Www.grimmy.com/. Transcription & Translation Transcription : writing again Translation : changing languages.

www.grimmy.com/

Transcription &

Translation

•Transcription: writing again

•Translation: changing languages

Today we’ll go from here... To here

Text

Off to see the wizard...

• DNA replication

– both strands => new DNA

– => new cell

• Transcription– 1 strand => new RNA– => new protein

Sending ‘messages’ out from DNA

20 toys• EVERY one has a blue part. Chem name?• EVERY one has a red part. Chem name?• Thus these are all…? • How many are there?

Amino Acids• How are they similar?• How are they different?• What do the differences mean in

terms of “feel”?• How many are there?• Possible?

Amino Acids• You & partner have an amino

acid; which is it? (StructViewer or homepage => left column ‘big twenty’ amino acids)

Nucleic Acids• How are they similar?• How are they different?• What do the differences mean in

terms of “feel”?• Which is more diverse in terms of

shape and ‘feel’?• Which would allow for more diverse

shapes and surfaces when ‘connected’?

How does a codon ‘mean’ an amino acid?

The Play is the thing…

The Play is the thing…Or, Fun With Blocks

The Play is the thing…

• ‘Types of Bonds’– Velcro – can be easily broken/re-

made during lab– Duct tape – breaking it gets you and

zero (0) for this week’s quiz

The Play is the thing…

• The Players

The Play is the thing…

• The Players– tRNA

The Play is the thing…

• The Players– tRNA– Ribosome

The Play is the thing…

• The Players– tRNA– Ribosome– Aminoacyl tRNA synthetase

The Play is the thing…

• The Players– tRNA– Ribosome– Aminoacyl tRNA synthetase– RNA polymerase

The Play is the thing…

• The Players– tRNA (4 people)– Ribosome (1)– Aminoacyl tRNA synthetase (4)– RNA polymerase (1-2) * and RNA– Termination factor (1)

Blinding you with Science (jargon)

RNA Polymerase: joins RNA links into a chain

mRNA: messenger RNA; RNA string copied (‘transcribed’) from DNA

tRNA: transfer RNA; one of many RNA molecules that carry specific amino acids

ribosome: giant machine (>200 proteins, 4 RNAs (2 > 1000 nucleotides) that oversees the reading of the mRNA and the creation of polypeptide

aminoacyl tRNA synthetase: protein machine adds amino acid to tRNAs

Termination factor: ‘reads’ UAA etc., => ribosome looses the peptide & falls apart

Learning your ‘lines’

• Handout: Each group find questions related to their role; answer them

• Lab manual, textbook, internet OK as sources

• Meet your blocks-- 5’ is the end that sticks to hair, socks, shirts

5’ end is pointy/spiky3’ end is soft/furry

DNA Template

• 5’ CTTAAATCCGAATGCCCATG 3’

5’ is “sticky”, 3’ is “fuzzy”

5’ CTTAAATCCGAATGCCCATG 3’5’ is “sticky”, 3’ is “fuzzy”

Wielding the Power• ‘Recall’ that ribosome assembly is

the result of methionine tRNA finding a match on mRNA in presence of small ribosome subunit

• Only methionine tRNA (it will ‘know itself’ once crowned by the synthetase that hands out met) can team with small ribosomal subunit & join with the ‘AUG’!

Ready…. Go!• mRNA at the central bench• ribosome assembles around it• synthetases at bench corners (or ‘diffuse’

opp. direction vs. tRNA)• tRNAs will ‘diffuse’ by following a path

through the room• When any event first happens*, action

stops, molecules involved will announce, explain

• Go until a protein happens

“Who” knows what’s going on?

• What happens if a tRNA carries the wrong amino acid?

• What happens if the mRNA contains a copy error relative to DNA?

• What happens if a tRNA has a mutated anticodon

Exit Condition1.) Pair up (two in a group)

2.) Write your names and SECTION at the top of the paper3.) EXPLAIN the process of TRANSLATION

Include the following in your answer:tRNAmRNA

RibosomeAUG codon

RNA polymeraseAminoacyl tRNA synthetase

Termination factordiffusion

Meet your new best

friend

Protocol:(1) Put a ½ inch layer of milk into a picnic

plate

(2) Add a drop of each of several food colorings at different locations towards the perimeter

(3) Touch a wooden stick to a dab of dishwashing detergent

(4) Touch the detergent to the center of the milk

(5) Observe!

WHAT DID YOU SEE?

-Hypothesize: What all is going on? How can you

test your hypothesis?