern blot analyses, RNA was isolated from
NYG-grown Xcv strains in exponential and stationarygrowth phases, as described (22). RACE analyses werecarried out as described (23) with modifications [fordetailed information see Supporting Information (SI)].Northern blots were performed as described (24) using10 mg RNA, 5–10 pmol [g-32P]-ATP end-labeledoligodeoxynucleotides (Supplementary Table S1).Hybridization signals were visualized with aphosphoimager (FLA-3000 Series, Fuji). Northern blothybridizations were performed at least twice with inde-pendently isolated RNA.
Construction of cDNA libraries for dRNA-seq and 454pyrosequencing
Prior to RNA treatment and cDNA synthesis, equalamounts of RNA from the two Xcv strains 85–10 and85* were mixed. dRNA-seq libraries were prepared ac-cording to Sharma et al. (2010) and sequenced with aRoche 454 sequencer using FLX and Titanium chemistry(see SI).
Annotation of transcription start sites
We aimed at the automated identification of TSSs basedon the discrimination between narrow clusters ofdRNA-seq reads that might represent a TSS and the dis-tribution of individual read starts. The density of readstarts varies across the genome and can be modeledlocally by a Poisson distribution with a parameter �. Weused fixed-length intervals of size l to determine �r = sr/lfrom the number of read starts sr in the region r. Theparameter �ave models the average genome wide arrivalrate of read starts. � is defined as �r/�ave. The correspond-ing Poisson distribution F(k,�) describes the probabilitythat at most k read starts are observed at a givengenomic position. We used library 1 to determine �m forthe background distribution of read starts. Similarly,library 2 was used to obtain �p to model the distributionbiased towards the TSS.A TSS is defined as the genomic position at which the
observed number of read starts in library 2 significantlyexceeds the background distribution of read starts inlibrary 1. The significance of a putative TSS wasdetermined as follows: for each genomic position, the dif-ference of the number of read starts P in library 2 and Min library 1, D = P–M, was calculated. The difference oftwo Poisson distributed variables, D, follows a Skellamdistribution (25) whose cumulative distribution functionis given by
FðD,�p,�mÞ ¼XD
d¼�1e�ð�p+�mÞ �p
�m
� �d2
Jjdjð2ffiffiffiffiffiffiffiffiffiffi�p�m
p Þ; d 2 Z
where Jjdj is the modified Bessel function of the first kindand integer order jdj. Furthermore, 1� FðD,�p,�mÞ repre-sents the probability that a difference of at least D readstarts is observed given the normalized rates of read starts�p and �m. To reduce the influence of window sizes andlocal variation of transcriptional activity a sliding windowof size x was shifted by y nucleotides along the genome
Nucleic Acids Research, 2012, Vol. 40, No. 5 2021
Ergebnisse 17
and each site was tested t = x/y times for being a TSS.The p-value was obtained using the geometric mean
p ¼ffiffiffiffiffiffiffiffiffiffiffiYti¼1
pit
vuut
where pi denotes the P-value obtained in the i-th test. Notethat only sites with a minimum expression of three readstarts within a distance of �5 nt were tested. Furthermore,we excluded sites in the vicinity of perfectly aligned hitblocks, i.e. stacks of hits that all share a common 50-and 30-end. To determine �r, we selected a region size of500 nt. For the sliding window approach an offset of 50 ntwas used. All potential TSSs significant to the p=0.05level are listed in Supplementary Table S2. In order toachieve a high positive predictive value for data sets ofsimilar size, these parameters have been fixed globally inour study and may have to be adjusted for the applicationof the method to other data sets.
Evaluation of the automated TSS annotation method
To evaluate the predictive power of the automated TSSannotation method we used Helicobacter pylori and itsmanually curated TSS map (4) as reference. A data setof comparable size to the Xcv data set was generated.Reads overlapping with annotated tRNA or rRNAgenes were excluded. From the H. pylori data set 40 385mapped reads of the treated library and 49 845 reads ofthe untreated library were randomly selected and con-tained 392 manually annotated TSSs which were used asreference class. TSSs were predicted using the same par-ameter settings (500 nt window size, 50 nt offset; 0.05p-value cutoff) as for the Xcv data set. 566 genomic pos-itions met the criteria for being TSS candidates, i.e. theclustering of at least three read starts. These positions rep-resent putative TSSs and were statistically evaluated withthe automatic TSS annotation approach, according to(26). The results are summarized in an extended confusionmatrix (Supplementary Table S9).
Estimation of expression level
To estimate the expression level of CDSs in Xcv likely toexhibit a proximal promoter, we selected 1276 annotatedCDSs in a head-to-head arrangement. The set comprised549 CDSs with and 727 without annotated TSS. Due tothe limited sequencing depth of our data set we combinedreads of both libraries and evaluated the coverage of thefirst 100 nt of CDSs (Supplementary Figure S2).Detailed information about additional methods is
provided in SI.Further supporting information and the raw sequencing
data are available at the official institutional website of theUniversity of Leipzig (http://www.bioinf.uni-leipzig.de/publications/supplements/10-035).
RESULTS
Mapping of sequencing reads
To analyze the primary transcriptome of Xcv, total RNAof strain 85–10 and its derivative 85* were mixed (SI andSupplementary Table S1). Xcv strain 85* carries achromosomal point mutation in hrpG (hrpG*) leading toexpression of the Hrp-regulon. cDNAs were synthesizedfrom total RNA (untreated library; hereafter library 1)and RNA enriched for primary transcripts (treatedlibrary; hereafter library 2), respectively (4). dRNA-seqanalysis resulted in 160 349 reads for library 1 and149 596 reads for library 2. A total of 84% of the readswere mapped to the Xcv genome using the programsegemehl (27). As previously described, Xcv contains twoidentical copies of the 5S, 23S and 16S rRNA clusters,respectively, and 56 tRNA loci (9). A total of 63% ofthe reads of library 1 and 68% of library 2 readsmapped to these genes although the processed rRNAsand tRNAs were expected to be depleted in library 2.Closer examination revealed that the majority oftRNA-read starts in library 2 correspond to thepresumed RNase P processing sites rather than TSSs(Supplementary Figure S1). To verify our observationswe analyzed all reads overlapping tRNAs in theHelicobacter pylori dRNA-seq data set (4), whichsupports our findings (Supplementary Figure S1). Theabundance of library 2 tRNA reads mapping to putativeRNase P processing sites might be due to stable secondarystructures formed after RNase P cleavage thus protectingmature tRNAs from exonuclease degradation. We, there-fore, discarded the reads mapping to rRNA and tRNAloci and analyzed the remaining 49 845 and 40 385 readsin more detail. While reads of library 1 cover entire genes,the read starts of library 2 are shifted towards the 50-end ofprimary transcripts, which permits precise mapping of theTSS of a given gene (Figure 1A, e.g. XCV0520), asdescribed (4).
A statistical model to annotate TSSs
Most of the TSS maps published to date are derived fromtedious manual inspection of sequencing data (4,24,28) orusing ad hoc heuristics complemented by manual inspec-tion (29–31). Here, we aimed at the automated identifica-tion of TSSs based on well-defined criteria, i.e. todiscriminate between potential TSSs and the backgrounddistribution of read starts. This background, however, isnot uniform across the genome but varies depending ongene expression levels. We therefore modeled read startsby Poisson distributions depending on the expression levelin a well-defined genomic neighbourhood. Comparing thetwo libraries, a TSS is defined as a position where theobserved difference of read starts in both libraries signifi-cantly exceeds the expected differences of read startsmodeled by a Skellam distribution from which p-valuesare readily derived (see ‘Materials and Methods’ section).
2022 Nucleic Acids Research, 2012, Vol. 40, No. 5
18 Ergebnisse
Annotation of TSSs
In total, 1372 chromosomal and 49 TSSs on the largeplasmid pXCV183 of Xcv (Figure 1B and SupplementaryTable S2) were identified. The data confirm TSSsdetermined previously for selected pathogenicity genes,e.g. hrcU and hrpB1 (20,32). Nevertheless, the majorityof TSSs annotated in our study should be considered asputative. TSSs were classified into four categories, i.e. (i)primary TSSs located up to 300 bp 50 of an annotatedtranslation start, (ii) internal TSSs within an annotatedcoding sequence (CDS), (iii) antisense TSSs that map tothe opposite strand of CDSs±100 bp and (iv) orphanTSSs that do not belong to the other three categories.Most of the annotated TSSs are primary TSSs (831) andprobably correspond to the 50-end of mRNAs. Overall,CDSs that lack an assigned TSS exhibit much lower ex-pression levels than CDSs with an annotated TSS (see‘Materials and Methods’ section and SupplementaryFigure S2).
As illustrated in Figure 1B, TSSs can belong to morethan one category, e.g. the assumed primary TSS ofXCV0523 is also antisense to XCV0522 (Figure 1A).Interestingly, 10% (86/831) of primary TSSs are also clas-sified as internal. Thus, some neighboring CDSs previous-ly supposed to be cotranscribed as part of a polycistronicmRNA can also be transcribed from alternative pro-moters. As illustrated for XCV0522 (Figure 1A), we
identified 71 putative TSSs which are located within thefirst 50 bp of annotated CDSs suggesting that previouslyannotated translation starts have to be revisited(Supplementary Table S3). Furthermore, 345 TSSs arelocated antisense to annotated genes. Interestingly, 41%of these TSSs are also classified as primary TSSs, including16 TSSs that correspond to overlapping mRNAs in anantisense orientation (Supplementary Table S2). 49 anti-sense TSSs are positioned in the 30-region (±100 bp) ofannotated sense genes (Supplementary Table S4). In total,antisense reads map to 22% of all nucleotides that belongto annotated CDSs irrespective of read numbers, thepresence of a TSS and the expression of the correspondingCDSs. The majority of these antisense reads lack automat-ically assigned TSSs and do not accumulate in clusters andthus, might not be originated from defined antisensegenes. We also compared the sense- and antisense-readcoverage of all annotated CDSs in Xcv and did notobserve a correlation (data not shown).Most bacterial d70-dependent promoters contain
conserved sequence elements, i.e. �35 (TTGACA) and�10 (TATAAT) elements present in Escherichia coli(33). In Xcv, there is a weakly conserved T/A-rich motifin the proximity of �10 regions, however, other conservedpromoter elements and a Shine-Dalgarno (SD) motif aremissing (Figure 1C). This might be due to the high G+Ccontent (65%) of the Xcv genome (9) and is discussedbelow.
Figure 1. Identification of TSSs, promoter elements and analysis of 50-UTRs. (A) Distribution of dRNA-seq reads in the chromosomal locus of Xcv85–10 spanning genes XCV0519 to XCV0524. Annotated CDSs and RNAcode high-scoring segments are highlighted in green and blue, respectively.Sequencing reads of library 1 (black) and library 2 (red) are shown on top for the (+)-strand and below for the (�)-strand. Predicted TSSs andcorresponding classes are indicated in red. (B) Venn diagram illustrating the TSS classes. TSSs found maximal 300-bp upstream of coding sequencesare classified as primary. Internal TSSs are found within and antisense TSSs on the opposite strand of genes (±100 bp). Orphan TSSs do not belongto other classes. (C) Sequence analysis identified a T/A-rich promoter element for 1205 of 1421 putative TSSs. The histogram depicts the position ofthe conserved sequence pattern relative to the annotated TSSs at position+1. (D) 50-UTR length distribution. The x-axis is split into linear (0–50)and logarithmic (51–300) scales. The top of the histogram gives the percentage of leaderless (�10 bp), short (�50 bp) and longer UTRs (>50 bp).
Nucleic Acids Research, 2012, Vol. 40, No. 5 2023
Ergebnisse 19
Analysis of 50-UTRs revealed unexpected size diversity
The lengths of 50-UTRs deduced from 831 putativeprimary TSSs range from 0 to >300 bp, with themajority being between 10 and 50 bp (Figure 1D).Surprisingly, 14% of the mRNAs (118 of 831) are leader-less, i.e. their 50-UTR consists of <10 bp with respect tothe annotated genome sequence of Xcv (9). Many of thecorresponding genes presumably have housekeeping func-tions (Supplementary Table S5). In addition, the 50-UTRsof type III effectors were manually inspected. TSSs of 11described type III effectors from Xcv strain 85–10 (9,13)were mapped in this study (Supplementary Table S5). Thepromoter regions of nine effector genes contain a PIP box(consensus TTCG-N16-TTCG) (20). The assumed lengthsof the 50-UTRs of avrBs2, xopE2, xopJ1 and xopO areaverage. Curiously, the avrRxv mRNA is leaderless, andsix mRNAs (avrBs1, xopAA, xopB, xopC, xopD andxopN) (9,13) contain unusually long 50-UTRs, rangingfrom 173 to 678 bp. Consequently, the CDSs of someeffector genes might be considerably larger than previous-ly described (9). Overall, 13% of the Xcv 50-UTRs areunusually long (150–300 bp; Supplementary Table S5).
Northern blot analysis confirmed 23 sRNAs in Xcv
A computational scan for known RNA elements in Xcvidentified already annotated tRNAs, rRNAs and therecently described ptaRNA1 (34). In addition, weidentified eight putative riboswitches and widelyconserved RNAs, i.e. RNase P-, RtT-, SRP-, tmRNAand 6S-RNA (Figure 2 and Supplementary Table S6).Based on our dRNA-seq data, most of these transcriptswere strongly expressed and TSSs were annotated for fourof the housekeeping RNAs and five of the predictedriboswitches (Supplementary Table S6). The geneslocated downstream of the riboswitch candidates areeither known to be involved in the respective riboswitch-controlled pathways in other bacteria or, as in case ofyybP/ykoY candidates, presumably encode membraneproteins (35–37) (Supplementary Table S6).
Prior to the automated TSS prediction, we selected 89sRNA candidates by manual inspection of the sequencingdata with a focus on intergenic regions. We used northernblot analysis to experimentally validate sRNA candidatesand analyzed their potential coregulation with the T3Ssystem. To this end, RNA was isolated from exponentialand stationary phase cultures of NYG-grown Xcv strains85–10, 85–10 expressing HrpG* and a derivative lackinghrpX (85–10�hrpXphrpG*), respectively. Northern hy-bridizations confirmed 23 new sRNAs, whereas remainingcandidates either appeared to correspond to longer tran-scripts, i.e. UTRs of mRNAs, or were poorly detectable.The latter can be explained by their low abundance in thedRNA-seq data (data not shown).
After completion of bioinformatic analyses, sevenverified sRNAs turned out to correspond to cis-encodedantisense RNAs, termed asX1-7 (Table 1, Figure 2 andSupplementary Figure S3). We detected dRNA-seq readsmapping to both antisense RNA and mRNA for six ofthese transcripts and a few reads mapping to the CDScomplementary to asX4, respectively (data not shown).The remaining 16 sRNAs mapped to intergenic regionsand were termed sX1-15 and 6S (Table 1, Figures 2, 3A,4A and Supplementary Figure S3). Intriguingly, threesRNAs (sX15, asX6, asX7) are encoded on the largeplasmid, two of which (asX7 and sX15) are in antisenseorientation to each other (Table 1 and SupplementaryFigure S3). Most sRNA genes were constitutively ex-pressed under the conditions tested, and appeared to ac-cumulate in stationary growth phase either due to highertranscription rates or increased stability, e.g. sX14 and 6S(Figure 2). Interestingly, expression/accumulation of fiveintergenic sRNAs and three antisense RNAs was affectedby the key regulators of hrp gene expression, HrpG andHrpX, suggesting a role of these sRNAs or their targets inthe interaction of Xcv with the plant. HrpX-dependentinduction of sRNA expression was observed for asX4,sX5, sX8 (Figure 2) and sX12 (see below), whereas sX11appeared to be HrpG/HrpX-dependently repressed
Figure 2. Expression of selected Xcv sRNAs and antisense RNAs depends on HrpG and HrpX. Total RNA isolated from exponential (exp) andstationary phase cultures (stat) of (a) Xcv strain 85–10, (b) 85–10 expressing hrpG* from pFG72-1 and (c) 85–10�hrpX carrying pFG72-1 wasanalyzed by northern blot. Arrows and filled squares indicate signals corresponding to the expected full-length RNA and processing productsobtained by transcriptome sequencing, respectively. The open square indicates the expected size of full-length asX4 determined by RACEanalysis. The expected size of sX4 according to the sequencing data is marked by an asterisk. 5S rRNA (lower panel) was probed as loading control.
2024 Nucleic Acids Research, 2012, Vol. 40, No. 5
20 Ergebnisse
Table 1. Verified sRNAs (sX) and antisense RNAs (asX) in Xcv
RNA (Strand) TSS categorya Start-Stopb Library
2cLibrary
1cExpected
length
(nt)d
Detected
length
(nt)e
HrpG/HrpX
dependencyfConservationg
sX1 (�) primary: XCV0067 78978–78799 8 5 180 190 – A (5); B (4); C1 (4); C2 (5);
aClassification of the automatically annotated TSS (Figure 1B). bThe 50- and 30-positions of the respective dRNA-seq-read clusters on the Xcvchromosome and plasmid pXCV183 (indicated by #). Positions highlighted in bold indicate an automatically annotated TSS (see SI; SupplementaryTable S2). Underlined numbers correspond to transcript ends which were verified by 50- and 30-RACE, respectively. The underlined 30-end of asX4was identified only by RACE. cNumber of read starts at the respective start position given in column ‘Start-Stop’. dTranscript length deduced fromdRNA-seq. etranscript size and fHrpG/HrpX dependency of sRNA/antisense RNA accumulation determined by northern blot (Figures 2, 3, 4 andSupplementary Figure S3); ‘stability’ indicates altered amounts of sRNA processing products in dependency of HrpG and/or HrpX. Constitutiveexpression is indicated by ‘-’. gsequence conservation among other bacteria (see SI). Strains containing homologous sequences and the respectiveaccession numbers are given below. Numbers in brackets indicate the number of homologous sequences in the respective strains if more than onehomolog was identified.A: X. campestris pv. vesicatoria 85–10 (NC_007508)Ap: X. campestris pv. vesicatoria 85–10 plasmid pXCV183 (NC_007507)B: X. axonopodis pv. citri 306 (NC_003919)Bp: X. axonopodis pv. citri 306 plasmid pXAC64 (NC_003922)C1: X. campestris pv. campestris ATCC 33913 (NC_003902)C2: X. campestris pv. campestris 8004 (NC_007086)C3: X. campestris pv. campestris B100 (NC_010688)D1: X. oryzae pv. oryzae MAFF 311018 (NC_007705)D2: X. oryzae pv. oryzae KACC 10331 (NC_006834)D3: X. oryzae pv. oryzae PXO99A (NC_010717)E: X. albilineans GPE PC73 (NC_013722)F1: Xylella fastidiosa 9a5c (NC_002488)F2: Xylella fastidiosa Temecula1 (NC_004556)F3: Xylella fastidiosa M12 (NC_010513)F4: Xylella fastidiosa M23 (NC_010577)G1: Stenotrophomonas maltophilia K279a (NC_010943)G2: S. maltophilia R551-3 (NC_011071)H: Burkholderia xenovorans LB400 (NC_007951)I: Acidovorax sp. JS42 (NC_008782)J: Bordetella petrii DSM 12804 (NC_010170)Kp: Ralstonia solanacearum CMR15 plasmid pRSC35 (FP885893)Lp: X. citri plasmid pXcB (AY228335)
Nucleic Acids Research, 2012, Vol. 40, No. 5 2025
Ergebnisse 21
(Supplementary Figure S3). In case of sX4 (Figure 2) andthe antisense RNAs asX1 and asX5 (SupplementaryFigure S3) the sRNA stability appeared to depend onHrpG and HrpX as well as on the growth phase.
Processing of sRNAs
In general, the dRNA-seq data and northern blots suggestthat Xcv sRNAs do not accumulate as primary transcripts
but undergo growth-phase dependent processing.However, in most cases the apparent sizes of full-lengthand processed sRNAs in northern blots were in agreementwith the dRNA-seq data, e.g. sX8 and 6S RNA (Figure 2and Table 1). In addition to full-length and processingproducts, northern blots detected unexpectedly longsignals, up to 900 nt, for the antisense RNAs asX1,asX2, asX3, asX6 and asX7 (Supplementary Figure S3).These signals may be caused by alternative termination oftranscription. The sequencing data also suggest that sX7,sX13 and sX14 represent processing products of longertranscripts since reads mapping to these loci are predom-inantly found in library 1, and no TSS was identified inlibrary 2 (Table 1). For selected RNAs the 50- and 30-endswere determined by RACE (Table 1). While the 50-end ofthe antisense RNA asX4 is identical to the TSS identifiedby dRNA-seq, the 30-region is 170 nt longer suggesting thepresence of a processing site.
Phylogenetic distribution of sRNAs from Xcv
While sX3 and asX5 are unique for Xcv, homologysearches revealed that 10 sRNA genes are exclusivelyfound in sequenced Xanthomonas species that encode ahrp-T3S system (Table 1). Four of the latter sRNAs,including sX12 described in more detail below, and asX5were coregulated with the T3S system.
Two intergenic sRNAs, sX1 and sX10 (Table 1;Supplementary Figure S3) are highly similar in sequenceand structure. Three additional homologous genes are pre-dicted and expressed in Xcv and might therefore be con-sidered as an sRNA family. As three to six copies ofmembers of this gene family are found in otherXanthomonas species (Table 1), we propose a functionalredundancy of the respective sRNAs.
Interestingly, 10 homologs of the plasmid-encoded andcomplementary Xcv sX15 and asX7 genes are present inthe chromosome of Stenotrophomonas maltophilia strainK279a (38) (Table 1). Moreover, asX6, which is also
Figure 4. sX12 is involved in virulence of Xcv. (A) sX12 is HrpX-dependently expressed. Total RNA isolated from exponential (exp) and stationaryphase cultures (stat) of (a) Xcv strain 85–10, (b) Xcv expressing hrpG* from pFG72-1 and (c) a derivative deleted in hrpX and carrying pFG72-1 wasanalyzed by northern blot. The right panel shows a northern blot with RNA from (d) Xcv strain 85–10 and (e) an sX12 deletion mutant carryingempty vector pLAFR6, respectively, and (f) an sX12 deletion mutant ectopically expressing sX12 from psX12. The expected RNA size is indicated byan arrow. The asterisk denotes an unspecific signal. 5S rRNA (lower panel) was probed as loading control. (B) sX12 contributes to virulence and theHR. Strains used in (A) (right panel) were inoculated at a density of 1.25� 108 CFU ml�1 into leaves of susceptible ECW and resistant ECW-10Rpepper plants. Disease symptoms were photographed at 7 days post-inoculation (dpi). The HR was visualized by ethanol bleaching of the leaves at 2days post-inoculation. Dashed lines indicate the inoculation site.
Figure 3. sX6 encodes a small protein. (A) Expression analysis of thesX6 transcript. Total RNA isolated from exponential (exp) and station-ary phase cultures (stat) of (a) Xcv strain 85–10, (b) 85–10 expressinghrpG* from pFG72-1 and (c) 85–10�hrpX carrying pFG72-1 wasanalyzed by northern blot. The expected signal according to sequencingdata is indicated by an arrow. 5S rRNA (lower panel) was probed asloading control. (B) Expression of the sX6 protein. Derivatives of Xcvstrain 85–10 (wt) carrying promoterless empty vector pBRM-P (�) andsX6-c-Myc expression construct, respectively, were grown toOD600=0.7. Protein extracts were analyzed by immunoblotting usingc-Myc epitope-specific and GroEL-specific antibodies.
2026 Nucleic Acids Research, 2012, Vol. 40, No. 5
22 Ergebnisse
located on pXCV183 of Xcv, is conserved in plasmids ofX. axonopodis pv. citri strain 306 (39), Ralstoniasolanacearum strain CMR15 (40) and X. citri (41)(Table 1). A rather erratic phylogenetic distribution wasobserved for sX8 since homologs are predicted in a smallsubset of the known genomes of both beta- andgamma-proteobacteria (Table 1). Interestingly, this holdstrue also for the gene cluster upstream of sX8 whichsuggests a common evolutionary origin of this region.This type of phylogenetic pattern has in particular beenobserved for toxin/anti-toxin systems and suggestsfrequent horizontal transmissions (42).
sX6 encodes a small protein
Using RNAcode, a program, which was applied for thedetection of novel protein coding genes in E. coli (43), 24potential short ORFs were predicted in the Xcv genome(see SI and Supplementary Table S7). dRNA-seq readsmapped to 12 of these loci. One example is sX6 (341 nt),which is constitutively expressed (Figure 3A) and has apredicted coding capacity of 80 amino acids includinga signal peptide in the N-terminal region. We generateda translational fusion of sX6 with a C-terminal c-Mycepitope tag, under control of the native sX6 promoter(44), and introduced the expression construct into Xcvstrain 85–10. As shown in Figure 3B, a fusion protein ofthe predicted molecular mass (�12 kDa) was detectable inprotein extracts of Xcv.
Besides sX6, TSSs for two of the predicted ORFs with acoding capacity of 36 and 67 amino acids, respectively,were predicted (Supplementary Table S7). Interestingly,homologs of genes for the three small proteins are exclu-sively found in xanthomonads encoding a hrp-T3S system.
sX12 contributes to virulence
The fact that several sRNAs are expressed under controlof the T3S system regulators suggested a possible role invirulence. Here, we focused on sX12 whose size of 78 ntwas confirmed by 50- and 30-RACE (Table 1). As men-tioned above, expression of sX12 is HrpX-dependentlyinduced and accumulates in stationary growth phase(Figure 4A). To assess the contribution of sX12 to viru-lence we generated a deletion mutant derivative of strain85–10 (�sX12). While growth of strain �sX12 in plantawas as wild-type (Supplementary Figure S4), plant reac-tions were altered. Disease symptoms in leaves of infectedsusceptible (ECW) and the HR in resistant (ECW-10R)pepper plants were delayed with strain �sX12 whencompared to the wild-type (Figure 4B). The �sX12mutant phenotype was complemented by ectopic expres-sion of sX12 under control of its own promoter (Figure 4).We also performed T3S assays to analyze whether thedelay in plant reactions by strain �sX12 might be due toreduced protein levels of T3S system components, e.g. theconserved apparatus component HrcJ, or the secretionof T3S substrates, i.e. the translocon protein HrpF.However, the detected protein amounts and the secretionof HrpF were comparable for the wild-type and the�sX12mutant (Supplementary Figure S4).
DISCUSSION
The dRNA-seq-based analysis of the Xcv transcriptomeled to remarkable insights into the transcriptional land-scape of this important model plant pathogen andidentified an sRNA with a role in virulence. In thisstudy, we have devised a new method to automaticallygenerate maps of TSSs for dRNA-seq data sets alleviatingthe need for manual inspection and allowing applicationof dRNA-seq also for larger genomes than Xcv. Incontrast to earlier dRNA-seq approaches, mostly basedon laborious manual inspection of sequencing data(4,24,28), the presented computational approachprovides a measure of statistical confidence and ensuresthat predictions are comparable between different studiesas demonstrated by our comparative analysis betweenmanual and automated annotation of the previously pub-lished H. pylori transcriptome (4). While the sensitivity of82% demonstrates the method’s capability of recoveringmanually annotated TSS at exactly the same position, apositive predictive value of 72% indicates its reliability(Supplementary Table S9). However, to dynamicallyadjust parameters such as significance levels the methodremains subject to further research. We used only exactmatches of the manual and automated TSS map for thisanalysis. The number of false positives and negativesmight therefore be overestimated and suffers from biasesintroduced by manual inspection. Several parametersincluding window sizes to determine local expressionlevels, minimum coverage and significance thresholds tocontrol for sensitivity and specificity have been fixedglobally for this study.We annotated 1421 putative TSSs in Xcv
(Supplementary Table S2) including riboswitches andgenes for conserved housekeeping and novel sRNAs.Interestingly, 178 TSSs correspond to antisense transcriptsincluding six that map to type III effector genes and tohrcC, which is transcriptionally induced by HrpX andessential for T3S and pathogenicity (SupplementaryTables S2 and S4) (10,45). The potential role ofpost-transcriptional regulation in Xcv is further supportedby the finding that 22% of all nucleotides that belong toannotated CDSs are covered by antisense reads.Nevertheless, the majority of these reads might bederived from promiscuous transcription initiation as itwas also suggested for E. coli (46). It remains to beclarified whether the identified antisense transcripts inXcv represent functional gene products or the transcrip-tion itself has a regulatory function.We identified 831 putative primary TSSs, which were
assigned to 17.35% of the 4726 annotated CDSs(Figure 1B and Supplementary Table S2) (9). Similarly,in the archeon Methanosarcina mazei TSSs for �20% ofthe CDSs were assigned (24). A considerably largernumber of TSSs corresponding to 60% of the CDSswere recently mapped in the plant symbiontSinorhizobium meliloti (31) and the human pathogenH. pylori (>50%) (4). This might be explained by theplethora of conditions analyzed and/or the highernumber of sequencing reads and is supported by ourfinding that TSSs in Xcv are predominantly assigned to
Nucleic Acids Research, 2012, Vol. 40, No. 5 2027
Ergebnisse 23
CDSs with high expression level whereas CDSs withoutassigned TSS are generally weakly or not expressed(Supplementary Figure S2).In Xcv, the majority of 50-UTRs appears to be <50 bp
(Figure 1D), which is characteristic for bacteria (3).Surprisingly, there is no clear consensus sequence forribosome binding. A recent study (47) analyzed theevolutionary process of translation initiation in prokary-otes and found that a SD-initiated translation inxanthomonads is unlikely. In good agreement with this,we identified an unexpected high number of leaderlessmRNAs in Xcv (Supplementary Table S5) suggesting analternative mechanism of ribosome guidance. In Xcv, tran-scription of 82% of the leaderless mRNAs starts withAUG which was shown to be essential for stableribosome binding to these transcripts in E. coli (48).Unusually long 50-UTRs as identified here for Xcv
might be indicative of extensive post-transcriptional regu-lation, e.g. by sRNA-mediated modulation of mRNAtranslation or transcript stability. Since also 50-UTRs ofgenes that encode type III effector proteins are unusuallylong (Supplementary Table S5), this might indicate a roleof these 50-UTRs in virulence. For instance, the genes forthe type III effector proteins XopN and XopAA, shown tobe important virulence factors of Xcv (49,50), comprise50-UTRs of 173 and 477 bp, respectively (SupplementaryTable S5). In H. pylori, mRNAs of genes involved inpathogenesis also carry long 50-UTRs (4).Another potential implication of the high number of
unusually long 50-UTRs in Xcv is that the respectiveCDSs might be longer than predicted by the genome an-notation as shown recently for the type III effector proteinXopD (51). On the other hand, a number of CDSs arepresumably shorter than annotated, because 71 internalTSSs are located within the first 50 bp of annotatedCDSs (Supplementary Table S3). We also identified 12expressed new loci with potential coding capacity(Supplementary Table S7) exemplified by sX6 thatencodes an 80 amino acid protein (Figure 3). Hence, thisstudy contributes to a first refinement of CDS annotationin Xcv.sRNAs represent important post-transcriptional regula-
tors involved in a variety of processes such as quorumsensing (52) and virulence (53). In this study, the combin-ation of manual and automatic inspection of the cDNAsequencing data and northern blots verified 23 sRNAs inXcv, seven of which represent antisense RNAs (Table 1).For six of the antisense RNAs we also detected expressionof the complementary mRNAs. It should be noted,however, that our data do not allow distinguishingbetween cells that express both transcripts at the sametime and cells that either express the mRNA or the anti-sense RNA.Notably, expression of five intergenic sRNAs and three
antisense RNAs verified in this study was affected by themaster regulators of Xcv virulence, HrpG and/or HrpX(Table 1) (16,18,19). Coregulation of sRNA expressionwith the T3S system clearly suggests a role of these tran-scripts in the interaction of Xcv with its host plant. As aproof-of-principle, we have demonstrated that sX12 con-tributes to virulence of Xcv (Figure 4B). Lack of sX12 does
not affect bacterial growth inside the host and T3S, i.e.bacterial fitness is not impaired (Supplementary FigureS4). What might be the targets of sX12? Preliminary ex-periments did not reveal an effect of the absence of sX12on selected hrp (T3S) genes, i.e. transcript and proteinaccumulation was unaltered. Instead of regulatingmRNA targets, sX12 might control gene expression in adifferent manner, e.g. by binding to proteins, DNA ormetabolites. Furthermore, sX12 might impinge on the ef-ficiency of the T3S system, similar to the Salmonellatyphimurium sRNA IsrJ which accumulates under infec-tion conditions. IsrJ positively contributes to invasion andeffector translocation (54).
After our analysis was complete, the identification ofeight sRNAs in Xanthomonas oryzae pv. oryzae (Xoo)strain PXO99A was reported (55). In agreement withour data, the Xoo sRNAs, Xoo3, Xoo4 and Xoo6, repre-sent orthologs of the Xcv RNAs sX14, asX4 and sX1,respectively (Table 1). Contrary to Xoo4 (55), which is145 nt, our analyses revealed that asX4 in Xcv is 309-ntlong and encoded antisense to an annotated CDS. Wealso identified potential TSSs for the Xcv homologs ofXoo1 and Xoo5, whereas Xcv lacks homologs of describedbacterial sRNA genes except for housekeeping RNAs.Vice versa, the majority of sRNAs identified in Xcv is re-stricted to the genera Xanthomonas, Xylella andStenotrophomonas (Table 1) and thus, reflects the currenttaxonomy (56). An estimation of the total number ofsRNAs in Xcv is hampered by the relatively smallnumber of sequence reads and the fact that, forexample, TSSs of sRNA genes in the proximity(�300 bp) of downstream CDSs are classified as primaryTSSs (see sX1; Table 1).
A remarkable finding of this study is the indication offrequent processing of Xcv sRNAs, which appears to begrowth-phase dependent. In several studies, sRNA pro-cessing was shown to affect sRNA activity, e.g. GlmZfrom E. coli which is cleaved and thus inactivated(57,58). The E. coli sRNA IstR-1 is rendered inactive byRNase III-dependent cleavage upon sRNA-mRNA inter-action (59). In contrast, MicX from Vibrio cholerae isstabilized by RNaseE-mediated cleavage which does notimpair its interaction with target-mRNAs (60). Whichribonucleases are involved in processing of the XcvsRNAs is not known.
The analysis of additional knock-out mutants is neededto assess sRNA functions in Xcv. In case of virulencephenotypes, a challenge will be the identification of thetargets. Besides possible effects of sRNAs on mRNAsthe target can also be an RNA-binding protein. To thebest of our knowledge, the only reported sRNAsinvolved in the regulation of virulence gene expression inplant pathogenic bacteria are members of the RsmBfamily which was studied in Erwinia carotovora ssp.carotovora. RsmB antagonizes the RNA-binding proteinRsmA that acts as translational repressor (61–63).Although a major virulence function was reported forRsmA from X. campestris pv. campestris the interactingsRNAs are not known yet (5). The latter is complicated bythe lack of CsrB/RsmB sequence homologs inxanthomonads.
2028 Nucleic Acids Research, 2012, Vol. 40, No. 5
24 Ergebnisse
SUPPLEMENTARY DATA
Supplementary Data are available at NAR Online:Supporting Information (SI), Supplementary FiguresS1–4, Supplementary Tables S1–9 and SupplementaryReferences [64–76].
ACKNOWLEDGEMENTS
The authors are grateful to B. Rosinsky and C.Kretschmer for technical assistance. The authors thankRichard Reinhardt (MPI for Molecular Genetics, Berlin,Germany) for 454 sequencing and Daniela Buttner forhelpful comments on the manuscript.
FUNDING
Deutsche Forschungsgemeinschaft as part of the priorityprogram ‘Sensory and Regulatory RNAs in Prokaryotes’(SPP 1258, to U.B., P.F.S. and J.V.); ‘Graduiertenkolleg’(GRK 1591, to U.B.); Bundesministerium fur Bildung undForschung (‘GenoMik-Plus’ network, to U.B.); LIFELeipzig Research Center for Civilization Diseases,Universitat Leipzig; European Social Fund and the FreeState of Saxony. Funding for open access charge:Deutsche Forschungsgemeinschaft as part of the priorityprogram ‘Sensory and Regulatory RNAs in Prokaryotes’(SPP 1258, to U.B., P.F.S. and J.V.).
Conflict of interest statement. None declared.
REFERENCES
1. van Vliet,A.H. (2010) Next generation sequencing of microbialtranscriptomes: challenges and opportunities. FEMS Microbiol.Lett., 302, 1–7.
2. Croucher,N.J. and Thomson,N.R. (2010) Studying bacterialtranscriptomes using RNA-seq. Curr. Opin. Microbiol., 13,619–624.
3. Sorek,R. and Cossart,P. (2010) Prokaryotic transcriptomics: anew view on regulation, physiology and pathogenicity. Nat. Rev.Genet., 11, 9–16.
4. Sharma,C.M., Hoffmann,S., Darfeuille,F., Reignier,J., Findeiss,S.,Sittka,A., Chabas,S., Reiche,K., Hackermuller,J., Reinhardt,R.et al. (2010) The primary transcriptome of the major humanpathogen Helicobacter pylori. Nature, 464, 250–255.
5. Chao,N.X., Wei,K., Chen,Q., Meng,Q.L., Tang,D.J., He,Y.Q.,Lu,G.T., Jiang,B.L., Liang,X.X., Feng,J.X. et al. (2008) ThersmA-like gene rsmAXcc of Xanthomonas campestris pv. campestrisis involved in the control of various cellular processes, includingpathogenesis. Mol. Plant-Microbe Interact., 21, 411–423.
6. Plener,L., Manfredi,P., Valls,M. and Genin,S. (2010) PrhG, atranscriptional regulator responding to growth conditions, isinvolved in the control of the type III secretion system regulon inRalstonia solanacearum. J. Bacteriol., 192, 1011–1019.
7. Filiatrault,M.J., Stodghill,P.V., Bronstein,P.A., Moll,S.,Lindeberg,M., Grills,G., Schweitzer,P., Wang,W., Schroth,G.P.,Luo,S. et al. (2010) Transcriptome analysis of Pseudomonassyringae identifies new genes, noncoding RNAs, and antisenseactivity. J. Bacteriol., 192, 2359–2372.
8. Jones,J.B., Stall,R.E. and Bouzar,H. (1998) Diversity amongxanthomonads pathogenic on pepper and tomato.Annu. Rev. Phytopathol., 36, 41–58.
9. Thieme,F., Koebnik,R., Bekel,T., Berger,C., Boch,J., Buttner,D.,Caldana,C., Gaigalat,L., Goesmann,A., Kay,S. et al. (2005)Insights into genome plasticity and pathogenicity of the plantpathogenic bacterium Xanthomonas campestris pv. vesicatoria
revealed by the complete genome sequence. J. Bacteriol., 187,7254–7266.
10. Bonas,U., Schulte,R., Fenselau,S., Minsavage,G.V.,Staskawicz,B.J. and Stall,R.E. (1991) Isolation of a gene-clusterfrom Xanthomonas-campestris pv. vesicatoria that determinespathogenicity and the hypersensitive response on pepper andtomato. Mol. Plant-Microbe Interact., 4, 81–88.
11. Szczesny,R., Buttner,D., Escolar,L., Schulze,S., Seiferth,A. andBonas,U. (2010) Suppression of the AvrBs1-specific hypersensitiveresponse by the YopJ effector homolog AvrBsT fromXanthomonas depends on a SNF1-related kinase. New Phytol.,187, 1058–1074.
12. Buttner,D. and Bonas,U. (2010) Regulation and secretion ofXanthomonas virulence factors. FEMS Microbiol. Rev., 34,107–133.
13. White,F.F., Potnis,N., Jones,J.B. and Koebnik,R. (2009)The type III effectors of Xanthomonas. Mol. Plant Pathol., 10,749–766.
15. Klement,Z. (1982) In: Mount,M.S. and Lacy,G.H. (eds),Phytopathogenic Prokaryotes, Vol. 2. Academic Press, New York,pp. 149–177.
16. Wengelnik,K. and Bonas,U. (1996) HrpXv, an AraC-typeregulator, activates expression of five of the six loci in the hrpcluster of Xanthomonas campestris pv. vesicatoria. J. Bacteriol.,178, 3462–3469.
17. Schulte,R. and Bonas,U. (1992) Expression of the Xanthomonascampestris pv. vesicatoria hrp gene cluster, which determinespathogenicity and hypersensitivity on pepper and tomato, is plantinducible. J. Bacteriol., 174, 815–823.
18. Wengelnik,K., Van den Ackerveken,G. and Bonas,U. (1996)HrpG, a key hrp regulatory protein of Xanthomonascampestris pv. vesicatoria is homologous to two-component response regulators. Mol. Plant-Microbe Interact., 9,704–712.
19. Noel,L., Thieme,F., Nennstiel,D. and Bonas,U. (2001)cDNA-AFLP analysis unravels a genome-wide hrpG-regulonin the plant pathogen Xanthomonas campestris pv. vesicatoria.Mol. Microbiol., 41, 1271–1281.
20. Koebnik,R., Kruger,A., Thieme,F., Urban,A. and Bonas,U.(2006) Specific binding of the Xanthomonas campestris pv.vesicatoria AraC-type transcriptional activator HrpX toplant-inducible promoter boxes. J. Bacteriol., 188, 7652–7660.
21. Wengelnik,K., Rossier,O. and Bonas,U. (1999) Mutations in theregulatory gene hrpG of Xanthomonas campestris pv. vesicatoriaresult in constitutive expression of all hrp genes. J. Bacteriol.,181, 6828–6831.
22. Hartmann,R.K., Bindereif,A., Schon,A. and Westhof,E. (2005)Handbook of RNA biochemistry, Vol. 2. Wiley-VCH, Weinheim,Germany, pp. 636–637.
23. Argaman,L., Hershberg,R., Vogel,J., Bejerano,G., Wagner,E.G.,Margalit,H. and Altuvia,S. (2001) Novel small RNA-encodinggenes in the intergenic regions of Escherichia coli. Curr. Biol., 11,941–950.
24. Jager,D., Sharma,C.M., Thomsen,J., Ehlers,C., Vogel,J. andSchmitz,R.A. (2009) Deep sequencing analysis of theMethanosarcina mazei Go1 transcriptome in response tonitrogen availability. Proc. Natl Acad. Sci. USA, 106,21878–21882.
25. Skellam,J.G. (1946) The frequency distribution of the differencebetween two Poisson variates belonging to different populations.J. R. Stat. Soc. Ser. A, 109, 296.
26. Fawcett,T. (2006) An introduction to ROC analysis.Pattern Recogn. Lett., 27, 861–874.
27. Hoffmann,S., Otto,C., Kurtz,S., Sharma,C.M., Khaitovich,P.,Vogel,J., Stadler,P.F. and Hackermuller,J. (2009) Fast mapping ofshort sequences with mismatches, insertions and deletions usingindex structures. PLoS Comput. Biol., 5, 10.1371/journal.pcbi.1000502.
28. Albrecht,M., Sharma,C.M., Reinhardt,R., Vogel,J. and Rudel,T.(2010) Deep sequencing-based discovery of the Chlamydiatrachomatis transcriptome. Nucleic Acids Res., 38, 868–877.
Nucleic Acids Research, 2012, Vol. 40, No. 5 2029
Ergebnisse 25
29. Wurtzel,O., Sapra,R., Chen,F., Zhu,Y., Simmons,B.A. andSorek,R. (2010) A single-base resolution map of an archaealtranscriptome. Genome Res., 20, 133–141.
30. Mitschke,J., Georg,J., Scholz,I., Sharma,C.M., Dienst,D.,Bantscheff,J., Voss,B., Steglich,C., Wilde,A., Vogel,J. et al. (2011)An experimentally anchored map of transcriptional start sitesin the model cyanobacterium Synechocystis sp. PCC6803.Proc. Natl Acad. Sci. USA, 108, 2124–2129.
31. Schluter,J.P., Reinkensmeier,J., Daschkey,S., Evguenieva-Hackenberg,E., Janssen,S., Janicke,S., Becker,J.D., Giegerich,R.and Becker,A. (2010) A genome-wide survey of sRNAs in thesymbiotic nitrogen-fixing alpha-proteobacterium Sinorhizobiummeliloti. BMC Genomics, 11, 1111–1245.
32. Fenselau,S. and Bonas,U. (1995) Sequence and expression analysisof the hrpB pathogenicity operon of Xanthomonas campestris pv.vesicatoria which encodes eight proteins with similarity tocomponents of the Hrp, Ysc, Spa, and Fli secretion systems.Mol. Plant-Microbe Interact., 8, 845–854.
33. Burgess,R.R. and Anthony,L. (2001) How sigma docks to RNApolymerase and what sigma does. Curr. Opin. Microbiol., 4,126–131.
34. Findeiß,S., Schmidtke,C., Stadler,P.F. and Bonas,U. (2010) Anovel family of plasmid-transferred anti-sense ncRNAs. RNABiol., 7, 120–124.
35. Barrick,J.E., Corbino,K.A., Winkler,W.C., Nahvi,A., Mandal,M.,Collins,J., Lee,M., Roth,A., Sudarsan,N., Jona,I. et al. (2004)New RNA motifs suggest an expanded scope for riboswitches inbacterial genetic control. Proc. Natl Acad. Sci. USA, 101,6421–6426.
36. Wang,J.X. and Breaker,R.R. (2008) Riboswitches that senseS-adenosylmethionine and S-adenosylhomocysteine. Biochem. CellBiol., 86, 157–168.
37. Winkler,W.C. and Breaker,R.R. (2005) Regulation of bacterialgene expression by riboswitches. Annu. Rev. Microbiol., 59,487–517.
38. Crossman,L.C., Gould,V.C., Dow,J.M., Vernikos,G.S.,Okazaki,A., Sebaihia,M., Saunders,D., Arrowsmith,C., Carver,T.,Peters,N. et al. (2008) The complete genome, comparative andfunctional analysis of Stenotrophomonas maltophilia reveals anorganism heavily shielded by drug resistance determinants.Genome Biol., 9, R74.
39. da Silva,A.C., Ferro,J.A., Reinach,F.C., Farah,C.S., Furlan,L.R.,Quaggio,R.B., Monteiro-Vitorello,C.B., Van Sluys,M.A.,Almeida,N.F., Alves,L.M. et al. (2002) Comparison of thegenomes of two Xanthomonas pathogens with differing hostspecificities. Nature, 417, 459–463.
40. Remenant,B., Coupat-Goutaland,B., Guidot,A., Cellier,G.,Wicker,E., Allen,C., Fegan,M., Pruvost,O., Elbaz,M., Calteau,A.et al. (2010) Genomes of three tomato pathogens within theRalstonia solanacearum species complex reveal significantevolutionary divergence. BMC Genomics, 11, 379.
41. El Yacoubi,B., Brunings,A.M., Yuan,Q., Shankar,S. andGabriel,D.W. (2007) In planta horizontal transfer of a majorpathogenicity effector gene. Appl. Environ. Microbiol., 73,1612–1621.
42. Makarova,K.S., Wolf,Y.I. and Koonin,E.V. (2009)Comprehensive comparative-genomic analysis of type 2toxin-antitoxin systems and related mobile stress response systemsin prokaryotes. Biol. Direct, 4, 10.1186/1745-6150-1184-1119.
43. Washietl,S., Findeiß,S., Muller,S.A., Kalkhof,S., von Bergen,M.,Hofacker,I.L., Stadler,P.F. and Goldman,N. (2011) RNAcode:robust discrimination of coding and noncoding regions incomparative sequence data. RNA, 17, 578–594.
44. Szczesny,R., Jordan,M., Schramm,C., Schulz,S., Cogez,V.,Bonas,U. and Buttner,D. (2010) Functional characterization ofthe Xcs and Xps type II secretion systems from the plantpathogenic bacterium Xanthomonas campestris pv. vesicatoria.New Phytol., 187, 983–1002.
45. Wengelnik,K., Marie,C., Russel,M. and Bonas,U. (1996)Expression and localization of HrpA1, a protein of Xanthomonascampestris pv. vesicatoria essential for pathogenicity andinduction ofthe hypersensitive reaction. J. Bacteriol., 178,1061–1069.
46. Dornenburg,J.E., Devita,A.M., Palumbo,M.J. and Wade,J.T.(2010) Widespread antisense transcription in Escherichia coli.MBio, 46, e00024–10.
47. Nakagawa,S., Niimura,Y., Miura,K. and Gojobori,T. (2010)Dynamic evolution of translation initiation mechanisms inprokaryotes. Proc. Natl Acad. Sci. USA, 107, 6382–6387.
48. Brock,J.E., Pourshahian,S., Giliberti,J., Limbach,P.A. andJanssen,G.R. (2008) Ribosomes bind leaderless mRNA inEscherichia coli through recognition of their 50-terminal AUG.RNA, 14, 2159–2169.
49. Kim,J.G., Li,X., Roden,J.A., Taylor,K.W., Aakre,C.D., Su,B.,Lalonde,S., Kirik,A., Chen,Y., Baranage,G. et al. (2009)Xanthomonas T3S Effector XopN Suppresses PAMP-TriggeredImmunity and Interacts with a Tomato Atypical Receptor-LikeKinase and TFT1. Plant Cell, 21, 1305–1323.
50. Morales,C.Q., Posada,J., Macneale,E., Franklin,D., Rivas,I.,Bravo,M., Minsavage,J., Stall,R.E. and Whalen,M.C. (2005)Functional analysis of the early chlorosis factor gene.Mol. Plant-Microbe Interact., 18, 477–486.
51. Canonne,J., Marino,D., Noel,L.D., Arechaga,I., Pichereaux,C.,Rossignol,M., Roby,D. and Rivas,S. (2010) Detection andfunctional characterization of a 215 amino acid N-terminalextension in the xanthomonas type III effector XopD.PLoS One, 5, e15773.
52. Bejerano-Sagie,M. and Xavier,K.B. (2007) The role of smallRNAs in quorum sensing. Curr. Opin. Microbiol., 10, 189–198.
53. Papenfort,K. and Vogel,J. (2010) Regulatory RNA in bacterialpathogens. Cell Host Microbe, 8, 116–127.
54. Padalon-Brauch,G., Hershberg,R., Elgrably-Weiss,M., Baruch,K.,Rosenshine,I., Margalit,H. and Altuvia,S. (2008) Small RNAsencoded within genetic islands of Salmonella typhimurium showhost-induced expression and role in virulence. Nucleic Acids Res.,36, 1913–1927.
56. Cutino-Jimenez,A.M., Martins-Pinheiro,M., Lima,W.C.,Martin-Tornet,A., Morales,O.G. and Menck,C.F. (2010)Evolutionary placement of Xanthomonadales based on conservedprotein signature sequences. Mol. Phylogenet. Evol., 54, 524–534.
57. Kalamorz,F., Reichenbach,B., Marz,W., Rak,B. and Gorke,B.(2007) Feedback control of glucosamine-6-phosphate synthaseGlmS expression depends on the small RNA GlmZ and involvesthe novel protein YhbJ in Escherichia coli. Mol. Microbiol., 65,1518–1533.
58. Urban,J.H. and Vogel,J. (2008) Two seemingly homologousnoncoding RNAs act hierarchically to activate glmS mRNAtranslation. PLoS Biol., 6, e64.
59. Vogel,J., Argaman,L., Wagner,E.G. and Altuvia,S. (2004) Thesmall RNA IstR inhibits synthesis of an SOS-induced toxicpeptide. Curr. Biol., 14, 2271–2276.
60. Davis,B.M. and Waldor,M.K. (2007) RNase E-dependentprocessing stabilizes MicX, a Vibrio cholerae sRNA. Mol.Microbiol., 65, 373–385.
61. Cui,Y., Chatterjee,A., Liu,Y., Dumenyo,C.K. and Chatterjee,A.K.(1995) Identification of a global repressor gene, rsmA, of Erwiniacarotovora subsp. carotovora that controls extracellular enzymes,N-(3-oxohexanoyl)-L-homoserine lactone, and pathogenicity insoft-rotting Erwinia spp. J. Bacteriol., 177, 5108–5115.
62. Liu,Y., Cui,Y., Mukherjee,A. and Chatterjee,A.K. (1998)Characterization of a novel RNA regulator of Erwinia carotovorassp. carotovora that controls production of extracellular enzymesand secondary metabolites. Mol. Microbiol., 29, 219–234.
63. Cui,Y., Chatterjee,A., Yang,H. and Chatterjee,A.K. (2008)Regulatory network controlling extracellular proteins in Erwiniacarotovora subsp. carotovora: FlhDC, the master regulator offlagellar genes, activates rsmB regulatory RNA production byaffecting gacA and hexA (lrhA) expression. J. Bacteriol., 190,4610–4623.
64. Berezikov,E., Thuemmler,F., van Laake,L.W., Kondova,I.,Bontrop,R., Cuppen,E. and Plasterk,R.H. (2006) Diversity ofmicroRNAs in human and chimpanzee brain. Nat. Genet., 38,1375–1377.
2030 Nucleic Acids Research, 2012, Vol. 40, No. 5
26 Ergebnisse
65. Bailey,T.L. and Elkan,C. (1995) The value of prior knowledge indiscovering motifs with MEME. Proc. Int. Conf. Intell. Syst. Mol.Biol., 3, 21–29.
67. Hertel,J., de Jong,D., Marz,M., Rose,D., Tafer,H., Tanzer,A.,Schierwater,B. and Stadler,P.F. (2009) Non-coding RNAannotation of the genome of Trichoplax adhaerens.Nucleic Acids Res., 37, 1602–1615.
68. Will,S., Reiche,K., Hofacker,I.L., Stadler,P.F. and Backofen,R.(2007) Inferring noncoding RNA families and classes by means ofgenome-scale structure-based clustering. PLoS Comput. Biol., 3,e65.
69. Buttner,D., Nennstiel,D., Klusener,B. and Bonas,U. (2002)Functional analysis of HrpF, a putative type III transloconprotein from Xanthomonas campestris pv. vesicatoria. J. Bacteriol.,184, 2389–2398.
70. Rossier,O., Van den Ackerveken,G. and Bonas,U. (2000) HrpB2and HrpF from Xanthomonas are type III-secreted proteins andessential for pathogenicity and recognition by the host plant.Mol. Microbiol., 38, 828–838.
71. Canteros,B.I. (1990), Ph.D. thesis. University of Florida,Gainesville, FL.
72. Menard,R., Sansonetti,P.J. and Parsot,C. (1993) Nonpolarmutagenesis of the ipa genes defines IpaB, IpaC, and IpaDas effectors of Shigella flexneri entry into epithelial cells.J. Bacteriol., 175, 5899–5906.
73. Bonas,U., Stall,R.E. and Staskawicz,B. (1989) Genetic andstructural characterization of the avirulence gene avrBs3 fromXanthomonas campestris pv. vesicatoria. Mol. Gen. Genet., 218,127–136.
74. Huguet,E., Hahn,K., Wengelnik,K. and Bonas,U. (1998) hpaAmutants of Xanthomonas campestris pv. vesicatoria are affected inpathogenicity but retain the ability to induce host-specifichypersensitive reaction. Mol. Microbiol., 29, 1379–1390.
75. Figurski,D.H. and Helinski,D.R. (1979) Replication of anorigin-containing derivative of plasmid RK2 dependent on aplasmid function provided in trans. Proc. Natl Acad. Sci. USA,76, 1648–1652.
76. Gardner,P.P., Daub,J., Tate,J., Moore,B.L., Osuch,I.H., Griffiths-Jones,S., Finn,R.D., Nawrocki,E.P., Kolbe,D.L., Eddy,S.R. et al.(2010) Rfam: Wikipedia, clans and the ‘decimal’ release. NucleicAcids Res., 39, D141–145.
Nucleic Acids Research, 2012, Vol. 40, No. 5 2031
Ergebnisse 27
2.1.1.1. Anlagen zu Publikation 1
Die folgenden ‚Supplementary Data‘ enthalten Zusatzinformationen zu Kapitel 2.1.1.: ‚Supporting Information‘, Abbildung S1 bis S4 und Referenzen. Die Tabellen S1 bis S9 sind im Anhang aufgeführt.
Supporting Information SI Materials and Methods RNA isolation for 454 pyrosequencing, Northern blot and RACE analysis. RNA was extracted for 454 pyrosequencing as follows: Xcv strains 85-10 and 85* were grown in NYG medium to exponential growth phase (OD600 = 0.6). Then, 10 ml stop-solution (95% ethanol, 5% phenol) was added to 40 ml bacterial culture which was snap-frozen in liquid nitrogen, thawn on ice and centrifuged. Cells were resuspended in 6 ml buffer (0.02 M sodium acetate pH 5.5, 0.5% SDS, 1 mM EDTA). RNA was isolated by addition of 6 ml phenol, preheated to 60°C, followed by two chloroform extractions. The RNA was precipitated at -80°C overnight with 2.1 volumes of an ethanol/0.15 M sodium acetate solution. After centrifugation, the RNA was washed with 70% ethanol, dried, resuspended in water and treated with DNase I (Roche) followed by phenol-chloroform extraction. For RACE and Northern blot analyses, RNA was isolated from NYG-grown Xcv strains at exponential and both exponential and stationary (OD600 = ~1.5) growth phase, respectively, and treated with DNase I (Roche) as described (1).
RACE analyses. RACE analyses (see Table 1) were carried out as described (2) with the following modifications: Reverse transcription was performed with 2 µg RNA, the Thermoscript RT system (Invitrogen) and a gene-analysis. Oligonucleotides used for RACE analyses are listed in Table S1. RACE-PCR was performed with Hotstar Taq-Polymerase (Qiagen). Cycling conditions: 95°C/15 min; 35 cycles of 95°C/40ss, 58°C/40 s, 72°C/40 s; 72°C/7 min. PCR products were cloned into pCR2.1-TOPO and transformed into E. coli (Invitrogen). Bacterial colonies were screened by colony PCR with vector-specific primers (see Table S1). Plasmid DNA was DNA sequencer (Applied Biosystems). Construction of cDNA libraries for dRNA-seq and 454 pyrosequencing. Equal amounts of RNA from Xcv strains 85-10 and 85* were mixed. Next, we constructed dRNA-seq libraries as described (3). Briefly, primary transcripts of total RNA were enriched by a selective
mono- TM P-dependent exonuclease (Epicentre). Prior to cDNA library construction, equal amounts of Xcv RNA were incubated 60 min at 30°C with terminator exonuclease (for generation of cDNA-library 2) or in buffer (for generation of cDNA-library 1). We used 1 unit terminator exonuclease per g total RNA. Following organic extraction (25:24:1 v/v phenol/chloroform/isoamyalcohol), RNA was precipitated overnight with 2.5 volumes of an ethanol/0.1 M sodium acetate (pH 6.5) solution, and treated with 1 unit TAP (tobacco acid pyrophosphatase) (Epicentre) fo mono-phosphates for linker ligation, and again purified by organic extraction and precipitation as above. cDNA libraries for 454 pyrosequencing were constructed by vertis Biotechnology AG, Germany (http://www.vertisbiotech.com/) as described for eukaryotic microRNA (4) but omitting RNA size-fractionation prior to cDNA synthesis. Briefly, equal amounts of RNA treated with terminator exonuclease and untreated RNA, respectively, were poly(A)-tailed using poly(A) polymerase, followed by ligation of an RNA adapter to the 5´ P-RNA fragments. First-strand cDNA synthesis was performed using an oligo(dT)-adapter primer and M-MLV RNase H- reverse transcriptase. Incubation temperatures were 42°C for 20 min, ramp to 55°C, followed by 55°C for 5 min. The cDNAs were PCR-amplified to yield a concentration of 20-30 ng/ l using a high fidelity DNA polymerase. Libraries were generated for the 454 FLX and Titanium kits. Each library contains a specific barcode sequence,
: For FLX libraries, CCGA and CGCA were used as barcode tags for library 1 and 2, respectively. For Titanium libraries, ACGTGC and AGCGTA were used as barcode tags for library 1 and 2, respectively. 454 pyrosequencing was performed on a Roche 454 sequencer using FLX and Titanium chemistry at the Max Planck Institute for Molecular Genetics (Berlin, Germany). For library 1, a total of 62,056 and 98,293 reads was
28 Ergebnisse
sequenced using the FLX and Titanium kits, respectively. For library 2, a total of 51,091 and 98,505 reads was sequenced using the FLX and Titanium kits, respectively.
Sequence mapping. -end-linker sequences were clipped, and reads with a poly(A) content of
> 70% were discarded to prevent mapping errors. The remaining reads, including poly(A) tails and the adapter sequence, were aligned to the genome sequence of Xcv strain 85-10 using the segemehl
program (parameter settings E 10 A 65 D 1 H 2) (5). Mapped reads were post-processed by clipping
match = 2, substitution = -2 and insertion/deletion = -3) the alignment score from the start of the read to each downstream nucleotide was calculated and stored in an array. All elements stored at a position greater than the maximum score at index imax presumably correspond to the poly(A) tail and the 3 -linker sequence. Hence, the mapped read was clipped at position imax. Reads that mapped with
85% and a minimum length of 12 nt were analyzed further whereas reads mapping to rRNA or tRNA genes were excluded. Prediction of regulatory motifs and small ORFs. Promoter regions, 50 nt UTRs were scanned with MEME (6) for regulatory motifs. To identify short conserved protein coding genes in Xcv, a multiple sequence alignment of 19 bacterial genomes (see Table S8) was calculated with the Multiz package (7). The alignments were analyzed for potential coding segments using RNAcode (8) and a p-value cutoff of
Regions that overlapped with annotated genes were discarded. The remaining 265 regions were inspected for potential open reading frames starting with an ATG and ending with a canonical stop codon. If no complete ORF was detected, the RNAcode high scoring segment was extended by 51 nt up- and downstream followed by repeated analysis. The RNAcode prediction resulted in 24 potential short ORFs in Xcv (Table S7; annotation files are available at www.bioinf.uni-leipzig.de/publications/supplements/10-035). Rfam scan. The Rfam database version 10.0 was downloaded from ftp://ftp.sanger.ac.uk/pub/databases/Rfam/10.0/. To scan the Xcv genome for known noncoding RNAs the Rfam provided Perl script rfam_scan.pl with an e-value cutoff of 100 was used. Eight riboswitches (FMN, SAH, Glycine, SAM, Cobalamin, TPP, yybP-ykoY) and five RNAs (RNase P, SRP, tmRNA, 6S-RNA, RrT) were identified (see Table S6). Annotation files are available at http://www.bioinf.uni-leipzig.de/publications/supplements/10-035. Homology analysis. Homology searches were based on scans of the bacterial NCBI genome database (ftp://ftp.ncbi.nih.gov/genomes/Bacteria/; downloaded 08/02/2010). To identify homologs of Xcv sRNA genes, Gotohscan (9) was used. Results were aligned with RNAclust, which is based on the LocARNA algorithm (10), and visualized with the SoupViewer (www.bioinf.uni-leipzig.de/software.html). Alignments of the analyzed Xcv sRNAs are available at http://www.bioinf.uni-leipzig.de/publications/supplements/10-035. Protein detection. The analysis of type III secretion was performed with Xcv strains incubated in minimal medium A as described (11). Total cell extracts and culture supernatants were concentrated 10 and 100 times, respectively, and were analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting. For protein detection, specific polyclonal antibodies directed against HrpF (11), HrcJ (12) and GroEL (Stressgen) were used. A horseradish peroxidase-labeled anti-rabbit antibody (Amersham Pharmacia Biotech) was used as secondary antibody. The antibody reactions were visualized by enhanced chemiluminescence (Amersham Pharmacia Biotech).
Ergebnisse 29
For detection of the sX6-c-Myc protein, total cell extracts of NYG-grown bacteria (harvested at OD600 = 0.7) were concentrated 10-fold and analyzed by SDS-PAGE and immunoblotting using PVDF membranes. sX6-c-Myc was visualized with a monoclonal anti-c-Myc antibody (Roche) and a horseradish peroxidase-labeled anti-mouse secondary antibody (Amersham Pharmacia Biotech) by enhanced chemiluminescence (Amersham Pharmacia Biotech). References 1. Hartmann, R.K., Bindereif, A., Schön, A. and Westhof, E. (2005) Handbook of RNA biochemistry.
Wiley-VCH, Weinheim, Germany, 2, 636-637. 2. Argaman, L., Hershberg, R., Vogel, J., Bejerano, G., Wagner, E.G., Margalit, H. and Altuvia, S.
(2001) Novel small RNA-encoding genes in the intergenic regions of Escherichia coli. Curr. Biol., 11, 941-950.
3. Sharma, C.M., Hoffmann, S., Darfeuille, F., Reignier, J., Findeiss, S., Sittka, A., Chabas, S., Reiche, K., Hackermüller, J., Reinhardt, R. et al. (2010) The primary transcriptome of the major human pathogen Helicobacter pylori. Nature, 464, 250-255.
4. Berezikov, E., Thuemmler, F., van Laake, L.W., Kondova, I., Bontrop, R., Cuppen, E. and Plasterk, R.H. (2006) Diversity of microRNAs in human and chimpanzee brain. Nat. Genet., 38, 1375-1377.
5. Hoffmann, S., Otto, C., Kurtz, S., Sharma, C.M., Khaitovich, P., Vogel, J., Stadler, P.F. and Hackermüller, J. (2009) Fast mapping of short sequences with mismatches, insertions and deletions using index structures. PLoS Comput Biol, 5, 10.1371/journal.pcbi.1000502.
6. Bailey, T.L. and Elkan, C. (1995) The value of prior knowledge in discovering motifs with MEME. Proc. Int. Conf. Intell. Syst. Mol. Biol., 3, 21-29.
7. Blanchette, M., Kent, W.J., Riemer, C., Elnitski, L., Smit, A.F., Roskin, K.M., Baertsch, R., Rosenbloom, K., Clawson, H., Green, E.D. et al. (2004) Aligning multiple genomic sequences with the threaded blockset aligner. Genome Res., 14, 708-715.
8. Washietl, S., Findeiß, S., Müller, S.A., Kalkhof, S., von Bergen, M., Hofacker, I.L., Stadler, P.F. and Goldman, N. (2011) RNAcode: Robust discrimination of coding and noncoding regions in comparative sequence data. RNA, 17, 578-594.
9. Hertel, J., de Jong, D., Marz, M., Rose, D., Tafer, H., Tanzer, A., Schierwater, B. and Stadler, P.F. (2009) Non-coding RNA annotation of the genome of Trichoplax adhaerens. Nucleic Acids Res., 37, 1602-1615.
10. Will, S., Reiche, K., Hofacker, I.L., Stadler, P.F. and Backofen, R. (2007) Inferring noncoding RNA families and classes by means of genome-scale structure-based clustering. PLoS Comput. Biol., 3, e65.
11. Büttner, D., Nennstiel, D., Klüsener, B. and Bonas, U. (2002) Functional analysis of HrpF, a putative type III translocon protein from Xanthomonas campestris pv. vesicatoria. J. Bacteriol., 184, 2389-2398.
12. Rossier, O., Van den Ackerveken, G. and Bonas, U. (2000) HrpB2 and HrpF from Xanthomonas are type III-secreted proteins and essential for pathogenicity and recognition by the host plant. Mol. Microbiol., 38, 828-838.
30 Ergebnisse
05101520253035Read coverage
0 0
0.1 0.1
0.2 0.2
0.3 0.3
0.4 0.4
0.5 0.5
0.6 0.6
0.7 0.7
0.8 0.8
0.9 0.9
1 1
Cum
mul
ativ
e fra
ctio
n of
CD
Ss
CDSs with TSS (549)CDSs without TSS (727)
128
220
301
474
629673692
353
-40 -20 60 80Position relative to the annotated tRNA 5’ end
0
0.1
0.2
0.3
0.4
Rel
ativ
e re
ad s
tart
rate
untreated librarytreated library
Read start distributionaveraged over 54 tRNAs annotated in Xcv
0 20 40 -40 -20 60 80Position relative to the annotated tRNA 5’ end
0
0.05
0.1
0.15
0.2
0.25
Rel
ativ
e re
ad s
tart
rate
untreated librarytreated library
Read start distributionaveraged over 36 tRNAs annotated in H. pylori
0 20 40
Figure S1. Averaged distribution of read starts across all annotated tRNA loci in Xcv and H. pylori, respectively. For each library, the number of read starts at any position was normalized to the total number of reads that map to tRNAs. Position 0 indicates the 5‘ ends of annotated tRNA genes and corresponds to the RNase P processing site. Although treated libraries (black) show a relative reduction of read start rates compared to untreated RNA-seq libraries (red), tRNA expression is still detected in the enriched libraries. TSSs of tRNAs are expected to be located upstream of position 0.
Figure S1
Figure S2
Figure S2. Coverage of CDSs with and without assigned TSSs in Xcv.The plot displays the coverage of the first 100 nt of selected CDSs that are assumed to possess an own promoter since upstream genes are encoded on the opposite strand. The y-axis indicates the cummulative fraction of CDSs that exhibit a certain coverage in each data set. Numbers of CDSs with 0- up to 4-fold coverage are given at the corresponding positions within the plot. A successful TSS annotation depends on coverage. CDS without annotated TSS exhibit an overall lower coverage than CDSs with assigned TSS.
Ergebnisse 31
34
404
331
242
190
147
110 67501
692
881
ab
cex
pa
bc
stat
sX1
5S
bp
34
404
331
242
190
147
110 67501
692
881
5S
ab
cex
pa
bc
stat
sX10
bp
34
404
331
242
190
147
110 67501
692
881
5S
ab
cex
pa
bc
stat
sX11
bp
34
404
331
242
190
147
110 67501
692
881
ab
cex
pa
bc
stat
sX2
5S
bp
34
404
331
242
190
147
110 67501
692
881
ab
cex
pa
bc
stat
sX9
5S
bp
34
404
331
242
190
147
110 67501
692
881
ab
cex
pa
bc
stat
sX3
5S
bp
34
404
331
242
190
147
110 67501
692
881
5S
ab
cex
pa
bc
stat
sX13
bp
ab
cex
pa
bc
stat
sX7
34
404
331
242
190
147
110 67501
692
881
5S
bp
34
404
331
242
190
147
110 67501
692
881
5S
ab
cex
pa
bc
stat
sX15
bp
Figu
re S
3 (C
ontin
ued)
32 Ergebnisse
34
404
331
242
190
147
110 67501
692
881
5S
ab
cex
pa
bc
stat
asX
3
bp
34
404
331
242
190
147
110 67501
692
881
5S
ab
cex
pa
bc
stat
asX
5
bp
34
404
331
242
190
147
110 67501
692
881
5S
ab
cex
pa
bc
stat
asX
2
bp
34
404
331
242
190
147
110 67501
692
881
5S
ab
cex
pa
bc
stat
asX
7
bp
34
404
331
242
190
147
110 67501
692
881
5S
ab
cex
pa
bc
stat
asX
1
bp
34
404
331
242
190
147
110 67501
692
881
5S
ab
cex
pa
bc
stat
asX
6
bp
Figu
re S
3. E
xpre
ssio
n of
inte
rgen
ic s
RN
As
and
antis
ense
RN
As
in X
cv.T
otal
RN
A is
olat
ed
from
exp
onen
tial
(exp
) an
d st
atio
nary
pha
se c
ultu
res
(sta
t) of
(a)
Xcv
stra
in 8
5-10
, (b
) 85
-10
expr
essi
ng h
rpG
* fro
m p
FG72
-1 a
nd (c
) 85-
10∆h
rpX
car
ryin
g pF
G72
-1 w
as a
naly
zed
by N
orth
ern
blot
. Arr
ows
and
squa
res
indi
cate
sig
nals
cor
resp
ondi
ng t
o th
e ex
pect
ed f
ull-l
engt
h R
NA
and
proc
essi
ng p
rodu
cts
obta
ined
by
trans
crip
tom
e-se
quen
cing
, res
pect
ivel
y. A
ster
isks
mar
k th
e si
ze
of e
xpec
ted
sign
als
acco
rdin
g to
the
sequ
enci
ng d
ata.
Circ
les
deno
te la
rger
sig
nals
than
exp
ecte
d.
5S rR
NA
(low
er p
anel
) was
pro
bed
as lo
adin
g co
ntro
l.
Figu
re S
3
Ergebnisse 33
3
4
5
6
7
8
9
2 4 6 8 10
wt∆sX12
2
Time post inoculation (d)
Log
(CFU
cm
-2)
25
55
TE
kDa
α-GroEL
α-HrcJ
α-HrpF100
wt (e.v.
)
∆sX12
(psX
12)
∆sX12
(e.v.
)
wt (e.v.
)
∆sX12
(psX
12)
∆sX12
(e.v.
)
SNA B
Figure S4
Figure S4. Deletion of sX12 does not affect in planta growth and type III secretion. A. In planta growth of an sX12 mutant strain. Xcv wild type strain 85-10 (wt) and an sX12 deletion mutant (∆sX12) were inoculated at a density of 104 CFU ml-1 into leaves of susceptible ECW pepper plants. Bacterial growth was determined over a period of 10 days. Data points indicate the mean of three samples from three different plants. Error bars represent standard deviations. B. Analysis of type III secretion. Xcv strain 85-10 carrying empty vector pLAFR6 [wt (e.v.)], an sX12 deletion mutant [∆sX12 (e.v.)] and a complemented strain [∆sX12 (psX12)] were incubated in secretion medium. The respective strains additionally express hrpG* from pFG72-1. Total protein extracts (TE) and culture supernatants (SN) were analyzed by immunoblotting using antibodies directed against HrpF, HrcJ and GroEL.
34 Ergebnisse
2.1.1.2. Zusammenfassung der Ergebnisse
Der vorangegangene Artikel beschreibt die dRNA-Seq-basierte Identifizierung von TSSs und ncRNAs
im Xcv Stamm 85-10. Die 454-Pyrosequenzierung ergab insgesamt 310.000 ‚reads‘, von denen
90.000, exklusive der ‚reads‘ für tRNAs und rRNAs, dem Xcv Genom zugewiesen werden konnten.
Mittels eines neuartigen automatisierten Ansatzes zur Identifizierung von TSSs wurden 1.372 und 49
potentielle TSSs im Xcv Chromosom bzw. im Plasmid pXCV183 identifiziert. Die Klassifizierung der
TSSs anhand ihrer Lokalisierung ergab 345 ‚antisense TSSs‘, welche auf dem Gegenstrang
proteinkodierender Gene lokalisiert sind, sowie 426 ‚interne TSSs‘, die in annotierten ORFs lokalisiert
sind. 831 der identifizierten TSSs repräsentieren vermutlich die TSSs von 17,35% der 4.726 in Xcv
annotierten ORFs. Die korrespondierenden Xcv mRNAs enthalten keine konservierte SD-Sequenz und
weisen überwiegend 5‘-UTR Längen von 20-30 Nt auf. Dagegen weisen 14% und 13% der Xcv
mRNAs keine bzw. ungewöhnlich lange 5‘-UTRs (150-300 Nt) auf. Lange 5‘-UTRs wurden auch für
sechs mRNAs identifiziert, die Typ III Effektoren kodieren. Mittels bioinformatischer Analysen der
Xcv Genomsequenz und der dRNA-Seq Daten wurden fünf in Bakterien konservierte RNAs mit
vermutlich generellen zellulären Funktionen sowie acht potentielle Riboswitches identifiziert. Durch
manuelle Sichtung der Sequenzierdaten und Northern Blot Analysen wurden 15 neue sRNAs, die
konservierte 6S RNA sowie acht cis-kodierte asRNAs, einschließlich PtaRNA1 (s. Kapitel 2.2.1.),
nachgewiesen. Zudem konnte gezeigt werden, dass die potentielle sRNA sX6 ein Protein kodiert,
wohingegen die anderen sRNAs nicht-kodierend sind. Für die meisten sRNAs und asRNAs wurden in
Xcv mögliche Prozessierungsprodukte detektiert, deren Abundanz abhängig von HrpG und/ oder HrpX
oder der Wachstumsphase verändert war. Die Ko-Regulation der Expression bzw. Akkumulation von
fünf sRNAs und drei asRNAs mit dem T3S System lässt eine Rolle in der Virulenz von Xcv vermuten
und wurde am Beispiel der sRNA sX12 näher untersucht. Die Deletion des sX12 Gens hatte eine
verminderte Virulenz von Xcv in suszeptiblen und eine verzögerte HR Induktion in resistenten
Pflanzen zur Folge, welche durch ektopische Expression von sX12 komplementiert werden konnte.
Das in planta Wachstum der sX12 Deletionsmutante und Xcv 85-10 war vergleichbar. Zudem wurde
nachgewiesen, dass die in vitro Typ III Sekretion des Translokonproteins HrpF bzw. die
Akkumulation des HrcJ Proteins, einer zytoplasmatischen Komponente des T3S Systems, nicht durch
die Deletion von sX12 beeinflusst wird.
Ergebnisse 35
2.2. Bioinformatische Charakterisierung der Xcv asRNA PtaRNA1
The genome of Xanthomonas camp-estris pv. vesicatoria encodes a con-
stitutively expressed small RNA, which we designate PtaRNA1, “Plasmid trans-ferred anti-sense RNA”. It exhibits all hallmarks of a novel RNA antitoxin that proliferates by frequent horizontal transfer. It shows an erratic phyloge-netic distribution with occurrences on chromosomes in a few individual strains distributed across both beta- and gamma-proteobacteria. Moreover, a homologous gene located on plasmid pMATVIM-7 of Pseudomonas aeruginosa is found. All ptaRNA1 homologs are located anti-sense to a putative toxin, which in turn is never encountered without the small RNA. The secondary structure of PtaRNA1, furthermore, is very similar to that of the FinP anti-sense RNA found on F-like plasmids in Escherichia coli.
Introduction
Several toxin-antitoxin systems of type 1, in which the toxin is a short protein and the antitoxin an anti-sense RNA and of type 2, where both elements are proteins, are frequently found in both prokaryotic chromosomes and plasmids.1-4 The para-digmatic example for type 1 is the plas-mid encoded hok/sok system in Escherichia coli and its close relatives. The toxin-encoding stable mRNA encodes a protein that rapidly leads to cell-death unless its translation is suppressed by a short-lived small RNA. The plasmid encoded mod-ule prevents the growth of plasmid-free offsprings thus ensuring the persistence of the plasmid in the population: After
cell division, plasmid-free cells still con-tain the stable toxin mRNA, while the comparably unstable antitoxin is quickly depleted. It is poorly understood how the chromosomally encoded systems func-tion. Interestingly, the SOS-induced genes tisB and symE are expressed under very specific stress conditions. The corre-sponding antitoxins (SymR and Sib) are constitutively expressed.
Although distinct toxin-antitoxin sys-tems have been found in widely separated bacterial groups (e.g., hok/sok in E. coliand txpA/ratA in Bacillus subtilis5), each of the known examples exhibits a very narrow phylogenetic distribution.
In this contribution we characterize by computational means a small RNA that has all the hallmarks of the known type 1 toxin-antitoxin systems but shows a rather wide spread erratic phylogenetic distribu-tion that hints at frequent horizontal gene transfers.
Results
The founding member, PtaRNA1 (“Plasmid transferred anti-sense RNA”), of the family was detected in a library of pyrosequencing data of Xanthomonas campestris pv. vesicatoria strain 85-10 (Xcv) that was prepared and analyzed for unrelated purposes. The superposi-tion of the individual reads revealed a small RNA encoded adjacent to the trbLgene. Expression and approximate size of the small RNA was verified by northern blot (Fig. 1). These analyses revealed a constitutive expression with respect to the tested growth phases. Interestingly,
A novel family of plasmid-transferred anti-sense ncRNAs
Sven Findeiß,1,* Cornelius Schmidtke,2 Peter F. Stadler1,3-6 and Ulla Bonas2
1BioinformaticsGroup; Department of Computer Science; and InterdisciplinaryCenter for Bioinformatics; University of Leipzig; Leipzig, Germany; 2Institute of Biology; Department of Genetics; Martin-Luther-University Halle-Wittenberg; Halle, Germany; 3Max-Planck-Institute for Mathematics in the
Sciences; Leipzig, Germany; 4Institute for Theoretical Chemistry; University of Vienna; Wien, Austria; 5Fraunhofer Institute for Cell Therapy und Immunology;
Leipzig, Germany; 6Santa Fe Institute; Santa Fe, NM USA
36 Ergebnisse
www.landesbioscience.com RNA Biology 121
RNA FAMILIES RNA FAMILIES
and rearrangement events within this species.6
Conspicuously, ptaRNA1 was not found in other closely related genomes, e.g., other strains of Burkholderia, Pseudomonas or Xanthomonas. This distinguishes PtaRNA1 from most other bacterial small RNAs, such as the cyanobacteria-specific Yfr RNAs.7 In addition to the chromosomal loci listed above, we found a ptaRNA1 homolog in the P. aeruginosa plasmid pMATVIM-7, adjacent to the transfer region, a gene cluster that encodes proteins of unknown function and the plasmid stabilization protein ParE. Figure 2A depicts the align-ment and the resulting consensus second-ary structure of all detected PtaRNA1 homologs.
Phylogenetic analysis of the PtaRNA1 sequences (Fig. 3) shows that the
two bands which indicate procession of the full length PtaRNA1 are detected in the exponential but not in the stationary growth phase.
Chromosomally encoded homologs of ptaRNA1 were found in beta-proteobacte-ria (Nitrosomonas eutropha C91, Azoarcus sp. EbN1, Verminephrobacter eiseniaeEF01-2, Burkholderia cenocepacia J2315, B. pseudomallei K96243, B. pseudomal-lei 9, B. pseudomallei 91, and Acidovorax JS42) as well as gamma-proteobacteria (X. campestris pv. vasculorum NCPPB702, Shigella flexneri 2a 2457T, Acinetobacter baumannii ATCC 17978, Marinobacter aquaeolei VT8, and Pseudomonas aerugi-nosa UCBPP-PA14). Two ptaRNA1 cop-ies were found in N. eutropha C91 and are named ptaRNA1-a and ptaRNA1-b. This observation is in accordance with various reported insertion, duplication
Figure 1. Expression of PtaRNA1 and 5S RNA in exponential and stationary growth phase of Xcv analysed by northern blot. The size of corresponding marker bands is indicated on the left.
Figure 2. (A) Consensus secondary structure model of PtaRNA1 based on the depicted seed alignment. The structure is highly stable (minimum free energy -37 kcal/mol) and supported by various compensatory mutations within the stem on the right-hand side. Marked in blue is the region complementary to the putative Shine-Dalgarno sequence of the XCV2162 mRNA. (B) Amino acid alignment of XCV2162 homologs. The alignment shows various totally (indicated by ‘*’) and by substitutions (indicated by ‘:’ and ‘.’) supported and therefore conserved columns. The protein topology of a trans-membrane domain, predicted by MEMSAT3,8 is indicated as well. ‘+’ marks inside loop, ‘ ’ outside loop, ‘O’ outside helix cap, ‘X’ central trans-membrane helix segment and ‘I’ inside cap. The truncated Verminephrobacter sequence was not used for the calculation of the conservation track.
Ergebnisse 37
122 RNA Biology Volume 7 Issue 2
only ptaRNA1 encoding species in which no trbL homolog was found.
Analysis of the putative ptaRNA1 pro-moter regions revealed the existence of two highly conserved sequence motifs of eight nucleotides. The first one starts between 42 and 36 nt upstream and the other 13/12 nt upstream of the transcrip-tion start corresponding to the -35 and -10 box, respectively (Fig. 4). In the upstream region of XCV2162, an ultra conserved AG-rich motif was found (Fig. 4), prob-ably representing the Shine-Dalgarno sequence of the mRNA. This motif is entirely covered by the complementary ptaRNA1 sequence (Fig. 2A).
The consensus secondary structure of PtaRNA1 consists of a 5'-stem loop and a long 3' stem which presumably acts as terminator hairpin, (Fig. 2A). This struc-ture is very similar to that of FinP found in E. coli (data not shown). Interestingly, FinP is the anti-sense regulator of TraJ, a transcriptional activator required for expression of various conjungative pro-tein components.9 Thus, FinP is only one component in a complex network of sev-eral interacting molecules.
Discussion
All evidence available for PtaRNA1 sug-gests that XCV2162/ptaRNA1 is a novel toxin-antitoxin system: both genes are only found as combined cluster and in fact do not appear as single genes; XCV2162 encodes a relatively short pro-tein that shows the typical topology of toxins with a trans-membrane domain; the presence on a plasmid in combination with the erratic phylogenetic distribution of the system indicates a frequent hori-zontal gene transfer. It is known that type 2 systems, where both molecules are pro-teins, show an erratic phylogenetic distri-bution.4 We assume that this might also be the case for type 1 systems, such as the one presented here.
Furthermore, the phylogenetic distri-bution of the XCV2162/ptaRNA1 pair indicates a very rapid loss of the chro-mosomal homologs: the erratic distribu-tion suggests that we only see very recent chromosomal insertions. The homolog in Verminephrobacter with its trun-cated XCV2162 coding sequence might
whose uncharacterized gene p07-406.22is an ortholog of XCV2162, as in Xcvadjacent to trbL (Fig. 4). According to MEMSAT38 prediction,XCV2162 con-tains a trans-membrane domain (Fig. 2B), as it is also the case for many reported toxic proteins.3,4
Furthermore, the gene phylogeny of the XCV2162 proteins (not shown) is con-gruent with the phylogeny of PtaRNA1 sequences, indicating that they are trans-ferred together. We observed a frequent co-occurrence of ptaRNA1/XCV2162 and trbL homologs, albeit trbL was detected in at least 155 eubacterial genomes, sug-gesting that trbL might have a role in the frequent chromosomal insertions of the ptaRNA1/XCV2162 system. In V. eiseniaeEF01-2 we found a truncated XCV2162homolog. Verminephrobacter is also the
phylogeny of the PtaRNA1 sequences is not congruent with the phylogeny of their “host” species. This indicates that the proliferation of ptaRNA1 depends on fre-quent horizontal transfer, presumably by means of plasmids.
The ptaRNA1 gene in Xcv is located anti-sense to a so far uncharacterized pro-tein coding gene (XCV2162). The gene is adjacent to trbL, encoding a type IV secretion system protein. The small over-lap of both genes strongly suggests that PtaRNA1 is an anti-sense regulator of XCV2162 (Fig. 4). We therefore searched the complete set of eubacterial genomes for homologs of XCV2162 and found that ptaRNA1 and XCV2162 co-occur in all cases, indicating their functional link-age. This is in particular also the case in the P. aeruginosa plasmid pMATVIM-7,
Figure 3. Phylogenetic tree based on PtaRNA1 alignment (similar for XCV2162 alignment, data not shown). Class of the “host” species is shown by the symbols on the right hand side. Numbers indicate bootstrap values of the inner nodes.
38 Ergebnisse
www.landesbioscience.com RNA Biology 123
In order to keep the list of references at reasonable length, we had to give priority to reviews and recent publications.
Note
Supplementary materials can be found at:www.landesbioscience.com/supple-ment/FindeissRNA7-2-Sup.txt
References1. Gerdes K, Wagner EGH. RNA antitoxin. Cur Op
3. Fozo EM, Hemm MR, Storz G. Small toxic proteins and the antisense RNAs that repress them. Microbiol Mol Biol Rev 2008; 72:579-89.
4. Makarova KS, Wolf YI, Koonin EV. Comprehensive comparative-genomic analysis of type 2 toxin-antitox-in systems and related mobile stress response systems in prokaryotes. Biol Direct 2009; 4:19.
5. Silvaggi JM, Perkins JB, Losick R. Small untranslated RNA antitoxin in Bacillus subtilis. J Bacteriol 2005; 187:6641-50.
6. Stein LY, et al. Whole-genome analysis of the ammo-nia-oxidizing bacterium, Nitrosomonas eutropha C91: implications for niche adaptation. Environ Microbiol 2007; 9:2993-3007.
7. Voss B, Gierga G, Axmann IM, Hess WR. A motif-based search in bacterial genomes identifies the ortholog of the small RNA Yfr1 in all lineages of cyanobacteria. BMC Genomics 2007; 8:375.
8. Nugent T, Jones DT. Transmembrane protein topol-ogy prediction using support vector machines. BMC Bioinformatics 2009; 10:159.
9. Arthur DC, Ghetu AF, Gubbins MJ, Edwards RA, Frost LS, Glover JNM. FinO is an RNA chaper-one that facilitates sense-antisense RNA interactions. EMBO J 2003; 22:6346-55.
10. Daniels MJ, Barber CE, Turner PC, Sawczyc MK, Byrde RJW, Fielding AH. Cloning of genes involved in pathogenicity of Xanthomonas campestris pv. campestrisusing the broad host range cosmid pLAFR1. EMBO J 1984; 3:3323-8.
11. Hartmann RK, Bindereif ASA, Westhof E. Handbook of RNA Biochemistry. Wiley-VCH 2005.
12. Urban JH, Vogel J. Translational control and target recognition by Escherichia coli small RNAs in vivo. Nucleic Acids Res 2007; 35:1018-37.
13. Altschul SF, et al. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 1997; 25:3389-402.
as the plasmid genome database (http://www.genomics.ceh.ac.uk/plasmiddb/downloaded 06/12/2009). Homologs of protein coding genes were searched using tblastn of the Blast package.13 Since non-coding RNAs may vary in sequence but still fold into the same secondary struc-ture a semi-global alignment implemen-tation, GotohScan,14 was used to scan for ptaRNA1 homologs. The microbial web Blast (http://www.ncbi.nlm.nih.gov/sutils/genom_table.cgi) was used to search for additional homologs especially in unfinished genome projects.
Alignments were calculated with ClustalW15 and locARNATE16 for sequence structure alignments, respec-tively. The consensus structure model was calculated with RNAalifold.17
Using, MEME18 we analyzed the 100 nt upstream region of all homologous ptaRNA1 loci. MEME searches for simi-larities among the given sequences and calculates descriptors for these motifs. To search for known regulatory sites within the 100 nt upstream region the PRODORIC database was queried using the Virtual Footprint v3.0 web tool.19
Submitted data. This manuscript documents the seed alignment ptaRNA1.seed.stk. A short summary is available as Wikipedia Entry at http://en.wikipedia.org/wiki/User:SveFinBioInf/ptaRNA1.
Acknowledgements
This work was supported by a grant from the DFG (German Research Foundation, SPP 1258) to U.B. and P.F.S.
represent the first step towards the com-plete loss of the system.
This apparent evolutionary instabil-ity further supports the hypothesis that XCV2162/ptaRNA1 is a toxin-antitoxin pair. Only chromosomal integration of the toxin-antitoxin pair makes the plas-mid dispensable. Thus, cell-death is pre-vented by chromosomal integration of the system. Plasmid-loss and subsequent destruction of the toxin XCV2162 then leaves the chromosomal copy of the anti-toxin PtaRNA1 without function, so it is also rapidly removed from the genome.
Materials and Methods
For northern blot analysis Xanthomonas campestris pv. vesicatoria strain 85-10 was cultivated at 30°C in nutrient-yeast-glyc-erol medium.10 Cells were harvested at exponential and stationary growth phase at OD of 0.6 and 1.5, respectively. RNA was extracted as described in.11 Northern blots were done according to12 with the following modifications: 20 g RNA were separated on 8.3 M urea—6% polyacryl-amide gels. For detection of PtaRNA1 and 5S rRNA membranes were incubated for 1 h at 42°C with Rapid-hybTM Buffer (GE Healthcare) containing 32P 5' end-labeled oligodeoxyribonucleotides NB39 (5'-ATG GAG AGG TGA ATC ATG GC-3') and NB5S (5'-ATG ACC TAC TCT CGC ATG GC-3'), respectively.
Homology searches were based on scans of the bacterial NCBI genome data-base (ftp://ftp.ncbi.nih.gov/genomes/Bacteria/downloaded 06/12/2009) as well
Figure 4. Surrounding genomic location of the ptaRNA1 gene in Xcv. On the plus strand the coding sequences of trbL and XCV2162 are indicated. Infront of XCV2162 an ultra conserved AG rich motif, the putative Shine-Dalgarno sequence is shown. ptaRNA1 is encoded on the minus strand. A con-served -10 as well as -35 box (sequence logos) was found directly upstream of this gene.
Ergebnisse 39
124 RNA Biology Volume 7 Issue 2
17. Bernhart SH, Hofacker IL, Will S, Gruber AR, Stadler PF. RNAalifold: improved consensus structure predic-tion for RNA alignments. BMC Bioinformatics 2008; 9:474.
18. Bailey TL, Elkan C. The value of prior knowledge in discovering motifs with MEME. Proc Int Conf Intell Syst Mol Biol 1995; 3:21-9.
19. Münch R, et al. Virtual Footprint and PRODORIC: an integrative framework for regulon prediction in prokaryotes. Bioinformatics 2005; 21:4187-9.
14. Hertel J, et al. Non-coding RNA annotation of the genome of trichoplax adhaerens. Nucleic Acids Res 2009; 37:1602-15.
15. Larkin MA, et al. Clustal W and Clustal X version 2.0. Bioinformatics 2007; 23:2947-8.
16. Otto W, Will S, Backofen R. Structure local mul-tiple alignment of RNA. In Proceedings of the German Conference on Bioinformatics (CGB 08), volume P-136 of LNI GI 2008; 178-88.
40 Ergebnisse
2.2.1.1. Zusammenfassung der Ergebnisse
Der Artikel beschreibt die bioinformatische Charakterisierung der Xcv asRNA PtaRNA1 (‚plasmid-
transferred antisense RNA 1‘), welche in der vorangegangenen dRNA-Seq Analyse (s. Kapitel 2.1.1.)
als ncRNA Kandidat identifiziert wurde. Northern Blot Analysen von Xcv 85-10 ergaben, dass
PtaRNA1 (72 Nt) in der stationären Wachstumsphase als stabiles Transkript akkumuliert, wohingegen
die RNA in der exponentiellen Wachstumsphase vermutlich prozessiert wird. In Xcv überlappt das
chromosomale ptaRNA1 Gen in antisense Orientierung mit der 5‘-Region des XCV2162 Gens, welches
ein potentielles Transmembranprotein mit unbekannter Funktion kodiert. Zudem ist ptaRNA1
benachbart zu trbL lokalisiert, welches vermutlich am konjugalen DNA Transfer beteiligt ist.
Phylogenetische Analysen ergaben, dass Orthologe von ptaRNA1 und XCV2162 in den Chromosomen
zahlreicher, nur entfernt verwandter ß- und γ-Proteobakterien konserviert sind und stets ko-
lokalisieren, jedoch nicht in nahe verwandten Bakterien vorkommen. Zudem sind die entsprechenden
Loci meist in Nachbarschaft von trbL lokalisiert. In Vertretern der Gattung Xanthomonas kommt
ptaRNA1 nur in Xcv und X. campestris pv. vasculorum vor. Der ptaRNA1 Lokus weist typische
Merkmale eines Typ I-Toxin-Antitoxin Systems auf, bei dem die Synthese eines toxischen Proteins
durch eine cis-kodierte asRNA unterdrückt wird. Die sporadische phylogenetische Verbreitung des
Lokus steht im scheinbaren Gegensatz zur hohen Sequenzkonservierung, deutet jedoch auf einen
Erwerb durch horizontalen Gentransfer hin. Hierbei spielen vermutlich Plasmide eine Rolle, da ein
entsprechender plasmidlokalisierter ptaRNA1 Lokus in P. aeruginosa vorhergesagt wurde.
Ergebnisse 41
2.3. Funktionelle Charakterisierung der Xcv sRNA sX13
2.3.1. Publikation 3
Small RNA sX13: A Multifaceted Regulator of Virulence inthe Plant Pathogen XanthomonasCornelius Schmidtke1*, Ulrike Abendroth1, Juliane Brock1, Javier Serrania2, Anke Becker2, Ulla Bonas1*
1 Institute for Biology, Department of Genetics, Martin-Luther-Universitat Halle-Wittenberg, Halle, Germany, 2 Loewe Center for Synthetic Microbiology and Department
of Biology, Philipps-Universitat Marburg, Marburg, Germany
Abstract
Small noncoding RNAs (sRNAs) are ubiquitous posttranscriptional regulators of gene expression. Using the model plant-pathogenic bacterium Xanthomonas campestris pv. vesicatoria (Xcv), we investigated the highly expressed and conservedsRNA sX13 in detail. Deletion of sX13 impinged on Xcv virulence and the expression of genes encoding components andsubstrates of the Hrp type III secretion (T3S) system. qRT-PCR analyses revealed that sX13 promotes mRNA accumulation ofHrpX, a key regulator of the T3S system, whereas the mRNA level of the master regulator HrpG was unaffected.Complementation studies suggest that sX13 acts upstream of HrpG. Microarray analyses identified 63 sX13-regulated genes,which are involved in signal transduction, motility, transcriptional and posttranscriptional regulation and virulence.Structure analyses of in vitro transcribed sX13 revealed a structure with three stable stems and three apical C-rich loops. Acomputational search for putative regulatory motifs revealed that sX13-repressed mRNAs predominantly harbor G-richmotifs in proximity of translation start sites. Mutation of sX13 loops differentially affected Xcv virulence and the mRNAabundance of putative targets. Using a GFP-based reporter system, we demonstrated that sX13-mediated repression ofprotein synthesis requires both the C-rich motifs in sX13 and G-rich motifs in potential target mRNAs. Although the RNA-binding protein Hfq was dispensable for sX13 activity, the hfq mRNA and Hfq::GFP abundance were negatively regulated bysX13. In addition, we found that G-rich motifs in sX13-repressed mRNAs can serve as translational enhancers and are locatedat the ribosome-binding site in 5% of all protein-coding Xcv genes. Our study revealed that sX13 represents a novel class ofvirulence regulators and provides insights into sRNA-mediated modulation of adaptive processes in the plant pathogenXanthomonas.
Citation: Schmidtke C, Abendroth U, Brock J, Serrania J, Becker A, et al. (2013) Small RNA sX13: A Multifaceted Regulator of Virulence in the Plant PathogenXanthomonas. PLoS Pathog 9(9): e1003626. doi:10.1371/journal.ppat.1003626
Editor: Matthew K. Waldor, Harvard University, United States of America
Received February 5, 2013; Accepted August 1, 2013; Published September 12, 2013
Copyright: � 2013 Schmidtke et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permitsunrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was supported by grants from the Deutsche Forschungsgemeinschaft to UB and AB. (SPP 1258; ‘‘Sensory and Regulatory RNAs inProkaryotes’’) and the ‘‘Graduiertenkolleg’’ (GRK 1591) to UB, and by the Bundesministerium fur Bildung und Forschung (grant 0313105) to AB. The funders hadno role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
the activity of the translational repressor protein RsmA, which
impacts on QS, the production of extracellular enzymes and
virulence [21,22,23]. In Xcv, sX12 was reported to be required
for full virulence [16].
Xanthomonads are ubiquitous plant-pathogenic bacteria that
infect approximately 120 monocotyledonous and 270 dicotyle-
donous plant species, many of which are economically
important crops [24,25]. These pathogens, usually only found
in association with plants and plant parts, differ from most
other Gram-negative bacteria in their high G+C content
(,65%), and high numbers of TonB-dependent transporters
and signaling proteins [26]. Pathogenicity of most Xanthomonas
spp. and other Gram-negative plant- and animal-pathogenic
bacteria relies on a type III secretion (T3S) system which
translocates bacterial effector proteins into the eukaryotic host
cell [27,28]. In addition, other protein secretion systems,
degradative enzymes and QS regulation contribute to virulence
of Xanthomonas spp. [29,30].
One of the models to study plant-pathogen interactions is Xcv,
the causal agent of bacterial spot disease on pepper and tomato
[31,32]. The T3S system of Xcv is encoded by the hrp2[hypersensitive response (HR) and pathogenicity] gene cluster
and translocates effector proteins into the plant cell where they
interfere with host cellular processes to the benefit of the pathogen
[29,33,34]. The mutation of hrp-genes abolishes bacterial growth
in the plant tissue and the induction of the HR in resistant plants.
The HR is a local and rapid programmed plant cell death at the
infection site and coincides with the arrest of bacterial multipli-
cation [33,35,36]. The expression of the T3S system is transcrip-
tionally induced in the plant and in the synthetic medium XVM2,
and is controlled by the key regulators HrpG and HrpX
[37,38,39,40]. The OmpR-type regulator HrpG induces tran-
scription of hrpX which encodes an AraC-type activator [39,41].
HrpG and HrpX control the expression of hrp, type III effector
and other virulence genes [16,29,40,42,43]. Recently, dRNA-seq
identified 24 sRNAs in Xcv strain 85-10, expression of eight of
which is controlled by HrpG and HrpX, including the aforemen-
tioned sX12 sRNA [15,16].
In this study, we aimed at a detailed characterization of sX13
from Xcv strain 85-10, which is an abundant and HrpG-/HrpX-
independently expressed sRNA [16]. Using mutant and comple-
mentation studies, we discovered that sX13 promotes the
expression of the T3S system and contributes to virulence of
Xcv. Microarray and quantitative reverse transcription PCR (qRT-
PCR) analyses identified a large sX13 regulon and G-rich motifs in
presumed sX13-target mRNAs. Selected putative targets were
analyzed by site-directed mutagenesis of sX13 and mRNA::gfp
fusions. Furthermore, we provide evidence that sX13 acts Hfq-
independently. Our study provides the first comprehensive
characterization of a trans-encoded sRNA that contributes to
virulence of a plant-pathogenic bacterium.
Results
sX13 contributes to bacterial virulenceThe sRNA sX13 (115 nt; [16]) is encoded in a 437-bp
intergenic region of the Xcv 85-10 chromosome, i. e., 175 bp
downstream of the stop codon of the DNA polymerase I-encoding
gene polA and 148 bp upstream of the translation start site (TLS) of
XCV4199, which encodes a hypothetical protein. Sequence
comparisons revealed that the sX13 gene is exclusively found in
members of the Xanthomonadaceae family, i. e., in the genomes of
plant-pathogenic Xanthomonas and Xylella species, the human
pathogen Stenotrophomonas maltophilia and non-pathogenic bacteria
of the genus Pseudoxanthomonas. Interestingly, sX13 homologs are
highly conserved [16] and always located downstream of polA. By
contrast, sX13-flanking sequences are highly variable.
To characterize sX13 in Xcv strain 85-10, we introduced an
unmarked sX13 deletion into the chromosome (see ‘Materials and
Methods’). Analysis of bacterial growth of the sX13 mutant strain
(DsX13) revealed a significantly reduced stationary-phase density
compared to the Xcv wild-type strain 85-10 in complex medium
(NYG; Figure 1A) and in minimal medium A (MMA; Figure 1B).
The mutant phenotype of XcvDsX13 was complemented by
chromosomal re-integration of sX13 into the sX13 locus, termed
DsX13+sX13ch (Figure 1A, B; see ‘Materials and Methods’).
To address a potential role of sX13 in virulence, we performed
plant infection assays. As shown in Figure 1C, the Xcv strains 85-10
and DsX13 grew similarly in leaves of susceptible pepper plants
(ECW). Strikingly, infection with the sX13 mutant resulted in
strongly delayed disease symptoms in susceptible and a delayed
HR in resistant pepper plants (ECW-10R) (Figure 1D). Ectopic
expression of sX13 under control of the lac promoter (psX13),
which is constitutive in Xcv [38], and re-integration of sX13 into
the DsX13 locus fully complemented the mutant phenotype of
XcvDsX13 (Figure 1D; data not shown). Strain Xcv 85-10 carrying
psX13 induced an accelerated HR in comparison to the wild type
(data not shown).
Deletion of sX13 derogates hrp-gene expressionAs the HR induction in ECW-10R plants depends on the
recognition of the bacterial type III effector protein AvrBs1 by the
plant disease resistance gene Bs1 [44,45], the in planta phenotype of
XcvDsX13 suggested a reduced activity of the T3S system. To
address this question, we investigated protein accumulation of
selected components of the T3S system. Given that T3S apparatus
proteins are not detectable in NYG-grown bacteria, we incubated
the bacteria for 3.5 hours in the hrp-gene inducing XVM2
medium [38,40]. Western blot analysis revealed reduced amounts
of the translocon protein HrpF, the T3S-ATPase HrcN and the
Author Summary
Since the discovery of the first regulatory RNA in 1981,hundreds of small RNAs (sRNAs) have been identified inbacteria. Although sRNA-mediated control of virulencewas demonstrated for numerous animal- and human-pathogenic bacteria, sRNAs and their functions in plant-pathogenic bacteria have been enigmatic. We discoveredthat the sRNA sX13 is a novel virulence regulator ofXanthomonas campestris pv. vesicatoria (Xcv), which causesbacterial spot disease on pepper and tomato. sX13contributes to the Xcv-plant interaction by promotingthe synthesis of an essential pathogenicity factor of Xcv, i.e., the type III secretion system. Thus, in addition totranscriptional regulation, sRNA-mediated posttranscrip-tional regulation contributes to virulence of plant-patho-genic xanthomonads. To repress target mRNAs carrying G-rich motifs, sX13 employs C-rich loops. Hence, sX13exhibits striking structural similarity to sRNAs in distantlyrelated human pathogens, e. g., Staphylococcus aureus andHelicobacter pylori, suggesting that structure-driven targetregulation via C-rich motifs represents a conserved featureof sRNA-mediated posttranscriptional regulation. Further-more, sX13 is the first sRNA shown to control the mRNAlevel of hfq, which encodes a conserved RNA-bindingprotein required for sRNA activity and virulence in manyenteric bacteria.
T3S-apparatus component HrcJ in XcvDsX13 compared to the
wild type, DsX13(psX13) (Figure 2A) and strain DsX13+sX13ch(selectively tested for HrcJ; Figure 2B). Thus, sX13 positively
affects the synthesis of T3S components.
As HrpG controls the expression of the hrp-regulon [39], we
analyzed whether the reduced virulence of strain DsX13 is due to a
reduced activity of HrpG. Therefore, we ectopically expressed a
constitutively active version of HrpG (HrpG*; phrpG*; [41]) in
XcvDsX13 and performed plant-infection assays. The disease
symptoms induced by XcvDsX13 and the wild type were
comparable in presence of phrpG*, whereas with low inoculum
of Xcv 85-10DsX13 the HR was slightly delayed (Figure 1D). This
suggests that HrpG* suppresses the 85-10DsX13 phenotype. HrpF,
HrcN and HrcJ protein accumulation in strain DsX13(phrpG*) wasidentical to the wild type suggesting full complementation
(Figure 2A, B).
To investigate whether the reduced protein amounts of T3S-
system components in XcvDsX13 are due to altered mRNA levels,
we performed qRT-PCR analyses. mRNA accumulation of hrpF,
hrcJ and the type III effector genes avrBs1 and xopJ was two-fold
lower in XcvDsX13 than in the wild type and the complemented
strain DsX13+sX13ch (Figure 2C). In addition, the mRNA amount
of hrpX, but not of hrpG, was reduced in the sX13 mutant
(Figure 2C). In presence of phrpG*, comparable mRNA amounts
of hrpG, hrpX, hrpF, hrcJ and xopJ were detected in Xcv 85-10,
DsX13 and DsX13+sX13ch, whereas the avrBs1 mRNA accumu-
lation was significantly reduced in strain 85-10DsX13 (Figure 2C).
Taken together, our data suggest that the reduced virulence of the
85-10DsX13 mutant is caused by a lower expression of compo-
nents and substrates of the T3S system (Figure 1D; Figure 2A–C).
The deletion and chromosomal re-insertion of sX13 in
XcvDsX13 and DsX13+sX13ch, respectively, were verified by
Northern blot using an sX13-specific probe (Figure S1). The
sX13 abundance was not affected by expression of HrpG*, which
confirms our previous findings [16] and suggests that expression of
sX13 is independent of HrpG and HrpX (Figure S1).
sX13 accumulates under stress conditionsThe expression of known bacterial sRNAs depends on a variety
of environmental stimuli, which often reflect the physiological
functions of sRNAs [2,46], e. g., the E. coli sRNA Spot42 is
repressed in the absence of glucose and regulates carbon
metabolism [47,48]. Northern blots revealed similar sX13
amounts in bacteria incubated in NYG medium at 30uC (standard
condition), in presence of H2O2, at 4uC and in NYG medium
lacking nitrogen (Figure 3A). By contrast, sX13 accumulation was
increased in presence of high salt (NaCl), 37uC and in MMA
(Figure 3A). Hence, sX13 is differentially expressed in different
growth conditions and might contribute to environmental
adaptation of Xcv.
Microarray analyses suggest a large sX13 regulonTo gain an insight into the sX13 regulon we performed
microarray analyses. For this, cDNA derived from Xcv strains 85-
10 and DsX13 grown in NYG and MMA, respectively, was used as
a probe. The hybridization data were evaluated using EMMA
2.8.2 [49] (see ‘Materials and Methods’). In XcvDsX13 grown in
NYG, 23 mRNAs were upregulated and 21 mRNAs were
downregulated by a factor of at least 1.5 compared to the wild
type (Table S2). In the MMA-grown sX13 mutant, 23 upregulated
Figure 1. sX13 contributes to bacterial growth in culture and virulence. Growth of Xcv wild type 85-10 (wt), the sX13 deletion mutant (DsX13)and DsX13 containing chromosomally re-integrated sX13 (DsX13+sX13ch) in (A) complex medium NYG and (B) minimal medium MMA, respectively.Error bars represent standard deviations. Asterisks indicate statistically significant differences compared to wt (t-test; P,0.05). (C) Growth of Xcv 85-10(wt) and DsX13 in leaves of susceptible ECW pepper plants. Data points represent the mean of three different samples from three different plants ofone experiment. Standard deviations are indicated by error bars. (D) Plant infection assay. Xcv strains 85-10 (wt) and DsX13 carrying the empty vector(pB) or the sX13 expression construct (psX13) and strains additionally expressing HrpG* (phrpG*) were inoculated at a density of 46108 (left panel)and 108 cfu/ml (right panel), respectively, into leaves of susceptible ECW and resistant ECW-10R pepper plants. Disease symptoms in ECW werephotographed 9 days post inoculation (dpi). The HR was visualized by ethanol bleaching of the leaves 3 dpi (left panel) and 18 hours post inoculation(right panel), respectively. Dashed lines indicate the inoculated areas. All experiments were performed at least three times with similar results.doi:10.1371/journal.ppat.1003626.g001
lation was two-fold increased in XcvDsX13.The microarray data suggested that most upregulated genes in
XcvDsX13 were only expressed in NYG- or MMA-grown bacteria
(Table S2), which might be explained by the P-value and signal-
strength thresholds applied for data evaluation. qRT-PCR
analyses showed that the mRNA accumulation of hfq, XCV2186,
pilG and XCV3927 was increased in both the NYG- and MMA-
Figure 2. Deletion of sX13 derogates virulence gene expres-sion. (A) Xcv strains 85-10 (wt) and the sX13 deletion mutant (DsX13)carrying the empty vector (pB) or the sX13 expression construct (psX13)and strains additionally expressing HrpG* (phrpG*) were incubated for3.5 hours in hrp-gene inducing medium XVM2. Total protein extractswere analyzed by immunoblotting using antibodies directed againstHrpF, HrcN, HrcJ and GroEL. The experiment was repeated twice withsimilar results. (B) Xcv 85-10 (wt), DsX13 and DsX13+sX13ch and strainsadditionally expressing HrpG* were incubated for 3.5 hours in hrp-geneinducing medium XVM2. Total protein extracts were analyzed byimmunoblotting using antibodies directed against HrcJ and GroEL. Theexperiment was repeated twice with similar results. (C) Indicated geneswere analyzed by qRT-PCR using RNA from cultures described in (B).The amount of each RNA in Xcv 85-10 was set to 1. Data points anderror bars represent mean values and standard deviations obtainedwith three independent biological samples. Asterisks indicate statisti-cally significant differences compared to wt (t-test; P,0.03).doi:10.1371/journal.ppat.1003626.g002
Figure 3. sX13 accumulation is altered under stress conditionsin Xcv 85-10. (A) Northern blot analysis of sX13. Exponential phasecultures of NYG-grown Xcv 85-10 were transferred to NYG medium orMMA containing the indicated additives or lacking a nitrogen or carbonsource (DN; DC). Cultures were shaken for three hours at 30uC unlessotherwise indicated. 5S rRNA was probed as loading control. (B) sX13and selected sX13-regulated genes (see Table 1) were analyzed by qRT-PCR using RNA from Xcv 85-10 (wt) cultures shown in (A) and NYG-grown DsX13. Bars represent fold-changes (log10) of mRNA amountscompared to Xcv 85-10 grown in NYG at 30uC. Experiments wereperformed twice with similar results.doi:10.1371/journal.ppat.1003626.g003
in XcvDsX13 grown in NYG compared to the wild type, whereas
the accumulation in MMA-grown cells was identical (Figure 4;
Table 1). Similarly, XCV3572, which encodes a TonB-dependent
receptor, was downregulated in NYG- but not in MMA-grown
XcvDsX13 (Figure 4; Table 1). Gene XCV3573, which is encoded
adjacent to XCV3572 and encodes an AraC-type regulator, was
also downregulated (Figure 4; Table 1). As mentioned above, sX13
positively affected the mRNA accumulation of hrpX in XVM2
medium (see Figure 2C), which was also true for bacteria grown in
NYG and MMA (Figure 4; Table 1). Since HrpX controls the
expression of many type III effector genes, we analyzed xopS [52]
by qRT-PCR and detected similarly decreased levels in NYG-
grown XcvDsX13 as for hrpX (Figure 4; Table 1). Taken together,
our data suggest that the sX13 regulon comprises genes involved
in signal transduction, motility, transcriptional and posttranscrip-
tional regulation and virulence.
Accumulation of potential target mRNAs correlates withsX13 abundanceTo address whether differential expression of sX13 under
different conditions (see Figure 3A) affects the mRNA abundance
of sX13-regulated genes, we performed qRT-PCR. We detected
elevated sX13 levels in Xcv strain 85-10 cultivated in high salt
conditions, at 37uC and in MMA compared to standard
conditions and an increased hrpX and decreased XCV3927
mRNA accumulation (Figure 3B). In addition, low amounts of
the hfq mRNA were detected in presence of high sX13 levels,
whereas the abundance of the sX13-independent XCV0612
mRNA (see Table 1) was not altered (Figure 3B).
sX13 activity does not require HfqThe hfq mRNA accumulation in XcvDsX13 (Figure 3B; Figure 4;
Table 1) prompted us to test whether sX13 activity depends on the
RNA-binding protein Hfq. For this, we introduced a frameshift
mutation into the hfq gene of Xcv strains 85-10 and 85-10DsX13.Northern blot analyses revealed comparable sX13 accumulation
in both strains and the complemented hfq mutant, which
ectopically expressed Hfq (phfq) (Figure 5A). By contrast, the
accumulation of the sRNA sX14 [16] was strongly reduced in the
hfq mutant; this was restored by phfq (Figure 5A). Unexpectedly,
the hfq mutant strain was not altered in the induction of in planta
phenotypes, i. e., in virulence (Figure 5B).
To investigate whether sX13 affects translation of putative
target mRNAs, we established a GFP-based in vivo reporter system
for Xcv similar to the one described for E. coli [53]. The
promoterless broad-host range plasmid pFX-P permits generation
of translational gfp fusions in a one-step restriction-ligation reaction
(Golden Gate cloning [54]; see ‘Materials and Methods’). We
cloned the promoter, 59-UTRs, and 10 and 25 codons of
XCV3927 and hfq, respectively, into pFX-P resulting in pFX3927
and pFXhfq. XCV3927 was selected because of a strongly increased
mRNA accumulation in XcvDsX13 compared to the wild type (see
Table 1). In presence of pFX3927 or pFXhfq, fluorescence of
XCV3927::GFP or Hfq::GFP fusion proteins was comparable in
the Xcv wild type and hfqmutant (Figure 5C). The XCV3927::GFP
and Hfq::GFP fluorescence was about 4-fold and 2-fold increased,
respectively, in XcvDsX13 compared to strain 85-10 (Figure 5C),
suggesting that the synthesis of the fusion proteins is repressed by
sX13. Interestingly, the XCV3927::GFP and Hfq::GFP fluores-
cence was similarly increased in XcvDsX13 and the sX13hfq double
Figure 4. qRT-PCR analysis of sX13-regulated genes. Selected sX13-regulated genes (see Table 1) were analyzed by qRT-PCR using RNA fromNYG- and MMA-grown Xcv strains 85-10 (wt) and DsX13. The amount of each mRNA in the wt was set to 1. Bars represent fold-changes of mRNAamounts in strain DsX13 compared to 85-10 on a logarithmic scale (log10). Data points and error bars represent mean values and standard deviationsobtained with at least three independent biological samples. Asterisks denote statistically significant differences (t-test; P,0.05). Dashed linesindicate a 1.5-fold change. Transcripts not detected in the microarray analyses are marked with ‘a’.doi:10.1371/journal.ppat.1003626.g004
XCV2022 FliC; flagellin and related hook-associated proteins — 0.2 — 0.0660.03 1.060.39
XCV3572 TonB-dependent outer membrane receptor a 0.2 — 0.260.04 0.960.24
Additional genes tested by qRT-PCR
XCV0173 putative secreted protein a,b,b,b — — 1.960.19 0.860.26
XCV0612 ATPase of the AAA+ class a — — 1.060.06 0.860.26
XCV1533 AsnB2; asparagine synthase b — — 1.060.04 1.060.17
XCV3232 PilH; type IV pilus response regulator a — — 2.260.07 1.960.67
XCV3573 putative transcriptional regulator, AraC family a — — 0.260.11 n.t.
XCV0324 type III effector protein XopS — — — 0.660.05 n.t.
a, bold letters indicate genes with known TSS [16].b, refers to Thieme et al. (2005) [32].c, presence of a 4G-motif within the 59-UTR or 100 bp upstream of translation start codon if TSS is unknown (a) and within 100 bp downstream of start codon (b) (seeFigure S4).d, genes not detected as expressed are marked with —.e, values represent mean fold-change and standard deviation (see Figure 4);n.t. - not tested.doi:10.1371/journal.ppat.1003626.t001
sX13 loops differentially contribute to mRNAaccumulationAs mutation of sX13 loops impinged on Xcv virulence
(Figure 6B), we addressed by qRT-PCR whether loop mutations
affect the mRNA abundance of XCV2821, XCV3927, hfq and pilH,
which were upregulated in XcvDsX13 (see Figure 4; Table 1). In
addition, we analyzed a downregulated gene, XCV3572, and
XCV0612, which was not affected by sX13 deletion. As shown in
Figure 7A–E, sX13 negatively affected the mRNA abundance of
XCV2821, XCV3927, hfq and pilH, whereas sX13 promoted
mRNA accumulation of XCV3572. Mutation of sX13 loops
differentially affected the mRNA abundance of the tested genes:
pL2 and pL1/2 failed to complement XcvDsX13 with respect to the
mRNA abundance of XCV2821, XCV3927 and hfq (Figure 7A–C).
Intermediate mRNA amounts of XCV3927 and hfq were detected
in XcvDsX13 carrying pL1/3 or pL2/3 compared to pB and psX13
(Figure 7B, C). Taken together, the mRNA abundance of
XCV2821, XCV3927 and hfq appears to be mainly controlled by
sX13-loop 2. In contrast, pilH mRNA accumulation appears to
depend on multiple sX13 loops as only psX13 and pL1
complemented XcvDsX13 (Figure 7D). The reduced mRNA
amount of XCV3572 in XcvDsX13 was complemented by pL1
and pL3 but not by pL1/3 (Figure 7E), which suggests redundant
roles of sX13-loops. In presence of pL2, pL1/2 or pL2/3 in
XcvDsX13, the XCV3572 mRNA levels were intermediate com-
pared to XcvDsX13 carrying pB or psX13 (Figure 7E). As expected,
the mRNA abundance of XCV0612 was identical in the different
strains (Figure 7F).
Figure 5. sX13 activity does not require Hfq. (A) Northern blotanalysis. Total RNA from NYG-grown Xcv strains 85-10 (wt), the hfqframeshift mutant (hfq2) and the hfq mutant ectopically expressing Hfq(phfq) was analyzed using sX13- or sX14-specific probes. 5S rRNA wasprobed as loading control. The experiment was performed twice withtwo independent mutants and with similar results. (B) Plant infectionassay. The Xcv wild-type 85-10 (wt) and hfq mutant strain (hfq2) wereinoculated at 26108 cfu/ml into leaves of susceptible ECW and resistantECW-10R plants. Disease symptoms were photographed 6 dpi. The HRwas visualized 2 dpi by ethanol bleaching of the leaves. Dashed linesindicate the inoculated areas. The experiment was repeated three timeswith similar results. (C) GFP fluorescence of NYG-grown Xcv 85-10 (wt),the hfqmutant (hfq2), the sX13 deletion mutant (DsX13) and the doublemutant (DsX13hfq2) carrying pFX3927 or pFXhfq. Xcv autofluorescencewas determined by Xcv 85-10 carrying pFX0 (control). Data points anderror bars represent mean values and standard deviations obtainedwith at least four independent experiments. GFP fluorescence of the wtwas set to 1. Asterisks denote statistically significant differences (t-test;P,0.01).doi:10.1371/journal.ppat.1003626.g005
Figure 6. sX13 loops impact on Xcv virulence. (A) Secondarystructure of sX13 based on prediction and probing (see Figure S2). sX13consists of an unstructured 59-, three double-stranded regions (S1; S2;S3) and three loops (loop 1–3). 4C-/5C-motifs are highlighted in red.Bold letters indicate unpaired bases and bars mark double-strandedregions deduced from structure probing. Mutations in loops are boxed,exchanged nucleotides are underlined. (B) Derivatives mutated in loops2 and 3 fail to complement the plant phenotype of DsX13. Leaves ofresistant ECW-10R plants were inoculated at 108 cfu/ml with Xcv 85-10(wt) and DsX13 carrying pBRS (pB), psX13 or one of the followingderivatives: sX13 lacking 14 terminal nucleotides (psX13D59), sX13mutated in single loops (pL1, pL2, pL3) or in two loops (pL1/2, pL1/3,pL2/3). The HR was visualized by ethanol bleaching of the leaves 2 dpi.Dashed lines indicate the inoculated areas. The experiment wasperformed four times with similar results.doi:10.1371/journal.ppat.1003626.g006
Identification of putative sX13-binding sitesTo identify potential regulatory motifs in sX13-regulated
mRNAs, a discriminative motif search was performed using
DREME [56]. For this, sequences surrounding the TLSs of the 42
up- and 21 downregulated genes identified by microarray analyses
(Table S2) were compared. More precisely, sequences spanning
from known transcription start sites (TSSs) to 100 bp downstream
of TLSs or, in case of unknown TSSs, 100 bp up- and 100 bp
downstream of the TLS were inspected.
We found that up- and downregulated genes differ in the
presence of ‘GGGG’ (4G) motifs. In the NYG-grown sX13
mutant, 15 out of 23 (65%) upregulated genes contain up to three
4G-motifs which are predominantly located upstream of the TLS
(Figure S4A; Table S2). 70% of the genes upregulated in MMA
(16 out of 23), but only 14% of the genes downregulated in NYG
medium (3 out of 21) contain 4G-motifs (Figure S4A; Table S2).
Thus, 4G-motifs appear to be enriched in sX13-repressed
mRNAs. However, the position of the motifs and flanking
nucleotides are not conserved among sX13-regulated genes. Note
that the term ‘4G-motif’ also refers to motifs containing more than
four G-residues in a row. The complementarity of C-rich sX13-
loop sequences and G-rich mRNA motifs suggests sX13-mRNA
interactions via antisense-base pairing (Figure 6A; Table 1; Table
S2).
Compared to the occurrence of 4G-motifs in approximately
70% of sX13-repressed genes, only 30.71% of all chromosomally
encoded Xcv genes (1,378 out of 4,487) carry 4G-motifs in
proximity of their TLS (Figure S4A). Interestingly, 4G-motifs in
241 of the chromosomally encoded genes (5.37%) are located
between nucleotide position 8 and 15 upstream of the TLS (Figure
S4B). This position corresponds to the presumed location of the
RBS and suggests a role of 4G-motifs in translation control.
sX13 dependency of target::GFP synthesis requires both4C- and 4G-motifsTo study the effect of sX13 on translation of selected putative
targets, i. e., XCV3927 and hfq, we used the above-mentioned
GFP-reporter plasmids pFX3927 and pFXhfq. In addition, we
generated pilH::gfp (pFXpilH) and XCV0612::gfp (pFX0612) fusions
(see ‘Materials and Methods’). All mRNA::gfp fusions contain a G-
rich motif in the proximity of their TLS which is complementary
to C-rich sX13-loop regions (see ‘Materials and Methods’). The
fluorescence of the sX13 deletion mutant carrying pFX3927,
pFXhfq and pFXpilH was about 3.5-, 1.6- and 2.5-fold higher,
respectively, compared to the Xcv wild type (Figure 8A–C). In
presence of psX13, pL1, pL3 or pL1/3 in XcvDsX13, the
XCV3927::GFP and Hfq::GFP fluorescence levels were compa-
rable to the Xcv wild type (Figure 8A, B). By contrast, the
XCV3927::GFP and Hfq::GFP fluorescence of strain DsX13carrying pL2, pL1/2 or pL2/3 was similarly increased as
compared to XcvDsX13 carrying pB (Figure 8A, B). This suggests
that the 4C-motif in sX13-loop 2 is required to repress
XCV3927::GFP and Hfq::GFP synthesis. The increased
PilH::GFP fluorescence of XcvDsX13 was complemented by
Figure 7. sX13 loops differentially contribute to abundance of putative mRNA targets. Relative transcript levels of (A) XCV2821, (B)XCV3927, (C) hfq, (D) pilH, (E) XCV3572 and (F) XCV0612 were analyzed by qRT-PCR in total RNA of NYG-grown Xcv strains 85-10 (wt) and DsX13carrying pBRS (pB), psX13 or mutated sX13-derivatives (see Figure 6). The mRNA abundance in the wt was set to 1. Data points and error barsrepresent mean values and standard deviations obtained with at least three independent biological samples. Statistically significant differences areindicated (t-test; P,0.015).doi:10.1371/journal.ppat.1003626.g007
and PilH::GFP synthesis in MMA was sX13-dependently
repressed to a greater extent than in NYG (Figure S5; see
Figure 8).
Because sX13 negatively affected both the mRNA accumulation
of chromosomally encoded XCV3927, hfq and pilH genes and
accumulation of the corresponding GFP-fusion proteins, we
exemplarily analyzed whether this is due to an altered mRNA
abundance. However, qRT-PCR analyses revealed that the
XCV3927::gfp mRNA accumulation was sX13-independent sug-
gesting that sX13 posttranscriptionally affects the synthesis of
XCV3927::GFP (Figure S6).
To discriminate between transcriptional and posttranscriptional
effects of sX13 on target::GFP synthesis we generated reporter
fusions controlled by plac (see ‘Materials and Methods’). Note that
the activity of the lac promoter is not affected by deletion of sX13
(data not shown). As shown in Figure S7, the fluorescence of
XcvDsX13 carrying pFXpl-3927 (XCV3927) and pFXpl-pilH (pilH)
was 2.5- and 4-fold higher, respectively, compared to the Xcv wild
type and the complemented sX13 mutant strain. Interestingly,
mutation of the 4G-motif in the XCV3927 59-UTR did not only
abolish sX13-dependency but also led to a significantly reduced
fluorescence compared to the Xcv wild type which carried the non-
mutated reporter plasmid (Figure S7). This suggests that the 4G-
motif in the XCV3927 59-UTR promotes translation, i. e., acts as
translational enhancer element. In presence of pFXpl-pilH, the
fluorescence of the fusion protein was only detectable in the sX13
mutant but not in the wild type or complemented strain,
confirming that PilH::GFP synthesis is repressed by sX13 (Figure
S7). Overall, the data confirm that sX13 represses the synthesis of
XCV3927 and PilH on the posttranscriptional level.
Figure 8. sX13-dependency of mRNA target::GFP synthesis requires a G-rich motif. GFP fluorescence of NYG-grown Xcv strains 85-10 (wt)and DsX13 carrying pB, psX13 or mutated sX13-derivatives (see Figure 6) and carrying GFP-reporter plasmids (A) pFX3927, (B) pFXhfq, (C) pFXpilH or(D) pFX0612. pFXMUT derivatives contain a mutated 4G-motif. Xcv autofluorescence was determined using pFX0. GFP fluorescence of the wt was set to1. Data points and error bars represent mean values and standard deviations obtained from at least four independent experiments. Statisticallysignificant differences are indicated (t-test; P,0.015).doi:10.1371/journal.ppat.1003626.g008
Figure S1 sX13 abundance is not affected by expressionof HrpG*. Xcv 85-10 (wt), DsX13 and DsX13+sX13ch and strains
additionally expressing HrpG* were incubated for 3.5 hours in
hrp-gene inducing medium XVM2 (see Figure 2B). Total RNA was
analyzed by Northern blot using an sX13-specific probe. 5S rRNA
was probed as loading control. The experiment was performed
twice with similar results.
(EPS)
Figure S2 Structure probing of sX13. In vitro transcribed sX13
was 59-labeled and treated with RNase T1 (T1) or alkaline hydroxyl
(OH2) buffer for generation of nucleotide ladders and RNase V1
(V1) for mapping of base-paired regions. Lane ‘C’ contains untreated
sX13; triangle indicates decreasing concentrations of RNase V1;
‘#G’ indicates positions of G residues; the deduced secondary
structure is indicated on the right hand side (see Figure 6A).
(EPS)
Figure S3 Expression of sX13 derivatives. Total RNA of
NYG-grown Xcv strains 85-10 (wt) and DsX13 carrying pBRS (pB),
psX13 or expressing mutated sX13-derivatives (see Figure 6) was
analyzed by Northern blot using an sX13-specific probe. 5S rRNA
was probed as loading control. The experiment was performed
twice with similar results.
(EPS)
Figure S4 Distribution of 4G-motifs among sX13-regu-lated genes and chromosomally encoded Xcv genes. (A)Percentage of sX13-regulated genes identified by microarray
analyses (see Table S2) and chromosomal CDSs in Xcv containing
one or more 4G-motifs in region2100 to +100 relative to the TLSor in case of known TSSs, in the sequence comprising the 59-UTR
to position +100. The number of genes analyzed (n) is given below.
(B) Distribution of 4G-motifs found in region 2100 to +100 bp
relative to the TLSs of 1,378 chromosomal CDSs [see (A)].
(EPS)
Figure S5 sX13-dependency of mRNA target::GFP syn-thesis in MMA-grown Xcv strains. GFP fluorescence of
MMA-grown Xcv strains 85-10 (wt) and DsX13 carrying pB or
psX13 and carrying GFP-reporter plasmids pFX3927,
pFX3927MUT, pFXpilH or pFXpilHMUT. pFX3927MUT and
pFXpilHMUT contain a mutated 4G- and 5G-motif, respectively.
Xcv autofluorescence was determined using pFX0. GFP fluores-
cence of the wt was set to 1. Data points and error bars represent
mean values and standard deviations obtained from three
45. Escolar L, Van Den Ackerveken G, Pieplow S, Rossier O, Bonas U (2001) TypeIII secretion and in planta recognition of the Xanthomonas avirulence proteins
AvrBs1 and AvrBsT. Mol Plant Pathol 2: 287–296.46. Beisel CL, Storz G (2010) Base pairing small RNAs and their roles in global
RNA mediates discoordinate expression of the E. coli galactose operon. Genes
Dev 16: 1696–1706.48. Beisel CL, Storz G (2011) The base-pairing RNA spot 42 participates in a
multioutput feedforward loop to help enact catabolite repression in Escherichia
coli. Mol Cell 41: 286–297.
49. Dondrup M, Albaum SP, Griebel T, Henckel K, Junemann S, et al. (2009)
EMMA 2–a MAGE-compliant system for the collaborative analysis andintegration of microarray data. BMC Bioinformatics 10: 50.
50. Mhedbi-Hajri N, Jacques MA, Koebnik R (2011) Adhesion mechanisms ofplant-pathogenic Xanthomonadaceae. Adv Exp Med Biol 715: 71–89.
51. Jarrell KF, McBride MJ (2008) The surprisingly diverse ways that prokaryotesmove. Nat Rev Microbiol 6: 466–476.
52. Schulze S, Kay S, Buttner D, Egler M, Eschen-Lippold L, et al. (2012) Analysis
of new type III effectors from Xanthomonas uncovers XopB and XopS assuppressors of plant immunity. New Phytol 195: 894–911.
53. Urban JH, Vogel J (2007) Translational control and target recognition byEscherichia coli small RNAs in vivo. Nucleic Acids Res 35: 1018–1037.
54. Engler C, Kandzia R, Marillonnet S (2008) A one pot, one step, precision
cloning method with high throughput capability. PLoS One 3: e3647.55. Zuker M (2003) Mfold web server for nucleic acid folding and hybridization
prediction. Nucleic Acids Res 31: 3406–3415.56. Bailey TL (2011) DREME: motif discovery in transcription factor ChIP-seq
data. Bioinformatics 27: 1653–1659.57. Hengge R (2009) Principles of c-di-GMP signalling in bacteria. Nat Rev
Microbiol 7: 263–273.
58. Ryan RP, Fouhy Y, Lucey JF, Jiang BL, He YQ, et al. (2007) Cyclic di-GMPsignalling in the virulence and environmental adaptation of Xanthomonas
campestris. Mol Microbiol 63: 429–442.59. Wilms I, Moller P, Stock AM, Gurski R, Lai EM, et al. (2012) Hfq influences
multiple transport systems and virulence in the plant pathogen Agrobacterium
tumefaciens. J Bacteriol 194: 5209–5217.60. Barra-Bily L, Pandey SP, Trautwetter A, Blanco C, Walker GC (2010) The
Sinorhizobium meliloti RNA chaperone Hfq mediates symbiosis of S. meliloti andalfalfa. J Bacteriol 192: 1710–1718.
61. Lenz DH, Mok KC, Lilley BN, Kulkarni RV, Wingreen NS, et al. (2004) Thesmall RNA chaperone Hfq and multiple small RNAs control quorum sensing in
Vibrio harveyi and Vibrio cholerae. Cell 118: 69–82.
62. Bardill JP, Zhao X, Hammer BK (2011) The Vibrio cholerae quorum sensingresponse is mediated by Hfq-dependent sRNA/mRNA base pairing interactions.
Mol Microbiol 80: 1381–1394.63. Novick RP, Ross HF, Projan SJ, Kornblum J, Kreiswirth B, et al. (1993)
Synthesis of staphylococcal virulence factors is controlled by a regulatory RNA
molecule. EMBO J 12: 3967–3975.64. Geisinger E, Adhikari RP, Jin R, Ross HF, Novick RP (2006) Inhibition of rot
translation by RNAIII, a key feature of agr function. Mol Microbiol 61: 1038–1048.
65. Boisset S, Geissmann T, Huntzinger E, Fechter P, Bendridi N, et al. (2007)
Staphylococcus aureus RNAIII coordinately represses the synthesis of virulencefactors and the transcription regulator Rot by an antisense mechanism. Genes
Dev 21: 1353–1366.66. Geissmann T, Chevalier C, Cros MJ, Boisset S, Fechter P, et al. (2009) A search
for small noncoding RNAs in Staphylococcus aureus reveals a conserved sequencemotif for regulation. Nucleic Acids Res 37: 7239–7257.
67. Benito Y, Kolb FA, Romby P, Lina G, Etienne J, et al. (2000) Probing the
structure of RNAIII, the Staphylococcus aureus agr regulatory RNA, andidentification of the RNA domain involved in repression of protein A expression.
RNA 6: 668–679.68. Argaman L, Altuvia S (2000) fhlA repression by OxyS RNA: kissing complex
formation at two sites results in a stable antisense-target RNA complex. J Mol
Biol 300: 1101–1112.69. Sharma CM, Hoffmann S, Darfeuille F, Reignier J, Findeiss S, et al. (2010) The
primary transcriptome of the major human pathogen Helicobacter pylori. Nature464: 250–255.
70. Desnoyers G, Morissette A, Prevost K, Masse E (2009) Small RNA-induced
differential degradation of the polycistronic mRNA iscRSUA. EMBO J 28: 1551–
1561.
71. Nakagawa S, Niimura Y, Miura K, Gojobori T (2010) Dynamic evolution of
translation initiation mechanisms in prokaryotes. Proc Natl Acad Sci U S A 107:
6382–6387.
72. Sharma CM, Darfeuille F, Plantinga TH, Vogel J (2007) A small RNA regulates
multiple ABC transporter mRNAs by targeting C/A-rich elements inside and
upstream of ribosome-binding sites. Genes Dev 21: 2804–2817.
73. Sharma CM, Papenfort K, Pernitzsch SR, Mollenkopf HJ, Hinton JC, et al.
(2011) Pervasive post-transcriptional control of genes involved in amino acid
metabolism by the Hfq-dependent GcvB small RNA. Mol Microbiol 81: 1144–
1165.
74. Martin-Farmer J, Janssen GR (1999) A downstream CA repeat sequence
increases translation from leadered and unleadered mRNA in Escherichia coli. Mol
Microbiol 31: 1025–1038.
75. del Val C, Rivas E, Torres-Quesada O, Toro N, Jimenez-Zurdo JI (2007)
Identification of differentially expressed small non-coding RNAs in the legume
endosymbiont Sinorhizobium meliloti by comparative genomics. Mol Microbiol 66:
1080–1091.
76. Sahagan BG, Dahlberg JE (1979) A small, unstable RNA molecule of Escherichia
Die folgenden ‚Supporting Informations‘ zu Kapitel 2.3.1. enthalten die Abbildungen S1 bis S8 und die Tabellen S1 und S2.
ΔsX13ΔsX
13+s
X13 ch
wt ΔsX13ΔsX
13+s
X13 ch
wt
phrpG*
sX13
5S rRNA
110 bp −
110 bp −
Figure S1. sX13 abundance is not affected by expression of HrpG*. Xcv 85-10 (wt), ∆sX13 and ∆sX13+sX13ch and strains additionally expressing HrpG* were incubated for 3.5 hours in hrp-gene inducing medium XVM2 (see Figure 2B). Total RNA was analyzed by Northern blot using an sX13-specific probe. 5S rRNA was probed as loading control. The experiment was performed twice with similar results.
Ergebnisse 57
C OH- T1V1
15
32
44
50
65
S1
S1
loop 1
S2
loop 2
S2
4 - 15 nt
45
#G
Figure S2. Structure probing of sX13. In vitro transcribed sX13 was 5’-labeled and treated with RNase T1 (T1) or alkaline hydroxyl (OH─) buffer for generation of nucleo-tide ladders and RNase V1 (V1) for mapping of base-paired regions. Lane ‘C’ contains untreated sX13; black triangle indicates decreasing concentrations of RNase V1; ‘#G’ indicates positions of G residues; the deduced secondary structure is indicated on the right hand side (see Figure 6A).
58 Ergebnisse
sX13
5S rRNA
110 −
~120 −
147 −pB ps
X13pB ps
X13pL
1pL
2pL
3pL
1/2pL
1/3pL
2/3wt ΔsX13
bp
Figure S3. Expression of sX13 derivatives. Total RNA of NYG-grown Xcvstrains 85-10 (wt) and ∆sX13 carrying pBRS (pB), psX13 or expressing mutated sX13-derivatives (see Figure 6) was analyzed by Northern blot using an sX13-specific probe. 5S rRNA was probed as loading control. The experiment was performed twice with similar results.
Ergebnisse 59
05
101520253035404550
100 80 60 40 20 start 21 41 61 81
Num
ber o
f 4G
-mot
ifs
Position relative to translation start site (bp)
A
B
up-regulated
(NYG)n=23
up-regulated
(MMA)n=23
down-regulated
(NYG)n=21
chromosomen=4,487
0
20
40
60
80
100P
erce
ntag
e
one 4Gtwo 4Gthree 4G
w/o 4G
Figure S4. Distribution of 4G-motifs among sX13-regulated genes and chromoso-mally encoded Xcv genes. (A) Percentage of sX13-regulated genes identified by microarray analyses (see Table S2) and chromosomal CDSs in Xcv containing one or more 4G-motifs in region -100 to +100 relative to the TLS or in case of known TSSs, in the sequence comprising the 5’-UTR to position +100. The number of genes analyzed (n) is given below. (B) Distribution of 4G-motifs found in region -100 to +100 bp relative to the TLSs of 1,378 chromosomal CDSs [see (A)].
60 Ergebnisse
02468
1012
Rel
ativ
e flu
ores
cenc
e
pFX3927 pFX3927MUT pFX0
pBps
X13 pBps
X13
wt ΔsX13
pB
wt
*
0123456
Rel
ativ
e flu
ores
cenc
epB
psX13 pB
psX13
wt ΔsX13
pB
wt
pFXpilH pFXpilHMUT pFX0
* *
*
*
Figure S5. sX13-dependency of mRNA target::GFP synthesis in MMA-grown Xcv strains. GFP fluorescence of MMA-grown Xcv strains 85-10 (wt) and ∆sX13 carrying pB or psX13 and carrying GFP-reporter plasmids pFX3927, pFX3927MUT, pFXpilH or pFXpilHMUT. pFX3927MUT and pFXpilHMUT contain a mutated 4G- and 5G-motif, respectively. Xcv autofluorescence was determined using pFX0. GFP fluorescence of the wt was set to 1. Data points and error bars represent mean values and standard deviations obtained from three independent experiments. Statistically significant differences compared to the wt are indicated by an asterisk (t-test; P<0.03). For comparison, see Figure 8A and C.
Ergebnisse 61
0
0.5
1.0
1.5
2.0
2.5 pFX3927 pFX3927MUTR
elat
ive
trans
crip
t lev
el (g
fp)
pBps
X13 pBps
X13 pL1
pL2
pL3pL
1/2pL
1/3pL
2/3
wt ΔsX13
Figure S6. mRNA amount of XCV3927::gfp is sX13-independent. The XCV3927::gfp mRNA amount in NYG-grown Xcv strains 85-10 (wt) and ∆sX13 carrying pB, psX13 or mutated sX13-derivatives and contai-ning pFX3927 or pFX3927MUT was analyzed by qRT-PCR using gfp-specific oligonucleotides. The RNA level in the wt was set to 1. Data points and error bars represent mean values and standard deviations obtained with three independent biological samples. For comparison, see Figure 7B and Figure 8A.
62 Ergebnisse
ΔsX13 ΔsX13+sX13ch
wt ΔsX13 ΔsX13+sX13ch
wt0
1.0
2.0
3.0
0
1
2
3
4
52.5
1.5
0.5
Rel
ativ
e flu
ores
cenc
e
Rel
ativ
e flu
ores
cenc
e
pFXpl-pilHpFXpl-pilHMUT
pFXpl-3927pFXpl-3927MUT*
* * **
*
Figure S7. sX13 posttranscriptionally affects XCV3927::GFP and PilH::GFP synthesis. GFP fluorescence of NYG-grown Xcv strains 85-10 (wt), ∆sX13 and ∆sX13 containing chromosomally re-integrated sX13 (∆sX13+sX13ch); strains express XCV3927::gfp (pFXpl-3927) or pilH::gfp (pFXpl-pilH) under control of plac. pFXMUT derivatives contain a mutated 4G-motif. Xcv autofluorescence was determined using pFX0 and is indicated by the dashed line. GFP fluore-scence of the wt carrying pFXpl-3927 or pFXpl-pilH was set to 1. Data points and error bars represent mean values and standard deviations obtained from three independent experiments. Asterisks indicate statistically significant differences (t-test; P<0.03).
Ergebnisse 63
ΔsX13wt ΔsX13wt0
1.01.2
0.20.40.60.8
0
1.01.2
0.20.40.60.8
Rel
ativ
e flu
ores
cenc
e
Rel
ativ
e flu
ores
cenc
e
pFXpl-hrpG pFXpl-hrpX
Figure S8. Translation of HrpG::GFP and HrpX::GFP is sX13-independent. GFP fluorescence of NYG-grown Xcvstrains 85-10 (wt) and ∆sX13 expressing hrpG::gfp (pFXpl-hrpG) or hrpX::gfp (pFXpl-hrpX) under control of plac. Xcvautofluorescence was determined using pFX0 and is indicated by dashed line. GFP fluorescence of the wt was set to 1. Data points and error bars represent mean values and standard deviations obtained from three independent experiments. Differences were not statistically significant (t-test; P<0.03).
64 Ergebnisse
Table S1. Bacterial strains, plasmids and oligonucleotides used in this study.
Strain or plasmid Relevant characteristicsa Reference or source
Xanthomonas campestris pv. vesicatoria
85-10 Pepper-race 2; wild type; RifR [1] sX13 85-10 derivative deleted in sX13; RifR This study sX13+sX13ch sX13 derivative containing re-integrated sX13 at sX13 locus; RifR This study
hfq hfq frameshift mutant of strain 85-10; RifR This study sX13hfq 85-10 derivative deleted in sX13 and containing frameshift mutation in hfq; RifR This study
Escherichia coli
F- recA hsdR17(rk-,mk
+) [2]
TOP10 F- mcr mrr-hsdRMS-mcr lacZ lacX74 recA1 ara ara-leu) 7697 galU galK rpsL (StrR) endA1 nupG Invitrogen
sX13 pOK1 derivative containing flanking regions of sX13; SmR This study pOKint13 pOK1 derivative containing sX13 locus; SmR This study pOK-fshfq pOK1 derivative for frameshift mutation of hfq; SmR This study pBRM-P pBBR1MCS-5 derivative without promoter; GmR [6] phfq pBRM-P derivative containing hfq; GmR This study pBBR1mod1 pBBR1MCS-5 derivative without polylinker; GmR [6] pBRS pBBR1mod1 derivative for sRNA expression; GmR This study psX13 pBRS derivative expressing sX13; GmR This study p pBRS derivative expressing (lacks 14 nt at 5' end); GmR This study pL1 psX13 derivative containing mutations in sX13 loop 1; GmR This study pL2 psX13 derivative containing mutations in sX13 loop 2; GmR This study pL3 psX13 derivative containing mutations in sX13 loop 3; GmR This study pL1/2 pL2 derivative containing mutations in sX13 loops 1 and 2; GmR This study pL1/3 pL1 derivative containing mutations in sX13 loops 1 and 3; GmR This study pL2/3 psX13 derivative containing mutations in sX13 loops 2 and 3; GmR This study pDSK602 Broad-host-range vector; contains triple lacUV5 promoter; SmR [7] pXG-1 GFP expression plasmid; CmR [8]
pFX-P Golden Gate-compatible pDSK602 derivative without promoter for generation of translational mRNA::gfp fusions; SmR This study
pFX0 Promoterless pFX-P derivative; control plasmid for GFP reporter fusions (measurement of Xcv autofluorescence); SmR This study
pFX3927 pFX-P derivative for expression of XCV3927::GFP; SmR This study pFXhfq pFX-P derivative for expression of Hfq::GFP; SmR This study pFXpilH pFX-P derivative for expression of PilH::GFP; SmR This study pFX0612 pFX-P derivative for expression of XCV0612::GFP; SmR This study pFX3927MUT pFX-P derivative containing mutation in 4G-motif within 5'-UTR of XCV3927; SmR This study pFXhfqMUT pFX-P derivative containing mutation in 4G-motif within CDS of hfq; SmR This study pFXpilHMUT pFX-P derivative containing mutation in 5G-motif within 5'-UTR of pilH; SmR This study pFXpl-3927 pFX-P derivative for plac-driven expression of XCV3927::GFP; SmR This study pFXpl-pilH pFX-P derivative for plac-driven expression of PilH::GFP; SmR This study
pFXpl-3927MUT pFX-P derivative containing plac and mutation in 4G-motif within 5'-UTR of XCV3927; SmR This study
pFXpl-pilHMUT pFX-P derivative containing plac and mutation in 5G-motif within 5'-UTR of pilH; SmR This study
pFXpl-hrpG pFX-P derivative for plac-driven expression of HrpG::GFP; SmR This study pFXpl-hrpX pFX-P derivative for plac-driven expression of HrpX::GFP; SmR This study pUC-13T7 pUC57 derivative containing T7 promoter upstream of sX13; ApR; SmR This study
Oligonucleotide Sequenceb Purpose
pBRS-EcoRI-fw AACCTTAAGATTCCACACAACATACGAGC Generation of pBRS pBRS-NcoI-rev CGTCCATGGGCAAATATTATA Generation of pBRS sX13-fw TCAGAATTCGCGCAACGCCTGTCGGTAGA Generation of psX13 sX13-rev GCTAAGCTTGCGCATAGTGGAAGGACACAAAT Generation of psX13 sX13d5-fw TGGGAATTCGATCTCTCCCATCCCCTGG Generation of p
Ergebnisse 65
Oligonucleotide Sequenceb Purpose
sX13d5-rev TGGAAGCTTATAAAAAGCCCCGCAGACCAG Generation of p L1-fw CGGAAACTCCTCCCCAAGTTT Generation of pL1 L1-rev CTCCGAGATCTGCTCCAGCGCATGGGAG Generation of pL1 L2-fw AGCGGAAACTCCTGCGCAAGTTTCCGTTCC Generation of pL2 L2-rev CCGAGATCTGCTCCAGGGGATG Generation of pL2 L3-fw CCCCGCCGACCTGCGCCTGGTCTGC Generation of pL3 L3-rev CCAGGGAACGGAAACTTGGGGA Generation of pL3 L1/2-rev CCGAGATCTGCTCCAGCGCATGGGAGAGATC Generation of pL1/2 L2/3-rev CCAGGGAACGGAAACTTGCGCAGGAGTTTCC Generation of pL2/3 plac-fw TTTGGTCTCTATTCTGAGCGCAACGCAATTAATG Generation of pFXpl plac-rev TTTGGTCTCTCCACCCACACAACATACGAGCCGG Generation of pFXpl pFX-lz-fw GACATGCATGAATTCAGAGACCGCAGCTG Generation of pFX-P pFX-lz-rev Phosphate-AGAGACCTTACAATTTCCATTCGC Generation of pFX-P pFXgfp-fw Phosphate-GCTAGCAAAGGAGAAGAACTTTTCACTG Generation of pFX-P pFXgfp-rev GACAGATCT AGCAAAACCCGTACCCTAGGTC Generation of pFX-P pFX0-fw TTTGGTCTCTATTCCGCGAGGAAGAGGAAGAAGAA Generation of pFX0 pFX0-rev TTTGGTCTCTTAGCCATACAGCTACCCCAAAAGCGAAC Generation of pFX0 pFX3927-fw TTTGGTCTCTATTCCGGCAAGACGCTGTCATTCTAG Generation of pFX3927 pFX3927-rev TTTGGTCTCTTAGCAGCGACGACCGTACGAAGTC Generation of pFX3927 pFXhfq-fw TTTGGTCTCTATTCAGCGTGACCGCCATCAATTG Generation of pFXhfq pFXhfq-rev TTTGGTCTCTTAGCATACACCGACACGGGCACC Generation of pFXhfq pFXpilH-fw TTTGGTCTCTATTCACCCAGACGTGGTCGGAAC Generation of pFXpilH pFXpilH-rev TTTGGTCTCTTAGCCCATTGACTGAAGACTGCCCTG Generation of pFXpilH pFX0612-fw TTTGGTCTCTATTCATCGCGTGGTTTGTGATAAGTG Generation of pFX0612 pFX0612-rev TTTGGTCTCTTAGCCACCAGCGCTCTTAGTTGTTCTG Generation of pFX0612 pFX3927mut-L-rev TTTGGTCTCTGCGCAACAGGTCTGCGCACTATAGTCTAG Generation of pFX3927MUT pFX3927mut-R-rev TTTGGTCTCTGCGCAATCAGGCAAGAAGGCACCTATG Generation of pFX3927MUT pFXhfqmut-L-rev TTTGGTCTCTGCGCTTAGCCATCGAAAAATCCTCTTCA Generation of pFXhfqMUT pFXhfqmut-R-rev TTTGGTCTCTGCGCCAATCTTTACAGGACCCATTCCTC Generation of pFXhfqMUT pFXpilHmut-L-rev TTTGGTCTCTGCGCCTGGTCAGGCGTGGACGTAC Generation of pFXpilHMUT pFXpilHmut-R-rev TTTGGTCTCTGCGCAAAGGCAACATGGCTCGAATTATAT Generation of pFXpilHMUT pFXpl3927-fw TTTGGTCTCTGTGGACCTGTTGGGGAATCAGGCA Generation of pFXpl-3927
pFXpl3927mut-fw TTTGGTCTCTGTGGACCTGTTGCGCAATCAGGCA Generation of pFXpl-3927MUT
pFXplpilH-fw TTTGGTCTCTGTGGGTTTCGTAGCGACGTCGGAAG Generation of pFXpl-pilH pFXpl-hrpG-fw TTTGGTCTCTGTGGGTCCAGCTCCACTGGACTCTC Generation of pFXpl-hrpG pFXpl-hrpG-rev TTTGGTCTCTTAGCGTCCTGCGTCAACAGGAACAC Generation of pFXpl-hrpG pFXpl-hrpX-fw TTTGGTCTCTGTGGCGCCAGCGAGTTCGGCGC Generation of pFXpl-hrpX pFXpl-hrpX-rev TTTGGTCTCTTAGCACGTTCTGCGTATGACAACGCA Generation of pFXpl-hrpX d13L-fw CAGGATCCGCTGGGAGTACGGCTTCACG Deletion of sX13 d13L-rev AACAAGCTTATTTGTGTCCTTCCACTATGCGCA Deletion of sX13 d13R-fw AACAAGCTTATTGATGGATCGTGAAGATAACTG Deletion of sX13 d13R-rev GCTCTAGAAACTTCGGCCTGATGTACG Deletion of sX13 int13L-fw CAGGATCCCCGAGAGCATCCTGATGAGTTT sX13 complementation int13L-rev TGCAACGTTAACAGCGATGCTGCAGGTG sX13 complementation int13R-fw GTTAACGTTGCAGCGCTTGCGCATAGTG sX13 complementation int13R-rev GCTCTAGAAGCTGATCGCCTGCGACTATT sX13 complementation hfqL-fw TCAGGATCCAAATTGCCGATTCTGGCCGG Mutation of hfq hfqL-rev TTTGGTCTCTCATTATGGGTCCTGTAAAGATTGCCC Mutation of hfq hfqR-fw TTTGGTCTCTAATGCGCTGCGGCGCGAGC Mutation of hfq hfqR-rev GCATCTAGAGCGTGGCGAACAATTGATCT Mutation of hfq seqhfq-fw GAGCGTGACCGCCATCAATTG Screening hfq mutation seqhfq-rev GAACTCCTCCATCACATCGTCTTCG Screening hfq mutation pMphfq-fw TTTGGTCTCTATTCAGCGTGACCGCCATCAATTG Generation of phfq pMphfq-rev CAGGGTCTCTCACCTTACTGCTCGACGTCGTCATCTTCCG Generation of phfq sX13T7-fw GAAATTAATACGACTCACTATAGGGCGCAACGCCTGTC in vitro transcription sX13T7-rev TTATAAAAAGCCCCGCAGACCAGG in vitro transcription sX13-ITC-fw TAATACGACTCACT in vitro transcription sX13-ITC-rev ATAAAAAGCCCCGCA in vitro transcription
a, Ap, ampicillin; Gm, gentamycin; Km, kanamycin; Rif, rifampicin; Sm, spectinomycin; R, resistance. b, Recognition sites of restriction enzymes are underlined.
References 1. Canteros BI (1990) Ph.D. thesis. University of Florida, Gainesville, FL. 2. Menard R, Sansonetti PJ, Parsot C (1993) Nonpolar mutagenesis of the ipa genes defines IpaB, IpaC, and IpaD as effectors
of Shigella flexneri entry into epithelial cells. J Bacteriol 175: 5899-5906. 3. Figurski DH, Helinski DR (1979) Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid
function provided in trans. Proc Natl Acad Sci U S A 76: 1648-1652. 4. Wengelnik K, Rossier O, Bonas U (1999) Mutations in the regulatory gene hrpG of Xanthomonas campestris pv. vesicatoria
result in constitutive expression of all hrp genes. J Bacteriol 181: 6828-6831. 5. Huguet E, Hahn K, Wengelnik K, Bonas U (1998) hpaA mutants of Xanthomonas campestris pv. vesicatoria are affected in
pathogenicity but retain the ability to induce host-specific hypersensitive reaction. Mol Microbiol 29: 1379-1390. 6. Szczesny R, Jordan M, Schramm C, Schulz S, Cogez V, et al. (2010) Functional characterization of the Xcs and Xps type II
secretion systems from the plant pathogenic bacterium Xanthomonas campestris pv. vesicatoria. New Phytol 187: 983-1002.
7. Murillo J, Shen H, Gerhold D, Sharma A, Cooksey DA, et al. (1994) Characterization of pPT23B, the plasmid involved in syringolide production by Pseudomonas syringae pv. tomato PT23. Plasmid 31: 275-287.
8. Urban JH, Vogel J (2007) Translational control and target recognition by Escherichia coli small RNAs in vivo. Nucleic Acids Res 35: 1018-1037.
68 Ergebnisse
Table S2. sX13-regulated genes identified by microarray and qRT-PCR analysis.
Locusa Annotated gene productb 4G-motifc
Microarray Fold-change ( sX13 / wt)d
qRT-PCR Fold-change
sX13 / wt)e NYG MMA NYG MMA
sX13 / wt) XCV0678 AlgR; two-component system regulatory protein a,a,a 1.8 2.5 ± 0.23 n.t. XCV0730 Prc; tail-specific protease 1.6 n.t. n.t. XCV0950 conserved hypothetical protein a,a 1.6 n.t. n.t. XCV1274 putative secreted protein a 2.7 n.t. n.t. XCV1528 putative secreted protein 1.8 n.t. n.t. XCV1626 peptidyl-prolyl cis-trans isomerase 1.6 n.t. n.t. XCV1768 Hfq; host factor-I protein b 1.6 2.4 ± 0.08 1.6 ± 0.31 XCV2041 putative signal transduction protein a 1.9 n.t. n.t. XCV2185 conserved hypothetical protein 3.7 n.t. n.t. XCV2186 methyl-accepting chemotaxis protein a 7.7 2.1 ± 0.34 10.2 ± 4.63 XCV2302 conserved hypothetical protein 1.5 1.6 n.t. n.t. XCV2341 conserved hypothetical protein 1.5 n.t. n.t. XCV2357 conserved hypothetical protein 1.7 n.t. n.t. XCV2499 putative membrane protein a,b 2.0 n.t. n.t. XCV2565 conserved hypothetical protein b 1.6 n.t. n.t. XCV2608 type IV secretion system VirJ-like protein b 1.7 2.5 n.t. n.t. XCV2814 PilE; type IV pilus pilin 2.8 3.3 ± 0.36 n.t. XCV2815 type IV pilus adhesin b 2.1 n.t. n.t. XCV2819 type IV pilus assembly protein PilW a 3.7 4.0 3.4 ± 0.37 5.5 ± 3.0 XCV2820 type IV pilus assembly protein PilV a 2.9 n.t. n.t. XCV2821 type IV pilus assembly protein FimT a 4.3 7.4 4.2 ± 0.32 3.4 ± 1.27 XCV2917 hypothetical protein 2.9 n.t. n.t. XCV3059 putative secreted protein b 2.1 n.t. n.t. XCV3067 PilU; type IV pilus assembly protein ATPase a 1.8 1.7 ± 0.29 n.t. XCV3096 ComEA-related DNA uptake protein 4.2 n.t. 1.9 ± 0.12 XCV3151 hypothetical protein b,b 1.6 n.t. n.t. XCV3230 PilJ; type IV pilus methyl-accepting chemotaxis protein a 2.2 n.t. n.t. XCV3233 PilG; type IV pilus response regulator a,b 2.0 2.3 ± 0.26 4.1 ± 1.71 XCV3353 PilA; type IV pilus assembly protein, major pilin a 2.9 n.t. n.t. XCV3371 conserved hypothetical protein a,b 1.8 n.t. n.t. XCV3376 hypothetical protein 2.0 n.t. n.t. XCV3497 PilQ; type IV pilus assembly protein a,b 1.6 n.t. n.t. XCV3498 PilP; type IV pilus assembly protein 2.5 n.t. n.t. XCV3499 PilO; type IV pilus assembly protein a 2.4 n.t. n.t. XCV3500 PilN; type IV pilus assembly protein 2.7 2.7 ± 0.16 n.t. XCV3629 putative amidohydrolase family protein a 1.9 n.t. n.t. XCV3727 conserved hypothetical protein a 2.3 n.t. n.t. XCV3730 type IV pilus assembly protein a,a 2.0 n.t. n.t. XCV3927 putative secreted protein a 1.7 5.6 ± 0.45 8.3 ± 4.54 XCV4099 conserved hypothetical protein b 1.7 n.t. n.t. XCV4117 conserved hypothetical protein b 1.5 n.t. n.t. XCV4382 putative acetyltransferase 1.5 n.t. n.t.
XCV1787 predicted ATPase related to phosphate starvation-inducible protein PhoH 0.6 n.t. n.t.
XCV1945 methyl-accepting chemotaxis protein 0.5 n.t. n.t. XCV1956 CheA1; chemotaxis protein 0.6 n.t. n.t. XCV1957 CheY; chemotaxis response regulator 0.4 0.1 ± 0.04 n.t. XCV1958 putative anti-sigma factor antagonist 0.4 n.t. n.t. XCV2021 FliD; flagellar capping protein 0.7 n.t. n.t. XCV2022 FliC; flagellin and related hook-associated proteins 0.2 0.06 ± 0.03 1.0 ± 0.39 XCV2037 conserved hypothetical protein 0.3 n.t. n.t. XCV2276 hypothetical protein b 0.6 n.t. n.t. XCV2282 conserved hypothetical protein 0.6 n.t. n.t. XCV2535 CydA; cytochrome D ubiquinol oxidase, subunit II a 0.3 n.t. n.t. XCV2537 putative membrane protein 0.1 n.t. n.t. XCV3119 sigma-54 modulation protein 0.6 n.t. n.t. XCV3206 TonB-dependent outer membrane receptor 0.4 n.t. n.t. XCV3572 TonB-dependent outer membrane receptor a 0.2 0.2 ± 0.04 0.9 ± 0.24 XCV4119 putative secreted protein 0.2 n.t. n.t. XCVd0093 putative secreted protein 0.5 n.t. n.t.
Ergebnisse 69
Locusa Annotated gene productb 4G-motifc
Microarray Fold-change ( sX13 / wt)d
qRT-PCR Fold-change
sX13 / wt)e NYG MMA NYG MMA
Additional genes tested by qRT-PCR XCV0173 putative secreted protein a,b,b,b 1.9 ± 0.19 0.8 ± 0.26 XCV0612 ATPase of the AAA+ class a 1.0 ± 0.06 0.8 ± 0.26 XCV1533 AsnB2; asparagine synthase b 1.0 ± 0.04 1.0 ± 0.17 XCV3232 PilH; type IV pilus response regulator a 2.2 ± 0.07 1.9 ± 0.67 XCV3573 putative transcriptional regulator, AraC family a 0.2 ± 0.11 n.t. XCV0324 type III effector protein XopS 0.6 ± 0.05 n.t.
a, bold letters indicate genes with known TSS [1]. b, refers to Thieme et al. (2005) [2]. c, presence of a 4G- -UTR or 100 bp upstream of translation start codon if TSS is unknown (a) and within 100 bp downstream of the start codon (b) (see Figure S4). d, genes not detected as expressed are marked with e, values represent mean fold-change and standard deviation (see Figure 4); n.t. - not tested.
References 1. Schmidtke C, Findeiss S, Sharma CM, Kuhfuss J, Hoffmann S, et al. (2012) Genome-wide transcriptome analysis of the plant
pathogen Xanthomonas identifies sRNAs with putative virulence functions. Nucleic Acids Res 40: 2020-2031. 2. Thieme F, Koebnik R, Bekel T, Berger C, Boch J, et al. (2005) Insights into genome plasticity and pathogenicity of the plant
pathogenic bacterium Xanthomonas campestris pv. vesicatoria revealed by the complete genome sequence. J Bacteriol 187: 7254-7266.
70 Ergebnisse
2.3.1.2. Zusammenfassung der Ergebnisse
Der Artikel beschreibt die funktionelle Charakterisierung der Xcv sRNA sX13, welche in der
vorangegangenen dRNA-Seq Analyse als HrpG-/ HrpX-unabhängig exprimierte und abundante sRNA
identifiziert wurde (s. Kapitel 2.1.1.). Die Analyse einer sX13 Deletionsmutante ergab, dass sX13 zur
Virulenz von Xcv in suszeptiblen und der HR Induktion in resistenten Wirtspflanzen beiträgt. Während
das in planta Wachstum der sX13 Deletionsmutante mit dem des Wildtypstamms vergleichbar war,
förderte sX13 das Wachstum von Xcv in Komplex- und Minimalmedium. Expressionsanalysen
ergaben, dass sX13 die mRNA Akkumulation von hrpX, jedoch nicht von hrpG, beeinflusst und die
Expression von Komponenten und Substraten des T3S Systems fördert. Da die ektopische Expression
von HrpG*, einer konstitutiv aktiven Version von HrpG, die sX13 Deletion kompensierte, liegt die
Vermutung nahe, dass sX13 die Aktivität von HrpG beeinflusst. Mittels Northern Blot Analysen
wurde nachgewiesen, dass sX13 in Xcv unter verschiedenen Stressbedingungen akkumuliert. Dies
lässt eine Rolle von sX13 in der Anpassung von Xcv an sich verändernde Umweltbedingungen
vermuten. ‚Microarray‘- und quantitative ‚reverse transcription‘-PCR (qRT-PCR) Analysen ergaben,
dass sX13 die mRNA Akkumulation von 63 Genen beeinflusst, welche vermutlich an der
Signaltransduktion, der Motilität, QS, transkriptioneller und posttranskriptioneller Regulation sowie
der Virulenz beteiligt sind. Da sX13 die mRNA Akkumulation von hfq negativ beeinflusste, wurde
untersucht, ob die verzögerte Virulenz der sX13 Deletionsmutante auf einer De-Regulation der Hfq
Synthese beruht. Die Inaktivierung von hfq hatte keinen Einfluss auf die Virulenz von Xcv oder die
Akkumulation und Aktivität von sX13, was zeigt, dass sX13 Hfq-unabhängig agiert. Während 70%
der mRNAs, deren Akkumulation durch sX13 gehemmt wurde, ‚G‘-reiche Motive in der Umgebung
des TLS aufweisen, ergaben Strukturanalysen von sX13 drei doppelsträngige Bereiche mit ‚C‘-reichen
apikalen Loops. Die Mutation der sX13 Loops beeinflusste in unterschiedlichem Maße die Virulenz
von Xcv und die Akkumulation potentieller Ziel-mRNAs. Mittels eines GFP-Reportersystems konnte
nachgewiesen werden, dass sX13 die Expression von XCV3927, pilH und hfq hemmt und dass die ‚C‘-
reichen sX13 Loops und ‚G‘-reiche Motive in potentiellen Ziel-mRNAs für die sX13-vermittelte
Repression der Proteinsynthese essentiell sind. Des Weiteren zeigen die Ergebnisse, dass ‚G‘-reiche
mRNA Motive in potentiellen sX13-Ziel mRNAs als translationale ‚enhancer‘ wirken können und in
5% aller proteinkodierenden Xcv Gene an der RBS Position lokalisiert sind.
Ergebnisse 71
2.4. Eigenanteil an den Publikationen
Publikation 1, Kapitel 2.1.1. und 2.1.1.1.
Schmidtke, C., Findeiß, S., Sharma, C.M., Kuhfuss, J., Hoffmann, S., Vogel, J., Stadler, P.F. and
Bonas, U. (2012) Genome-wide transcriptome analysis of the plant pathogen Xanthomonas identifies
sRNAs with putative virulence functions. Nucleic Acids Res., 40, 2020-2031.
Eigenanteil: Die Planung der Probenaufbereitung für die Pyrosequenzierung erfolgte in
Zusammenarbeit mit J. Vogel, C. M. Sharma und U. Bonas. Die RNA Extraktion und DNase I-
Behandlung wurde von mir durchgeführt. Die nachfolgende Behandlung der RNA und die
Sequenzierung wurde von C. M. Sharma durchgeführt. Die bioinformatische Prozessierung der
Sequenzierdaten, das ‚mapping‘ der ‚reads‘ sowie die Klassifizierung von TSSs wurde von S. Findeiß
in Absprache mit mir durchgeführt. Die folgenden Analysen und Experimente habe ich selbstständig
durchgeführt: manuelle Sichtung der Sequenzierdaten und Auswahl von ncRNA Kandidaten; RNA
Präparation und Test der ncRNA Kandidaten mittels Northern Blot; 5‘-RACE Analyse von asX4
sowie 5‘- und 3‘-RACE Analyse von sX12; Deletionsmutagenese von sX12, Erstellung des
Komplementationskonstrukts und Infektionsexperimente; Wachstumsanalysen von Xcv und
Xcv∆sX12; bioinformatische Analyse der 5‘-UTRs von Typ III Effektorgenen. Die 3‘-RACE
Experimente von asX4 erfolgten in Zusammenarbeit mit J. Brock (geb. Kuhfuß). Die Ergebnisse des
von S. Findeiß und S. Hoffmann entwickelten bioinformatischen Ansatzes zur automatischen TSS
Identifizierung wurden stichprobenartig von mir überprüft. Die Abbildungen 2, 3, 4, S3 und S4A
sowie die Tabellen 1 und S1 wurden von mir erstellt. Die Abbildung 1 und die Tabellen S2 bis S7
wurden in Zusammenarbeit mit S. Findeiß angefertigt. Abbildung S4B wurde in Zusammenarbeit mit
J. Brock erstellt. Die Anfertigung des Manuskripts erfolgte in Zusammenarbeit mit S. Findeiß und U.
Bonas. Geteilte Erstautorenschaft mit S. Findeiß.
Publikation 2, Kapitel 2.2.1.
Findeiß, S., Schmidtke, C., Stadler, P.F. and Bonas, U. (2010) A novel family of plasmid-
tmRNA und 6S RNA)(s. Kapitel 2.1.1.; Koop. mit S. Findeiß; (188)). Diese Transkripte standen nicht
im Fokus dieser Arbeit, da in verschiedenen Bakterien generelle zelluläre Funktionen dieser RNAs,
mit Ausnahme der RtT RNA, nachgewiesen wurden: Das Ribozym RNase P ist essentiell für die
Prozessierung von Vorläufer-tRNAs, die SRP RNA (4.5S RNA) ist an der Membranlokalisierung von
Proteinen mit Sec-Signalpeptiden beteiligt und tmRNA vermittelt die Termination der Translation im
Falle der Unterbrechung des Translationsprozesses (s. Kapitel 1.3.2.)(49,72,81,142). Die genaue
Funktion der RtT RNA, die in E. coli durch Prozessierung des tyrT tRNA Operons generiert wird, ist
nicht bekannt (18). Da keine dRNA-Seq ‚reads‘ für den vorhergesagten rtT Lokus in Xcv detektiert
wurden und die Region nicht Teil eines tRNA Operons ist, bleibt zu untersuchen, ob der Lokus eine
ncRNA kodiert. Northern Blot Analysen ergaben eine Akkumulation der Xcv 6S RNA in der
stationären Wachstumsphase (s. Kapitel 2.1.1.; (188)). Da zudem dRNA-Seq ‚reads‘ für eine pRNA
detektiert wurden (s. Kapitel 2.1.1.; (188)), liegt der Schluss nahe, dass die 6S RNA in Xcv ähnliche
76 Diskussion
Funktionen wie in anderen Bakterien erfüllt und die Aktivität der RNA Polymerase reguliert (s.
Kapitel 1.3.2.).
Mittels dRNA-Seq wurden TSSs von fünf potentiellen Riboswitches (TPP, SAM, SAH, Glycin und
YybP-YkoY) in Xcv detektiert (s. Kapitel 2.1.1.; Koop. mit S. Findeiß; (188)). Zudem wurden drei
Riboswitch Kandidaten (YybP-YkoY, FMN, Ado-Cbl) vorhergesagt, für die allerdings nur wenige
bzw. keine Expressionsdaten vorliegen (s. Kapitel 2.1.1.; Koop. mit S. Findeiß; (188)). Mit Ausnahme
der vorliegenden Arbeit wurden bislang keine Riboswitches in Xanthomonas spp. identifiziert. In Xcv
und den meisten anderen Bakterien sind TPP, SAM, FMN bzw. Ado-Cbl Riboswitches mit Genen
assoziiert, die an der Biosynthese von TPP, Methionin/ Cystein, FMN bzw. dem Transport von Ado-
Cbl beteiligt sind (s. Kapitel 2.1.1.; (188)). Solche Riboswitches hemmen typischerweise die
Expression der cis-lokalisierten Gene in Gegenwart der Liganden (50,69,136,137,147,231,232,260).
Der SAH bzw. Glycin Riboswitch reguliert in Xcv vermutlich die Expression eines SAH-Hydrolase-
bzw. Glycin-Dehydrogenase-kodierenden Gens (s. Kapitel 2.1.1.; (188)). In Gegenwart der Liganden
fördern solche Riboswitches typischerweise die Synthese von Proteinen, die am Abbau von SAH bzw.
Glycin beteiligt sind (129,194,239). Die zwei in Xcv identifizierten YybP-YkoY Riboswitch-
Kandidaten sind, ähnlich wie in anderen Bakterien, mit Genen assoziiert, die potentielle
Membranproteine kodieren (s. Kapitel 2.1.1.; (188))(6,134). Wenngleich die Liganden bislang
unbekannt sind, wird angenommen, dass YybP-YkoY Elemente pH-Wert Änderungen perzipieren
(134).
Da dRNA-Seq ‚reads‘ für die potentiellen TPP und SAM Riboswitches in Xcv ausschließlich für die
Riboswitches, jedoch nicht für den jeweils flankierenden ORF detektiert wurden (s. Kapitel 2.1.1.;
(188)), liegt der Schluss nahe, dass diese RNA Elemente die Expression der stromabwärts lokalisierten
ORFs durch vorzeitige Termination der Transkription regulieren (s. Kapitel 1.3.1.). Eine ähnliche
Funktionsweise wurde für TPP Riboswitches von E. coli und Rhizobium etli beschrieben (136,260).
Interessanterweise wurden kürzlich im Gram-positiven Humanpathogen L. monocytogenes zwei SAM
Riboswitches identifiziert, die auch in trans als sRNAs wirken können. Bei hohem zellulären SAM
Level akkumulieren die Terminationsprodukte der Riboswitches (SreA und SreB; ~200 Nt) und
hemmen die Synthese des Virulenzgenaktivators PrfA durch Basenpaarung mit der prfA mRNA (122).
Dies wirft die Frage auf, ob in Xcv TPP und SAM Riboswitches die Virulenzgenexpression in
Abhängigkeit von der Nährstoffverfügbarkeit beeinflussen können. Eine solche Funktion könnte durch
Mutagenese der Riboswitches und Infektionsanalysen untersucht werden.
Diskussion 77
3.3. Identifizierung neuartiger ncRNAs in Xcv
Die dRNA-Seq Analyse von Xcv ergab antisense ‚reads‘ für 22% aller Nukleotide, die annotierten
ORFs zugewiesen sind (s. Kapitel 2.1.1.; Koop. mit S. Findeiß; (188)). Vergleichbar mit diesem
Ergebnis wurden asRNAs für 1-27% der proteinkodierenden Gene von Mycoplasma pneumoniae,
Synechocystis sp. PCC 6803, S. meliloti, A. tumefaciens, P. syringae und S. aureus sowie für 46% der
ORFs von H. pylori beschrieben (7,52,71,138,186,196,258).
In dieser Arbeit wurden TSSs für 178 abundante antisense Transkripte detektiert, von denen einige
vermutlich die Aktivität mobiler Elemente oder die Expression von Virulenzgenen modulieren (s.
Kapitel 2.1.1.; Koop. mit S. Findeiß; (188)). Beispielsweise wurden antisense ‚reads‘ für die meisten
der 66 annotierten IS Elemente detektiert (188). Eine spezifische Zuordnung von dRNA-Seq ‚reads‘
zu IS Elementen ist jedoch nur eingeschränkt möglich, da beispielsweise Transposasegene von IS1477
Elementen in 20 Kopien mit mehr als 90% Sequenzidentität vorliegen (215). Eine Funktion von
asRNAs in der Regulation der Transposonaktivität wurde für E. coli beschrieben und wird für
zahlreiche asRNAs in anderen Bakterien vermutet (14,124,186,258). Mit asRNAs assoziierte Xcv
Pathogenitäts- bzw. Virulenzgene umfassen u.a. hrcC und die Typ III Effektorgene avrBs1, xopAA,
xopB, xopD, xopE2 und xopO (s. Kapitel 2.1.1.; (188)). hrcC kodiert das Sekretin des T3S Systems
und ist essentiell für die Pathogenität von Xcv (16,253). Eine Virulenzfunktion wurde für XopAA,
XopB und XopD beschrieben (102,143,191). Die genannten Gene werden transkriptionell durch HrpX
induziert und weisen eine charakteristische PIP Box in den Promotorregionen auf (105,191,253).
Dagegen ist das Expressionsmuster der hier identifizierten asRNAs unbekannt. Die Synthese von Typ
III Effektoren kann durch Anzucht von Xcv in XVM2 Medium induziert werden, wohingegen die in
vitro Sekretion nur in Minimalmedium A (pH 5,2) und in Gegenwart von HrpG* erfolgt (180,253).
Denkbar wäre, dass die genannten asRNAs die Stabiliät und/ oder Translation der entsprechenden
Effektor-mRNAs unter nicht-sekretorischen Bedingungen vermindern und dadurch die Akkumulation
potentiell toxischer Proteine unterdrücken.
In dieser Arbeit wurden in Xcv 15 sRNAs (sX1-15), die 6S RNA und acht cis-kodierte asRNAs (asX1-
7 und PtaRNA1) experimentell bestätigt (s. Kapitel 2.1.1.; (188)). Zudem ergaben Northern Blot
Analysen für einige der 65 weiteren getesteten sRNA Kandidaten Signale für kurze Transkripte (C.
Schmidtke und U. Bonas, unveröffentlicht). Allerdings korrelierten die detektierten RNA Längen nicht
mit den dRNA-Seq Daten, da die entsprechenden Loci offenbar nicht vollständig durch ‚reads‘
abgedeckt wurden. Solche sRNA Kandidaten könnten in zukünftigen Analysen, z.B. durch
Bestimmung der Transkriptenden, näher untersucht werden.
Für die meisten der verifizierten Xcv sRNAs und asRNAs ergaben Northern Blot Analysen mehrere
Hybridisierungsignale, wobei die Abundanz einiger Signale in Abhängigkeit von HrpG und/ oder
HrpX (sX4, asX1 und asX5) oder der Wachstumsphase (z.B. sX3 und 6S RNA) verändert war (s.
Kapitel 2.1.1.; (188)). Die Größe von einigen der alternativen Hybridisierungssignale korrelierte mit
78 Diskussion
den Längen entsprechender dRNA-Seq ‚reads‘ (s. Kapitel 2.1.1.; (188)). Dennoch können
Kreuzhybridisierungen der verwendeten Sonden mit anderen Transkripten nicht ausgeschlossen
werden. Um die Spezifität der erhaltenen Hybridisierungssignale zu untersuchen, könnten andere
Oligonukleotidsonden verwendet bzw. entsprechende sRNA Deletionsmutanten erstellt und mittels
Northern Blot Analysen überprüft werden. Insgesamt deuten die Daten auf eine veränderte Stabilität
bzw. Prozessierung von Xcv sRNAs unter verschiedenen Bedingungen hin (s. Kapitel 2.1.1.; (188)).
Aufgrund der Rifampicin Resistenz der verwendeten Xcv Stämme war keine Untersuchung der RNA
Stabilität mit Hilfe des üblicherweise verwendeten Transkriptionsinhibitors Rifampicin möglich. Die
Prozessierung von Xcv sRNAs könnte durch Analyse der sRNA Expressionsmuster in RNase-Gen
Mutanten untersucht werden. Xcv kodiert mehr als 15 vorhergesagte RNasen (215). Mögliche sRNA
Prozessierungsprodukte wurden auch für Xoo und A. tumefaciens beschrieben (118,258). Zudem ist
bekannt, dass die Aktivität enterobakterieller sRNAs, z.B. GlmZ, IstR-1 und MicX, durch RNase-
vermittelte Prozessierung reguliert wird (43,98,233).
Phylogenetische Analysen ergaben, dass die in Xcv identifizierten sRNA und asRNA Gene, mit
Ausnahme von 6S, sX8, asX6 und ptaRNA1, nur in den nahe verwandten Gattungen Xanthomonas,
Xylella und Stenotrophomonas vorkommen (s. Kapitel 2.1.1.; Koop. mit S. Findeiß; (188)). Neben den
im Rahmen dieser Arbeit identifizierten Xcv sRNAs wurden sRNAs bzw. Kandidaten für Xcc Stamm
8004, Xoo Stamm PXO99 und das opportunistische Humanpathogen Stenotrophomonas maltophilia
Stamm K279a beschrieben (1,92,118,179). S. maltophilia gehört ebenfalls zur Xanthomonadaceae
Familie der γ-Proteobakterien (37). Entgegen der Annahme der Autoren, dass die drei Xcc sRNAs
Xcc2, Xcc3 und Xcc4 basenpaarende und Xanthomonas-spezifische sRNAs repräsentieren (92),
handelt es sich dabei um konservierte Orthologe der 6S RNA, SRP RNA und 5S rRNA. Das sRNA-
Xcc1 Gen wird HrpX-abhängig transkribiert (36,92), kommt jedoch nicht in Xcv Stamm 85-10 vor.
Kürzlich wurden acht weitere sRNAs und 16 sRNA Kandidaten in Xcc identifiziert, wobei der
zugrundeliegende RNA-Seq Ansatz keine strangspezifische Zuordnung der Sequenzierdaten erlaubt
(1). Interessanterweise wurde eine verminderte Virulenz für einen Xcc Stamm beschrieben, welcher
Deletionen in drei Rpf-/ DSF-abhängig exprimierten sRNA Genen (sRNAXcc-15/ -16/ -18) aufwies.
Dagegen hatte die Deletion der einzelnen sRNA Gene keinen Einfluss auf die Xcc Virulenz (1). Die
entsprechenden Gene kommen im Xcv Stamm 85-10 nicht vor. Parallel zu den Ergebnissen dieser
Arbeit wurde die Identifizierung von acht sRNAs im Xoo Stamm PXO99 beschrieben (118), wobei
Xoo3, Xoo4 und Xoo6 Orthologe der Xcv RNAs sX14, asX4 bzw. sX1 repräsentieren (s. Kapitel 2.1.1.;
(188)). Während Xoo4 als trans-kodierte sRNA (145 Nt) identifiziert wurde, handelt es sich bei asX4
in Xcv um eine 309 Nt-lange antisense RNA (s. Kapitel 2.1.1.; Koop. mit J. Brock; (188)). Die
Deletion von einzelnen sRNA Genen in Xoo hatte keinen Einfluss auf die Virulenz (118). Wenngleich
mögliche Ziel-mRNAs unbekannt sind, lassen Proteomanalysen vermuten, dass sRNA-Xoo1, sRNA-
Xoo3 und sRNA-Xoo4 an der Regulation des Aminosäurestoffwechsels und anderen generellen
zellulären Prozessen beteiligt sind (118). Für S. maltophilia wurden 16 sRNAs mit unbekannten
Diskussion 79
Funktionen beschrieben, von denen SmsR26 und SmsR39 Orthologe der Xcv sRNAs sX5 bzw. sX13
repräsentieren (179).
Neben Vertretern der Xanthomonadaceae wurden sRNAs in den pflanzenpathogenen Bakterien P.
syringae pv. tomato Stamm DC3000, A. tumefaciens sowie in Erwinia spp. identifiziert
(33,52,161,258,259). Virulenzfunktionen wurden für zwei sRNAs aus E. amylovora nachgewiesen
(262). Zudem ist bekannt, dass RNAs der RsmB/ RsmC Familie in E. carotovora subsp. carotovora
die Aktivität des translationalen Repressorproteins RsmA kontrollieren und QS, die Produktion
extrazellulärer Enzyme sowie die Virulenz beeinflussen (38,39,121). RsmA ist ebenfalls für die
Pathogenität von Xcc und Xoo essentiell, wenngleich die zugehörigen regulatorischen RNAs bislang
unbekannt sind (34,123,264).
3.3.1. Mögliche Funktionen cis-kodierter asRNAs
Zwei der in dieser Arbeit identifizierten asRNAs, asX6 und PtaRNA1, werden unabhängig von HrpG
und HrpX exprimiert und sind vermutlich an der Regulation der Expression von zytotoxischen
Proteinen beteiligt (s. Kapitel 2.1.1. und 2.2.1.; (54,188)). Das asX6 Gen ist im Xcv Plasmid pXCV183
lokalisiert und überlappt in antisense Orientierung mit der 3‘-Region des XCVd0100-XCVd0099
Operons, welches vermutlich ein Antitoxinprotein der ε-Familie bzw. ein ζ-Toxin-ähnliches Protein
kodiert (s. Kapitel 2.1.1.; (188)). Die Lokalisierung der Gene lässt vermuten, dass asX6 die Expression
des Toxingens posttranskriptionell beeinflussen könnte, dies wurde in dieser Arbeit jedoch nicht näher
untersucht. Für das ζ-/ ε-Toxin-Antitoxin (TA) System in Xcv wird vermutet, dass es die Weitergabe
von pXCV183 während der Zellteilung sicherstellt (215). Für Streptococcus wurde gezeigt, dass das ε-
Antitoxin die zytotoxische Aktivität des ζ-Toxins unterdrückt. Ein Verlust des Plasmids bzw. des TA
Lokus während der Zellteilung führt zum schnellen proteolytischen Abbau des Antitoxins,
wohingegen das stabile Toxin eine Zelltodreaktion induziert und die Vermehrung plasmidfreier Zellen
verhindert (28,119,265). Das ζ-/ ε-TA System und andere TA Systeme, in welchen ein
Antitoxinprotein die Toxinaktivität hemmt, werden als Typ II-TA Systeme bezeichnet (192). Bisher ist
nicht bekannt, dass asRNAs an der Regulation der Aktivität von Typ II-TA Systemen beteiligt sind.
In Typ I-TA Systemen wird die Toxinsynthese durch eine asRNA unterdrückt, welche als Antitoxin
wirkt und meist konstitutiv exprimiert wird (192). Die Bindung der asRNA an die Toxin-kodierende
mRNA hemmt die Ribosomenbindung und/ oder induziert den Abbau des RNA Duplex (41,56,233).
Neben plasmidkodierten TA-Systemen wurden entsprechende Loci auch in den Chromosomen
zahlreicher Bakterien identifiziert (57,127). In Xcv kodiert das ptaRNA1 Gen (‚plasmid-transferred
antisense RNA 1‘) vermutlich das RNA Antitoxin (72 Nt) eines chromosomal-lokalisierten Typ I-TA
Systems (s. Kapitel 2.2.1.; (54)). Das asRNA Gen überlappt mit der RBS und der 5‘-Region des
XCV2162 ORFs, welcher ein hypothetisches Protein (76 Aminosäuren; AS) mit unbekannter Funktion
kodiert (s. Kapitel 2.2.1.; (54))(215). Der Lokus weist typische Merkmale eines Typ I-TA Systems
80 Diskussion
auf, da dRNA-Seq ‚reads‘ für PtaRNA1 im Vergleich zu XCV2162 deutlich überrepräsentiert sind
(~200 bzw. 2 ‚reads‘)(s. Kapitel 2.1.1. und 2.2.1.; (54,188))(66). Phylogenetische Analysen ergaben,
dass der potentielle TA Lokus in zahlreichen, nur entfernt mit Xcv verwandten γ- und ß-
Proteobakterien konserviert ist, jedoch nicht in nahe verwandten Bakterien vorkommt (s. Kapitel
2.2.1.; (54)). Zudem sind Orthologe von ptaRNA1/ XCV2162 überwiegend in Nachbarschaft des trbL
Gens kodiert, welches vermutlich am konjugalen DNA Transfer beteiligt ist. Das sporadische
phylogenetische Auftreten sowie die Plasmidlokalisierung eines entsprechenden Lokus in P.
aeruginosa lassen vermuten, dass dieses TA System seinen Ursprung in Plasmiden hat und durch
horizontalen Gentransfer verbreitet wird (s. Kapitel 2.2.1.; (54)). Die meisten Typ I-Toxine,
einschließlich XCV2162, sind kleine Proteine (20-65 AS) mit Transmembrandomänen (s. Kapitel
2.2.1.; (54))(57). Für die E. coli Proteine Hok, IbsC und ShoB wird beispielsweise angenommen, dass
sie das Membranpotential der Zelle beeinträchtigen können (55,56,57,65). Einen Sonderfall stellt das
E. coli symE/ SymR Typ I-TA System dar. symE kodiert vermutlich eine toxinähnliche RNA-
Endonuklease und wird als Antwort auf DNA-Schädigung exprimiert (99). Bislang wurde nicht
untersucht, ob XCV2162 ein Toxin kodiert und unter welchen Bedingungen es exprimiert wird. Der
Einfluss von PtaRNA1 auf die Expression von XCV2162 könnte beispielsweise durch Mutation des
ptaRNA1 Promotors analysiert werden. Zudem könnte die ektopische Expression von XCV2162
Hinweise auf dessen Funktion liefern.
Die HrpG-/ HrpX-abhängige Akkumulation von drei der in dieser Arbeit verifizierten asRNAs (asX1,
asX4 und asX5), welche komplementär zur 3‘-Region der cis-kodierten Gene sind (XCV0392,
XCV4105 bzw. nrdB), deutet auf mögliche Virulenzfunktionen hin (s. Kapitel 2.1.1.; (188)). Die
zelluläre Funktion von XCV0392 ist nicht bekannt. XCV4105 ähnelt eukaryotischen mitochondrialen
Rho GTPasen, welche u.a. am programmierten Zelltod (Apoptose) beteiligt sind (58).
Interessanterweise weist XCV4105 ein vergleichbares Expressionsmuster wie asX4 auf und trägt
vermutlich zur Virulenz von Xcv bei (J. Brock, C. Schmidtke und U. Bonas, unveröffentlicht). NrdB,
die ß-Untereinheit der Ribonukleotid-Diphosphat Reduktase, vermittelt wahrscheinlich die Synthese
von Desoxyribonukleotiden aus Ribonukleotiden und ist dadurch indirekt an der DNA Synthese
beteiligt (80). Wenngleich NrdB in Bakterien konserviert ist, wurden Orthologe von asX5
ausschließlich in Xcv identifiziert (s. Kapitel 2.1.1.; (188)). Dies könnte auf eine spezifische Funktion
von asX5/ nrdB in der Interaktion von Xcv mit Wirtspflanzen hindeuten. Nachfolgende Analysen
könnten die Expressionsmuster der genannten mRNAs untersuchen und regulatorische Funktionen der
entsprechenden asRNAs mit Hilfe von Promotormutationen bzw. Überexpressionexperimenten
ermitteln.
Diskussion 81
3.3.2. sRNAs mit potentiellen Virulenzfunktionen
Die im Rahmen dieser Arbeit identifizierten Xcv sRNAs sind mit Ausnahme von sX6 nicht-kodierend.
Wenngleich sX6 ein Protein kodiert (80 AS)(s. Kapitel 2.1.1.; Koop. mit J. Brock; (188)), kann eine
Funktion als regulatorische RNA nicht ausgeschlossen werden. Duale Funktionen wurden
beispielsweise für SgrS in E. coli und RNAIII in S. aureus beschrieben (226). SgrS hemmt die
Synthese des Zuckerphosphat-Transporters PtsG durch Basenpaarung mit der ptsG mRNA und kodiert
zudem das SgrT Protein (43 AS), welches die Aktivität von Transporterproteinen inhibiert (227,237).
RNAIII reguliert durch Basenpaarung die Translation von sechs mRNAs und vermittelt die Produktion
von Exotoxinen. Darüber hinaus kodiert RNAIII einen sekretierten Virulenzfaktor (Hämolysin δ; 26
AS)(226).
Im Fokus dieser Arbeit stand die Identifizierung von Xcv sRNAs mit möglichen Virulenzfunktionen.
Das HrpG- bzw. HrpX-abhängige Expressionsmuster von fünf Xcv sRNAs (sX4, sX5, sX8, sX11 und
sX12) deutet auf eine solche Funktion hin (s. Kapitel 2.1.1.; (188)). Bislang wurde nur sX12 (78 Nt)
näher untersucht. sX12 wird HrpX-abhängig exprimiert und fördert die Ausbildung wässriger
Läsionen in suszeptiblen sowie die HR-Induktion in resistenten Pflanzen (s. Kapitel 2.1.1.; (188)). Die
Deletion von sX12 hat keinen Einfluss auf die Vermehrung von Xcv in planta oder die generelle
Fähigkeit zur Typ III Sekretion in vitro (s. Kapitel 2.1.1.; Koop. mit J. Brock; (188)). Um die
molekularen Funktionen von sX12 zu untersuchen, wurden bislang qRT-PCR Analysen von mehr als
zehn bioinformatisch vorhergesagten Ziel-mRNAs sowie Proteom- und ‚Microarray‘ Analysen von
Xcv Stamm 85-10 und der sX12 Deletionsmutante durchgeführt. Diese Experimente ergaben keine
signifikanten Unterschiede in den Protein- oder Transkriptmengen der getesteten Stämme (C.
Schmidtke und U. Bonas, unveröffentlicht; C. Schmidtke, B. Voigt, M. Hecker und U. Bonas,
unveröffentlicht; C. Schmidtke, S. Serrania, A. Becker und U. Bonas, unveröffentlicht). Bislang ist
nicht bekannt, worauf die reduzierte Virulenz der sX12 Deletionsmutante beruht. In zukünftigen
Untersuchungen könnten sogenannte ‚pulse expression‘ Analysen durchgeführt werden. Hierbei wird
die Expression der sRNA mittels eines induzierbaren Promotors kurzzeitig und stark induziert, wobei
angenommen wird, dass dies vor allem direkt gebundene mRNAs beeinflusst (158,159). Durch
nachfolgende RNA-Seq Analysen könnten potentielle sX12 Ziel-mRNAs identifiziert werden.
Allerdings könnte sX12 auch die Translation von mRNAs modulieren, ohne die mRNA Akkumulation
zu beeinflussen. Denkbar wäre auch, dass sX12 an Proteine bindet und deren Aktivität reguliert.
Mögliche sX12-gebundene Proteine könnten mittels eines RNA-Epitop-markierten sRNA Derivats
gereinigt werden (184).
Die Funktion von sX12 ist vermutlich mit dem T3S System verknüpft, da die Expression von sX12
mit dem T3S System ko-reguliert ist und da sX12 Orthologe ausschließlich in Xanthomonas spp.
vorkommen, die ein hrp-T3S System kodieren (s. Kapitel 2.1.1.; (188)). Hierbei könnte sX12 die
Aktivität oder Expression einzelner Komponenten oder Substrate des T3S Systems beeinflussen. Eine
82 Diskussion
solche Funktion wird auch für die Salmonella sRNA IsrJ vermutet. IsrJ ist Teil des SPI-1 (‚Salmonella
pathogenicity island 1‘) Regulons und fördert durch einen bislang unbekannten Mechanismus die
Translokation von SPI-1 Typ III Effektoren sowie die bakterielle Invasion von Epithelzellen (155).
Um weitere sRNAs zu identifizieren, die zur Virulenz von Xcv beitragen, könnte mittels ‚dual
sequencing‘ das Transkriptom von Pathogen und Wirt während der Infektion analysiert werden
(249,256). Denkbar wäre auch, dass bakterielle Transkripte in die Wirtszelle transloziert werden und
dort die Expression pflanzlicher Abwehrgene unterdücken. Eine solche Funktion wurde erstmals
kürzlich für microRNAs des pflanzenpathogenen Pilzes Botrytis cinerea nachgewiesen (249).
3.4. sX13 – ein neuartiger Regulator der Virulenzgenexpression
3.4.1. sX13 fördert die hrp-Genexpression und die Virulenz von Xcv
Die meisten Xcv Virulenzfaktoren, einschließlich sX12, wurden anhand ihrer Ko-Expression mit dem
T3S System identifiziert (s. Kapitel 2.1.1.; (188))(24). Unerwarteterweise beeinträchtigte die Deletion
des konstitutiv exprimierten sX13 Gens die Virulenz von Xcv bzw. die Fähigkeit zur HR Induktion (s.
Kapitel 2.3.1.; (187)). Dies beruht vermutlich nicht auf einer veränderten Fitness der Bakterien, da das
in planta Wachstum von Mutante und Wildtypstamm vergleichbar war (s. Kapitel 2.3.1.; (187)).
Expressionsanalysen ergaben, dass sX13 die Expression von hrpX und HrpX-kontrollierten Genen
nach Anzucht von Xcv in hrp-Gen induzierendem XVM2 Medium fördert (s. Kapitel 2.3.1.; (187)).
Dies lässt vermuten, dass sX13 die Aktivität des T3S Systems fördert und dadurch zur Virulenz von
Xcv beiträgt. Interessanterweise war die mRNA Abundanz von hrpX sowie des HrpX-induzierten
Effektorgens xopS auch nach Anzucht von Xcv in NYG Komplexmedium sX13-abhängig verändert (s.
Kapitel 2.3.1.; (187)). Dies zeigt, dass HrpX, anders als bislang angenommen (189,252), bereits in
geringem Maße unter nicht-hrp-Gen induzierenden Bedingungen aktiv ist. Dieses Ergebnis beruht
vermutlich auf der höheren Sensitivität der in dieser Arbeit verwendeten ‚Microarray‘ und qRT-PCR
Analysen, verglichen mit den zuvor getesteten Promotor-Reportergenfusionen (189,252).
Wie wirkt sX13 auf das hrp-Regulon? sX13 beeinflusste einerseits die mRNA Akkumulation von
hrpX, hatte jedoch keinen Einfluss auf hrpG und die Expression translationaler hrpG- bzw. hrpX-
Reportergenfusionen (s. Kapitel 2.3.1.; (187)). Dies lässt vermuten, dass sX13 indirekt auf das hrp-
Regulon wirkt. Da die Reporterplasmide nur einen Teil der kodierenden Sequenzen von hrpG und
hrpX enthielten, sollte untersucht werden, ob sX13 die Translation der Volllängen mRNAs beeinflusst.
sX13 fördert vermutlich die Aktivität des HrpG Proteins, da die ektopische Expression von HrpG*,
einer konstitutiv aktiven Version von HrpG (254), die Deletion von sX13 hinsichtlich des in planta
Phänotyps sowie der Expression von hrpX und HrpX-regulierter Gene kompensierte (s. Kapitel 2.3.1.;
(187)). Denkbar wäre, dass sX13 die Synthese eines bislang unbekannten HrpG-aktivierenden Proteins
Diskussion 83
reguliert. HrpG gehört zur Familie der OmpR-Typ ‚response regulators‘, welche typischerweise durch
zugehörige Sensor-Histidinkinasen phosphoryliert und aktiviert werden (255). Das Xcv Genom kodiert
mehr als 80 solcher Proteine (215). Kürzlich wurde eine in Xanthomonas spp. konservierte Sensor-
Histidinkinase, HpaS (‚hrp-associated sensor‘), im Xcc Stamm 8004 als Regulator der HrpG Aktivität
identifiziert (116). Die Mutation von hpaS beeinträchtigt die Phosphorylierung von HrpG sowie die
Virulenz von Xcc (116). Zukünftige Analysen könnten untersuchen, ob in Xcv die Aktivität von HrpG
durch HpaS kontrolliert wird bzw. inwiefern sX13 die Expression von HpaS oder anderen möglichen
Sensor-Histidinkinasen beeinflusst.
Die regulatorische Rolle von sX13 ist nicht allein auf das Xcv T3S System beschränkt. Dies wird u.a.
anhand der phylogenetischen Verbreitung von sX13 deutlich (s. Kapitel 2.3.1.; (187)). Homologe sind
in allen Vertretern der Xanthomonadaceae Familie konserviert, von denen einige kein hrp-T3S
System kodieren, z.B. Xal und S. maltophilia (s. Kapitel 2.3.1.; (187)). Interessanterweise sind alle
sX13 Homologe stromabwärts des DNA Polymerase I-kodierenden polA Gens lokalisiert (s. Kapitel
2.3.1.; (187))(51). Dieser Lokus kodiert in E. coli und α-Proteobakterien die sRNA Spot42 bzw.
sRNAs der αr7 Familie (45,97,173,183). sX13 weist keine Sequenzähnlichkeit zu diesen sRNAs auf,
wenngleich αr7 sRNAs ‚Stem-Loops‘ mit ‚C‘-reichen Loop-Sequenzen enthalten und sX13 strukturell
ähneln (s. Kapitel 2.3.1.; (187))(45). Die Funktion von αr7 sRNAs ist nicht bekannt. Spot42 ist an der
Regulation des Zuckerstoffwechsels in E. coli beteiligt (9,141). sX13, Spot42 und αr7 RNAs haben
sich vermutlich unabhängig voneinander oder durch divergente Evolution eines gemeinsamen
Vorläufers entwickelt.
3.4.2. Mögliche physiologische Funktionen von sX13
In dieser Arbeit wurden 63 potentielle sX13-Ziel mRNAs anhand veränderter Transkriptmengen in der
sX13 Deletionsmutante gegenüber dem Xcv Wildtypstamm identifiziert, wobei die Expression von
XCV0173, XCV3573 und pilH zwar mittels qRT-PCR, jedoch nicht durch die ‚Microarray‘ Analysen
nachgewiesen werden konnte (s. Kapitel 2.3.1.; (187)). Dies ist auf die geringe Signalstärke der
‚Microarray‘ Hybridisierungsignale für diese mRNAs zurückzuführen und deutet auf eine geringe
Sensitivität der ‚Microarray‘ Analysen hin. Folglich könnte sX13 die Akkumulation von weiteren
mRNAs beeinflussen. Die ‚Microarray‘ Analysen erlauben keine Rückschlüsse darauf, ob sX13 direkt
mit mRNAs intergagiert (s. Kapitel 3.4.5.). Da das sX13 Regulon Gene umfasst, die transkriptionelle
Regulatoren kodieren, z.B. hrpX, algR und pilH (s. Kapitel 2.3.1.; (187)), liegt die Vermutung nahe,
dass sX13 indirekt die Transkription von Xcv Genen beeinflusst.
Die Ergebnisse zeigen außerdem, dass sX13 die Expression des RNA-Bindeproteins Hfq hemmt (s.
Kapitel 2.3.1.; (187)), welches in zahlreichen Bakterien die Stabilität und Aktivität von sRNAs
kontrolliert (44). Folglich könnte sX13 durch Regulation der Hfq Synthese indirekt
posttranskriptionelle Prozesse in Xcv beeinflussen. Die Ergebnisse von J. Brock zeigen, dass die
84 Diskussion
Mutation von hfq keine Auswirkung auf die Virulenz von Xcv oder die Abundanz von sX13 hatte,
jedoch die Akkumulation der sX14 sRNA beeinträchtigte (s. Kapitel 2.3.1.; (187)). Zudem wurde
nachgewiesen, dass die Mutation von hfq keinen Einfluss auf die sX13-abhängige Expression von
mRNA::gfp Fusionen hat, was zeigt, dass sX13 Hfq-unabhängig agiert (s. Kapitel 2.3.1.; Koop. mit U.
Abendroth und J. Brock; (187)). Bislang ist sX13 die einzige bakterielle sRNA, für die ein Einfluss
auf hfq nachgewiesen wurde. In Übereinstimmung mit den Ergebnissen von J. Brock wurde für Xoo
beschrieben, dass die Deletion von hfq die Akkumulation des sX14 Orthologs sRNA-Xoo3
beeinträchtigt und keinen Einfluss auf die Virulenz hat (118). Zudem wurde für S. maltophilia
nachgewiesen, dass das sX13 Ortholog SmsR39 Hfq-unabhängig akkumuliert (179). In den meisten
pathogenen Bakterien, einschließlich des Pflanzenpathogens A. tumefaciens, trägt Hfq zur Virulenz bei
(35,257), wohingegen beispielsweise die S. aureus sRNA RNAIII in Hfq-unabhängiger Weise die
Virulenzgenexpression kontrolliert (13).
Die in dieser Arbeit durchgeführten Expressionsanalysen lassen vermuten, dass sX13 durch
Modulation der Genexpression zur Adaption von Xcv an sich verändernde Umweltbedingungen
beiträgt (Abb. 4). Hierfür spricht, dass die sRNA unter bestimmten Wachstumsbedingungen
akkumulierte und dass die Abundanz ausgewählter mRNAs, z.B. hrpX, mit der Abundanz von sX13
korrelierte (s. Kapitel 2.3.1.; (187)). Zudem beeinflusste sX13 in gegensätzlicher Weise und in
Abhängigkeit von den Wachstumsbedingungen die Akkumulation von mRNAs, welche an der Tfp
Biogenese bzw. der Flagellum-vermittelten Chemotaxis beteiligt sind (s. Kapitel 2.3.1.; (187)). Tfp
vermitteln die bakterielle Fortbewegung auf festen Oberflächen, wohingegen das Flagellum eine
schwimmende Fortbewegung ermöglicht (91). Für Xanthomonas spp. wurde beschrieben, dass Tfp
und Flagellum Virulenzfunktionen erfüllen und u.a. die bakterielle Anheftung an die Blattoberfläche
ermöglichen (42,128,225,240). Folglich könnte sX13 in Abhängigkeit von den Umweltbedingungen
die Art der bakteriellen Fortbewegung modulieren bzw. zur Kolonisierung pflanzlicher Oberflächen
durch Xcv beitragen.
sX13 ist vermutlich an der QS-abhängigen Regulation der Genexpression beteiligt, da die Zelldichte
der sX13 Deletionsmutante in der stationären Wachstumsphase gegenüber dem Xcv Wildtypstamm
reduziert war (s. Kapitel 2.3.1.; (187)). In diesen Experimenten wurde sowohl die optische Dichte der
Kulturen gemessen, als auch die bakterielle Zellzahl bestimmt. Die Zellzahl des Xcv Wildtypstamms
und der sX13 Deletionsmutante korrelierte in vergleichbarem Maße mit der optischen Dichte der
Kulturen (C. Schmidtke und U. Bonas, unveröffentlicht). Ein weiterer Hinweis auf eine Funktion von
sX13 in der QS-abhängigen Regulation ist die sX13-abhängige Akkumulation der XCV2041 mRNA,
welche ein Protein kodiert, das GGDEF- und EAL-Domänen aufweist (s. Kapitel 2.3.1.; (187)).
Solche Proteine kontrollieren typischerweise die Menge des intrazellulären Botenmoleküls zyklisches
di-GMP und modulieren dadurch die QS-abhängige Genexpression (78). Interessanterweise weist
XCV2041 94% Sequenzübereinstimmung mit dem Xcc Protein XC2226 auf, welches als Repressor
der Tfp-vermittelten Motilität beschrieben wurde (182). Studien in Xac, Xcc und Xoc ergaben, dass QS
Diskussion 85
die Expression des hrp-Regulons und die Flagellum-vermittelte Motilität beeinflusst bzw. dass HrpG
die Expression von Genen des QS Systems und des Flagellarapparats moduliert (73,76,77,182,263).
Insgesamt lassen die Ergebnisse dieser Arbeit den Schluss zu, dass sX13 in Xcv die Aktivität
verschiedener regulatorischer Netzwerke koordiniert und dadurch die Virulenzgenexpression, QS und
die Motilität in Abhängigkeit von den Umweltbedingungen beeinflusst (Abb. 4)(s. Kapitel 2.3.1.;
(187)). Weitere Analysen könnten untersuchen, durch welche Signalwege und
Transkriptionsregulatoren die Transkription von sX13 kontrolliert wird.
Auch in anderen pathogenen Bakterien wurden sRNAs identifiziert, welche QS und die
Virulenzgenexpression kontrollieren: In V. cholerae akkumulieren vier homologe und redundant
wirkende sRNAs (Qrr1-4) bei niedriger Zelldichte und hemmen die Translation der hapR mRNA
(4,114). HapR kontrolliert die QS-Antwort und unterdrückt die Transkription von T3S- und anderen
Virulenzgenen. Die Expression der S. aureus sRNA RNAIII steigt mit zunehmender Zelldichte. Durch
Repression der Translation der rot mRNA (‚repressor of toxins‘) hemmt RNAIII die Synthese von
Außenmembranproteinen und fördert die Produktion sekretierter Toxine (15,61,151).
Abbildung 4. Modell physiologischer Funktionen von sX13 in Xcv. Die Expression bzw. Akkumulation von sX13 wird durch extrazelluläre Stimuli und unbekannte Signalwege induziert und beeinflusst die Aktivität regulatorischer Netzwerke. sX13 fördert indirekt die Aktivität von HrpG und beeinflusst dadurch die Expression von hrpX sowie des hrp-Regulons. HrpG wird in Gegenwart pflanzlicher Signale bzw. XVM2 Medium durch unbekannte Signalwege aktiviert, wobei sX13 möglicherweise die Synthese eines HrpG-aktivierenden Proteins moduliert. sX13 hemmt vermutlich die Typ IV Pilus-vermittelte Motilität, fördert eine Flagellum-abhängige schwimmende Fortbewegung von Xcv und beeinflusst möglicherweise die Zelldichte-abhängige Genexpression (QS). Für andere Xanthomonas spp. wurde nachgewiesen, dass hrp- und QS-Regulon partiell überlappen und Motilitätsgene umfassen. Durch Hemmung der Hfq Synthese beeinflusst sX13 vermutlich weitere sRNA-vermittelte posttranskriptionelle Prozesse. (Umrahmte Pfeile, Wellenlinien und Kreise kennzeichnen Gene, mRNAs bzw. Proteine. Unbekannte Proteine/ Signalwege sind durch gestrichelte Kreise dargestellt. Grüne, rote und gestrichelte Pfeile kennzeichnen positive, negative bzw. vermutete Effekte. IM, innere Membran; ÄM, äußere Membran).
86 Diskussion
3.4.3. Die Aktivität von sX13 beruht auf ‚C‘-reichen Loops
Die Strukturanalyse von sX13 wurde von U. Abendroth durchgeführt und ergab drei doppelsträngige
Bereiche, welche einzelsträngige apikale Loops mit ‚C‘-reichen (‚4C‘/ ‚5C‘) Motiven enthalten (s.
Kapitel 2.3.1.; (187)). Wenngleich die Sequenzen auf redundante Funktionen der sX13 Loops
hindeuten, ergaben die von U. Abendroth durchgeführten Komplementationsexperimente mit
plasmidkodierten sX13 Derivaten, dass die Loops 2 und 3, jedoch nicht Loop 1 oder die
unstrukturierte 5‘-Region, zur Virulenz von Xcv beitragen (s. Kapitel 2.3.1.; (187)). qRT-PCR
Analysen und Experimente mit translationalen mRNA::gfp Fusionen ergaben, dass sX13 mittels Loop
2 die mRNA Akkumulation von XCV3927 und hfq sowie die Synthese von XCV3927::GFP und
Hfq::GFP hemmt (s. Kapitel 2.3.1.; (187)). Dagegen hemmen vermutlich mehrere sX13 Loops die
mRNA Akkumulation von pilH bzw. die Synthese von PilH::GFP (s. Kapitel 2.3.1.; (187)). Die
Expression des plasmidkodierten sX13 Gens sowie der sX13 Loopmutanten wurde mittels Northern
Blot Analysen nachgewiesen, wobei im Gegensatz zum chromosomal-lokalisierten sX13 Gen mehrere
Hybridisierungssignale detektiert wurden (s. Kapitel 2.3.1.; (187)). Diese Signale waren jedoch
identisch für die verschiedenen sX13 Derivate und beruhen vermutlich auf einer ineffizienten
Termination der Transkription der plasmidkodierten Gene.
sX13 beeinflusste die Synthese der genannten GFP-Fusionsproteine in ähnlichem Maße wie die
mRNA Abundanz der entsprechenden chromosomal-kodierten Gene (s. Kapitel 2.3.1.; (187)). Diese
Ergebnisse ließen zunächst vermuten, dass sX13 die Akkumulation potentieller Ziel-mRNAs, jedoch
nicht deren Translation beeinflusst. Dagegen spricht, dass die Fluoreszenz des XCV3927::GFP
Proteins, jedoch nicht die Abundanz der XCV3927::gfp mRNA sX13-abhängig verändert war (s.
Kapitel 2.3.1.; (187)). Folglich beeinflusst sX13 die mRNA Akkumulation und Translation von
XCV3927 unabhängig voneinander. Die Ergebnisse deuten darauf hin, dass weitere Sequenzen des
XCV3927 ORFs, welche nicht im XCV3927::gfp Derivat enthalten waren, für die sX13-abhängige
mRNA Akkumulation essentiell sind. Dies könnte durch Expressionsanalysen von gfp-Fusionen der
Volllängen-mRNAs untersucht werden. Aufgrund der zuvor erwähnten Rifampicin Resistenz der
verwendeten Xcv Stämme steht der Nachweis aus, dass sX13 die Stabilität, d.h. die Halbwertszeit,
möglicher Ziel-mRNAs beeinflusst. Da sRNAs häufig den Abbau von Ziel-mRNAs durch RNase E
oder RNase III induzieren (s. Kapitel 1.3.4.1.), könnte der Einfluss von sX13 auf die Stabilität von
Ziel-mRNAs durch Mutation von sX13 sowie der entsprechenden RNase-kodierenden Gene untersucht
werden. Ähnlich zu den Ergebnissen für sX13/ XCV3927 in Xcv wurde für Salmonella beschrieben,
dass die sRNA RyhB die RNase E-vermittelte Spaltung der sodB mRNA in rund 350-Nt Entfernung
stromabwärts von der sRNA-Bindestelle induziert (169). Zudem wurde für RyhB in E. coli
nachgewiesen, dass die Repression der sodB Translation unabhängig von der RNaseE-vermittelten
mRNA Degradation erfolgt (145).
Diskussion 87
3.4.4. ‚G‘-reiche mRNA Motive vermitteln die sX13-abhängige Genexpression
Wie wirkt sX13 auf mögliche Ziel-mRNAs? sX13 hemmte die Synthese von XCV3927::GFP und
PilH::GFP Fusionsproteinen, welche unter Kontrolle des sX13-unabhängigen lac-Promotors
exprimiert wurden (s. Kapitel 2.3.1.; (187)). Dies zeigt, dass sX13 als posttranskriptioneller Repressor
wirkt. Da sRNAs auch die Translation von mRNAs fördern können (60), sollte untersucht werden, ob
sX13 die Expression positiv regulierter mRNAs posttranskriptionell beeinflusst.
Die bioinformatische Analyse der ‚Microarray‘ Daten ergab, dass 70% der durch sX13 negativ
beeinflussten mRNAs, einschließlich XCV3927, hfq und pilH, ein oder mehrere ‚GGGG‘ (‚4G‘)-
Motive in den 5‘-Regionen aufweisen (s. Kapitel 2.3.1.; (187)). Dies lässt vermuten, dass sX13 über
‚C‘-reiche Loops mit ‚G‘-reichen Motiven in potentiellen Ziel-mRNAs interagiert. sX13 weist
strukturelle Ähnlichkeit zu RNAIII und anderen sRNAs aus S. aureus auf, welche in Loops
lokalisierte ‚UCCC‘-Motive enthalten und mit ‚G‘-reichen Sequenzen in den 5‘-UTRs von Ziel-
mRNAs interagieren (s. Kapitel 2.3.1.; Koop. mit U. Abendroth; (187))(62). Zudem ist die Loop 3
Sequenz von sX13 (‚UCCCCCU‘) identisch zu einem Teil der Loop-Sequenz der H. pylori sRNA
HPnc5490 (s. Kapitel 2.3.1.; (187)). Diese hemmt wahrscheinlich durch komplementäre Basenpaarung
die Synthese des Chemotaxisregulators TlpB (196).
Die meisten bakteriellen sRNAs hemmen die Initiation der Translation von Ziel-mRNAs (245), wobei
Mutationen in sRNA oder mRNA zum Verlust der translationalen Repression führen (19,224). Eine
direkte Interaktion wird meist dann angenommen, wenn die sRNA-vermittelte Repression durch
komplementäre Sequenzaustausche in sRNA und mRNA wiederhergestellt wird (19,210,224). Eine
Rolle in der Hemmung der Translationsinitiation wurde zunächst auch für sX13 angenommen (Abb.
5A), da die Mutation der sX13 Loops mit einer verstärkten Synthese der entsprechenden GFP-
Fusionsproteine verbunden war (s. Kapitel 2.3.1.; (187)). Ein solches Modell wird jedoch nicht durch
die übrigen Ergebnisse gestützt. Entgegen der Erwartung führte die Mutation der ‚4G‘-mRNA Motive
nicht zu einer verstärkten Synthese von XCV3927::GFP und Hfq::GFP. Stattdessen war die
Expression der mutierten mRNA::gfp Fusionen in An- und Abwesenheit von sX13 oder Derivaten
ähnlich reduziert, wie die Expression der nicht-mutierten mRNA::gfp Fusionen in Gegenwart von
sX13 (s. Kapitel 2.3.1.; (187)). Zudem führte die Mutation des ‚4G‘-Motivs in der XCV3927::gfp
mRNA, welche unter Kontrolle des lac-Promotors exprimiert wurde, zu einer reduzierten und sX13-
unabhängigen Expression des Fusionsproteins (s. Kapitel 2.3.1.; (187)). Diese Ergebnisse lassen
folgende Schlussfolgerungen zu: (i) ‚C‘-reiche sX13 Loops und ‚G‘-reiche Motive in möglichen Ziel-
mRNAs sind für die Aktivität von sX13 essentiell. (ii) sX13 beeinflusst vermutlich nicht die
Translationsinitiation von XCV3927::gfp und hfq::gfp. (iii) ‚4G‘-Motive in möglichen sX13-Ziel
mRNAs können die Translation fördern, d.h. wirken als translationale Verstärker (‚enhancer‘).
Wenngleich die in sX13 und mRNAs eingeführten Mutationen die Sequenzkomplementarität
88 Diskussion
wiederherstellen, erlauben die Ergebnisse keine Rückschlüsse darauf, ob sX13 direkt mit mRNAs
interagiert (s. Kapitel 3.4.5.).
Insgesamt können die erhaltenen Ergebnisse durch ein Modell erklärt werden, in welchem sX13 an
‚G‘-reiche Motive in mRNAs bindet und dadurch die Bindung eines Translations-fördernden Faktors
verhindert (Abb. 5B). Ein solcher Faktor könnte eine sRNA, ein Protein oder das Ribosom selbst sein.
Die Xcv sRNA sX5 ähnelt sX13 und weist zwei in einem einzelnen Loop lokalisierte ‚4C‘-Motive auf
(s. Kapitel 2.1.1.; (188)). Daher sollte untersucht werden, inwiefern sich mögliche Ziel-mRNAs von
sX13 und sX5 überschneiden bzw. ob die Mutagenese oder Überexpression von sX5 die sX13
Aktivität beeinflusst. Alles in allem ist eine Rolle des Ribosoms in der Bindung ‚G‘-reicher mRNA
Motive naheliegend, da 5% aller proteinkodierenden Xcv Gene, einschließlich pilH, ein ‚4G‘- oder
‚5G‘-Motiv an den Positionen 8 bis 15 stromaufwärts des TLS aufweisen (s. Kapitel 2.3.1.; (187)).
Diese Hypothese wird dadurch gestützt, dass die Mutation des ‚5G‘-Motivs zum Verlust der
PilH::GFP Synthese führte (s. Kapitel 2.3.1.; (187)). Wenngleich Xcv mRNAs keine konservierte SD-
Sequenz aufweisen (s. Kapitel 3.1.1.), könnte die Anti-SD Sequenz der 16S rRNA theoretisch durch
‚U-G‘ (‚non-Watson-Crick‘) Basenpaarungen mit ‚4G‘- oder ‚5G‘-mRNA Motiven die
Ribosomenbindung vermitteln.
Insgesamt zeigen die Ergebnisse, dass ‚G‘-reiche mRNA Motive eine sX13-abhängige Expression
vermitteln und abhängig von ihrer Lokalisierung als translationale ‚enhancer‘ wirken können (s.
Kapitel 2.3.1.; (187)). Die Gegenwart eines ‚G‘-reichen Motivs ist offenbar nicht allein
ausschlaggebend für eine sX13-abhängige mRNA Expression, da XCV0612 zwar ähnlich wie pilH ein
‚5G‘-Motiv an der RBS Position trägt, jedoch sX13-unabhängig exprimiert wird (s. Kapitel 2.3.1.;
(187)). Denkbar wäre, dass neben ‚G‘-reichen Motiven weitere regulatorische mRNA Sequenzen für
eine sX13-abhängige Expression erforderlich sind. Ebenso könnten mRNA Sekundärstrukturen zur
Bindung von sX13 beitragen. Beispielsweise bindet RNAIII in S. aureus mittels zwei ‚C‘-reicher
Loops an zwei in Loops lokalisierte ‚G‘-reiche Motive der rot mRNA (15,61). Das für sX13
vorgeschlagene Modell (Abb. 5B) ähnelt der Funktionsweise der Salmonella sRNA GcvB, welche die
Translation von Ziel-mRNAs durch Bindung an ‚CA‘-reiche ‚enhancer‘ Motive hemmt (195,197). In
Salmonella und E. coli fördern ‚CA‘-reiche mRNA Sequenzen die Ribosomenbindung und
Translation, unabhängig von ihrer Lokalisierung stromaufwärts oder stromabwärts des TLS (132,195).
Diskussion 89
Abbildung 5. Mögliche Modelle der sX13-vermittelten Repression der mRNA Expression. (A) Inhibierung der Translationsinitiation. Die Interaktion ‚C‘-reicher sX13 Loops (blau) mit ‚G‘-reichen Motiven in den 5‘-Regionen von mRNAs (rot) hemmt die Bindung des Ribosoms (grau) und die Synthese des Proteins (roter Kreis)(oben). Die translationale Repression wird durch Mutation der sX13 Loops bzw. der ‚G‘-reichen mRNA Motive aufgehoben (linke Seite und Mitte) und durch komplementäre Sequenzaustausche in sX13 und Ziel-mRNAs wiederhergestellt (rechte Seite). (B) sX13 hemmt die Aktivität ‚G‘-reicher ‚enhancer‘ Elemente. Die Interaktion von sX13 Loops mit Ziel-mRNAs hemmt die Bindung eines unbekannten translationsfördernden Faktors (X) an ‚G‘-reiche mRNA Motive (oben). Die Mutation der sX13 Loops führt zum Verlust der sX13-mRNA Interaktion, wodurch die Bindung des unbekannten Faktors ermöglicht und die mRNA Translation gefördert wird (linke Seite). Die Mutation der ‚G‘-reichen Motive beeinträchtigt die Translation der mRNA (Mitte) und kann nicht durch komplementäre Sequenzaustausche in sX13 kompensiert werden (rechte Seite).
3.4.5. Mögliche weiterführende Untersuchungen an sX13
Die Ergebnisse dieser Arbeit werfen die Frage auf, wie die ‚C‘-reichen Loops von sX13, insbesondere
Loop 3, zur beobachteten Virulenzfunktion beitragen (s. Kapitel 2.3.1.; U. Abendroth; (187)).
Diesbezüglich könnte untersucht werden, ob die Mutation der sX13 Loops die hrp-Gen Expression
während der Xcv Infektion der Wirtspflanze beeinflusst. Durch den wechselseitigen Austausch der
sX13 Loop-Sequenzen, Komplementationsanalysen mit einzelnen ‚Stem-Loop‘ Strukturen oder durch
Mutation weiterer Nukleotide der Loops könnte untersucht werden, ob die Funktionalität der sX13
‚Stem-Loops‘ durch ihre Position in der sRNA bzw. durch die Sequenzumgebung der ‚4C‘-Motive
bedingt wird. Zudem könnten ‚pulse expression‘ Analysen mit sX13 und Loopmutanten durchgeführt
werden, um potentiell direkt-gebundene und Loop-spezifische Ziel-mRNAs zu identifizieren (s.
Kapitel 3.3.2.).
Die Kenntniss von direkt gebundenen mRNAs ist essentiell für das Verständnis der Funktionsweise
von sX13. Durch RNase-Schutzexperimente und sogenannte ‚gel-shift‘ bzw. ‚toeprint‘ Analysen
(195,197) könnte untersucht werden, ob sX13 in vitro mit mRNAs interagiert bzw. ob sX13 die
90 Diskussion
Bindung von 30S Ribosomenuntereinheiten an mRNAs beeinflusst. Da acht der potentiellen sX13-Ziel
mRNAs mindestens zwei ‚4G‘-Motive nahe des TLS aufweisen (s. Kapitel 2.3.1.; (187)), könnte
untersucht werden, ob sX13 über mehrere Loops mit multiplen ‚4G‘-Motiven in bestimmten mRNAs
interagiert. Eine solche Funktionsweise wurde für die sRNAs RNAIII in S. aureus und OxyS in E. coli
nachgewiesen und trägt vermutlich zur Spezifität der sRNA-mRNA Interaktion bei (2,15,61). Mittels
einer RNA-Epitop-markierten sRNA könnten potentielle RNA- und Proteininteraktoren von sX13
identifiziert werden (184). Dies ist insbesondere relevant, da sX13 Hfq-unabhängig agiert (s. Kapitel
2.3.1.; Koop. mit J. Brock und U. Abendroth; (187)). Folglich könnten bislang unbekannte RNA-
Bindeproteine Hfq-ähnliche Funktionen in Xcv erfüllen. Ein solcher Fall wurde kürzlich für S. meliloti
beschrieben (157).
Literaturverzeichnis 91
4. Literaturverzeichnis
1. An, S.Q., Febrer, M., McCarthy, Y., Tang, D.J., Clissold, L., Kaithakottil, G., Swarbreck, D., Tang, J.L., Rogers, J., Dow, J.M. and Ryan, R.P. (2013) High-resolution transcriptional analysis of the regulatory influence of cell-to-cell signalling reveals novel genes that contribute to Xanthomonas phytopathogenesis. Mol. Microbiol., 88, 1058-1069.
2. Argaman, L. and Altuvia, S. (2000) fhlA repression by OxyS RNA: kissing complex formation at two sites results in a stable antisense-target RNA complex. J. Mol. Biol., 300, 1101-1112.
3. Babitzke, P. and Romeo, T. (2007) CsrB sRNA family: sequestration of RNA-binding regulatory proteins. Curr. Opin. Microbiol., 10, 156-163.
4. Bardill, J.P., Zhao, X. and Hammer, B.K. (2011) The Vibrio cholerae quorum sensing response is mediated by Hfq-dependent sRNA/mRNA base pairing interactions. Mol. Microbiol., 80, 1381-1394.
5. Barrick, J.E. and Breaker, R.R. (2007) The distributions, mechanisms, and structures of metabolite-binding riboswitches. Genome Biol., 8, R239.
6. Barrick, J.E., Corbino, K.A., Winkler, W.C., Nahvi, A., Mandal, M., Collins, J., Lee, M., Roth, A., Sudarsan, N., Jona, I., Wickiser, J.K. and Breaker, R.R. (2004) New RNA motifs suggest an expanded scope for riboswitches in bacterial genetic control. Proc. Natl. Acad. Sci. U.S.A., 101, 6421-6426.
7. Beaume, M., Hernandez, D., Farinelli, L., Deluen, C., Linder, P., Gaspin, C., Romby, P., Schrenzel, J. and Francois, P. (2010) Cartography of methicillin-resistant S. aureus transcripts: detection, orientation and temporal expression during growth phase and stress conditions. PLoS ONE, 5, e10725.
8. Becker, A. and Vorhölter, F.-J. (2009) Xanthan biosynthesis by Xanthomonas bacteria: an overview of the current biochemical and genomic data. Caister Academic Press, Norfolk, UK.
9. Beisel, C.L. and Storz, G. (2011) The base-pairing RNA Spot 42 participates in a multioutput feedforward loop to help enact catabolite repression in Escherichia coli. Mol. Cell, 41, 286-297.
11. Birch, R.G. (2001) Xanthomonas albilineans and the antipathogenesis approach to disease control. Mol. Plant Pathol., 2, 1-11.
12. Böhme, K., Steinmann, R., Kortmann, J., Seekircher, S., Heroven, A.K., Berger, E., Pisano, F., Thiermann, T., Wolf-Watz, H., Narberhaus, F. and Dersch, P. (2012) Concerted actions of a
92 Literaturverzeichnis
thermo-labile regulator and a unique intergenic RNA thermosensor control Yersinia virulence. PLoS Pathog., 8, e1002518.
13. Bohn, C., Rigoulay, C. and Bouloc, P. (2007) No detectable effect of RNA-binding protein Hfq absence in Staphylococcus aureus. BMC Microbiol., 7, 1-9.
14. Bohn, C., Rigoulay, C., Chabelskaya, S., Sharma, C.M., Marchais, A., Skorski, P., Borezee-Durant, E., Barbet, R., Jacquet, E., Jacq, A., Gautheret, D., Felden, B., Vogel, J. and Bouloc, P. (2010) Experimental discovery of small RNAs in Staphylococcus aureus reveals a riboregulator of central metabolism. Nucleic Acids Res., 38, 6620-6636.
15. Boisset, S., Geissmann, T., Huntzinger, E., Fechter, P., Bendridi, N., Possedko, M., Chevalier, C., Helfer, A.C., Benito, Y., Jacquier, A., Gaspin, C., Vandenesch, F. and Romby, P. (2007) Staphylococcus aureus RNAIII coordinately represses the synthesis of virulence factors and the transcription regulator Rot by an antisense mechanism. Genes Dev., 21, 1353-1366.
16. Bonas, U., Schulte, R., Fenselau, S., Minsavage, G.V., Staskawicz, B.J. and Stall, R.E. (1991) Isolation of a gene-cluster from Xanthomonas campestris pv. vesicatoria that determines pathogenicity and the hypersensitive response on pepper and tomato. Mol. Plant Microbe Interact., 4, 81-88.
17. Boni, I.V., Isaeva, D.M., Musychenko, M.L. and Tzareva, N.V. (1991) Ribosome-messenger recognition: mRNA target sites for ribosomal protein S1. Nucleic Acids Res., 19, 155-162.
18. Bosl, M. and Kersten, H. (1991) A novel RNA product of the tyrT operon of Escherichia coli. Nucleic Acids Res., 19, 5863-5870.
19. Bouvier, M., Sharma, C.M., Mika, F., Nierhaus, K.H. and Vogel, J. (2008) Small RNA binding to 5' mRNA coding region inhibits translational initiation. Mol. Cell, 32, 827-837.
20. Brantl, S. (2007) Regulatory mechanisms employed by cis-encoded antisense RNAs. Curr. Opin. Microbiol., 10, 102-109.
21. Brock, J.E., Pourshahian, S., Giliberti, J., Limbach, P.A. and Janssen, G.R. (2008) Ribosomes bind leaderless mRNA in Escherichia coli through recognition of their 5'-terminal AUG. RNA, 14, 2159-2169.
22. Büttner, D. (2012) Protein export according to schedule: architecture, assembly, and regulation of type III secretion systems from plant- and animal-pathogenic bacteria. Microbiol. Mol. Biol. Rev., 76, 262-310.
23. Büttner, D. and Bonas, U. (2002) Getting across--bacterial type III effector proteins on their way to the plant cell. EMBO J., 21, 5313-5322.
24. Büttner, D. and Bonas, U. (2010) Regulation and secretion of Xanthomonas virulence factors. FEMS Microbiol. Rev., 34, 107-133.
25. Büttner, D. and He, S.Y. (2009) Type III protein secretion in plant pathogenic bacteria. Plant Physiol., 150, 1656-1664.
26. Büttner, D., Nennstiel, D., Klüsener, B. and Bonas, U. (2002) Functional analysis of HrpF, a putative type III translocon protein from Xanthomonas campestris pv. vesicatoria. J. Bacteriol., 184, 2389-2398.
27. Büttner, D., Noël, L., Stuttmann, J. and Bonas, U. (2007) Characterization of the nonconserved hpaB-hrpF region in the hrp pathogenicity island from Xanthomonas campestris pv. vesicatoria. Mol. Plant Microbe Interact., 20, 1063-1074.
28. Camacho, A.G., Misselwitz, R., Behlke, J., Ayora, S., Welfle, K., Meinhart, A., Lara, B., Saenger, W., Welfle, H. and Alonso, J.C. (2002) In vitro and in vivo stability of the ε2ζ2 protein complex of the broad host-range Streptococcus pyogenes pSM19035 addiction system. Biol. Chem., 383, 1701-1713.
29. Canonne, J., Marino, D., Jauneau, A., Pouzet, C., Briere, C., Roby, D. and Rivas, S. (2011) The Xanthomonas type III effector XopD targets the Arabidopsis transcription factor MYB30 to suppress plant defense. Plant Cell, 23, 3498-3511.
30. Canonne, J., Marino, D., Noël, L.D., Arechaga, I., Pichereaux, C., Rossignol, M., Roby, D. and Rivas, S. (2010) Detection and functional characterization of a 215 amino acid N-terminal extension in the xanthomonas type III effector XopD. PLoS ONE, 5, e15773.
31. Caron, M.P., Lafontaine, D.A. and Massé, E. (2010) Small RNA-mediated regulation at the level of transcript stability. RNA Biol, 7, 140-144.
32. Carpousis, A.J., Luisi, B.F. and McDowall, K.J. (2009) Endonucleolytic initiation of mRNA decay in Escherichia coli. Prog Mol Biol Transl Sci, 85, 91-135.
33. Chai, Y. and Winans, S.C. (2005) A small antisense RNA downregulates expression of an essential replicase protein of an Agrobacterium tumefaciens Ti plasmid. Mol. Microbiol., 56, 1574-1585.
34. Chao, N.X., Wei, K., Chen, Q., Meng, Q.L., Tang, D.J., He, Y.Q., Lu, G.T., Jiang, B.L., Liang, X.X., Feng, J.X., Chen, B. and Tang, J.L. (2008) The rsmA-like gene rsmAXcc of Xanthomonas campestris pv. campestris is involved in the control of various cellular processes, including pathogenesis. Mol. Plant Microbe Interact., 21, 411-423.
35. Chao, Y. and Vogel, J. (2010) The role of Hfq in bacterial pathogens. Curr. Opin. Microbiol., 13, 24-33.
Literaturverzeichnis 93
36. Chen, X.L., Tang, D.J., Jiang, R.P., He, Y.Q., Jiang, B.L., Lu, G.T. and Tang, J.L. (2011) sRNA-Xcc1, an integron-encoded transposon- and plasmid-transferred trans-acting sRNA, is under the positive control of the key virulence regulators HrpG and HrpX of Xanthomonas campestris pathovar campestris. RNA Biol, 8, 947-953.
37. Crossman, L.C., Gould, V.C., Dow, J.M., Vernikos, G.S., Okazaki, A., Sebaihia, M., Saunders, D., Arrowsmith, C., Carver, T., Peters, N., Adlem, E., Kerhornou, A., Lord, A., Murphy, L., Seeger, K., Squares, R., Rutter, S., Quail, M.A., Rajandream, M.A., Harris, D., Churcher, C., Bentley, S.D., Parkhill, J., Thomson, N.R. and Avison, M.B. (2008) The complete genome, comparative and functional analysis of Stenotrophomonas maltophilia reveals an organism heavily shielded by drug resistance determinants. Genome Biol., 9, 1-13.
38. Cui, Y., Chatterjee, A., Liu, Y., Dumenyo, C.K. and Chatterjee, A.K. (1995) Identification of a global repressor gene, rsmA, of Erwinia carotovora subsp. carotovora that controls extracellular enzymes, N-(3-oxohexanoyl)-L-homoserine lactone, and pathogenicity in soft-rotting Erwinia spp. J. Bacteriol., 177, 5108-5115.
39. Cui, Y., Chatterjee, A., Yang, H. and Chatterjee, A.K. (2008) Regulatory network controlling extracellular proteins in Erwinia carotovora subsp. carotovora: FlhDC, the master regulator of flagellar genes, activates rsmB regulatory RNA production by affecting gacA and hexA (lrhA) expression. J. Bacteriol., 190, 4610-4623.
40. da Silva, A.C., Ferro, J.A., Reinach, F.C., Farah, C.S., Furlan, L.R., Quaggio, R.B., Monteiro-Vitorello, C.B., Van Sluys, M.A., Almeida, N.F., Alves, L.M., do Amaral, A.M., Bertolini, M.C., Camargo, L.E., Camarotte, G., Cannavan, F., Cardozo, J., Chambergo, F., Ciapina, L.P., Cicarelli, R.M., Coutinho, L.L., Cursino-Santos, J.R., El-Dorry, H., Faria, J.B., Ferreira, A.J., Ferreira, R.C., Ferro, M.I., Formighieri, E.F., Franco, M.C., Greggio, C.C., Gruber, A., Katsuyama, A.M., Kishi, L.T., Leite, R.P., Lemos, E.G., Lemos, M.V., Locali, E.C., Machado, M.A., Madeira, A.M., Martinez-Rossi, N.M., Martins, E.C., Meidanis, J., Menck, C.F., Miyaki, C.Y., Moon, D.H., Moreira, L.M., Novo, M.T., Okura, V.K., Oliveira, M.C., Oliveira, V.R., Pereira, H.A., Rossi, A., Sena, J.A., Silva, C., de Souza, R.F., Spinola, L.A., Takita, M.A., Tamura, R.E., Teixeira, E.C., Tezza, R.I., Trindade dos Santos, M., Truffi, D., Tsai, S.M., White, F.F., Setubal, J.C. and Kitajima, J.P. (2002) Comparison of the genomes of two Xanthomonas pathogens with differing host specificities. Nature, 417, 459-463.
41. Darfeuille, F., Unoson, C., Vogel, J. and Wagner, E.G. (2007) An antisense RNA inhibits translation by competing with standby ribosomes. Mol. Cell, 26, 381-392.
42. Das, A., Rangaraj, N. and Sonti, R.V. (2009) Multiple adhesin-like functions of Xanthomonas oryzae pv. oryzae are involved in promoting leaf attachment, entry, and virulence on rice. Mol. Plant Microbe Interact., 22, 73-85.
43. Davis, B.M. and Waldor, M.K. (2007) RNase E-dependent processing stabilizes MicX, a Vibrio cholerae sRNA. Mol. Microbiol., 65, 373-385.
44. De Lay, N., Schu, D.J. and Gottesman, S. (2013) Bacterial small RNA-based negative regulation: Hfq and its accomplices. J. Biol. Chem., 288, 7996-8003.
45. del Val, C., Romero-Zaliz, R., Torres-Quesada, O., Peregrina, A., Toro, N. and Jimenez-Zurdo, J.I. (2011) A survey of sRNA families in a-proteobacteria. RNA Biol, 9, 119-129.
46. Doidge, E.M. (1921) A tomato canker. Ann. Appl. Biol., 7, 407-430. 47. Dow, J.M., Crossman, L., Findlay, K., He, Y.Q., Feng, J.X. and Tang, J.L. (2003) Biofilm dispersal
in Xanthomonas campestris is controlled by cell-cell signaling and is required for full virulence to plants. Proc. Natl. Acad. Sci. U.S.A., 100, 10995-11000.
48. Dow, J.M., Fouhy, Y., Lucey, J.F. and Ryan, R.P. (2006) The HD-GYP domain, cyclic di-GMP signaling, and bacterial virulence to plants. Mol. Plant Microbe Interact., 19, 1378-1384.
49. Ellis, J.C. and Brown, J.W. (2009) The RNase P family. RNA Biol, 6, 362-369. 50. Epshtein, V., Mironov, A.S. and Nudler, E. (2003) The riboswitch-mediated control of sulfur
metabolism in bacteria. Proc. Natl. Acad. Sci. U.S.A., 100, 5052-5056. 51. Fijalkowska, I.J., Schaaper, R.M. and Jonczyk, P. (2012) DNA replication fidelity in Escherichia
P., Wang, W., Schroth, G.P., Luo, S., Khrebtukova, I., Yang, Y., Thannhauser, T., Butcher, B.G., Cartinhour, S. and Schneider, D.J. (2010) Transcriptome analysis of Pseudomonas syringae identifies new genes, noncoding RNAs, and antisense activity. J. Bacteriol., 192, 2359-2372.
53. Filiatrault, M.J., Stodghill, P.V., Myers, C.R., Bronstein, P.A., Butcher, B.G., Lam, H., Grills, G., Schweitzer, P., Wang, W., Schneider, D.J. and Cartinhour, S.W. (2011) Genome-wide identification of transcriptional start sites in the plant pathogen Pseudomonas syringae pv. tomato str. DC3000. PLoS ONE, 6, e29335.
94 Literaturverzeichnis
54. Findeiß, S., Schmidtke, C., Stadler, P.F. and Bonas, U. (2010) A novel family of plasmid-transferred anti-sense ncRNAs. RNA Biol, 7, 120-124.
55. Fozo, E.M., Hemm, M.R. and Storz, G. (2008) Small toxic proteins and the antisense RNAs that repress them. Microbiol. Mol. Biol. Rev., 72, 579-589.
56. Fozo, E.M., Kawano, M., Fontaine, F., Kaya, Y., Mendieta, K.S., Jones, K.L., Ocampo, A., Rudd, K.E. and Storz, G. (2008) Repression of small toxic protein synthesis by the Sib and OhsC small RNAs. Mol. Microbiol., 70, 1076-1093.
57. Fozo, E.M., Makarova, K.S., Shabalina, S.A., Yutin, N., Koonin, E.V. and Storz, G. (2010) Abundance of type I toxin-antitoxin systems in bacteria: searches for new candidates and discovery of novel families. Nucleic Acids Res., 38, 3743-3759.
58. Fransson, A., Ruusala, A. and Aspenstrom, P. (2003) Atypical Rho GTPases have roles in mitochondrial homeostasis and apoptosis. J. Biol. Chem., 278, 6495-6502.
59. Franze de Fernandez, M.T., Eoyang, L. and August, J.T. (1968) Factor fraction required for the synthesis of bacteriophage Qbeta-RNA. Nature, 219, 588-590.
60. Fröhlich, K.S. and Vogel, J. (2009) Activation of gene expression by small RNA. Curr. Opin. Microbiol., 12, 674-682.
61. Geisinger, E., Adhikari, R.P., Jin, R., Ross, H.F. and Novick, R.P. (2006) Inhibition of rot translation by RNAIII, a key feature of agr function. Mol. Microbiol., 61, 1038-1048.
62. Geissmann, T., Chevalier, C., Cros, M.J., Boisset, S., Fechter, P., Noirot, C., Schrenzel, J., Francois, P., Vandenesch, F., Gaspin, C. and Romby, P. (2009) A search for small noncoding RNAs in Staphylococcus aureus reveals a conserved sequence motif for regulation. Nucleic Acids Res., 37, 7239-7257.
63. Genin, S. (2010) Molecular traits controlling host range and adaptation to plants in Ralstonia solanacearum. New Phytol., 187, 920-928.
64. Georg, J. and Hess, W.R. (2011) cis-antisense RNA, another level of gene regulation in bacteria. Microbiol. Mol. Biol. Rev., 75, 286-300.
65. Gerdes, K., Bech, F.W., Jorgensen, S.T., Lobner-Olesen, A., Rasmussen, P.B., Atlung, T., Boe, L., Karlstrom, O., Molin, S. and von Meyenburg, K. (1986) Mechanism of postsegregational killing by the hok gene product of the parB system of plasmid R1 and its homology with the relF gene product of the E. coli relB operon. EMBO J., 5, 2023-2029.
66. Gerdes, K. and Maisonneuve, E. (2012) Bacterial persistence and toxin-antitoxin loci. Annu. Rev. Microbiol., 66, 103-123.
67. Gottesman, S. and Storz, G. (2011) Bacterial small RNA regulators: versatile roles and rapidly evolving variations. Cold Spring Harb Perspect Biol, 3, doi: 10.1101/cshperspect.a003798.
68. Greenberg, J.T. and Yao, N. (2004) The role and regulation of programmed cell death in plant-pathogen interactions. Cell. Microbiol., 6, 201-211.
69. Grundy, F.J., Moir, T.R., Haldeman, M.T. and Henkin, T.M. (2002) Sequence requirements for terminators and antiterminators in the T box transcription antitermination system: disparity between conservation and functional requirements. Nucleic Acids Res., 30, 1646-1655.
70. Gualerzi, C.O., Brandi, L., Caserta, E., Garofalo, C., Lammi, M., La Teana, A., Petrelli, D., Spurio, R., Tomsic, J. and Pon, C.L. (2001) Initiation factors in the early events of mRNA translation in bacteria. Cold Spring Harb. Symp. Quant. Biol., 66, 363-376.
71. Güell, M., van Noort, V., Yus, E., Chen, W.H., Leigh-Bell, J., Michalodimitrakis, K., Yamada, T., Arumugam, M., Doerks, T., Kuhner, S., Rode, M., Suyama, M., Schmidt, S., Gavin, A.C., Bork, P. and Serrano, L. (2009) Transcriptome complexity in a genome-reduced bacterium. Science, 326, 1268-1271.
72. Guerrier-Takada, C., Gardiner, K., Marsh, T., Pace, N. and Altman, S. (1983) The RNA moiety of ribonuclease P is the catalytic subunit of the enzyme. Cell, 35, 849-857.
73. Guo, Y., Figueiredo, F., Jones, J. and Wang, N. (2011) HrpG and HrpX play global roles in coordinating different virulence traits of Xanthomonas axonopodis pv. citri. Mol. Plant Microbe Interact., 24, 649-661.
74. Hajnsdorf, E. and Boni, I.V. (2012) Multiple activities of RNA-binding proteins S1 and Hfq. Biochimie, 94, 1544-1553.
75. He, S.Y., Nomura, K. and Whittam, T.S. (2004) Type III protein secretion mechanism in mammalian and plant pathogens. Biochim. Biophys. Acta, 1694, 181-206.
76. He, Y.W., Ng, A.Y., Xu, M., Lin, K., Wang, L.H., Dong, Y.H. and Zhang, L.H. (2007) Xanthomonas campestris cell-cell communication involves a putative nucleotide receptor protein Clp and a hierarchical signalling network. Mol. Microbiol., 64, 281-292.
77. He, Y.W., Xu, M., Lin, K., Ng, Y.J., Wen, C.M., Wang, L.H., Liu, Z.D., Zhang, H.B., Dong, Y.H., Dow, J.M. and Zhang, L.H. (2006) Genome scale analysis of diffusible signal factor regulon in Xanthomonas campestris pv. campestris: identification of novel cell-cell communication-dependent genes and functions. Mol. Microbiol., 59, 610-622.
Literaturverzeichnis 95
78. Hengge, R. (2009) Principles of c-di-GMP signalling in bacteria. Nat. Rev. Microbiol., 7, 263-273. 79. Henkin, T.M. (2008) Riboswitch RNAs: using RNA to sense cellular metabolism. Genes Dev., 22,
3383-3390. 80. Herrick, J. and Sclavi, B. (2007) Ribonucleotide reductase and the regulation of DNA replication: an
old story and an ancient heritage. Mol. Microbiol., 63, 22-34. 81. Herskovits, A.A., Bochkareva, E.S. and Bibi, E. (2000) New prospects in studying the bacterial
signal recognition particle pathway. Mol. Microbiol., 38, 927-939. 82. Herzfeld, E.-M. (2013), Halle (Saale), Universitäts-und Landesbibliothek Sachsen-Anhalt, Diss., 2013. 83. Higgins, B.B. (1922) The bacterial spot of pepper. Phytopathology, 12, 501-517. 84. Holmqvist, E., Reimegard, J., Sterk, M., Grantcharova, N., Römling, U. and Wagner, E.G. (2010)
Two antisense RNAs target the transcriptional regulator CsgD to inhibit curli synthesis. EMBO J., 29, 1840-1850.
85. Hotson, A., Chosed, R., Shu, H., Orth, K. and Mudgett, M.B. (2003) Xanthomonas type III effector XopD targets SUMO-conjugated proteins in planta. Mol. Microbiol., 50, 377-389.
86. Hui, A. and de Boer, H.A. (1987) Specialized ribosome system: preferential translation of a single mRNA species by a subpopulation of mutated ribosomes in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A., 84, 4762-4766.
87. Huntzinger, E., Boisset, S., Saveanu, C., Benito, Y., Geissmann, T., Namane, A., Lina, G., Etienne, J., Ehresmann, B., Ehresmann, C., Jacquier, A., Vandenesch, F. and Romby, P. (2005) Staphylococcus aureus RNAIII and the endoribonuclease III coordinately regulate spa gene expression. EMBO J., 24, 824-835.
88. Ikeda, Y., Yagi, M., Morita, T. and Aiba, H. (2011) Hfq binding at RhlB-recognition region of RNase E is crucial for the rapid degradation of target mRNAs mediated by sRNAs in Escherichia coli. Mol. Microbiol., 79, 419-432.
89. Jacob, F. and Monod, J. (1961) Genetic regulatory mechanisms in the synthesis of proteins. J. Mol. Biol., 3, 318-356.
90. Jacob, W.F., Santer, M. and Dahlberg, A.E. (1987) A single base change in the Shine-Dalgarno region of 16S rRNA of Escherichia coli affects translation of many proteins. Proc. Natl. Acad. Sci. U.S.A., 84, 4757-4761.
91. Jarrell, K.F. and McBride, M.J. (2008) The surprisingly diverse ways that prokaryotes move. Nat. Rev. Microbiol., 6, 466-476.
92. Jiang, R.P., Tang, D.J., Chen, X.L., He, Y.Q., Feng, J.X., Jiang, B.L., Lu, G.T., Lin, M. and Tang, J.L. (2010) Identification of four novel small non-coding RNAs from Xanthomonas campestris pathovar campestris. BMC Genomics, 11, 1-9.
93. Johansson, J., Mandin, P., Renzoni, A., Chiaruttini, C., Springer, M. and Cossart, P. (2002) An RNA thermosensor controls expression of virulence genes in Listeria monocytogenes. Cell, 110, 551-561.
94. Jones, J.B., Lacy, G.H., Bouzar, H., Stall, R.E. and Schaad, N.W. (2004) Reclassification of the xanthomonads associated with bacterial spot disease of tomato and pepper. Syst. Appl. Microbiol., 27, 755-762.
95. Jones, J.B., Stall, R.E. and Bouzar, H. (1998) Diversity among xanthomonads pathogenic on pepper and tomato. Annu. Rev. Phytopathol., 36, 41-58.
96. Jones, J.D. and Dangl, J.L. (2006) The plant immune system. Nature, 444, 323-329. 97. Joyce, C.M. and Grindley, N.D. (1982) Identification of two genes immediately downstream from the
polA gene of Escherichia coli. J. Bacteriol., 152, 1211-1219. 98. Kalamorz, F., Reichenbach, B., Marz, W., Rak, B. and Görke, B. (2007) Feedback control of
glucosamine-6-phosphate synthase GlmS expression depends on the small RNA GlmZ and involves the novel protein YhbJ in Escherichia coli. Mol. Microbiol., 65, 1518-1533.
99. Kawano, M., Aravind, L. and Storz, G. (2007) An antisense RNA controls synthesis of an SOS-induced toxin evolved from an antitoxin. Mol. Microbiol., 64, 738-754.
100. Kawano, M., Reynolds, A.A., Miranda-Rios, J. and Storz, G. (2005) Detection of 5'- and 3'-UTR-derived small RNAs and cis-encoded antisense RNAs in Escherichia coli. Nucleic Acids Res., 33, 1040-1050.
101. Kim, J., Lee, S., Shin, H., Kim, S.C. and Cho, B.-K. (2012) Elucidation of bacterial genome complexity using next-generation sequencing. Biotechnol. Bioprocess Eng., 17, 887-899.
102. Kim, J.G., Stork, W. and Mudgett, M.B. (2013) Xanthomonas type III effector XopD desumoylates tomato transcription factor SlERF4 to suppress ethylene responses and promote pathogen growth. Cell Host Microbe, 13, 143-154.
103. Kim, J.G., Taylor, K.W., Hotson, A., Keegan, M., Schmelz, E.A. and Mudgett, M.B. (2008) XopD SUMO protease affects host transcription, promotes pathogen growth, and delays symptom development in Xanthomonas-infected tomato leaves. Plant Cell, 20, 1915-1929.
96 Literaturverzeichnis
104. Kirchberg, J., Büttner, D., Thiemer, B. and Sawers, R.G. (2012) Aconitase B is required for optimal growth of Xanthomonas campestris pv. vesicatoria in pepper plants. PLoS ONE, 7, e34941.
105. Koebnik, R., Krüger, A., Thieme, F., Urban, A. and Bonas, U. (2006) Specific binding of the Xanthomonas campestris pv. vesicatoria AraC-type transcriptional activator HrpX to plant-inducible promoter boxes. J. Bacteriol., 188, 7652-7660.
106. Komarova, A.V., Tchufistova, L.S., Dreyfus, M. and Boni, I.V. (2005) AU-rich sequences within 5' untranslated leaders enhance translation and stabilize mRNA in Escherichia coli. J. Bacteriol., 187, 1344-1349.
107. Kortmann, J. and Narberhaus, F. (2012) Bacterial RNA thermometers: molecular zippers and switches. Nat. Rev. Microbiol., 10, 255-265.
108. Kröger, C., Dillon, S.C., Cameron, A.D., Papenfort, K., Sivasankaran, S.K., Hokamp, K., Chao, Y., Sittka, A., Hebrard, M., Handler, K., Colgan, A., Leekitcharoenphon, P., Langridge, G.C., Lohan, A.J., Loftus, B., Lucchini, S., Ussery, D.W., Dorman, C.J., Thomson, N.R., Vogel, J. and Hinton, J.C. (2012) The transcriptional landscape and small RNAs of Salmonella enterica serovar Typhimurium. Proc. Natl. Acad. Sci. U.S.A., 109, E1277-1286.
109. Kunze, G., Zipfel, C., Robatzek, S., Niehaus, K., Boller, T. and Felix, G. (2004) The N terminus of bacterial elongation factor Tu elicits innate immunity in Arabidopsis plants. Plant Cell, 16, 3496-3507.
110. Lapouge, K., Schubert, M., Allain, F.H. and Haas, D. (2008) Gac/Rsm signal transduction pathway of gamma-proteobacteria: from RNA recognition to regulation of social behaviour. Mol. Microbiol., 67, 241-253.
111. Laursen, B.S., Sørensen, H.P., Mortensen, K.K. and Sperling-Petersen, H.U. (2005) Initiation of protein synthesis in bacteria. Microbiol. Mol. Biol. Rev., 69, 101-123.
112. Lee, B.M., Park, Y.J., Park, D.S., Kang, H.W., Kim, J.G., Song, E.S., Park, I.C., Yoon, U.H., Hahn, J.H., Koo, B.S., Lee, G.B., Kim, H., Park, H.S., Yoon, K.O., Kim, J.H., Jung, C.H., Koh, N.H., Seo, J.S. and Go, S.J. (2005) The genome sequence of Xanthomonas oryzae pathovar oryzae KACC10331, the bacterial blight pathogen of rice. Nucleic Acids Res., 33, 577-586.
113. Lee, K., Huang, X., Yang, C., Lee, D., Ho, V., Nobuta, K., Fan, J.B. and Wang, K. (2013) A genome-wide survey of highly expressed non-coding RNAs and biological validation of selected candidates in Agrobacterium tumefaciens. PLoS ONE, 8, e70720.
114. Lenz, D.H., Mok, K.C., Lilley, B.N., Kulkarni, R.V., Wingreen, N.S. and Bassler, B.L. (2004) The small RNA chaperone Hfq and multiple small RNAs control quorum sensing in Vibrio harveyi and Vibrio cholerae. Cell, 118, 69-82.
115. Leyns, F., De Cleene, M., Swings, J.G. and De Ley, J. (1984) The host range of the genus Xanthomonas. The Botanical Review, 50, 308-356.
116. Li, R.F., Lu, G.T., Li, L., Su, H.Z., Feng, G.F., Chen, Y., He, Y.Q., Jiang, B.L., Tang, D.J. and Tang, J.L. (2013) Identification of a putative cognate sensor kinase for the two-component response regulator HrpG, a key regulator controlling the expression of the hrp genes in Xanthomonas campestris pv. campestris. Environ. Microbiol., doi: 10.1111/1462-2920.12207.
117. Li, W., Ying, X., Lu, Q. and Chen, L. (2012) Predicting sRNAs and their targets in bacteria. Genomics Proteomics Bioinformatics, 10, 276-284.
118. Liang, H., Zhao, Y.T., Zhang, J.Q., Wang, X.J., Fang, R.X. and Jia, Y.T. (2011) Identification and functional characterization of small non-coding RNAs in Xanthomonas oryzae pathovar oryzae. BMC Genomics, 12, 1-14.
119. Lioy, V.S., Martin, M.T., Camacho, A.G., Lurz, R., Antelmann, H., Hecker, M., Hitchin, E., Ridge, Y., Wells, J.M. and Alonso, J.C. (2006) pSM19035-encoded zeta toxin induces stasis followed by death in a subpopulation of cells. Microbiology, 152, 2365-2379.
120. Liu, M.Y., Gui, G., Wei, B., Preston, J.F., 3rd, Oakford, L., Yuksel, U., Giedroc, D.P. and Romeo, T. (1997) The RNA molecule CsrB binds to the global regulatory protein CsrA and antagonizes its activity in Escherichia coli. J. Biol. Chem., 272, 17502-17510.
121. Liu, Y., Cui, Y., Mukherjee, A. and Chatterjee, A.K. (1998) Characterization of a novel RNA regulator of Erwinia carotovora ssp. carotovora that controls production of extracellular enzymes and secondary metabolites. Mol. Microbiol., 29, 219-234.
122. Loh, E., Dussurget, O., Gripenland, J., Vaitkevicius, K., Tiensuu, T., Mandin, P., Repoila, F., Buchrieser, C., Cossart, P. and Johansson, J.r. (2009) A trans-acting riboswitch controls expression of the virulence regulator PrfA in Listeria monocytogenes. Cell, 139, 770-779.
123. Lu, X.H., An, S.Q., Tang, D.J., McCarthy, Y., Tang, J.L., Dow, J.M. and Ryan, R.P. (2012) RsmA regulates biofilm formation in Xanthomonas campestris through a regulatory network involving cyclic di-GMP and the Clp transcription factor. PLoS ONE, 7, e52646.
124. Ma, C. and Simons, R.W. (1990) The IS10 antisense RNA blocks ribosome binding at the transposase translation initiation site. EMBO J., 9, 1267-1274.
Literaturverzeichnis 97
125. Majdalani, N., Cunning, C., Sledjeski, D., Elliott, T. and Gottesman, S. (1998) DsrA RNA regulates translation of RpoS message by an anti-antisense mechanism, independent of its action as an antisilencer of transcription. Proc. Natl. Acad. Sci. U.S.A., 95, 12462-12467.
126. Majdalani, N., Hernandez, D. and Gottesman, S. (2002) Regulation and mode of action of the second small RNA activator of RpoS translation, RprA. Mol. Microbiol., 46, 813-826.
127. Makarova, K.S., Wolf, Y.I. and Koonin, E.V. (2009) Comprehensive comparative-genomic analysis of type 2 toxin-antitoxin systems and related mobile stress response systems in prokaryotes. Biol. Direct, 4, 1-38.
128. Malamud, F., Torres, P.S., Roeschlin, R., Rigano, L.A., Enrique, R., Bonomi, H.R., Castagnaro, A.P., Marano, M.R. and Vojnov, A.A. (2011) The Xanthomonas axonopodis pv. citri flagellum is required for mature biofilm and canker development. Microbiology, 157, 819-829.
129. Mandal, M., Lee, M., Barrick, J.E., Weinberg, Z., Emilsson, G.M., Ruzzo, W.L. and Breaker, R.R. (2004) A glycine-dependent riboswitch that uses cooperative binding to control gene expression. Science, 306, 275-279.
130. Mansfield, J., Genin, S., Magori, S., Citovsky, V., Sriariyanum, M., Ronald, P., Dow, M., Verdier, V., Beer, S.V., Machado, M.A., Toth, I., Salmond, G. and Foster, G.D. (2012) Top 10 plant pathogenic bacteria in molecular plant pathology. Mol. Plant Pathol., 13, 614-629.
132. Martin-Farmer, J. and Janssen, G.R. (1999) A downstream CA repeat sequence increases translation from leadered and unleadered mRNA in Escherichia coli. Mol. Microbiol., 31, 1025-1038.
133. McNealy, T.L., Forsbach-Birk, V., Shi, C. and Marre, R. (2005) The Hfq homolog in Legionella pneumophila demonstrates regulation by LetA and RpoS and interacts with the global regulator CsrA. J. Bacteriol., 187, 1527-1532.
134. Meyer, M.M., Hammond, M.C., Salinas, Y., Roth, A., Sudarsan, N. and Breaker, R.R. (2011) Challenges of ligand identification for riboswitch candidates. RNA Biol, 8, 5-10.
136. Miranda-Rios, J., Navarro, M. and Soberon, M. (2001) A conserved RNA structure (thi box) is involved in regulation of thiamin biosynthetic gene expression in bacteria. Proc. Natl. Acad. Sci. U.S.A., 98, 9736-9741.
137. Mironov, A.S., Gusarov, I., Rafikov, R., Lopez, L.E., Shatalin, K., Kreneva, R.A., Perumov, D.A. and Nudler, E. (2002) Sensing small molecules by nascent RNA: a mechanism to control transcription in bacteria. Cell, 111, 747-756.
138. Mitschke, J., Georg, J., Scholz, I., Sharma, C.M., Dienst, D., Bantscheff, J., Voss, B., Steglich, C., Wilde, A., Vogel, J. and Hess, W.R. (2011) An experimentally anchored map of transcriptional start sites in the model cyanobacterium Synechocystis sp. PCC6803. Proc. Natl. Acad. Sci. U.S.A., 108, 2124-2129.
139. Mizuno, T., Chou, M.Y. and Inouye, M. (1984) A unique mechanism regulating gene expression: translational inhibition by a complementary RNA transcript (micRNA). Proc. Natl. Acad. Sci. U.S.A., 81, 1966-1970.
140. Moll, I., Grill, S., Gualerzi, C.O. and Bläsi, U. (2002) Leaderless mRNAs in bacteria: surprises in ribosomal recruitment and translational control. Mol. Microbiol., 43, 239-246.
141. Møller, T., Franch, T., Udesen, C., Gerdes, K. and Valentin-Hansen, P. (2002) Spot 42 RNA mediates discoordinate expression of the E. coli galactose operon. Genes Dev., 16, 1696-1706.
142. Moore, S.D. and Sauer, R.T. (2007) The tmRNA system for translational surveillance and ribosome rescue. Annu. Rev. Biochem., 76, 101-124.
143. Morales, C.Q., Posada, J., Macneale, E., Franklin, D., Rivas, I., Bravo, M., Minsavage, J., Stall, R.E. and Whalen, M.C. (2005) Functional analysis of the early chlorosis factor gene. Mol. Plant Microbe Interact., 18, 477-486.
144. Morita, T., Maki, K. and Aiba, H. (2005) RNase E-based ribonucleoprotein complexes: mechanical basis of mRNA destabilization mediated by bacterial noncoding RNAs. Genes Dev., 19, 2176-2186.
98 Literaturverzeichnis
145. Morita, T., Mochizuki, Y. and Aiba, H. (2006) Translational repression is sufficient for gene silencing by bacterial small noncoding RNAs in the absence of mRNA destruction. Proc. Natl. Acad. Sci. U.S.A., 103, 4858-4863.
146. Mraheil, M.A., Billion, A., Mohamed, W., Mukherjee, K., Kuenne, C., Pischimarov, J., Krawitz, C., Retey, J., Hartsch, T., Chakraborty, T. and Hain, T. (2011) The intracellular sRNA transcriptome of Listeria monocytogenes during growth in macrophages. Nucleic Acids Res., 39, 4235-4248.
147. Nahvi, A., Sudarsan, N., Ebert, M.S., Zou, X., Brown, K.L. and Breaker, R.R. (2002) Genetic control by a metabolite binding mRNA. Chem. Biol., 9, 1043-1049.
148. Nakagawa, S., Niimura, Y., Miura, K. and Gojobori, T. (2010) Dynamic evolution of translation initiation mechanisms in prokaryotes. Proc. Natl. Acad. Sci. U.S.A., 107, 6382-6387.
149. Nocker, A., Hausherr, T., Balsiger, S., Krstulovic, N.P., Hennecke, H. and Narberhaus, F. (2001) A mRNA-based thermosensor controls expression of rhizobial heat shock genes. Nucleic Acids Res., 29, 4800-4807.
150. Noël, L., Thieme, F., Nennstiel, D. and Bonas, U. (2001) cDNA-AFLP analysis unravels a genome-wide hrpG-regulon in the plant pathogen Xanthomonas campestris pv. vesicatoria. Mol. Microbiol., 41, 1271-1281.
151. Novick, R.P., Ross, H.F., Projan, S.J., Kornblum, J., Kreiswirth, B. and Moghazeh, S. (1993) Synthesis of staphylococcal virulence factors is controlled by a regulatory RNA molecule. EMBO J., 12, 3967-3975.
152. Nürnberger, T., Brunner, F., Kemmerling, B. and Piater, L. (2004) Innate immunity in plants and animals: striking similarities and obvious differences. Immunol. Rev., 198, 249-266.
153. O'Donnell, S.M. and Janssen, G.R. (2002) Leaderless mRNAs bind 70S ribosomes more strongly than 30S ribosomal subunits in Escherichia coli. J. Bacteriol., 184, 6730-6733.
154. Opdyke, J.A., Kang, J.G. and Storz, G. (2004) GadY, a small-RNA regulator of acid response genes in Escherichia coli. J. Bacteriol., 186, 6698-6705.
155. Padalon-Brauch, G., Hershberg, R., Elgrably-Weiss, M., Baruch, K., Rosenshine, I., Margalit, H. and Altuvia, S. (2008) Small RNAs encoded within genetic islands of Salmonella typhimurium show host-induced expression and role in virulence. Nucleic Acids Res., 36, 1913-1927.
156. Palmer, A.C., Ahlgren-Berg, A., Egan, J.B., Dodd, I.B. and Shearwin, K.E. (2009) Potent transcriptional interference by pausing of RNA polymerases over a downstream promoter. Mol. Cell, 34, 545-555.
157. Pandey, S.P., Minesinger, B.K., Kumar, J. and Walker, G.C. (2011) A highly conserved protein of unknown function in Sinorhizobium meliloti affects sRNA regulation similar to Hfq. Nucleic Acids Res., 39, 4691-4708.
158. Papenfort, K., Pfeiffer, V., Lucchini, S., Sonawane, A., Hinton, J.C. and Vogel, J. (2008) Systematic deletion of Salmonella small RNA genes identifies CyaR, a conserved CRP-dependent riboregulator of OmpX synthesis. Mol. Microbiol., 68, 890-906.
159. Papenfort, K., Pfeiffer, V., Mika, F., Lucchini, S., Hinton, J.C. and Vogel, J. (2006) SigmaE-dependent small RNAs of Salmonella respond to membrane stress by accelerating global omp mRNA decay. Mol. Microbiol., 62, 1674-1688.
160. Papenfort, K. and Vogel, J. (2010) Regulatory RNA in bacterial pathogens. Cell Host Microbe, 8, 116-127.
161. Park, S.H., Butcher, B.G., Anderson, Z., Pellegrini, N., Bao, Z., D'Amico, K. and Filiatrault, M.J. (2013) Analysis of the small RNA P16/RgsA in the plant pathogen Pseudomonas syringae pv. tomato strain DC3000. Microbiology, 159, 296-306.
162. Perkins, T.T., Kingsley, R.A., Fookes, M.C., Gardner, P.P., James, K.D., Yu, L., Assefa, S.A., He, M., Croucher, N.J., Pickard, D.J., Maskell, D.J., Parkhill, J., Choudhary, J., Thomson, N.R. and Dougan, G. (2009) A strand-specific RNA-Seq analysis of the transcriptome of the typhoid bacillus Salmonella Typhi. PLoS Genet., 5, e1000569.
163. Pfeiffer, V., Papenfort, K., Lucchini, S., Hinton, J.C. and Vogel, J. (2009) Coding sequence targeting by MicC RNA reveals bacterial mRNA silencing downstream of translational initiation. Nat. Struct. Mol. Biol., 16, 840-846.
164. Pichon, C. and Felden, B. (2008) Small RNA gene identification and mRNA target predictions in bacteria. Bioinformatics, 24, 2807-2813.
165. Pieretti, I., Royer, M., Barbe, V., Carrere, S., Koebnik, R., Cociancich, S., Couloux, A., Darrasse, A., Gouzy, J., Jacques, M.A., Lauber, E., Manceau, C., Mangenot, S., Poussier, S., Segurens, B., Szurek, B., Verdier, V., Arlat, M. and Rott, P. (2009) The complete genome sequence of Xanthomonas albilineans provides new insights into the reductive genome evolution of the xylem-limited Xanthomonadaceae. BMC Genomics, 10, 1-15.
166. Pinto, A.C., Melo-Barbosa, H.P., Miyoshi, A., Silva, A. and Azevedo, V. (2011) Application of RNA-seq to reveal the transcript profile in bacteria. Genet. Mol. Res., 10, 1707-1718.
Literaturverzeichnis 99
167. Pitzschke, A. and Hirt, H. (2010) New insights into an old story: Agrobacterium-induced tumour formation in plants by plant transformation. EMBO J., 29, 1021-1032.
168. Pohronezny, K., Moss, M.A., Dankers, W. and Schenk, J. (1990) Dispersal and management of Xanthomonas campestris pv. vesicatoria during thinning of direct-seeded tomato. Plant Dis., 74, 800-805.
169. Prévost, K., Desnoyers, G., Jacques, J.F., Lavoie, F. and Massé, E. (2011) Small RNA-induced mRNA degradation achieved through both translation block and activated cleavage. Genes Dev., 25, 385-396.
170. Qian, W., Jia, Y., Ren, S.X., He, Y.Q., Feng, J.X., Lu, L.F., Sun, Q., Ying, G., Tang, D.J., Tang, H., Wu, W., Hao, P., Wang, L., Jiang, B.L., Zeng, S., Gu, W.Y., Lu, G., Rong, L., Tian, Y., Yao, Z., Fu, G., Chen, B., Fang, R., Qiang, B., Chen, Z., Zhao, G.P., Tang, J.L. and He, C. (2005) Comparative and functional genomic analyses of the pathogenicity of phytopathogen Xanthomonas campestris pv. campestris. Genome Res., 15, 757-767.
171. Rajagopal, L., Sundari, C.S., Balasubramanian, D. and Sonti, R.V. (1997) The bacterial pigment xanthomonadin offers protection against photodamage. FEBS Lett., 415, 125-128.
172. Ray, S.K., Rajeshwari, R., Sharma, Y. and Sonti, R.V. (2002) A high-molecular-weight outer membrane protein of Xanthomonas oryzae pv. oryzae exhibits similarity to non-fimbrial adhesins of animal pathogenic bacteria and is required for optimum virulence. Mol. Microbiol., 46, 637-647.
173. Rice, P.W. and Dahlberg, J.E. (1982) A gene between polA and glnA retards growth of Escherichia coli when present in multiple copies: physiological effects of the gene for spot 42 RNA. J. Bacteriol., 152, 1196-1210.
174. Richards, G.R. and Vanderpool, C.K. (2011) Molecular call and response: the physiology of bacterial small RNAs. Biochim. Biophys. Acta, 1809, 525-531.
175. Ringquist, S., MacDonald, M., Gibson, T. and Gold, L. (1993) Nature of the ribosomal mRNA track: analysis of ribosome-binding sites containing different sequences and secondary structures. Biochemistry, 32, 10254-10262.
176. Roberts, M.W. and Rabinowitz, J.C. (1989) The effect of Escherichia coli ribosomal protein S1 on the translational specificity of bacterial ribosomes. J. Biol. Chem., 264, 2228-2235.
177. Romeo, T., Gong, M., Liu, M.Y. and Brun-Zinkernagel, A.M. (1993) Identification and molecular characterization of csrA, a pleiotropic gene from Escherichia coli that affects glycogen biosynthesis, gluconeogenesis, cell size, and surface properties. J. Bacteriol., 175, 4744-4755.
178. Ronald, P.C. and Staskawicz, B.J. (1988) The avirulence gene avrBs1 from Xanthomonas campestris pv. vesicatoria encodes a 50-kD protein. Mol. Plant Microbe Interact., 1, 191-198.
179. Roscetto, E., Angrisano, T., Costa, V., Casalino, M., Forstner, K.U., Sharma, C.M., Di Nocera, P.P. and De Gregorio, E. (2012) Functional characterization of the RNA chaperone Hfq in the opportunistic human pathogen Stenotrophomonas maltophilia. J. Bacteriol., 194, 5864-5874.
180. Rossier, O., Wengelnik, K., Hahn, K. and Bonas, U. (1999) The Xanthomonas Hrp type III system secretes proteins from plant and mammalian bacterial pathogens. Proc. Natl. Acad. Sci. U.S.A., 96, 9368-9373.
181. Rothberg, J.M., Hinz, W., Rearick, T.M., Schultz, J., Mileski, W., Davey, M., Leamon, J.H., Johnson, K., Milgrew, M.J., Edwards, M., Hoon, J., Simons, J.F., Marran, D., Myers, J.W., Davidson, J.F., Branting, A., Nobile, J.R., Puc, B.P., Light, D., Clark, T.A., Huber, M., Branciforte, J.T., Stoner, I.B., Cawley, S.E., Lyons, M., Fu, Y., Homer, N., Sedova, M., Miao, X., Reed, B., Sabina, J., Feierstein, E., Schorn, M., Alanjary, M., Dimalanta, E., Dressman, D., Kasinskas, R., Sokolsky, T., Fidanza, J.A., Namsaraev, E., McKernan, K.J., Williams, A., Roth, G.T. and Bustillo, J. (2011) An integrated semiconductor device enabling non-optical genome sequencing. Nature, 475, 348-352.
182. Ryan, R.P., Fouhy, Y., Lucey, J.F., Jiang, B.L., He, Y.Q., Feng, J.X., Tang, J.L. and Dow, J.M. (2007) Cyclic di-GMP signalling in the virulence and environmental adaptation of Xanthomonas campestris. Mol. Microbiol., 63, 429-442.
183. Sahagan, B.G. and Dahlberg, J.E. (1979) A small, unstable RNA molecule of Escherichia coli: spot 42 RNA. I. Nucleotide sequence analysis. J. Mol. Biol., 131, 573-592.
184. Said, N., Rieder, R., Hurwitz, R., Deckert, J., Urlaub, H. and Vogel, J. (2009) In vivo expression and purification of aptamer-tagged small RNA regulators. Nucleic Acids Res., 37, e133.
185. Salah, P., Bisaglia, M., Aliprandi, P., Uzan, M., Sizun, C. and Bontems, F. (2009) Probing the relationship between Gram-negative and Gram-positive S1 proteins by sequence analysis. Nucleic Acids Res., 37, 5578-5588.
186. Schlüter, J.P., Reinkensmeier, J., Daschkey, S., Evguenieva-Hackenberg, E., Janssen, S., Jänicke, S., Becker, J.D., Giegerich, R. and Becker, A. (2010) A genome-wide survey of sRNAs in the symbiotic nitrogen-fixing alpha-proteobacterium Sinorhizobium meliloti. BMC Genomics, 11, 1-35.
100 Literaturverzeichnis
187. Schmidtke, C., Abendroth, U., Brock, J., Serrania, J., Becker, A. and Bonas, U. (2013) Small RNA sX13: a multifaceted regulator of virulence in the plant pathogen Xanthomonas. PLoS Pathog., 9, e1003626.
188. Schmidtke, C., Findeiß, S., Sharma, C.M., Kuhfuss, J., Hoffmann, S., Vogel, J., Stadler, P.F. and Bonas, U. (2012) Genome-wide transcriptome analysis of the plant pathogen Xanthomonas identifies sRNAs with putative virulence functions. Nucleic Acids Res., 40, 2020-2031.
189. Schulte, R. and Bonas, U. (1992) Expression of the Xanthomonas campestris pv. vesicatoria hrp gene cluster, which determines pathogenicity and hypersensitivity on pepper and tomato, is plant inducible. J. Bacteriol., 174, 815-823.
190. Schulze, S. (2013), Halle (Saale), Universitäts-und Landesbibliothek Sachsen-Anhalt, Diss., 2013. 191. Schulze, S., Kay, S., Büttner, D., Egler, M., Eschen-Lippold, L., Hause, G., Krüger, A., Lee, J.,
Müller, O., Scheel, D., Szczesny, R., Thieme, F. and Bonas, U. (2012) Analysis of new type III effectors from Xanthomonas uncovers XopB and XopS as suppressors of plant immunity. New Phytol., 195, 894-911.
192. Schuster, C.F. and Bertram, R. (2013) Toxin-antitoxin systems are ubiquitous and versatile modulators of prokaryotic cell fate. FEMS Microbiol. Lett., 340, 73-85.
193. Serganov, A. and Nudler, E. (2013) A decade of riboswitches. Cell, 152, 17-24. 194. Serganov, A. and Patel, D.J. (2009) Amino acid recognition and gene regulation by riboswitches.
Biochim. Biophys. Acta, 1789, 592-611. 195. Sharma, C.M., Darfeuille, F., Plantinga, T.H. and Vogel, J. (2007) A small RNA regulates multiple
ABC transporter mRNAs by targeting C/A-rich elements inside and upstream of ribosome-binding sites. Genes Dev., 21, 2804-2817.
196. Sharma, C.M., Hoffmann, S., Darfeuille, F., Reignier, J., Findeiss, S., Sittka, A., Chabas, S., Reiche, K., Hackermüller, J., Reinhardt, R., Stadler, P.F. and Vogel, J. (2010) The primary transcriptome of the major human pathogen Helicobacter pylori. Nature, 464, 250-255.
197. Sharma, C.M., Papenfort, K., Pernitzsch, S.R., Mollenkopf, H.J., Hinton, J.C. and Vogel, J. (2011) Pervasive post-transcriptional control of genes involved in amino acid metabolism by the Hfq-dependent GcvB small RNA. Mol. Microbiol., 81, 1144-1165.
198. Sharma, C.M. and Vogel, J. (2009) Experimental approaches for the discovery and characterization of regulatory small RNA. Curr. Opin. Microbiol., 12, 536-546.
199. Shendure, J., Porreca, G.J., Reppas, N.B., Lin, X., McCutcheon, J.P., Rosenbaum, A.M., Wang, M.D., Zhang, K., Mitra, R.D. and Church, G.M. (2005) Accurate multiplex polony sequencing of an evolved bacterial genome. Science, 309, 1728-1732.
200. Shine, J. and Dalgarno, L. (1974) The 3'-terminal sequence of Escherichia coli 16S ribosomal RNA: complementarity to nonsense triplets and ribosome binding sites. Proc. Natl. Acad. Sci. U.S.A., 71, 1342-1346.
201. Simons, R.W. and Kleckner, N. (1983) Translational control of IS10 transposition. Cell, 34, 683-691. 202. Sittka, A., Lucchini, S., Papenfort, K., Sharma, C.M., Rolle, K., Binnewies, T.T., Hinton, J.C. and
Vogel, J. (2008) Deep sequencing analysis of small noncoding RNA and mRNA targets of the global post-transcriptional regulator, Hfq. PLoS Genet., 4, e1000163.
203. Soper, T., Mandin, P., Majdalani, N., Gottesman, S. and Woodson, S.A. (2010) Positive regulation by small RNAs and the role of Hfq. Proc. Natl. Acad. Sci. U.S.A., 107, 9602-9607.
204. Sorek, R. and Cossart, P. (2010) Prokaryotic transcriptomics: a new view on regulation, physiology and pathogenicity. Nat. Rev. Genet., 11, 9-16.
205. Sorek, R., Lawrence, C.M. and Wiedenheft, B. (2013) CRISPR-mediated adaptive immune systems in bacteria and archaea. Annu. Rev. Biochem., 82, 237-266.
206. Stall, R.E., Jones, J.B. and Minsavage, G.V. (2009) Durability of resistance in tomato and pepper to xanthomonads causing bacterial spot. Annu. Rev. Phytopathol., 47, 265-284.
207. Stazic, D., Lindell, D. and Steglich, C. (2011) Antisense RNA protects mRNA from RNase E degradation by RNA-RNA duplex formation during phage infection. Nucleic Acids Res., 39, 4890-4899.
208. Steitz, J.A. and Jakes, K. (1975) How ribosomes select initiator regions in mRNA: base pair formation between the 3' terminus of 16S rRNA and the mRNA during initiation of protein synthesis in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A., 72, 4734-4738.
209. Stork, M., Di Lorenzo, M., Welch, T.J. and Crosa, J.H. (2007) Transcription termination within the iron transport-biosynthesis operon of Vibrio anguillarum requires an antisense RNA. J. Bacteriol., 189, 3479-3488.
210. Storz, G., Vogel, J. and Wassarman, K.M. (2011) Regulation by small RNAs in bacteria: expanding frontiers. Mol. Cell, 43, 880-891.
211. Stougaard, P., Molin, S. and Nordström, K. (1981) RNAs involved in copy-number control and incompatibility of plasmid R1. Proc. Natl. Acad. Sci. U.S.A., 78, 6008-6012.
213. Szczesny, R., Jordan, M., Schramm, C., Schulz, S., Cogez, V., Bonas, U. and Büttner, D. (2010) Functional characterization of the Xcs and Xps type II secretion systems from the plant pathogenic bacterium Xanthomonas campestris pv. vesicatoria. New Phytol., 187, 983-1002.
214. Tang, J.L., Liu, Y.N., Barber, C.E., Dow, J.M., Wootton, J.C. and Daniels, M.J. (1991) Genetic and molecular analysis of a cluster of rpf genes involved in positive regulation of synthesis of extracellular enzymes and polysaccharide in Xanthomonas campestris pathovar campestris. Mol. Gen. Genet., 226, 409-417.
215. Thieme, F., Koebnik, R., Bekel, T., Berger, C., Boch, J., Büttner, D., Caldana, C., Gaigalat, L., Goesmann, A., Kay, S., Kirchner, O., Lanz, C., Linke, B., McHardy, A.C., Meyer, F., Mittenhuber, G., Nies, D.H., Niesbach-Klösgen, U., Patschkowski, T., Rückert, C., Rupp, O., Schneiker, S., Schuster, S.C., Vorhölter, F.J., Weber, E., Pühler, A., Bonas, U., Bartels, D. and Kaiser, O. (2005) Insights into genome plasticity and pathogenicity of the plant pathogenic bacterium Xanthomonas campestris pv. vesicatoria revealed by the complete genome sequence. J. Bacteriol., 187, 7254-7266.
216. Thieme, F., Szczesny, R., Urban, A., Kirchner, O., Hause, G. and Bonas, U. (2007) New type III effectors from Xanthomonas campestris pv. vesicatoria trigger plant reactions dependent on a conserved N-myristoylation motif. Mol. Plant Microbe Interact., 20, 1250-1261.
217. Timmermans, J. and Van Melderen, L. (2010) Post-transcriptional global regulation by CsrA in bacteria. Cell. Mol. Life Sci., 67, 2897-2908.
218. Toledo-Arana, A., Dussurget, O., Nikitas, G., Sesto, N., Guet-Revillet, H., Balestrino, D., Loh, E., Gripenland, J., Tiensuu, T., Vaitkevicius, K., Barthelemy, M., Vergassola, M., Nahori, M.A., Soubigou, G., Regnault, B., Coppee, J.Y., Lecuit, M., Johansson, J. and Cossart, P. (2009) The Listeria transcriptional landscape from saprophytism to virulence. Nature, 459, 950-956.
219. Tomizawa, J., Itoh, T., Selzer, G. and Som, T. (1981) Inhibition of ColE1 RNA primer formation by a plasmid-specified small RNA. Proc. Natl. Acad. Sci. U.S.A., 78, 1421-1425.
220. Tramonti, A., De Canio, M. and De Biase, D. (2008) GadX/GadW-dependent regulation of the Escherichia coli acid fitness island: transcriptional control at the gadY-gadW divergent promoters and identification of four novel 42 bp GadX/GadW-specific binding sites. Mol. Microbiol., 70, 965-982.
221. Trotochaud, A.E. and Wassarman, K.M. (2004) 6S RNA function enhances long-term cell survival. J. Bacteriol., 186, 4978-4985.
222. Trotochaud, A.E. and Wassarman, K.M. (2005) A highly conserved 6S RNA structure is required for regulation of transcription. Nat. Struct. Mol. Biol., 12, 313-319.
223. Udagawa, T., Shimizu, Y. and Ueda, T. (2004) Evidence for the translation initiation of leaderless mRNAs by the intact 70 S ribosome without its dissociation into subunits in eubacteria. J. Biol. Chem., 279, 8539-8546.
224. Urban, J.H. and Vogel, J. (2007) Translational control and target recognition by Escherichia coli small RNAs in vivo. Nucleic Acids Res., 35, 1018-1037.
225. van Doorn, J., Boonekamp, P.M. and Oudega, B. (1994) Partial characterization of fimbriae of Xanthomonas campestris pv. hyacinthi. Mol. Plant Microbe Interact., 7, 334-344.
226. Vanderpool, C.K., Balasubramanian, D. and Lloyd, C.R. (2011) Dual-function RNA regulators in bacteria. Biochimie, 93, 1943-1949.
227. Vanderpool, C.K. and Gottesman, S. (2004) Involvement of a novel transcriptional activator and small RNA in post-transcriptional regulation of the glucose phosphoenolpyruvate phosphotransferase system. Mol. Microbiol., 54, 1076-1089.
228. Vanneste, J.L.L. (2000) Fire blight: the disease and its causative agent, Erwinia amylovora. CAB International, New York, USA.
229. Vauterin, L., Rademaker, J. and Swings, J. (2000) Synopsis on the taxonomy of the genus Xanthomonas. Phytopathology, 90, 677-682.
230. Viegas, S.C., Pfeiffer, V., Sittka, A., Silva, I.J., Vogel, J. and Arraiano, C.M. (2007) Characterization of the role of ribonucleases in Salmonella small RNA decay. Nucleic Acids Res., 35, 7651-7664.
231. Vitreschak, A.G., Rodionov, D.A., Mironov, A.A. and Gelfand, M.S. (2002) Regulation of riboflavin biosynthesis and transport genes in bacteria by transcriptional and translational attenuation. Nucleic Acids Res., 30, 3141-3151.
232. Vitreschak, A.G., Rodionov, D.A., Mironov, A.A. and Gelfand, M.S. (2003) Regulation of the vitamin B12 metabolism and transport in bacteria by a conserved RNA structural element. RNA, 9, 1084-1097.
233. Vogel, J., Argaman, L., Wagner, E.G. and Altuvia, S. (2004) The small RNA IstR inhibits synthesis of an SOS-induced toxic peptide. Curr. Biol., 14, 2271-2276.
102 Literaturverzeichnis
234. Vogel, J., Bartels, V., Tang, T.H., Churakov, G., Slagter-Jäger, J.G., Hüttenhofer, A. and Wagner, E.G. (2003) RNomics in Escherichia coli detects new sRNA species and indicates parallel transcriptional output in bacteria. Nucleic Acids Res., 31, 6435-6443.
235. Vogel, J. and Luisi, B.F. (2011) Hfq and its constellation of RNA. Nat. Rev. Microbiol., 9, 578-589. 236. Vogel, J. and Wagner, E.G. (2007) Target identification of small noncoding RNAs in bacteria. Curr.
Opin. Microbiol., 10, 262-270. 237. Wadler, C.S. and Vanderpool, C.K. (2007) A dual function for a bacterial small RNA: SgrS performs
base pairing-dependent regulation and encodes a functional polypeptide. Proc. Natl. Acad. Sci. U.S.A., 104, 20454-20459.
238. Waldminghaus, T., Heidrich, N., Brantl, S. and Narberhaus, F. (2007) FourU: a novel type of RNA thermometer in Salmonella. Mol. Microbiol., 65, 413-424.
239. Wang, J.X., Lee, E.R., Morales, D.R., Lim, J. and Breaker, R.R. (2008) Riboswitches that sense S-adenosylhomocysteine and activate genes involved in coenzyme recycling. Mol. Cell, 29, 691-702.
240. Wang, L., Makino, S., Subedee, A. and Bogdanove, A.J. (2007) Novel candidate virulence factors in rice pathogen Xanthomonas oryzae pv. oryzicola as revealed by mutational analysis. Appl. Environ. Microbiol., 73, 8023-8027.
241. Wang, L.H., He, Y., Gao, Y., Wu, J.E., Dong, Y.H., He, C., Wang, S.X., Weng, L.X., Xu, J.L., Tay, L., Fang, R.X. and Zhang, L.H. (2004) A bacterial cell-cell communication signal with cross-kingdom structural analogues. Mol. Microbiol., 51, 903-912.
242. Wassarman, K.M. (2007) 6S RNA: a small RNA regulator of transcription. Curr. Opin. Microbiol., 10, 164-168.
243. Wassarman, K.M., Repoila, F., Rosenow, C., Storz, G. and Gottesman, S. (2001) Identification of novel small RNAs using comparative genomics and microarrays. Genes Dev., 15, 1637-1651.
244. Wassarman, K.M. and Storz, G. (2000) 6S RNA regulates E. coli RNA polymerase activity. Cell, 101, 613-623.
245. Waters, L.S. and Storz, G. (2009) Regulatory RNAs in bacteria. Cell, 136, 615-628. 246. Weber, E., Berger, C., Bonas, U. and Koebnik, R. (2007) Refinement of the Xanthomonas
campestris pv. vesicatoria hrpD and hrpE operon structure. Mol. Plant Microbe Interact., 20, 559-567. 247. Weber, E., Ojanen-Reuhs, T., Huguet, E., Hause, G., Romantschuk, M., Korhonen, T.K., Bonas,
U. and Koebnik, R. (2005) The type III-dependent Hrp pilus is required for productive interaction of Xanthomonas campestris pv. vesicatoria with pepper host plants. J. Bacteriol., 187, 2458-2468.
248. Wei, B.L., Brun-Zinkernagel, A.M., Simecka, J.W., Pruss, B.M., Babitzke, P. and Romeo, T. (2001) Positive regulation of motility and flhDC expression by the RNA-binding protein CsrA of Escherichia coli. Mol. Microbiol., 40, 245-256.
249. Weiberg, A., Wang, M., Lin, F.M., Zhao, H., Zhang, Z., Kaloshian, I., Huang, H.D. and Jin, H. (2013) Fungal small RNAs suppress plant immunity by hijacking host RNA interference pathways. Science, 342, 118-123.
250. Weilbacher, T., Suzuki, K., Dubey, A.K., Wang, X., Gudapaty, S., Morozov, I., Baker, C.S., Georgellis, D., Babitzke, P. and Romeo, T. (2003) A novel sRNA component of the carbon storage regulatory system of Escherichia coli. Mol. Microbiol., 48, 657-670.
251. Weissenmayer, B.A., Prendergast, J.G., Lohan, A.J. and Loftus, B.J. (2011) Sequencing illustrates the transcriptional response of Legionella pneumophila during infection and identifies seventy novel small non-coding RNAs. PLoS ONE, 6, e17570.
252. Wengelnik, K. and Bonas, U. (1996) HrpXv, an AraC-type regulator, activates expression of five of the six loci in the hrp cluster of Xanthomonas campestris pv. vesicatoria. J. Bacteriol., 178, 3462-3469.
253. Wengelnik, K., Marie, C., Russel, M. and Bonas, U. (1996) Expression and localization of HrpA1, a protein of Xanthomonas campestris pv. vesicatoria essential for pathogenicity and induction of the hypersensitive reaction. J. Bacteriol., 178, 1061-1069.
254. Wengelnik, K., Rossier, O. and Bonas, U. (1999) Mutations in the regulatory gene hrpG of Xanthomonas campestris pv. vesicatoria result in constitutive expression of all hrp genes. J. Bacteriol., 181, 6828-6831.
255. Wengelnik, K., Van den Ackerveken, G. and Bonas, U. (1996) HrpG, a key hrp regulatory protein of Xanthomonas campestris pv. vesicatoria is homologous to two-component response regulators. Mol. Plant Microbe Interact., 9, 704-712.
256. Westermann, A.J., Gorski, S.A. and Vogel, J. (2012) Dual RNA-seq of pathogen and host. Nat. Rev. Microbiol., 10, 618-630.
257. Wilms, I., Möller, P., Stock, A.M., Gurski, R., Lai, E.M. and Narberhaus, F. (2012) Hfq influences multiple transport systems and virulence in the plant pathogen Agrobacterium tumefaciens. J. Bacteriol., 194, 5209-5217.
258. Wilms, I., Overlöper, A., Nowrousian, M., Sharma, C.M. and Narberhaus, F. (2012) Deep sequencing uncovers numerous small RNAs on all four replicons of the plant pathogen Agrobacterium tumefaciens. RNA Biol, 9, 446-457.
Literaturverzeichnis 103
259. Wilms, I., Voss, B., Hess, W.R., Leichert, L.I. and Narberhaus, F. (2011) Small RNA-mediated control of the Agrobacterium tumefaciens GABA binding protein. Mol. Microbiol., 80, 492-506.
260. Winkler, W., Nahvi, A. and Breaker, R.R. (2002) Thiamine derivatives bind messenger RNAs directly to regulate bacterial gene expression. Nature, 419, 952-956.
261. Yanofsky, C. (1981) Attenuation in the control of expression of bacterial operons. Nature, 289, 751-758.
262. Zeng, Q., McNally, R.R. and Sundin, G.W. (2013) Global small RNA chaperone Hfq and regulatory small RNAs are important virulence regulators in Erwinia amylovora. J. Bacteriol., 195, 1706-1717.
263. Zhang, Y., Wei, C., Jiang, W., Wang, L., Li, C., Wang, Y., Dow, J.M. and Sun, W. (2013) The HD-GYP domain protein RpfG of Xanthomonas oryzae pv. oryzicola regulates synthesis of extracellular polysaccharides that contribute to biofilm formation and virulence on rice. PLoS ONE, 8, e59428.
264. Zhu, P.L., Zhao, S., Tang, J.L. and Feng, J.X. (2010) The rsmA-like gene rsmAXoo of Xanthomonas oryzae pv. oryzae regulates bacterial virulence and production of diffusible signal factor. Mol. Plant Pathol., 12, 227-237.
265. Zielenkiewicz, U. and Ceglowski, P. (2005) The toxin-antitoxin system of the streptococcal plasmid pSM19035. J. Bacteriol., 187, 6094-6105.
Anhang 105
Anhang zu Kapitel 2.1.1.: Tabellen S1 bis S9
Table S1. Bacterial strains, plasmids and oligonucleotides used in this study.
Strain or plasmid Relevant characteristicsa Reference or source
Xanthomonas campestris pv. vesicatoria 85-10 Pepper-race 2; wild type; RifR (1) 85-10 hrpX 85-10 derivative deleted in hrpX; RifR (2) 85-10 sX12 85-10 derivative deleted in sX12; RifR This study 85* 85-10 derivative containing the hrpG* mutation; RifR (3)
a, Ap, ampicillin; Gm, gentamycin; Km, kanamycin; Rif, rifampicin; Sm, spectinomycin; Tc, tetracycline. R, resistance. Recognition sites of restriction enzymes are underlined. *,
References
1. Canteros, B.I. (1990) Ph.D. thesis. University of Florida, Gainesville, FL. 2. Koebnik, R., Krüger, A., Thieme, F., Urban, A. and Bonas, U. (2006) Specific binding of the Xanthomonas campestris pv.
vesicatoria AraC-type transcriptional activator HrpX to plant-inducible promoter boxes. J. Bacteriol., 188, 7652-7660. 3. Wengelnik, K., Rossier, O. and Bonas, U. (1999) Mutations in the regulatory gene hrpG of Xanthomonas campestris pv.
vesicatoria result in constitutive expression of all hrp genes. J. Bacteriol., 181, 6828-6831. 4. Menard, R., Sansonetti, P.J. and Parsot, C. (1993) Nonpolar mutagenesis of the ipa genes defines IpaB, IpaC, and IpaD as
effectors of Shigella flexneri entry into epithelial cells. J. Bacteriol., 175, 5899-5906. 5. Szczesny, R., Jordan, M., Schramm, C., Schulz, S., Cogez, V., Bonas, U. and Büttner, D. (2010) Functional characterization
of the Xcs and Xps type II secretion systems from the plant pathogenic bacterium Xanthomonas campestris pv. vesicatoria. New Phytol., 187, 983-1002.
6. Bonas, U., Stall, R.E. and Staskawicz, B. (1989) Genetic and structural characterization of the avirulence gene avrBs3 from Xanthomonas campestris pv. vesicatoria. Mol. Gen. Genet., 218, 127-136.
7. Huguet, E., Hahn, K., Wengelnik, K. and Bonas, U. (1998) hpaA mutants of Xanthomonas campestris pv. vesicatoria are affected in pathogenicity but retain the ability to induce host-specific hypersensitive reaction. Mol. Microbiol., 29, 1379-1390.
8. Figurski, D.H. and Helinski, D.R. (1979) Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid function provided in trans. Proc. Natl. Acad. Sci. U. S. A., 76, 1648-1652.
Anhang 107
a, TSS position on the Xcv chromosome and the plasmid (pXCV183; marked with #), respectively. b, p-value indicates the significance of the annotated TSS (see METHODS). c, number of read starts at TSS position. d, TSS classification and the corresponding CDS. e, distance of the TSS to annotated start and stop codon of the corresponding CDS. f, a TSS is classified as orphan (+) if it is neither classified as primary, internal nor antisense TSS.
Table S2. Classification of putative TSSs which were automatically identified in the Xcv genome [see Figure 1B and METHODS; (1)].
a, TSS position on the Xcv chromosome and the plasmid (pXCV183; marked with #), respectively. b, p-value indicates the significance of the annotated TSS (see METHODS). c, number of read starts at TSS position. d, TSS classification and the corresponding CDS. e, distance of the TSS to annotated start and stop codon of the corresponding CDS. f, a TSS is classified as orphan (+) if it is neither classified as primary, internal nor antisense TSS.
a, TSS position on the Xcv chromosome and the plasmid (pXCV183; marked with #), respectively. b, p-value indicates the significance of the annotated TSS (see METHODS). c, number of read starts at TSS position. d, TSS classification and the corresponding CDS. e, distance of the TSS to annotated start and stop codon of the corresponding CDS. f, a TSS is classified as orphan (+) if it is neither classified as primary, internal nor antisense TSS.
a, TSS position on the Xcv chromosome and the plasmid (pXCV183; marked with #), respectively. b, p-value indicates the significance of the annotated TSS (see METHODS). c, number of read starts at TSS position. d, TSS classification and the corresponding CDS. e, distance of the TSS to annotated start and stop codon of the corresponding CDS. f, a TSS is classified as orphan (+) if it is neither classified as primary, internal nor antisense TSS.
a, TSS position on the Xcv chromosome and the plasmid (pXCV183; marked with #), respectively. b, p-value indicates the significance of the annotated TSS (see METHODS). c, number of read starts at TSS position. d, TSS classification and the corresponding CDS. e, distance of the TSS to annotated start and stop codon of the corresponding CDS. f, a TSS is classified as orphan (+) if it is neither classified as primary, internal nor antisense TSS.
a, TSS position on the Xcv chromosome and the plasmid (pXCV183; marked with #), respectively. b, p-value indicates the significance of the annotated TSS (see METHODS). c, number of read starts at TSS position. d, TSS classification and the corresponding CDS. e, distance of the TSS to annotated start and stop codon of the corresponding CDS. f, a TSS is classified as orphan (+) if it is neither classified as primary, internal nor antisense TSS.
a, TSS position on the Xcv chromosome and the plasmid (pXCV183; marked with #), respectively. b, p-value indicates the significance of the annotated TSS (see METHODS). c, number of read starts at TSS position. d, TSS classification and the corresponding CDS. e, distance of the TSS to annotated start and stop codon of the corresponding CDS. f, a TSS is classified as orphan (+) if it is neither classified as primary, internal nor antisense TSS.
a, TSS position on the Xcv chromosome and the plasmid (pXCV183; marked with #), respectively. b, p-value indicates the significance of the annotated TSS (see METHODS). c, number of read starts at TSS position. d, TSS classification and the corresponding CDS. e, distance of the TSS to annotated start and stop codon of the corresponding CDS. f, a TSS is classified as orphan (+) if it is neither classified as primary, internal nor antisense TSS.
a, TSS position on the Xcv chromosome and the plasmid (pXCV183; marked with #), respectively. b, p-value indicates the significance of the annotated TSS (see METHODS). c, number of read starts at TSS position. d, TSS classification and the corresponding CDS. e, distance of the TSS to annotated start and stop codon of the corresponding CDS. f, a TSS is classified as orphan (+) if it is neither classified as primary, internal nor antisense TSS.
a, TSS position on the Xcv chromosome and the plasmid (pXCV183; marked with #), respectively. b, p-value indicates the significance of the annotated TSS (see METHODS). c, number of read starts at TSS position. d, TSS classification and the corresponding CDS. e, distance of the TSS to annotated start and stop codon of the corresponding CDS. f, a TSS is classified as orphan (+) if it is neither classified as primary, internal nor antisense TSS.
a, TSS position on the Xcv chromosome and the plasmid (pXCV183; marked with #), respectively. b, p-value indicates the significance of the annotated TSS (see METHODS). c, number of read starts at TSS position. d, TSS classification and the corresponding CDS. e, distance of the TSS to annotated start and stop codon of the corresponding CDS. f, a TSS is classified as orphan (+) if it is neither classified as primary, internal nor antisense TSS.
a, TSS position on the Xcv chromosome and the plasmid (pXCV183; marked with #), respectively. b, p-value indicates the significance of the annotated TSS (see METHODS). c, number of read starts at TSS position. d, TSS classification and the corresponding CDS. e, distance of the TSS to annotated start and stop codon of the corresponding CDS. f, a TSS is classified as orphan (+) if it is neither classified as primary, internal nor antisense TSS.
a, TSS position on the Xcv chromosome and the plasmid (pXCV183; marked with #), respectively. b, p-value indicates the significance of the annotated TSS (see METHODS). c, number of read starts at TSS position. d, TSS classification and the corresponding CDS. e, distance of the TSS to annotated start and stop codon of the corresponding CDS. f, a TSS is classified as orphan (+) if it is neither classified as primary, internal nor antisense TSS.
a, TSS position on the Xcv chromosome and the plasmid (pXCV183; marked with #), respectively. b, p-value indicates the significance of the annotated TSS (see METHODS). c, number of read starts at TSS position. d, TSS classification and the corresponding CDS. e, distance of the TSS to annotated start and stop codon of the corresponding CDS. f, a TSS is classified as orphan (+) if it is neither classified as primary, internal nor antisense TSS.
a, TSS position on the Xcv chromosome and the plasmid (pXCV183; marked with #), respectively. b, p-value indicates the significance of the annotated TSS (see METHODS). c, number of read starts at TSS position. d, TSS classification and the corresponding CDS. e, distance of the TSS to annotated start and stop codon of the corresponding CDS. f, a TSS is classified as orphan (+) if it is neither classified as primary, internal nor antisense TSS.
a, TSS position on the Xcv chromosome and the plasmid (pXCV183; marked with #), respectively. b, p-value indicates the significance of the annotated TSS (see METHODS). c, number of read starts at TSS position. d, TSS classification and the corresponding CDS. e, distance of the TSS to annotated start and stop codon of the corresponding CDS. f, a TSS is classified as orphan (+) if it is neither classified as primary, internal nor antisense TSS.
a, TSS position on the Xcv chromosome and the plasmid (pXCV183; marked with #), respectively. b, p-value indicates the significance of the annotated TSS (see METHODS). c, number of read starts at TSS position. d, TSS classification and the corresponding CDS. e, distance of the TSS to annotated start and stop codon of the corresponding CDS. f, a TSS is classified as orphan (+) if it is neither classified as primary, internal nor antisense TSS.
a, TSS position on the Xcv chromosome and the plasmid (pXCV183; marked with #), respectively. b, p-value indicates the significance of the annotated TSS (see METHODS). c, number of read starts at TSS position. d, TSS classification and the corresponding CDS. e, distance of the TSS to annotated start and stop codon of the corresponding CDS. f, a TSS is classified as orphan (+) if it is neither classified as primary, internal nor antisense TSS.
a, TSS position on the Xcv chromosome and the plasmid (pXCV183; marked with #), respectively. b, p-value indicates the significance of the annotated TSS (see METHODS). c, number of read starts at TSS position. d, TSS classification and the corresponding CDS. e, distance of the TSS to annotated start and stop codon of the corresponding CDS. f, a TSS is classified as orphan (+) if it is neither classified as primary, internal nor antisense TSS.
a, TSS position on the Xcv chromosome and the plasmid (pXCV183; marked with #), respectively. b, p-value indicates the significance of the annotated TSS (see METHODS). c, number of read starts at TSS position. d, TSS classification and the corresponding CDS. e, distance of the TSS to annotated start and stop codon of the corresponding CDS. f, a TSS is classified as orphan (+) if it is neither classified as primary, internal nor antisense TSS.
a, TSS position on the Xcv chromosome and the plasmid (pXCV183; marked with #), respectively. b, p-value indicates the significance of the annotated TSS (see METHODS). c, number of read starts at TSS position. d, TSS classification and the corresponding CDS. e, distance of the TSS to annotated start and stop codon of the corresponding CDS. f, a TSS is classified as orphan (+) if it is neither classified as primary, internal nor antisense TSS.
a, TSS position on the Xcv chromosome and the plasmid (pXCV183; marked with #), respectively. b, p-value indicates the significance of the annotated TSS (see METHODS). c, number of read starts at TSS position. d, TSS classification and the corresponding CDS. e, distance of the TSS to annotated start and stop codon of the corresponding CDS. f, a TSS is classified as orphan (+) if it is neither classified as primary, internal nor antisense TSS.
a, TSS position on the Xcv chromosome and the plasmid (pXCV183; marked with #), respectively. b, p-value indicates the significance of the annotated TSS (see METHODS). c, number of read starts at TSS position. d, TSS classification and the corresponding CDS. e, distance of the TSS to annotated start and stop codon of the corresponding CDS. f, a TSS is classified as orphan (+) if it is neither classified as primary, internal nor antisense TSS.
a, TSS position on the Xcv chromosome and the plasmid (pXCV183; marked with #), respectively. b, p-value indicates the significance of the annotated TSS (see METHODS). c, number of read starts at TSS position. d, TSS classification and the corresponding CDS. e, distance of the TSS to annotated start and stop codon of the corresponding CDS. f, a TSS is classified as orphan (+) if it is neither classified as primary, internal nor antisense TSS.
a, TSS position on the Xcv chromosome and the plasmid (pXCV183; marked with #), respectively. b, p-value indicates the significance of the annotated TSS (see METHODS). c, number of read starts at TSS position. d, TSS classification and the corresponding CDS. e, distance of the TSS to annotated start and stop codon of the corresponding CDS. f, a TSS is classified as orphan (+) if it is neither classified as primary, internal nor antisense TSS.
a, TSS position on the Xcv chromosome and the plasmid (pXCV183; marked with #), respectively. b, p-value indicates the significance of the annotated TSS (see METHODS). c, number of read starts at TSS position. d, TSS classification and the corresponding CDS. e, distance of the TSS to annotated start and stop codon of the corresponding CDS. f, a TSS is classified as orphan (+) if it is neither classified as primary, internal nor antisense TSS.
a, TSS position on the Xcv chromosome and the plasmid (pXCV183; marked with #), respectively. b, p-value indicates the significance of the annotated TSS (see METHODS). c, number of read starts at TSS position. d, TSS classification and the corresponding CDS. e, distance of the TSS to annotated start and stop codon of the corresponding CDS. f, a TSS is classified as orphan (+) if it is neither classified as primary, internal nor antisense TSS.
a, TSS position on the Xcv chromosome and the plasmid (pXCV183; marked with #), respectively. b, p-value indicates the significance of the annotated TSS (see METHODS). c, number of read starts at TSS position. d, TSS classification and the corresponding CDS. e, distance of the TSS to annotated start and stop codon of the corresponding CDS. f, a TSS is classified as orphan (+) if it is neither classified as primary, internal nor antisense TSS.
1. Thieme, F., Koebnik, R., Bekel, T., Berger, C., Boch, J., Büttner, D., Caldana, C., Gaigalat, L., Goesmann, A., Kay, S. et al. (2005) Insights into genome plasticity and pathogenicity of the plant pathogenic bacterium Xanthomonas campestris pv. vesicatoria revealed by the complete genome sequence. J. Bacteriol., 187, 7254-7266.
Anhang 135
a, number of read starts at TSS position.
Table S3. Putative chromosomal TSSs within the first 50 bp of annotated CDSs (1).
1. Thieme, F., Koebnik, R., Bekel, T., Berger, C., Boch, J., Büttner, D., Caldana, C., Gaigalat, L., Goesmann, A., Kay, S. et al. (2005) Insights into genome plasticity and pathogenicity of the plant pathogenic bacterium Xanthomonas campestris pv. vesicatoria revealed by the complete genome sequence. J. Bacteriol., 187, 7254-7266.
Anhang 137
Table S4. Predicted antisense TSSs located close to the 3' end of annotated CDSs (+/- 100 bp) (1).
TSS positiona Strand Library 2b Library 1b
Distance of CDS end to TSSc (bp) Gene product
81749# - 9 2 43 XCVd0073: hypothetical protein 109851# + 35 6 -99 XCVd0099: putative zeta toxin of the postsegregational killing system 127227# - 4 2 -62 XCVd0115: Tn5044 transposase 159633# + 3 0 -74 XCVd0154: hypothetical protein 180140# + 3 0 -86 XCVd0171: hypothetical protein
11675 - 6 0 -72 XCV0008: energy transducer TonB protein 78522 + 23 2 -46 XCV0067: hypothetical protein
a, TSS position on the Xcv chromosome and the plasmid (pXCV183; marked with #), respectively. b, number of read starts at TSS position. c, positive and negative sign indicates TSS within and downstream the CDS, respectively.
Reference
1. Thieme, F., Koebnik, R., Bekel, T., Berger, C., Boch, J., Büttner, D., Caldana, C., Gaigalat, L., Goesmann, A., Kay, S. et al. (2005) Insights into genome plasticity and pathogenicity of the plant pathogenic bacterium Xanthomonas campestris pv. vesicatoria revealed by the complete genome sequence. J. Bacteriol., 187, 7254-7266.
138 Anhang
a, number of read starts at the TSS position.
Table S5. 5' UTRs of type III effector gene 10 bp upstream of the annotated start codon and genes containing long 5' UTRs (150 to 300 bp) referring to the annotated genome sequence of Xcv strain 85-10 (1). TSSs marked with # are located on pXCV183. TSSs of type III effector genes marked in bold exhibit a PIP box and -10 T/A-rich element as previously described (2). The PIP box of the type III effector gene XCV2280 was identified in this study and is shown in brackets.
TSS position Strand Library
2a Library
1a 5' UTR
(bp) Gene product
5' UTRs of Type III Effectors
114827# - 11 0 375 XCVd0104: avirulence protein AvrBs1 62304 + 3 0 23 XCV0052: avirulence protein AvrBs2 486511 + 5 0 678 XCV0437: xanthomonas outer protein D (XopD) 532770 + 8 1 0 XCV0471: avirulence protein AvrRxv 660302 + 12 2 341 XCV0581: xanthomonas outer protein B (XopB)
1184957 + 12 1 25 XCV1055: xanthomonas outer protein O (XopO) 2480236 - 183 10 22 XCV2156: xanthomonas outer protein J1 (XopJ1) 2613410
1. Thieme, F., Koebnik, R., Bekel, T., Berger, C., Boch, J., Büttner, D., Caldana, C., Gaigalat, L., Goesmann, A., Kay, S. et al. (2005) Insights into genome plasticity and pathogenicity of the plant pathogenic bacterium Xanthomonas campestris pv. vesicatoria revealed by the complete genome sequence. J. Bacteriol., 187, 7254-7266.
2. Koebnik, R., Krüger, A., Thieme, F., Urban, A. and Bonas, U. (2006) Specific binding of the Xanthomonas campestris pv. vesicatoria AraC-type transcriptional activator HrpX to plant-inducible promoter boxes. J. Bacteriol., 188, 7652-7660.
Anhang 143
Table S6. Candidate riboswitches and widely conserved RNAs in Xcv.
a, Putative riboswitches and widely conserved RNAs identified in Rfam database [see SI; (1)]. b, chromosomal position in Xcv corresponding to Rfam entry. c, TSS position in the Xcv chromosome (2). Numbers in brackets indicate read starts at TSS position (library 2/library 1). d, gene product of CDS annotated downstream of putative riboswitch (2). e, chromosomal orientation of sRNA gene and flanking CDSs indicated by arrows.
et al. (2010) Rfam: Wikipedia, clans and the "decimal" release. Nucleic Acids Res., 39, D141-145. 2. Thieme, F., Koebnik, R., Bekel, T., Berger, C., Boch, J., Büttner, D., Caldana, C., Gaigalat, L., Goesmann, A., Kay, S. et al. (2005)
Insights into genome plasticity and pathogenicity of the plant pathogenic bacterium Xanthomonas campestris pv. vesicatoria revealed by the complete genome sequence. J. Bacteriol., 187, 7254-7266.
Riboswitch (Rfam entry)a Chromosomal position (strand)b TSS positionc Downstream CDSd
a, number of reads (library 2/library 1) mapped to the respective loci. b, automatically annotated TSS (see Table S2); -
References
1. Thieme, F., Koebnik, R., Bekel, T., Berger, C., Boch, J., Büttner, D., Caldana, C., Gaigalat, L., Goesmann, A., Kay, S. et al. (2005) Insights into genome plasticity and pathogenicity of the plant pathogenic bacterium Xanthomonas campestris pv. vesicatoria revealed by the complete genome sequence. J. Bacteriol., 187, 7254-7266.
2. Washietl, S., Findeiß, S., Müller, S.A., Kalkhof, S., von Bergen, M., Hofacker, I.L., Stadler, P.F. and Goldman, N. (2011) RNAcode: Robust discrimination of coding and noncoding regions in comparative sequence data. RNA, 17, 578-594.
Anhang 145
Table S8. Genome sequences used for the calculation of multiple sequence alignments.
Table S9. The extended two-by-two confusion matrix summarizes the predictive power of the automated TSS annotation approach. A subsample of the manually curated TSS map of H. pylori (1) was used as reference data set and evaluated with our method. The analyzed data-set contained 392 manually annotated TSSs. In total 566 genomic positions fulfilled the criteria (accumulation of at least three read starts) to be analyzed by our automated TSS annotation approach. According to Fawcett (2006), true positives (classified as TSS and also manually annotated) and false positives (classified as TSS but not manually annotated) as well as true negatives (neither classified as TSS nor manually annotated) and false negatives (not classified as TSS but manually annotated) were evaluated (2). Based on these values the calculated values for sensitivity, specificity as well as positive and negative predictive values are listed.
Reiche, K., Hackermüller, J., Reinhardt, R. et al. (2010) The primary transcriptome of the major human pathogen Helicobacter pylori. Nature, 464, 250-255.
2. Fawcett, T. (2006) An introduction to ROC analysis. Pattern recognition letters, 27, 861-874.
147
Erklärung
Hiermit erkläre ich, dass ich die vorliegende wissenschaftliche Arbeit selbstständig und ohne fremde
Hilfe verfasst habe. Ich erkläre weiterhin, dass andere als die von mir angegebenen Quellen und
Hilfsmittel nicht benutzt und die den benutzten Werken wörtlich oder inhaltlich entnommenen Stellen
als solche kenntlich gemacht wurden. Mit dieser Arbeit bewerbe ich mich erstmals um die Erlangung
2001-2007 Studium der Biologie an der Martin-Luther-Universität Halle-Wittenberg
2006-2007 Diplomarbeit am Institut für Genetik, Abteilung Pflanzengenetik der Martin- Luther-Universität Halle-Wittenberg
Thema: Analyse der potentiellen Virulenzfunktionen möglicher Adhäsine und Sekretionssysteme von Xanthomonas campestris pv. vesicatoria
Abschluss: Diplom-Biologe (Note 1,1)
2007-2013 Promotionsarbeit am Institut für Biologie, Institutsbereich Genetik, Abteilung Pflanzengenetik der Naturwissenschaftlichen Fakultät I der Martin-Luther- Universität Halle-Wittenberg